KR100914163B1

KR100914163B1 - Antimicrobial Protein Derived From Podoviridae Bacteriophage Specific To Staphylococcus aureus

Info

Publication number: KR100914163B1
Application number: KR1020070082357A
Authority: KR
Inventors: 윤성준; 최윤재; 이세정; 손지수; 전수연; 강상현
Original assignee: 주식회사 인트론바이오테크놀로지
Priority date: 2007-08-16
Filing date: 2007-08-16
Publication date: 2009-08-28
Also published as: KR20090017861A

Abstract

본 발명은 박테리오파지(Bacteriophage) 유래의 항균 기능을 갖는 신규 용균 단백질에 관한 것으로, 더욱 상세하게는 인간을 포함한 동물의 감염성 질환의 주된 원인균인 황색포도상구균(Staphylococcus aureus)을 특이적으로 사멸시킬 수 있는 포도비리대(Podoviridae) 박테리오파지로부터 유래한 항균 단백질, 상기 항균 단백질을 유효성분으로 포함하는 황색포도상구균에 의해 유발되는 감염성 질환의 예방 또는 치료용 약학적 조성물, 상기 항균 단백질을 유효성분으로 포함하는 항생제, 및 소독제에 관한 것이다.The present invention relates to a novel lytic protein having an antibacterial function derived from bacteriophage, and more particularly, to specifically kill Staphylococcus aureus , which is a major causative agent of infectious diseases in animals including humans. Antimicrobial protein derived from Podoviridae bacteriophage, pharmaceutical composition for the prevention or treatment of infectious diseases caused by Staphylococcus aureus comprising the antimicrobial protein as an active ingredient, antibiotic comprising the antimicrobial protein as an active ingredient , And disinfectants.

황색포도상구균, 항생제, 포도비리대, 박테리오파지, 단백질, 항균, 용균 Staphylococcus aureus, antibiotics, Staphylococcus aureus, bacteriophage, protein, antibacterial, lytic

Description

Antimicrobial Protein Derived From Podoviridae Bacteriophage Specific To Staphylococcus aureus

본 발명은 황색포도상구균 특이적 사멸능(용균능, 항균능)을 갖는 포도비리대 박테리오파지 유래의 신규한 항균 단백질에 관한 것이다.The present invention relates to a novel antimicrobial protein derived from Staphylococcus aureus bacteriophages having Staphylococcus aureus specific killing ability (lysogenic activity, antibacterial activity).

박테리오파지는 세균을 감염시키는 바이러스의 일종으로 보통 파지라고 줄여서 부르기도 한다. 박테리오파지는 핵산으로 이루어진 유전물질 중심부를 단백질 외피가 싸고 있는 단순한 구조의 유기체이며 핵산은 단일 사슬이거나 이중 사슬인 DNA 또는 RNA로 되어있다. 박테리오파지는 생존에 숙주가 반드시 필요하며 모든 세균에는 특정 박테리오파지가 존재한다고 알려져 있다. 박테리오파지는 숙주에 침투하여 복제 과정을 끝낸 다음, 숙주인 세균의 세포벽을 분해하기 위해 필요한 일군의 효소를 발현시킨다. 이들 효소는 세포벽의 경직성(rigidity) 및 기계적 강도 (mechanical strength)를 담당하는 세포벽의 펩티도글리칸 (peptidoglycan) 층 을 공격하여 세포벽을 파괴한다.Bacteriophages are a type of virus that infects bacteria, often called abbreviations. Bacteriophages are simple organisms in which the protein envelope is wrapped around the core of a genetic material consisting of nucleic acids. Nucleic acids are composed of DNA or RNA, either single or double chains. Bacteriophages are essential for survival and all bacteria are known to contain specific bacteriophages. The bacteriophage penetrates the host, completes the replication process, and then expresses a group of enzymes necessary to degrade the cell wall of the host bacterium. These enzymes attack the peptidoglycan layer of the cell wall, responsible for the rigidity and mechanical strength of the cell wall, destroying the cell wall.

박테리오파지는 1915년 영국의 세균학자 Twort가 포도상구균(Micrococcus) 집락이 어떤 것에 의해 투명하게 녹는 현상에 대한 연구에서 발견되었다. 또한, 1917년에는 프랑스의 세균학자 d'Herelle이 이질환자 변의 여과액 중에 적리균(Shigella disentriae)을 녹이는 작용을 가진 것이 있다는 것을 발견하고 이에 대한 연구를 통해 독립적으로 박테리오파지를 발견하였으며, 세균을 잡아먹는다는 뜻에서 박테리오파지라고 명명하였다. 이후 이질균, 장티푸스균, 콜레라균 등 여러 병원균에 대한 박테리오파지가 계속적으로 발견되었다. 그러나, 1950년 Flemming에 의해 페니실린이 발견된 이후, 항생제 사용의 보급화로 인해 일부 동유럽 국가에 한정되어서만 박테리오파지에 대한 연구가 계속되었으며 그 밖의 지역에서는 다소 시들하였다. 그러나, 2000년 이후에 항생제의 오남용으로 인해 다재 내성(Multidrug-resistant)을 지닌 병원성 세균의 출현빈도가 높아지고 기존 항생제의 많은 문제점들이 부각되면서 기존 항생제의 대체 물질로의 개발 가능성 때문에 박테리오파지에 대한 연구가 선진국들을 중심으로 많은 관심을 받으며 다시 활발하게 진행되고 있다.The bacteriophage was discovered in 1915 by a British bacteriologist Twort, in a study of the transparent melting of micrococcus colonies by something. Also, in 1917, French bacteriologist d'Herelle discovered that some of the filtrates of foreign patients had a function of dissolving Shigella disentriae , and through this research, they independently discovered bacteriophages and consumed them. In the sense, they named it bacteriophage. Since then, bacteriophages have been found for several pathogens such as dysentery, typhoid, and cholera. However, after penicillin was discovered by Flemming in 1950, research on bacteriophages continued to be limited to some Eastern European countries, due to the widespread use of antibiotics, and somewhat withered elsewhere. However, since 2000, the emergence of multidrug-resistant pathogenic bacteria due to the misuse of antibiotics has increased, and many problems of conventional antibiotics have emerged, leading to the possibility of developing antibiotics as substitutes. The developed countries are receiving a lot of attention, and are actively progressing again.

비록 항생제(또는 항균제)가 세균 감염에 의한 감염성 질환의 치료에 있어 여전히 주된 방법으로 널리 사용되고 있는 실정이지만, 1980년대 이후 과도한 항생제의 사용으로 더욱 많은 항생제 내성 균주가 발생하고 있으며, 1986년 최후의 항생제로 불리는 반코마이신(Vancomycin)에 내성을 지닌 황색포도상구균 및 다재 내성을 가진 세균이 다수 발견됨으로써 의학계에 큰 충격을 주었다. 반코마이신에 내성을 보이는 반코마이신 내성 장구균(Vancomycin Resistant Enterococci; VRE)은 1986년 프랑스에서 처음 보고 되었고 1988년 미국에서 분리된 이래, 치료가 곤란한 병원감염(nosocomial infections)의 원인균으로서 그 분리 빈도가 해마다 증가하고 있으며 최근에는 유럽, 미국 이외에도 싱가포르, 일본, 오스트레일리아, 한국 등 전 세계적으로 증가하는 추세이다. 국내에서는 1992년에 VRE가 처음 분리되었다. 황색포도상구균의 경우, 1990년대 초에 반코마이신 내성 황색포도상구균(Vancomycin-Resistant Staphylococcus aureus; VRSA)이 세계 최초 발견되었으며, 국내에서도 1996년 6월 VRSA가 발견되었다. Although antibiotics (or antimicrobials) are still widely used as the main method for the treatment of infectious diseases caused by bacterial infections, more antibiotic resistant strains have arisen due to the use of excessive antibiotics since the 1980s, and the last antibiotics in 1986. Vancomycin, called Staphylococcus aureus and multi-resistant bacteria were found to have a large impact on the medical community. Vancomycin Resistant Enterococci (VREs), which are resistant to vancomycin, were first reported in France in 1986 and since their isolation in the United States in 1988, have been increasing in frequency each year as the causative agent of difficult treatment of nosocomial infections. Recently, the trend is increasing worldwide, not only in Europe and the US, but also in Singapore, Japan, Australia, and Korea. In Korea, the VRE was first separated in 1992. In the case of Staphylococcus aureus, Vancomycin-Resistant Staphylococcus in the early 1990s aureus ; VRSA) was first discovered in the world, and VRSA was discovered in Korea in June 1996.

따라서 기존 항생제에 내성을 갖는 세균에 의한 질환까지도 치료할 수 있어 국민 건강과 의약 기술을 선도할 수 있는 새로운 항생 물질의 개발이 시급한 상황이다. 다시 말해, 내성세균의 출현에 대한 심각성뿐만 아니라 최근 사회적으로 큰 문제가 되고 있는 항생제 오남용에 의한 문제 및 항생제 잔류 문제에 대한 새로운 해결책으로 기존 항생제를 대체할 수 있는 물질의 개발 등 대안 마련이 매우 절실한 형편이다. 물론 이러한 대안 마련의 해결책은 기존 항생제와는 근본적으로 다른 방법에 의한 새로운 개념의 항생 물질의 개발을 통해서 일 것이다. Therefore, it is urgent to develop new antibiotics that can treat diseases caused by bacteria that are resistant to existing antibiotics and can lead national health and medical technology. In other words, not only the seriousness of the emergence of resistant bacteria, but also the need for alternatives, such as the development of a substance that can replace the existing antibiotics as a new solution to the problem of antibiotic abuse and the problem of antibiotic residue, which are becoming a major social problem in recent years. It's bad. The alternative solution, of course, would be to develop a new concept of antibiotics in a radically different way from existing antibiotics.

이를 위하여, 본 발명자들은 황색포도상구균을 특이적으로 사멸시킬 수 있는 신규 박테리오파지를 분리하였으며, 이렇게 선별된 박테리오파지를 2006년 6월 14일자로 농업생명공학연구원(기탁번호 KACC 97001P)과 2007년 7월 18일자로 한국생명공학연구원 생물자원센터 (기탁번호 KCTC 11153BP)에 재차 기탁하였으며, 관련 내용을 특허출원한 바 있다(대한민국 특허출원 제2006-55461호). 본 발명자는 계속 적 연구를 통하여 상기 기탁 박테리오파지와는 다른 또 다른 유효 박테리오파지를 확보하였으며 이를 2007년 7월 18일자로 한국생명공학연구원 생물자원센터에 기탁한 바도 있다(기탁번호 KCTC 11154BP). To this end, the present inventors have isolated a novel bacteriophage that can specifically kill Staphylococcus aureus, and the screened bacteriophages, as of June 14, 2006, with the Agricultural Biotechnology Research Institute (Accession Number KACC 97001P) and July 2007. On the 18th, it was deposited again with the Korea Institute of Biotechnology and Biotechnology Center (Accession No. KCTC 11153BP) and applied for a patent (Korean Patent Application No. 2006-55461). The present inventors secured another effective bacteriophage different from the deposited bacteriophage through continuous research, and it was deposited on July 18, 2007 at the Korea Institute of Biotechnology and Biotechnology Center (Accession No. KCTC 11154BP).

상기 2 가지 박테리오파지는 황색포도상구균에 의한 감염성 질환의 예방 및 치료에 매우 효과적이기는 하지만 몇 가지 단점을 가지고 있다. 박테리오파지를 직접 사용하는 방법은 박테리오파지라는 미생물 자체를 이용하는 것에 대한 막연한 거부감으로 인하여 그 응용에 제약이 따르고, 직접 사용되는 박테리오파지를 대량으로 확보하기 위해서는 반드시 숙주인 병원성 세균의 배양 단계가 생산 공정 중에 필요한데, 이로 인해 작업자가 병원성 세균에 노출될 위험성이 있으며, 이로 인한 병원성 세균의 엄격한 관리가 필요하다는 등의 문제점이 있었다. 이에 따라, 박테리오파지의 특성은 그대로 가지면서 좀더 다양한 분야로의 응용이 용이하고, 보다 안전하게 황색포도상구균을 사멸시킬 수 있는 새로운 물질의 개발이 요구된다.Although the two bacteriophages are very effective in the prevention and treatment of infectious diseases caused by Staphylococcus aureus, they have some disadvantages. Direct use of bacteriophage is limited due to the vague objection to the use of microorganisms called bacteriophage, and in order to secure a large amount of directly used bacteriophage, a culture step of a host pathogenic bacterium is necessary during the production process. Because of this, there is a risk that the worker is exposed to pathogenic bacteria, resulting in the need for strict management of pathogenic bacteria. Accordingly, while the characteristics of the bacteriophage remain intact, it is easy to be applied to various fields, and development of a new material that can safely kill Staphylococcus aureus is required.

이에, 본 발명자들은 황색포도상구균을 특이적으로 사멸시킬 수 있는 박테리오파지의 유전정보를 이용하여, 황색포도상구균을 특이적으로 사멸시킬 수 있는 신규 항균 단백질을 제공하는 발명을 개시한 바도 있다 (대한민국 특허출원 제2006-73562호). 이는 원래 숙주의 내부에서 생성되던 용균 단백질을 외부에서 처리하여도 내부에서와 동일한 세포파쇄(lysis) 효과(용균 효과)가 있음을 보여주는 결과였으며 또한, 박테리오파지 자체의 특이성을 넘어서 넓은 세균 사멸 능력이 있음을 보여 준 결과였다.Accordingly, the present inventors have disclosed an invention for providing a novel antimicrobial protein capable of specifically killing Staphylococcus aureus using genetic information of bacteriophage that can specifically kill Staphylococcus aureus (Korean patent). Application 2006-73562). This result shows that the lytic protein originally produced inside the host has the same lysis effect (lysis effect) as the inside, and also has the ability to kill bacteria wider than the specificity of the bacteriophage itself. It was a result that showed.

그런데 이러한 항균 단백질도 비록 그 정도는 덜하지만 박테리오파지 자체와 같이 그 항균 효과를 나타내는 적용 가능 세균의 종류나 범위에 있어 서로 차이가 있는 것이 일반적이어서 다양한 종류의 항균 단백질의 확보는 늘 요구되고 있다. By the way, even if the antimicrobial protein to a lesser extent, such as the bacteriophage itself is generally different in the type or range of applicable bacteria that exhibit the antimicrobial effect, so it is always required to secure various types of antimicrobial protein.

이러한 박테리오파지의 용균 단백질은 박테리오파지가 숙주로부터 밖으로 나올 때, 숙주의 세포벽을 파괴하는 역할을 하는 단백질이다. 이러한 박테리오파지의 용균 단백질을 보통 리신이라고 부르기도 한다. 일반적으로 용균 단백질인 리신은 N-말단 작용 부위(N-terminal catalytic domain)와 C-말단 결합 부위(C-terminal binding domain)로 구성되어 있고 두 부위 사이에 짧은 연결쇄(linker)로 연결되어 있다. 드문 경우에 리신은 두 가지 다른 작용 부위(catalytic domain)를 갖는 경우도 있다. C-말단 결합 부위는 목적 박테리아(target bacteria)의 세포벽에서 기질과 결합하는 기능을 한다. 이런 리신의 두 부위는 생물분류의 린네식 계층분류체계에 있어서 동일 강(class)의 경우 작용 부위의 작용 영역(catalytic region)이 보존되며(conserved) 결합 부위는 상대적으로 다양한(variable) 것으로 알려져 있다. 이러한 결합부위의 차이로 인해 용균 단백질의 항균 효과는 그 종류에 따라 차이가 있을 수 있다.The bacteriophage lysate protein is a protein that serves to destroy the cell wall of the host when the bacteriophage comes out from the host. The bacteriophage lysate protein is also commonly called lysine. Lysine, a lytic protein, is generally composed of an N-terminal catalytic domain and a C-terminal binding domain, and is linked by a short linker between the two sites. . In rare cases, lysine may have two different catalytic domains. The C-terminal binding site functions to bind the substrate in the cell wall of the target bacteria. These two sites of lysine are known to be conserved in the same class in the bioinlinen taxonomy, and the binding sites are relatively variable. . Due to the difference in the binding site, the antimicrobial effect of the lytic protein may vary depending on the type.

따라서 본 발명처럼 추가적 용균 단백질의 확보는 더 많은 황색포도상구균에 대처할 수 있는 방안을 제공해 주며 또한 이들 용균 단백질을 혼용할 시는 한 종류의 용균 단백질의 단독 사용에 비하여 추가적 항균 효과의 증가가 기대될 수 있다. Therefore, securing additional lytic protein as in the present invention provides a way to cope with more Staphylococcus aureus, and when using these lysing proteins, additional antimicrobial effect is expected to be increased compared to the use of one type of lytic protein alone. Can be.

이에, 본 발명자들은 황색포도상구균을 특이적으로 사멸시킬 수 있는 박테리오파지의 유전정보를 이용하여, 황색포도상구균을 특이적으로 사멸시킬 수 있는 신규 항균 단백질을 제공하고, 더 나아가 황색포도상구균에 특이적인 항균 단백질을 이용하여 황색포도상구균에 의해 유발되는 질환의 예방 및 치료 목적으로 이용함으로써 본 발명을 완성하였다.Accordingly, the present inventors provide a novel antibacterial protein capable of specifically killing Staphylococcus aureus using genetic information of bacteriophage that can specifically kill Staphylococcus aureus, and furthermore, specific to Staphylococcus aureus. The present invention has been completed by using an antimicrobial protein for the purpose of preventing and treating diseases caused by Staphylococcus aureus.

따라서, 본 발명의 목적은 인간을 포함한 동물의 감염성 질환의 주된 원인균인 황색포도상구균을 특이적으로 사멸시킬 수 있는 신규 항균 단백질을 제공하는 것이다.Accordingly, it is an object of the present invention to provide a novel antibacterial protein capable of specifically killing Staphylococcus aureus, which is a major causative agent of infectious diseases in animals including humans.

또한, 본 발명의 다른 목적은 상기 항균 단백질을 유효성분으로 포함하는, 황색포도상구균에 의해 유발되는 감염성 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.Another object of the present invention is to provide a pharmaceutical composition for preventing or treating an infectious disease caused by Staphylococcus aureus, comprising the antimicrobial protein as an active ingredient.

또한, 본 발명의 다른 목적은 상기 항균 단백질을 유효성분으로 포함하는 항생제를 제공하는 것이다.In addition, another object of the present invention to provide an antibiotic comprising the antimicrobial protein as an active ingredient.

또한, 본 발명의 또 다른 목적은 상기 항균 단백질을 유효성분으로 포함하는 소독제를 제공하는 것이다.In addition, another object of the present invention to provide an antiseptic including the antimicrobial protein as an active ingredient.

본 발명은 황색포도상구균(Staphylococcus aureus) 특이적 사멸능을 갖고, 서열번호 3으로 표시되는 아미노산 서열을 갖는 항균 단백질 및 이를 코딩하는 유전자를 제공한다.The present invention is Staphylococcus aureus ) provides an antimicrobial protein having a specific killing ability and an amino acid sequence represented by SEQ ID NO: 3 and a gene encoding the same.

본 명세서에서는 용균 현상에 의한 항균 작용을 다른 메카니즘에 의한 항균 작용과 특별히 구별하지 않고 혼용하여 사용하였다.In the present specification, the antibacterial action due to the lysis phenomenon was used in combination without being particularly distinguished from the antibacterial action caused by other mechanisms.

황색포도상구균은 피부감염, 식중독 등을 일으키는 주요 원인균이고, 국내에서 조사된 항생제 메티실린에 대한 내성률이 평균 73%로 세계 최고 수준인 매우 위해한 병원균이다. 이는 항생제를 써도 죽지 않는 황색포도상구균이 73%가 된다는 뜻으로 내성이 매우 심각한 병원균이라고 할 수 있다.Staphylococcus aureus is a major causative agent of skin infections and food poisoning, and it is a very harmful pathogen that has an average resistance rate of 73% against antibiotics methicillin. This means that 73% of Staphylococcus aureus bacteria that do not die even with antibiotics are very resistant pathogens.

황색포도상구균은 가축에서 전염성 유방염을 유발하는 주요 병원균 중 1위를 차지한다. 미국 내 전체 젖소우군의 90%에 황색포도상구균이 존재하고, 전체 젖소의 10%는 이 병원균에 감염되어 있을 것으로 추정되고 있다. 또한, 황색포도상구균은 인체에서는 급성 피부염의 원인균이기도 한데, 이 급성 피부염은 갑자기 패혈증으로 발전하여 환자의 목숨을 앗아가기도 한다. 또 황색포도상구균은 화농성 질환, 땀 냄새, 식중독의 원인균이기도 하다.Staphylococcus aureus is the number one leading cause of infectious mastitis in livestock. Staphylococcus aureus is present in 90% of all dairy cattle in the United States, and 10% of all cows are estimated to be infected with this pathogen. In addition, Staphylococcus aureus is a causative agent of acute dermatitis in the human body, and this acute dermatitis suddenly develops sepsis and takes the patient's life. Staphylococcus aureus is also a causative agent of purulent disease, sweat odor, and food poisoning.

본 발명자들은 이러한 황색포도상구균을 선택적으로 사멸시키기 위해 예의 노력한 결과, 병원체로부터 황색포도상구균을 분리하고, 이 황색포도상구균을 특이적으로 사멸시킬 수 있는 신규한 포도비리대 박테리오파지를 선별하였고 이를 ‘SAP-2’로 명명하였다. 이렇게 선별된 박테리오파지를 2007년 7월 18일자로 한국 생명공학연구원 생물자원센터 (기탁번호 KCTC 11154BP)에 기탁하였다. As a result of our intensive efforts to selectively kill such Staphylococcus aureus, the present inventors have isolated Staphylococcus aureus from pathogens and selected a novel Staphylococcus aureus bacteriophage that can specifically kill the Staphylococcus aureus. -2 '. The selected bacteriophages were deposited on July 18, 2007, at the Korea Institute of Biotechnology and Biotechnology Center (Accession No. KCTC 11154BP).

또한, 본 발명자들은 황색포도상구균을 특이적으로 사멸시킬 수 있는 상기 SAP-2 박테리오파지(기탁번호 KCTC 11154BP)의 유전정보를 이용하여, 황색포도상구균을 특이적으로 사멸시킬 수 있는 신규 항균 단백질을 제공하고, 더 나아가 황색포도상구균에 특이적인 항균 단백질을 황색포도상구균에 의해 유발되는 질환의 예방 및 치료 목적으로 이용함으로써 본 발명을 완성하였다. In addition, the present inventors provide a novel antimicrobial protein that can specifically kill Staphylococcus aureus by using the genetic information of the SAP-2 bacteriophage (Accession No. KCTC 11154BP) that can specifically kill Staphylococcus aureus. Furthermore, the present invention has been completed by using an antibacterial protein specific for Staphylococcus aureus for the purpose of preventing and treating diseases caused by Staphylococcus aureus.

이를 위하여 본 발명자들은 상기 SAP-2 박테리오파지의 유전체(genome)로부터 용균 작용과 직접적으로 관련이 있는 유전자 부분을 찾아내고, 이로부터 분자생물학 기술 및 생명공학 기술을 이용하여 항균 단백질을 생산하고 분리, 정제하게 되었다. 이렇게 하여 얻어진 항균 단백질은 서열번호 3으로 기재되는 아미노산 서열을 가지며, 이를 코딩하는 유전자는 서열번호 2로 기재되는 염기 서열이다. To this end, the present inventors find a part of the gene directly related to the lytic action from the genome of the SAP-2 bacteriophage, from which the antimicrobial protein is produced, separated and purified using molecular biology and biotechnology. Was done. The antimicrobial protein thus obtained has an amino acid sequence as set out in SEQ ID NO: 3, and the gene encoding the same is a nucleotide sequence as set out in SEQ ID NO: 2.

또한, 본 발명은 황색포도상구균을 선택적으로 사멸시킬 수 있는 항균 단백질 생산용 대장균 형질전환체(기탁번호 KCTC 11152BP)를 제공한다.The present invention also provides an E. coli transformant (Accession No. KCTC 11152BP) for producing an antibacterial protein capable of selectively killing Staphylococcus aureus.

본 발명자들은 항균 단백질(서열번호 3)을 과발현시키는 대장균 형질전환체를 제조하여 이를 'pBAD::lysinM' 이라 명명한 뒤 2007년 7월 18일자로 한국생명공학연구원 생물자원센터에 기탁번호 KCTC 11152BP로 기탁하였다. 이 기탁된 대장균 형질전환체를 배양하여 수득한 배양산물에는 항균 능력이 뛰어난 단백질이 포함되어 있으므로, 이 형질전환체를 배양하여 얻은 산물을 이용하면 황색포도상구균에 의해 유발되는 감염성 질환을 예방 또는 치료하는데 유용하게 사용할 수 있다.The present inventors prepared an E. coli transformant that overexpresses the antimicrobial protein (SEQ ID NO: 3), named it 'pBAD :: lysinM', and deposited it on July 18, 2007 to the Korea Institute of Biotechnology and Biotechnology Center, Accession No. KCTC 11152BP. Was deposited. Since the culture product obtained by culturing the deposited E. coli transformant contains a protein having excellent antibacterial ability, the product obtained by culturing the transformant can be used to prevent or treat infectious diseases caused by Staphylococcus aureus. This can be useful.

또한, 본 발명은 상기 SAP-2 박테리오파지 유래의 용균 단백질을 유효성분으로 포함하는, 황색포도상구균에 의해 유발되는 감염성 질환의 예방 또는 치료용 약학적 조성물을 제공한다.The present invention also provides a pharmaceutical composition for the prevention or treatment of infectious diseases caused by Staphylococcus aureus, comprising the lytic protein derived from SAP-2 bacteriophage as an active ingredient.

본 명세서에 있어서, '치료'라는 용어는 (ⅰ) 황색포도상구균에 의해 유발되는 감염성 질환의 예방; (ⅱ) 황색포도상구균에 의해 유발된 감염성 질환의 억제; 및 (ⅲ) 황색포도상구균에 의해 유발된 감염성 질환의 경감을 포괄적으로 의미한다.In the present specification, the term 'treatment' refers to (i) the prevention of infectious diseases caused by Staphylococcus aureus; (Ii) suppressing infectious diseases caused by Staphylococcus aureus; And (iii) alleviate the infectious disease caused by Staphylococcus aureus.

본 발명의 약학적 조성물에 포함되는 항균 단백질은 상술한 바와 같이 황색포도상구균을 특이적으로 사멸시키므로, 황색포도상구균에 의해 유발되는 다양한 질환, 예컨대 유방염, 급성 피부염, 패혈증, 화농성 질환, 식중독, 폐렴, 골수염, 농가진, 균혈증, 심내막염, 및 장염 등에 대한 치료에 효과를 나타낸다. 본 발명의 바람직한 실시예에 따르면, 본 발명의 항균 단백질을 유방염에 감염된 젖소의 감염 부위에 매일 분무해 주면 유의적 수준으로 유방염이 치료되며, 이를 통해 유방염 치료에 본 발명의 항균 단백질이 효과가 있음을 알 수 있다.Since the antimicrobial protein included in the pharmaceutical composition of the present invention specifically kills Staphylococcus aureus, various diseases caused by Staphylococcus aureus, such as mastitis, acute dermatitis, sepsis, purulent disease, food poisoning, and pneumonia , Osteomyelitis, impetigo, bacteremia, endocarditis, and enteritis. According to a preferred embodiment of the present invention, if the antimicrobial protein of the present invention is sprayed daily to the site of infection of a cow infected with mastitis, mastitis is treated to a significant level, thereby the antimicrobial protein of the present invention is effective in treating mastitis. It can be seen.

본 발명의 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.Pharmaceutically acceptable carriers included in the compositions of the present invention are those commonly used in the formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate , Microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but are not limited thereto. no. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.

본 발명의 약학적 조성물은 질환 부위에의 도포 또는 분무하는 방법으로 이용할 수 있으며, 그 밖에 경구 투여 또는 비경구 투여를 통해 투여할 수도 있으며, 비경구 투여의 경우 정맥내 투여, 복강내 투여, 근육내 투여, 피하 투여 또는 국부 투여를 이용하여 투여할 수도 있다.The pharmaceutical composition of the present invention can be used as a method of spraying or spraying on a diseased site, and can also be administered by oral or parenteral administration. In the case of parenteral administration, intravenous administration, intraperitoneal administration, muscle Administration may also be by intra-, subcutaneous or topical administration.

본 발명의 약학적 조성물의 적합한 도포, 분무 및 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 질병 증상의 정도, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 일반적으로, 본 발명의 약학적 조성물은 항균 단백질을 0.0001 - 10% (w/v) 포함하고, 바람직하게는 0.001 - 1% (w/v), 가장 바람직하게는 0.1% (w/v) 포함한다.Suitable application, spraying, and dosage of the pharmaceutical compositions of the present invention may include factors such as formulation method, mode of administration, age, weight, sex, degree of disease symptom, food, time of administration, route of administration, rate of excretion, and reaction sensitivity of the patient. The physician, who is usually skilled in the art, can readily determine and prescribe a dosage effective for the desired treatment. In general, the pharmaceutical composition of the present invention contains 0.0001-10% (w / v) antimicrobial protein, preferably 0.001-1% (w / v), most preferably 0.1% (w / v) do.

본 발명의 약학적 조성물은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 됨으로써 단위 용량 형태로 제조되거나 또는 다용량 용기내에 내입시켜 제조될 수도 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수도 있다.The pharmaceutical compositions of the present invention are prepared in unit dosage form by being formulated with pharmaceutically acceptable carriers and / or excipients according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of extracts, powders, granules, tablets or capsules, and may further comprise dispersants or stabilizers.

본 발명의 또 다른 양태에 따르면, 본 발명은 상기 SAP-2 박테리오파지 유래의 항균 단백질을 유효성분으로 포함하는 항생제를 제공한다.According to another aspect of the invention, the present invention provides an antibiotic comprising the antibacterial protein derived from the SAP-2 bacteriophage as an active ingredient.

본 명세서에 있어서, '항생제’라는 용어는 방부제, 살균제 및 항균제를 총칭한다.In the present specification, the term 'antibiotic' generically refers to preservatives, fungicides and antibacterial agents.

황색포도상구균은 고초균(Bacillus subtilis), 대장균 및 녹농균(Pseudomonas aeruginosa) 등과 함께 화장품에서 자주 발견되는 유해균이기도 하다. 화장품은 기름이나 물을 주성분으로 하며, 미생물의 탄소원이 되는 글리세린이나 솔비톨 등과 질소원이 되는 아미노산 유도체, 단백질 등이 배합된 것이 많으므로 세균 등의 미생물 침투가 용이하다. 또, 식품에 비하여 사용기간이 매우 길기 때문에 미생물에 의한 오염 위험이 훨씬 크다고 할 수 있다. 사용함에 따른 미생물 오염으로 나타나는 변색이나 변취 등으로부터 화장품을 장기간 보호하기 위하여 항균제의 첨가가 필수적이다.Staphylococcus aureus is subtilisBacillus subtilis), Escherichia coli and Pseudomonas aeruginosa (Pseudomonas aeruginosIt is also a harmful bacterium frequently found in cosmetics along with a). Cosmetics contain oil and water as the main components, and glycerin or sorbitol, which is a carbon source of microorganisms, and amino acid derivatives and proteins, which are nitrogen sources, are easily blended with each other. In addition, the use period is much longer than the food, it can be said that the risk of contamination by microorganisms is much greater. Addition of antimicrobial agent is essential for long-term protection of cosmetics from discoloration or odor caused by microbial contamination.

화장품에 가장 널리 사용되고 있는 파라벤류와 같은 합성방부제는 최근 그 위험성이 부각되고 있고, 특히 유방암 환자의 유방암 부위에 방부제가 축적되었다는 사실이 최근 알려지면서 아무런 경각심 없이 사용되고 있는 합성 방부제 함유 화장품이 예상 외로 위험할 수도 있다고 인식되고 있다. 또, 미국 피부과학회는 합성 방부제를 피부 알레르기 유발 원인물질 2위에 올려놓은 바도 있다. 이와 함께 최근에는 어린이용 제품에 인공 합성 방부제를 사용함으로써 어린 시절부터 방부제 함유제품에 노출되게 되어 그 사용기간과 사용량이 훨씬 증가할 수 있기 때문에 더욱 위험할 수 있다는 우려가 있어 새로운 천연유래의 방부제의 개발이 절실히 요구되고 있는 실정이다.Synthetic preservatives such as parabens, which are most widely used in cosmetics, have recently been exposed to dangers. Especially, cosmetics containing synthetic preservatives, which have been used without alarm, have been unexpectedly known as preservatives have accumulated in breast cancer areas of breast cancer patients. It is recognized that it can be done. The American Academy of Dermatology has also listed synthetic preservatives as the second leading cause of skin allergies. In addition, the use of artificial preservatives in children's products has recently been exposed to preservative-containing products since childhood, which may increase their use and usage. Development is urgently required.

본 발명의 SAP-2 박테리오파지 유래의 항균 단백질은 기존 항생제에 비하여 황색포도상구균에 대한 특이성이 매우 높다는 장점을 갖고 있다. 이는 유용한 균은 죽이지 않고 병원균인 황색포도상구균만을 선택적으로 죽일 수 있으므로 통상의 항생제 사용에서 나타나는 부작용이 없는 항생제로서 매우 가치가 있다고 할 수 있다. 또한, 본 발명의 항균 단백질은 상기 항균 단백질이 유래된 박테리오파지 자체보다 용균 효과를 보이는 황색포도상구균의 범위가 더 넓다는 장점을 제공한다 (Broad activity spectrum을 의미함).The antimicrobial protein derived from SAP-2 bacteriophage of the present invention has the advantage that the specificity for Staphylococcus aureus is very high as compared to conventional antibiotics. This can be said to be of great value as an antibiotic without the side effects of conventional antibiotic use because it can selectively kill only the pathogen Staphylococcus aureus without killing the useful bacteria. In addition, the antimicrobial protein of the present invention provides an advantage of a broader range of Staphylococcus aureus showing a lytic effect than the bacteriophage from which the antimicrobial protein is derived (meaning Broad activity spectrum).

본 발명의 황색포도상구균에 특이적인 SAP-2 박테리오파지 유래의 항균 단백질을 항생제로 이용하게 되면 기존의 항생제를 이용하는 것과는 달리 병원균의 내성 내지 저항성(resistance)을 유도하지 않는다는 중요한 장점을 갖기 때문에 기존의 항생물질에 비하여 제품수명(life cycling)이 긴 신규 항생제로서 제공될 수 있다. 대부분의 항생 물질들은 내성 증가에 직면함에 따라 갈수록 사용범위가 줄어들 수밖에 없는데 반해, 본 발명의 박테리오파지 유래의 항균 단백질을 유효성분으로 포함하는 항생제는 내성 문제를 근본적으로 해결할 수 있기에 그 만큼 항생제로서의 제품수명이 길어질 것으로 기대된다. 따라서, 본 발명의 SAP-2 박테리오파지 유래의 항균 단백질을 유효성분으로 포함하는 항생제는, 병원성 세균인 황색포도상구균을 특이적으로 사멸시키는 항균 효과, 살균 효과 및 방부 효과가 뛰어난 항생제로서 유용하게 사용될 수 있다. When using antibacterial protein derived from SAP-2 bacteriophage specific to Staphylococcus aureus of the present invention as an antibiotic, unlike conventional antibiotics, it has an important advantage that it does not induce resistance or resistance of pathogens. Life cycles can be provided as new antibiotics compared to the material. While most antibiotics face increasing resistance, the range of use is inevitably decreased. On the other hand, antibiotics containing an antibacterial protein derived from the bacteriophage of the present invention as an active ingredient can fundamentally solve the resistance problem. This is expected to be long. Therefore, the antibiotic containing the antimicrobial protein derived from SAP-2 bacteriophage of the present invention as an active ingredient can be usefully used as an antibiotic having excellent antimicrobial, bactericidal and antiseptic effect to specifically kill pathogenic bacteria Staphylococcus aureus. have.

또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 상기 SAP-2 박테리오파지 유래의 항균 단백질을 유효성분으로 포함하는 소독제를 제공한다.In addition, according to another aspect of the present invention, the present invention provides a disinfectant comprising the antibacterial protein derived from the SAP-2 bacteriophage as an active ingredient.

병원감염에서 분리되는 균의 분포는 시대에 따라 변화하고 있다. 미국의 NNIS (National Nosocomial Infection Surveillance System)에서 이러한 경향을 잘 볼 수 있는데, 1980년대 후반부터는 그람양성균, 특히 황색포도상구균의 분리가 증가하고 있으며, 이러한 경향은 국내에서도 나타났다. 1985년 국내 조사에 의하면 대장균, 녹농균, 코아굴레이스 음성 포도상구균(coagulase negative Staphylococcus), 황색포도상구균의 순으로 나타났으나, 점차 황색포도상구균의 분리가 증가하여, 1996년 대한병원감염관리학회의 조사에 따르면 황색포도상구균이 전체의 17.2%를 차지하였고, 다음으로 녹농균이 13.8%, 그 다음으로 대장균이 12.3%의 순이었다. 그리고 분리된 전체 황색포도상구균의 78.8%는 기존 항생제에 대한 내성을 가졌다.The distribution of bacteria isolated from hospital infections has changed over time. This trend can be seen in the National Nosocomial Infection Surveillance System (NNIS) in the United States. Since the late 1980s, the isolation of Gram-positive bacteria, especially Staphylococcus aureus, has been increasing. According to a domestic survey in 1985, Escherichia coli, Pseudomonas aeruginosa, coagulase negative Staphylococcus, and Staphylococcus aureus were found in order, but the separation of Staphylococcus aureus gradually increased. According to the survey, Staphylococcus aureus accounted for 17.2% of the total, followed by Pseudomonas aeruginosa (13.8%) and Escherichia coli (12.3%). And 78.8% of all isolated Staphylococcus aureus were resistant to conventional antibiotics.

이러한 점을 고려한다면, 황색포도상구균에 대해 특이적인 사멸능을 갖는 본 발명의 SAP-2 박테리오파지 유래의 항균 단백질을 유효성분으로 포함하는 소독제는 병원감염을 막기 위한 병원 및 보건용의 소독제로 유용하게 사용될 수 있고 또한, 일반 생활 소독제, 식품 및 조리 장소 및 조리 설비의 소독제, 축산산업의 축사 소독제로서 유용하게 사용될 수 있다. 특히 박테리오파지라는 미생물 자체의 이용이 아닌 단백질 형태의 이용이므로 식품 및 조리 장소에 거부감 없이 이용되어질 수 있다.Considering this point, a disinfectant comprising an antibacterial protein derived from SAP-2 bacteriophage of the present invention having specific killing ability against Staphylococcus aureus as an active ingredient is useful as a disinfectant for hospitals and health care to prevent hospital infection. It can be used and also useful as a general household disinfectant, disinfectant of food and cooking places and cooking equipment, and livestock disinfectant of the livestock industry. In particular, because the bacteriophage is not the use of microorganisms themselves, but in the form of protein, it can be used in food and cooking places without objection.

본 발명의 SAP-2 박테리오파지 유래의 항균 단백질은 황색포도상구균만을 선별적으로 사멸시킬 수 있기 때문에, 황색포도상구균이 주원인이 되는 감염성 질환의 예방 및 치료제, 항생제, 화장품용 항균제 또는 천연 유래의 방부제, 및 다양한 소독제 등으로 광범위하게 사용될 수 있다.Since the antimicrobial protein derived from SAP-2 bacteriophage of the present invention can selectively kill only Staphylococcus aureus, an agent for preventing and treating infectious diseases in which Staphylococcus aureus is the main cause, antibiotics, antibacterial agents for cosmetics or natural preservatives, And various disinfectants.

이하, 실시예에 의거하여 본 발명을 보다 구체적으로 설명하지만, 이들 실시예는 본 발명의 예시일 뿐이며 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, although an Example demonstrates this invention more concretely, these Examples are only illustrations of this invention, The scope of the present invention is not limited to these Examples.

실시예Example 1: 병원체로부터 황색포도상구균의 분리 및 황색포도상구균을 특이적으로 사멸시킬 수 있는 박테리오파지의 분리 1: Isolation of Staphylococcus Aureus from Pathogens and Isolation of Bacteriophage That Can Specificly Kill Staphylococcus Aureus

1-1: 황색포도상구균의 분리1-1: Isolation of Staphylococcus Aureus

박테리오파지는 자연계에 널리 존재하는데, 특히 세균이 존재하는 곳에 공생하는 경우가 많다. 본 발명자들은 황색포도상구균에 특이적으로 감염하는 박테리오파지를 분리하기 위해 기본적으로 황색포도상구균이 존재할 것으로 예상되는 곳을 기반으로 시료를 채집한 후 실제로 황색포도상구균이 존재하는 지를 황색포도상구균 선택배지인 Baird-Parker 아가(agar) 배지를 이용하여 조사하였다.Bacteriophages are widely present in nature, especially where they live in symbiosis. In order to isolate bacteriophages that specifically infect Staphylococcus aureus, the present inventors collected a sample based on where the Staphylococcus aureus is expected to exist, and then, whether the Staphylococcus aureus is actually present, Investigations were performed using Baird-Parker agar medium.

이를 상세히 설명하면, 대상 세균인 황색포도상구균을 병원체로부터 분리하 고자 선택한 질환은 젖소 유방염이었다. 유방염은 황색포도상구균에 의해 발병되는 대표적 질환 중의 하나이다. 유방염에 감염된 젖소의 우유에서 채취한 시료로부터 황색포도상구균의 선택배지인 Baird-Parker 아가 배지를 이용하여 황색포도상구균을 획득하였고, 그람염색법(Gram staining method), 카탈라아제 조사(catalase test)와 bioMerieux 사의 Vitek을 이용한 생화학적 조사를 통해 선별된 균이 황색포도상구균임을 최종적으로 확인하였다. 그 결과는 다음 표 1과 같다.In detail, the disease selected to isolate the target bacterium Staphylococcus aureus from the pathogen was cow mastitis. Mastitis is one of the representative diseases caused by Staphylococcus aureus. Staphylococcus aureus was obtained from a sample obtained from mastitis-infected cow's milk using Baird-Parker agar medium. Biochemical studies using Vitek finally confirmed that the selected bacteria were Staphylococcus aureus. The results are shown in Table 1 below.

Vitek IDVitek ID 200000-0 (A1-18) 카탈라아제 + 코아귤라아제(Coagulase) +200000-0 (A1-18) Catalase + Coagulase + 타입type 그램 양성 동정(identification) 카드(GPI)Gram positive identification card (GPI) 상태condition 최종final 경과 시간Elapsed time 5 시간5 hours 생물Creature 황색포도상구균Staphylococcus aureus PB + BAC - OPT + HCS + 6NC + 10B + 40B - ESC - ARG - URE - TZR + NOV - DEX + LAC + MAN + RAF - SAL - SOR - SUC + TRE + ARA - PYR + PUL - INU - MEL - MLZ - CEL - RIB - XYL - CAT + BH/CO +PB + BAC-OPT + HCS + 6NC + 10B + 40B-ESC-ARG-URE-TZR + NOV-DEX + LAC + MAN + RAF-SAL-SOR-SUC + TRE + ARA-PYR + PUL-INU-MEL- MLZ-CEL-RIB-XYL-CAT + BH / CO +

1-2: 황색포도상구균에 특이적인 박테리오파지의 분리1-2: Isolation of Bacteriophage Specific to Staphylococcus Aureus

다음 단계로서, 분리된 황색포도상구균에 특이적인 박테리오파지를 분리하기 위해 박테리오파지가 있을 것으로 예상되는 시료를 황색포도상구균과 함께 배양하였다. 이 배양액을 원심분리하여 상등액을 얻은 후 이를 여과한 다음, 배양된 황색포도상구균을 박테리오파지 분리를 위한 미끼로 상기 여과액과 함께 다시 배양하여 황색포도상구균의 사멸 여부를 확인하였다. 사멸 여부 확인은 최종적으로 용균반 분석을 통해 판별하였다.As a next step, in order to isolate bacteriophages specific for the isolated Staphylococcus aureus, a sample expected to be bacteriophage was incubated with Staphylococcus aureus. The culture solution was centrifuged to obtain a supernatant, and then filtered. The cultured Staphylococcus aureus was incubated with the filtrate again as a bait for bacteriophage separation to determine whether Staphylococcus aureus was killed. Confirmation of death was finally determined by lytic plaque analysis.

이를 상세히 설명하면, 황색포도상구균을 선택적으로 사멸시킬 수 있는 박테리오파지를 분리하기 위하여 박테리오파지가 존재할 것이라 예상되는 우사 내의 토양, 지푸라기, 흙, 및 하수 등에서 검체를 채집한 후, 상기 실시예 <1-1>에서 얻은 황색포도상구균과 함께 37℃에서 3-4시간동안 진탕배양 후, 8,000 rpm에서 20분간 원심분리하여 상등액을 회수하였다. 회수된 상등액을 0.45 ㎛의 필터를 이용하여 여과해준 후, 이렇게 얻어진 여과액을 이용한 용균반 분석을 통해 황색포도상구균에 특이적인 박테리오파지를 검출하였다(도 1). 이 때 사용한 방법의 모식도가 도 2에 개시되어 있다.In detail, the sample is collected from soil, straw, soil, and sewage in the barn where bacteriophage is expected to exist in order to separate bacteriophages capable of selectively killing Staphylococcus aureus. After shaking for 3-4 hours at 37 ℃ with Staphylococcus aureus obtained from>, the supernatant was recovered by centrifugation at 8,000 rpm for 20 minutes. The recovered supernatant was filtered using a 0.45 μm filter, and then bacteriophages specific to Staphylococcus aureus were detected by lytic plate analysis using the filtrate thus obtained (FIG. 1). The schematic diagram of the method used at this time is shown in FIG.

얻어진 박테리오파지의 형태를 관찰하기 위해 염화세슘(CsCl) 밀도 구배법(밀도: 1.15 g/㎖, 1.45 g/㎖, 1.50 g/㎖ 및 1.70 g/㎖)을 이용한 원심분리(38,000 rpm, 22시간, 4℃)를 통하여 박테리오파지를 정제한 다음, 이를 구리 격자(cupper grid)에 묻히고, 2% 유라닐 아세테이트(Uranyl acetate)를 이용한 역염색법(negative staining)과 건조를 수행한 후, 전자현미경을 통하여 그 형태를 촬영하였다. 그 결과 분리된 박테리오파지가 형태학적 분류상 포도비리대 과(Podoviridae family) φ29-유사 바이러스 속(φ29-like virus genus)에 속하는 것을 확인할 수 있었으며 크기는 약 36.4 nm이었고 이 박테리오파지를 SAP-2로 명명하였다 (도 3).Centrifugation (38,000 rpm, 22 hours, using a cesium chloride (CsCl) density gradient method (density: 1.15 g / ml, 1.45 g / ml, 1.50 g / ml and 1.70 g / ml) to observe the obtained bacteriophage morphology Purification of the bacteriophage was carried out through 4 ° C.), and then it was buried in a copper grid, subjected to negative staining and drying using 2% uranyl acetate, followed by electron microscopy. The shape was photographed. As a result, it was confirmed that the isolated bacteriophages belonged to the Podoviridae family φ29-like virus genus by morphological classification, and the size was about 36.4 nm and the bacteriophage was named SAP-2. (FIG. 3).

실시예 2: 황색포도상구균에 특이적인 분리된 박테리오파지 SAP-2의 유전적 특성 분석Example 2: Genetic Characterization of Isolated Bacteriophage SAP-2 Specific to Staphylococcus Aureus

얻어진 SAP-2 박테리오파지의 유전자 서열분석을 실시하였다. 이를 위해 SAP-2 박테리오파지의 유전체를 통상의 방법으로 추출한 다음 유전적 특성을 분석하였다. 구체적으로, 먼저 1 ℓ 플라스크에 TSB(Tryptic Soy Broth) 배지(카제인 다이제스트, 17 g/ℓ; 소이빈 다이제스트, 3 g/ℓ; 덱스트로스, 2.5 g/ℓ; NaCl, 5 g/ℓ; 디포타슘 포스페이트, 2.5 g/ℓ) 200 ㎖와 600 nm에서 흡광도가 1인 황색포도상구균 부유액 50 ㎖ 및 1× 10⁸ pfu/㎖ 수준으로 여과한 박테리오파지 용액 1 ㎖을 첨가하여 37℃에서 3-4시간 진탕배양 하였다. 배양 후, 황색포도상구균이 용균되었는지 여부를 확인한 다음, 용균이 일어났을 때 이 배양액을 0.45 ㎛의 필터로 여과해 주었다. 그 다음 이 여과한 배양액에 남아 있을 황색포도상구균의 DNA와 RNA를 제거하기 위해 이 여과한 배양액 10 ㎖에 DNase와 RNase 각각을 200 U씩 첨가한 다음 37℃에서 30분간 방치하였다. 그 후 DNase와 RNase의 활성을 제거하기 위해 0.5 M 에틸렌디아민테트라아세트산(ethylenediaminetetraacetic acid; EDTA) 500 ㎕를 첨가한 후 10분간 정치시켰다. 그 다음 단계로 박테리오파지 외벽을 와해시키기 위해 proteinase K (20 ㎎/㎖) 100 ㎕와 10% 도데실 황산 나트륨염(sodium dodecyl sulfate; SDS) 500 ㎕를 첨가한 다음 65℃에서 1시간 동안 반응시켰다. 1시간 반응 후, 이 반응액에 25:24:1의 구성비를 갖는 페놀(phenol) : 클로로포름(chloroform) : 이소아밀알코올(isoamylalcohol)의 혼합액 10 ㎖를 첨가해 준 후 잘 섞어 주었다. 그리고는 이것을 18,000 rpm에서 원심분리하여 층이 분리되게 한 다음 분리된 층 중에서 위층을 취하고 여기에 2부피비의 차가운 100% 알코올을 가하여 순수한 유전체만을 추출하였다. 추출한 박테리오파지의 유전체가 DNA인지, RNA 인지를 확인하기 위해, DNaseⅠ (10 U/㎕) 및 RNase A (10 ㎍/㎕)를 각각 첨가해 준 다음 37℃에서 1시간동안 처리하였고, 이와 더불어 DNA일 경우에 단일가닥 DNA인지, 이중가닥 DNA인지 구분하기 위해 녹두(Mung Bean) 뉴클레아제(45 U/㎕)를 첨가해 준 다음 상온에서 15분간 처리 하였다. 이렇게 처리한 시료들을 0.8% 아가로즈(agarose) 젤을 이용한 전기영동을 실시하여 각 효소에 의한 절단 양상을 조사하였다. 그 결과, 얻어진 유전체는 DNaseⅠ에만 민감하였다(도 4). DNase I에 민감한 것은 유전체가 DNA임을 의미하고, 녹두 뉴클레아제에 민감하지 않은 것은 유전체가 DNA 이중가닥 형태임을 의미한다. 이 결과로부터 얻어진 박테리오파지의 유전체가 DNA형이면서 이중가닥임을 확인할 수 있었다.Gene sequencing of the obtained SAP-2 bacteriophage was performed. To this end, the genome of the SAP-2 bacteriophage was extracted by a conventional method, and then the genetic characteristics were analyzed. Specifically, first, Tryptic Soy Broth (TSB) medium (casein digest, 17 g / l; soybean digest, 3 g / l; dextrose, 2.5 g / l; NaCl, 5 g / l; dipotassium in a 1 L flask Phosphate, 2.5 g / L) 200 ml and 50 ml of Staphylococcus aureus suspension with absorbance of 1 at 600 nm and 1 ml of a bacteriophage solution filtered to 1 × 10 ⁸ pfu / ml were shaken at 37 ° C. for 3-4 hours. Incubated. After incubation, it was confirmed whether Staphylococcus aureus was lysed, and when the lysate occurred, the culture solution was filtered with a 0.45 μm filter. Then, to remove DNA and RNA of Staphylococcus aureus remaining in the filtered culture, 200 U of each of DNase and RNase was added to 10 ml of the filtered culture, and then left at 37 ° C. for 30 minutes. Then, to remove the activity of DNase and RNase 500 μl of 0.5 M ethylenediaminetetraacetic acid (EDTA) was added and allowed to stand for 10 minutes. In the next step, 100 µl of proteinase K (20 mg / ml) and 500 µl of 10% sodium dodecyl sulfate (SDS) were added to disintegrate the bacteriophage outer wall, followed by reaction at 65 ° C for 1 hour. After the reaction for 1 hour, 10 ml of a mixture of phenol: chloroform: isoamylalcohol having a composition ratio of 25: 24: 1 was added to the reaction mixture, and the mixture was mixed well. Then, centrifugation was performed at 18,000 rpm to separate the layers, and the upper layer was taken from the separated layers, and 2 vol. Ratio of cold 100% alcohol was added thereto to extract only pure dielectric material. To confirm whether the genome of the extracted bacteriophage was DNA or RNA, DNase I (10 U / μl) and RNase A (10 μg / μl) were added, respectively, and treated at 37 ° C. for 1 hour. In this case, Mung Bean nuclease (45 U / μl) was added to separate single-stranded DNA or double-stranded DNA, and then treated at room temperature for 15 minutes. The samples thus treated were subjected to electrophoresis using 0.8% agarose gel to investigate the cleavage pattern by each enzyme. As a result, the obtained genome was sensitive only to DNase I (FIG. 4). Sensitive to DNase I means that the genome is DNA, while not sensitive to mung bean nucleases means that the genome is in the form of DNA double strands. The genome of the bacteriophage obtained from this result was confirmed to be DNA-type and double stranded.

위와 같이 분리된 박테리오파지의 유전체는 게놈 DNA(genomic DNA; gDNA)이다. 이 gDNA의 유전자 서열을 분석하기 위해 먼저 다양한 제한효소(restriction enzyme)로 처리하여 이에 따른 절단 양상을 일차적으로 파악하였다 (도 5). 그 결과, 제한효소 Nde I으로 처리하는 경우가 gDNA의 라이브러리(library) 구축에 가장 적합하다고 판단되어 Nde I으로 처리하여 준비된 유전자 단편(fragment)을 이용한 gDNA 라이브러리를 통상의 방법에 따라 구축하였다. gDNA 라이브러리 구축에 사용된 방법이 도 6에 모식적으로 제시되어 있다. 이와 더불어 SAP-2 박테리오파지의 gDNA 자체의 염기 서열을 직접 분석하여 전체 박테리오파지 유전체의 염기 서열을 확보하였다.The genome of the bacteriophage isolated as above is genomic DNA (gDNA). In order to analyze the gene sequence of the gDNA, first, the treatment was performed with various restriction enzymes (restriction enzymes) to determine the cleavage pattern accordingly (FIG. 5). As a result, it was determined that the treatment with restriction enzyme Nde I was most suitable for constructing a library of gDNA, and thus, a gDNA library using a gene fragment prepared by treatment with Nde I was constructed according to a conventional method. The method used to construct the gDNA library is shown schematically in FIG. 6. In addition, the nucleotide sequence of gDNA itself of SAP-2 bacteriophage was analyzed directly to secure the base sequence of the entire bacteriophage genome.

이를 상세히 설명하면, 먼저 통상의 방법대로 SAP-2 박테리오파지의 gDNA를Nde I으로 처리하여 유전자 단편을 얻었고, 또한 pGEM T-easy 벡터(vector)(Promega사)도 Nde I으로 처리하여 벡터 단편을 준비하였다. 이 때 사용한 pGEM T-easy 벡터는 TA-클로닝용 벡터이므로 그대로 사용하지 않고 벡터 말단의 T-돌출 (T-overhang)을 통상의 방법으로 제거한 후 평활말단 결합(blunt-ended ligation)을 통하여 환형으로 만들어 준 다음 사용하였다. 이렇게 준비된 유전자 단편들과 벡터 단편을 T4 리가아제(ligase)를 이용해 통상의 방법대로 서로 결합시켰다. 이렇게 하여 준비된 SAP-2 박테리오파지의 유전자 단편이 도입된 재조합 벡터를 전기천공법(electroporation)이라는 전기적 형질전환 방법(electro-transformation)을 통해 대장균의 한 종인 Top10F' 종 (Invitrogen사)에 도입시켰다. 이렇게 하여 형질전환된 형질전환체를 엑스-갈(X-Gal; 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside) 및 이소프로필 베타-디-1-티오갈락토피라노시드(isopropyl β-D-1-thiogalactopyranoside; IPTG)가 첨가된 암피실린(ampicillin) 함유 아가 평판배지 상에서 통상의 청백 콜로니 선별법(Blue-White colony selection)을 통해 선별하였다. 선별된 단일 콜로니(colony)를 암피실린이 포함된 배양배지에 접종한 후 하룻밤동안 진탕배양 하였고, 이 배양 세포로부터 플라스미드(plasmid) 정제 키트(iNtRON사)를 이용하여 플라스미드를 추출하였다. 이 추출된 플라스미드는 0.8% 아가로즈 젤을 이용한 전기영동을 통하여 그 크기를 확인함으로써 재조합된 플라스미드를 선별하였다. In detail, first, gDNA of SAP-2 bacteriophage was treated with Nde I in the usual manner to obtain a gene fragment, and pGEM T-easy vector (Promega) was also treated with Nde I to prepare a vector fragment. It was. The pGEM T-easy vector used at this time is a vector for TA-cloning. Thus, T-overhang at the end of the vector is removed in a conventional manner without being used as it is, and then annularly formed through blunt-ended ligation. After making it, it was used. Gene fragments and vector fragments thus prepared were combined with each other according to a conventional method using T4 ligase. The recombinant vector into which the gene fragment of SAP-2 bacteriophage prepared in this way was introduced was introduced into Top10F 'species (Invitrogen), a species of Escherichia coli, through an electrotransformation method called electroporation. The transformants thus transformed were X-Gal (5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside) and isopropyl beta-di-1-thiogalactopyranoside Ampicillin-containing agar plates containing (isopropyl β-D-1-thiogalactopyranoside; IPTG) were selected by conventional blue-white colony selection. Selected colonies (colony) were inoculated in the culture medium containing ampicillin and then shaken overnight, and the plasmid was extracted from the cultured cells using a plasmid purification kit (iNtRON). The extracted plasmid was screened for recombinant plasmid by checking its size through electrophoresis using 0.8% agarose gel.

이렇게 선별된 플라스미드는 3개였으며 이에 해당하는 클론(clone)도 당연히 그 플라스미드 수만큼 3개를 얻을 수 있었다. 이 클론들을 다시 배양하여 배양 세포로부터 다시 플라스미드를 상기 방법과 같이 추출하였고, 추출된 플라스미드를 이용하여 염기 서열을 분석하였다. 이와 병행하여 SAP-2 박테리오파지의 gDNA을 이용한 직접 염기 서열 분석도 실시하였다. 이때 사용한 프라이머(primer)는 다음의 표와 같다. Three plasmids were selected in this way, and corresponding clones were naturally able to obtain three plasmids. The clones were incubated again, and the plasmids were extracted from the cultured cells in the same manner as described above. In parallel, direct sequencing was also performed using gDNA of SAP-2 bacteriophage. The primer used at this time is shown in the following table.

프라이머primer 염기서열Sequence T7 promoterT7 promoter TAATACGACTCACTATAGGGCGATAATACGACTCACTATAGGGCGA SP6 promoterSP6 promoter GTATTCTATAGTGTCACCTAAATGTATTCTATAGTGTCACCTAAAT 1One CGTAATGCTTCAAAATGTTCCGTAATGCTTCAAAATGTTC 22 GAGCAATGTTAGTTGATTACTCATTGAGCAATGTTAGTTGATTACTCATT 33 CCATTTAAAAAATAATCATCACGTTCCATTTAAAAAATAATCATCACGTT 44 TGCAATTCATATATTAGATGATAA TGCAATTCATATATTAGATGATAA 55 TATGCTTTATATGGAGGTTGATAACTATGCTTTATATGGAGGTTGATAAC 66 AATTAGTGTACCGTCACCTAAAGAAATTAGTGTACCGTCACCTAAAGA 77 TGCAACACCATCGTGATGTATGCAACACCATCGTGATGTA 88 GTTGTTGAACATCGCAACAGGTTGTTGAACATCGCAACAG 99 CAAAATCTGATAAAAACGTCATCAAAATCTGATAAAAACGTCAT 1010 GACGTGATGAGGATTATTATGACGTGATGAGGATTATTAT 1111 ATAAATTCTCTTTCTTTTTCCTCAAATTCAAATCTCGCTAATGTATAAATTCTCTTTCTTTTTCCTCAAATTCAAATCTCGCTAATGT 1212 CATACGTGGATAATTACGTTTCAACATTAATTCCTCATTTCATACGTGGATAATTACGTTTCAACATTAATTCCTCATTT 1313 ATCAAATTCATTTAAAATTTTCTTTCTATCAAATTCATTTAAAATTTTCTTTCT 1414 AATGTCACCTATGTTTAATGCAGAAATGTCACCTATGTTTAATGCAGA 1515 AGTTCATCATTTAAGAATTGAACAACAGAACT AGTTCATCATTTAAGAATTGAACAACAGAACT 1616 TTTGTTGCTCTAATGATGTAATACGTTGTTCTAATATAACAGTTTGTTGCTCTAATGATGTAATACGTTGTTCTAATATAACAG 1717 TCACTTGCAATAATACCACTTTCTAATTCACTTGCAATAATACCACTTTCTAAT 1818 GTCAAGTATCATTTTAATACAATTTGTCAAGTATCATTTTAATACAATTT 1919 TCATTATACATTACGTGACGCTTATCATTATACATTACGTGACGCTTA 2020 AGCTTCTCTTTCTTTTTTCCATCTA AGCTTCTCTTTCTTTTTTCCATCTA 2121 GAACTTCATTGTATTTAGCGCTGTTGGAACTTCATTGTATTTAGCGCTGTTG 2222 TGAATCTTCATATGGTCGACCTGCAGTGAATCTTCATATGGTCGACCTGCAG 2323 ATTTAATAGTTTTGCACAAGTACCAA ATTTAATAGTTTTGCACAAGTACCAA 2424 CAAACTAACCCATCTGATAAACAAACCAAACTAACCCATCTGATAAACAAAC 2525 AACCTAATGGCTATTGGTTCCAACCAAACCTAATGGCTATTGGTTCCAACCA 2626 GGTAACAGTTCAGTTAATTCACAT GGTAACAGTTCAGTTAATTCACAT 2727 GGTGCCATAATTTATTATTCCTCCGGTGCCATAATTTATTATTCCTCC 2828 TTAATCGTACCTAATTTAATATCACTTAATCGTACCTAATTTAATATCAC 2929 AACGTAAATCGTTATTACTTGCAATGAACGTAAATCGTTATTACTTGCAATG 3030 CGTTACAACACCCGGAGAATATTACGTTACAACACCCGGAGAATATTA 3131 CCAAATGTCCAAGATTTTGAATAACCAAATGTCCAAGATTTTGAATAA 3232 TTTAAAATGTACAGGTACGTATACTTTAAAATGTACAGGTACGTATAC 3333 TTGAATTTAACGAATATAATTTGGCTTGAATTTAACGAATATAATTTGGC 3434 ATATTATCATGATTGCACATAACTGATATTATCATGATTGCACATAACTG 3535 GTAAAAGGTTATGGACGTTTTAAT GTAAAAGGTTATGGACGTTTTAAT 3636 AATTTTTATGACTATATAAAATCATTAATTTTTATGACTATATAAAATCATT 3737 ACAAAAAACATTTAACAACACGTAT ACAAAAAACATTTAACAACACGTAT 3838 AAATAAAATACAAAACATAATCAATAAATAAAATACAAAACATAATCAAT

상기 두 가지 방법을 통하여 확보된 SAP-2 박테리오파지의 전체 유전자의 염기 서열은 서열번호 1로 제시되어 있다. 최종적인 SAP-2 박테리오파지 유전체의 총 구성 염기 수는 17938개였다.The base sequence of the entire gene of SAP-2 bacteriophage obtained through the two methods is shown in SEQ ID NO: 1. The total number of constituent bases of the final SAP-2 bacteriophage genome was 17938.

분석된 박테리오파지의 염기 서열을 기반으로 Web상의 BLAST (http://www.ncbi.nlm.nih.gov/BLAST/)를 이용하여 기존 알려진 박테리오파지 유전자와의 상동성을 조사해 보았다. BLAST 조사 결과, 분석된 박테리오파지의 염기 서열은 Staphylococcus aureus phage phi P68와는 86.0%의 상동성을, 44AHJD 및 Bacteriophage 66은 각각 81.1% 및 49.2%의 상동성을 가지는 것으로 확인되었다. 이 세 가지 박테리오파지는 모두 Staphylococcus aureus에 특이적으로 감염하는 용균성의 포도비리대 박테리오파지로 각 유전체의 크기는 phi P68의 경우 18,227bp, 44AHJD의 경우 16,784bp이며, Bacteriophage 66의 경우는 18,119bp이다. 유전체 각 부분의 유전적 기능을 파악하기 위해 상동성이 가장 높았던 phi P68의 유전자 서열을 기반으로 하여 번역영역(open reading frame; ORF) 분석을 NCBI ORF finder(http://www.ncbi.nlm.nih.gov/gorf/gorf.html)와 Vector NTI ContigExpress (INFORMAX사) 프로그램을 이용하여 실시하였다. 또한 2003년에 FEMS Microbiology Letters(2003, 219: 275-283)에 발표되었던 ‘Complete nucleotide sequence and molecular characterization of two lytic Staphylococcus aureus phages: 44AHJD and P68’라는 제목의 논문과 비교하면서 ORF의 유사성이 어느 정도 되는지 비교하였다. 그 결과는 다음의 표와 같다. Based on the analyzed nucleotide sequence of the bacteriophage, the homology with the known bacteriophage gene was investigated using BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) on the Web. As a result of the BLAST investigation, it was confirmed that the base sequence of the analyzed bacteriophage was 86.0% homologous to Staphylococcus aureus phage phi P68, and 44AHJD and Bacteriophage 66 had homology of 81.1% and 49.2%, respectively. All three bacteriophages are lytic staphylococcus aureus -specific bacteriophage bacteriophages that are 18,227bp for phi P68, 16,784bp for 44AHJD, and 18,119bp for Bacteriophage 66. Based on the gene sequence of phi P68, which had the highest homology to identify the genetic function of each part of the genome, an open reading frame (ORF) analysis was performed by the NCBI ORF finder (http: //www.ncbi.nlm. nih.gov/gorf/gorf.html) and the Vector NTI ContigExpress (INFORMAX) program. In addition, the degree of similarity between ORFs was compared to a paper entitled `` Complete nucleotide sequence and molecular characterization of two lytic Staphylococcus aureus phages: 44AHJD and P68 '' published in FEMS Microbiology Letters (2003, 219: 275-283) in 2003. Was compared. The results are shown in the table below.

ORFORF FrameFrame StartStart EndEnd Putative translation initiation sitesPutative translation initiation sites No. of amino acidsNo. of amino acids Size (Da)Size (Da) PIPI Putative functionPutative function 1One +1+1 343343 645645 caaaacaaggaggtaacaaacaaaacaaggaggtaacaaa 100100 11550.8911550.89 3.91693.9169 UnknownUnknown 22 +3+3 660660 896896 ttagaaaggaatgatataatttagaaaggaatgatataat 7878 9306.719306.71 6.24186.2418 UnknownUnknown 33 +3+3 900900 12681268 aattaaagaggagaaataaaaattaaagaggagaaataaa 122122 14292.1214292.12 5.3015.301 single stranded DNA binding proteinsingle stranded DNA binding protein 44 +1+1 13181318 14971497 attttatgaggtgctaaacaattttatgaggtgctaaaca 5959 7141.187141.18 7.49137.4913 UnknownUnknown 55 +3+3 15001500 19131913 ttaaggagatataaaaatgttaaggagatataaaaatg 137137 16088.3616088.36 4.76374.7637 UnknownUnknown 66 +1+1 19061906 20732073 atacgggaaagtaatagaccatacgggaaagtaatagacc 5555 6369.956369.95 6.31266.3126 UnknownUnknown 77 +1+1 21012101 25592559 gctttatatggaggttgatagctttatatggaggttgata 152152 18423.7618423.76 9.98979.9897 UnknownUnknown 88 +3+3 27182718 38543854 caaatagaattagttgatgacaaatagaattagttgatga 378378 45857.745857.7 5.92195.9219 Encapsidation proteinEncapsidation protein 99 +3+3 38883888 61576157 aagattatgggattacttgaaagattatgggattacttga 761761 90383.0590383.05 5.42835.4283 DNA polymeraseDNA polymerase 1010 -2-2 77067706 62706270 acgattctgaaaagagtgatacgattctgaaaagagtgat 478478 52080.4852080.48 9.43479.4347 UnknownUnknown 1111 -1-One 80208020 79917991 agagagggggtataaaa agagagggggtataaaa 140140 16345.3516345.35 8.19028.1902 HolinHolin 1212 -2-2 98699869 81068106 ctatttttta tggaggtaaa a ctatttttta tggaggtaaa a 587587 68346.1768346.17 6.21396.2139 Tail proteinTail protein 1313 -1-One 1137111371 1083810838 taaataagaggtgtaaaca taaataagaggtgtaaaca 177177 20359.520359.5 5.37195.3719 UnknownUnknown 1414 -2-2 1218512185 1143611436 acataaaaaataggagtgtt acataaaaaataggagtgtt 249249 28653.8528653.85 6.89316.8931 AmidaseAmidase 1515 -3-3 1415914159 1414014140 tggtaaaggtggaaaattat tggtaaaggtggaaaattat 647647 74574.4774574.47 5.58355.5835 Minor structural proteinMinor structural protein 1616 -2-2 1391013910 1415414154 agatgaaagtagtgatttaa agatgaaagtagtgatttaa 259259 30037.5330037.53 5.22115.2211 lower collar proteinlower collar protein 1717 -1-One 1565215652 1490314903 ttaatgtagtggttggtgaa ttaatgtagtggttggtgaa 249249 28571.0628571.06 4.33324.3332 upper collar proteinupper collar protein 1818 -3-3 1712617126 1590015900 acgtagaggaggaataataa acgtagaggaggaataataa 408408 46804.9846804.98 5.55685.5568 major head proteinmajor head protein 1919 -3-3 1731517315 1713317133 atttagattaggaggaaaat atttagattaggaggaaaat 6060 6955.516955.51 4.13654.1365 UnknownUnknown 2020 -3-3 1766317663 1732517325 atattttggaggtgtcacaa atattttggaggtgtcacaa 112112 12991.912991.9 3.63133.6313 UnknownUnknown

실시예 3: 용균관련 유전자의 클로닝 및 발현 벡터 제작Example 3: Cloning and Expression Vector Production of Lysis Related Genes

앞서 실시예 2에서의 유전자 서열 분석 및 ORF분석을 통하여 용균 단백질일 가능성이 매우 높은 아미데이즈(Amidase)의 ORF를 찾을 수 있었다. 아미데이즈의 유전자 영역(domain)을 더욱 세밀하게 분석한 결과, CHAP(cysteine, histidine-dependent amidohydrolases/peptidases) 영역과 SH3_5 영역이 분석되었다. CHAP 영역은 박테리아의 펩티도글리칸 층을 끊어 세포 파쇄(cell lysis)를 시키는 펩티도글리칸 아미데이즈(peptidoglycan amidase)에 자주 포함되는 영역으로서 L-뮤라모일-L-알라닌 아미데이즈(L-muramoyl-L-alanine amidase)와 D-알라닐-글리실 엔도펩티데이즈(D-alanyl-glycyl endopeptidase)의 활성(activity)을 가지는 영역으로 알려져 있다. SH3_5 영역은 박테리오파지가 가지는 세포벽 표적 영역(cell wall targeting domain)으로 용균 단백질이 생성되어 숙주 박테리아에 접근할 때 이 영역이 박테리아의 세포벽의 특정 부분에 결합하여 용균 단백질이 특이적으로, 그리고 빠르게 펩티도글리칸 층의 특정 부위를 끊는 것을 가능하게 한다. Gene sequence analysis and ORF analysis in Example 2 was able to find the ORF of Amidases very likely to be a lytic protein. In a more detailed analysis of the gene domains of Amida's, the CHAP (cysteine, histidine-dependent amidohydrolases / peptidases) and SH3_5 regions were analyzed. The CHAP region is a region frequently included in peptidoglycan amidase, which breaks down the peptidoglycan layer of bacteria for cell lysis. It is known as a region having the activity of muramoyl-L-alanine amidase and D-alanyl-glycyl endopeptidase. The SH3_5 region is a cell wall targeting domain of bacteriophage, and when lytic proteins are produced and access to host bacteria, these regions bind to specific parts of the cell wall of the bacteria so that the lytic proteins are specific and rapidly It is possible to break specific sites of the glycan layer.

SAP-2 박테리오파지 유전체에서 용균 단백질을 코딩(coding)하고 있는 유전자의 크기는 750bp이며 이로부터 발현된 용균 단백질은 250개의 아미노산으로 구성되어 있다. 이 용균 단백질을 코딩하고 있는 유전자 서열은 서열번호 2로 제시되어 있고, 용균 단백질의 아미노산 서열은 서열번호 3으로 제시되어 있다.The gene encoding the lytic protein in the SAP-2 bacteriophage genome is 750 bp, and the lysed protein expressed therefrom is composed of 250 amino acids. The gene sequence encoding this lytic protein is shown in SEQ ID NO: 2, and the amino acid sequence of the lytic protein is shown in SEQ ID NO: 3.

이 용균 단백질의 발현을 위하여 용균 단백질의 발현 벡터를 제작했다. 아미데이즈에 해당하는 유전자를 Nco I과 Not I 제한효소 자리를 이용하여 pBAD-TOPO 벡터(Invitrogen 사)에 클로닝하였다. 이를 위해 클로닝 전에 미리 pBAD-TOPO 벡터 내에 존재했던 엔테로키나아제 자리(Enterokinase cleavage site)를 없애고 Not I 제한효소 자리를 삽입시킨 것을 준비한 다음 클로닝에 이용하였다. 이렇게 제작된 용균 단백질의 발현 벡터를 pBAD::lysinM으로 명명하였다. 이 항균 단백질의 발현 벡터를 이용하여 대장균 Origami (DE3)(Novagen사)을 형질전환 시켜 용균 단백질의 생산 균주를 제작하였다. 이렇게 제작된 용균 단백질의 생산 균주는 2007년 7월 18일자로 한국생명공학연구원 생물자원센터에 기탁하였다 (기탁번호 KCTC 11152BP).An expression vector of the lytic protein was prepared for the expression of the lytic protein. The gene corresponding to Amidases was cloned into pBAD-TOPO vector (Invitrogen) using Nco I and Not I restriction enzyme sites. To this end, the enterokinase cleavage site, which was previously present in the pBAD-TOPO vector, was removed and the Not I restriction site was inserted before cloning, and then used for cloning. The expression vector of the lysed protein thus prepared was named pBAD :: lysinM. E. coli Origami (DE3) (Novagen) was transformed using the expression vector of the antimicrobial protein to produce a lytic protein producing strain. The production strains of the lysed protein thus produced were deposited to the Korea Institute of Biotechnology and Biotechnology Center on July 18, 2007 (Accession No. KCTC 11152BP).

실시예Example 4: 항균 단백질의 과발현 4: Overexpression of Antimicrobial Proteins

실시예 3에서 제작된 재조합 플라스미드로 형질전환된 대장균을 이용하여 항균 단백질을 과발현시켰다. pBAD-TOPO 벡터 기반의 발현시스템은 L-아라비노즈(arabinose)를 이용하여 과발현을 유도(induction)하는 방식으로, 박테리아에 해로운(toxic) 유전자의 경우에도 원활히 발현시킬 수 있는 장점을 지닌 발현 벡터 시스템이다(제작사의 “pBAD expression system"이라는 제목의 설명서 및 제작사의 2004년 발행 설명서 25-0257호). Antibacterial protein was overexpressed using E. coli transformed with the recombinant plasmid prepared in Example 3. pBAD-TOPO vector-based expression system is an expression vector system having the advantage of smooth expression even in the case of toxic genes by inducing overexpression using L-arabinose. (Instructions titled “pBAD expression system” by the manufacturer and manufacturer's 2004 publication 25-0257).

과발현 유도 과정을 상세히 제시하면 다음과 같다. 제작된 벡터에는 암피실린 저항성 유전자가 존재하고 생산균주 자체에는 테트라사이클린 내성 유전자가 존재하기 때문에 암피실린과 테트라사이클린이 포함된 LB배지(트립톤, 10 g/L; 효모 추출물, 5 g/L; 염화나트륨, 10 g/L) 5㎖에 제작된 용균 단백질의 생산 균주를 접종한 다음 37℃에서 한밤동안 진탕 배양한다. 이렇게 밤새 배양한 배양액에서 100 ㎕를 취해 암피실린과 테트라사이클린이 포함된 새로운 LB배지 10 ㎖에 재접종하여 37℃에서 다시 진탕 배양한다. 세포 농도가 600 nm에서의 흡광도 기준으로 0.5가 되었을 때, 최종 농도가 0.2%가 되도록 L-아라비노즈를 첨가하여 항균 단백질의 발현을 유도하였다. 발현 유도를 한 직후부터는 배양온도를 23℃로 변경하였으며 이러한 저온배양을 12시간 동안 실시했다. 배양 종료 후, 세포 배양액 1 ㎖을 취하여 8,000 rpm에서 5분간 원심분리하여 세포 침전물을 회수하였다. 회수된 세포 침전물에 1% SDS 용액 100 ㎕를 가하여 세포를 파쇄한 다음, 세포 파쇄액 중 12 ㎕를 취하여 전기영동용 시료로 사용하였다. 취한 세포 파쇄액에 통상의 전기영동에 사용되는 5× 전기영동용 샘플 완충액(sample loading buffer) 3 ㎕를 첨가하여 잘 혼합하고 5분간 물중탕으로 끓여주는 방식으로 시료를 처리한 다음, 통상의 방법에 따라 전기영동을 실시하여 과발현된 항균 단백질을 확인하였다. 그 결과가 도 7에 제시되어 있다.The process of inducing overexpression is described in detail as follows. Since the produced vector contains the ampicillin resistance gene and the production strain itself contains the tetracycline resistance gene, LB medium containing ampicillin and tetracycline (tryptone, 10 g / L; yeast extract, 5 g / L; sodium chloride, 10 g / L) 5 ml of the production strain of the lysed protein produced was inoculated and then shaken at 37 ℃ overnight. 100 μl of the overnight culture was taken and reinoculated into 10 ml of fresh LB medium containing ampicillin and tetracycline and shake-cultured again at 37 ° C. When the cell concentration became 0.5 on the basis of absorbance at 600 nm, L-arabinose was added to induce the expression of the antimicrobial protein so that the final concentration was 0.2%. Immediately after induction of expression, the culture temperature was changed to 23 ° C. and the low temperature culture was performed for 12 hours. After the completion of the culture, 1 ml of the cell culture was taken and centrifuged at 8,000 rpm for 5 minutes to recover the cell precipitate. 100 μl of a 1% SDS solution was added to the recovered cell precipitate, and the cells were disrupted. Then, 12 μl of the cell disruption solution was taken as an electrophoretic sample. Samples were treated by adding 3 μl of 5 × electrophoretic sample loading buffer used for normal electrophoresis to the cell lysate and mixing them and boiling in a water bath for 5 minutes. Electrophoresis was performed to confirm the overexpressed antimicrobial protein. The results are shown in FIG.

실시예Example 5: 발현된 항균 단백질의 용균 활성 조사 5: Investigation of lytic activity of expressed antibacterial protein

발현된 항균 단백질의 용균 활성을 확인하기 위해, 생산 균주인 대장균 형질전환체(KCTC 11152BP)의 배양액 100 ㎖을 취한 다음 8,000 rpm에서 5분간 원심분리하여 세포를 침전물 형태로 회수하였고 이 세포 침전물에 80 mM 트리스-염산(Tris-HCl, pH 4.0) 완충액 1 ㎖을 사용하여 세포 침전물을 부유시킨 후 초음파 분쇄법(sonication)을 사용하여 세포를 파쇄하였다. 초음파 분쇄법의 적용 조건은 20초간 초음파를 가하여 세포를 깨고 5초간 멈추는 것을 총 20분간 반복하여 실시하였다. 이렇게 하여 얻어진 세포 파쇄액(whole cell lysate)을 다시 한 번 원심분리하여(10,000× g, 5분) 상등액을 회수하였고, 이렇게 얻어진 상등액을 이용하여 발현된 항균 단백질의 활성을 확인해 보았다. 용균 활성 확인에 사용된 박테리아는 본 발명자들이 경기도 및 강원도의 농장에서 젖소유방염에 감염된 젖소의 우유에서부터 임상적으로 분리하여 기 확보하고 있던 황색포도상구균 3종 이었다.To confirm the lytic activity of the expressed antimicrobial protein, 100 ml of the culture medium of E. coli transformant (KCTC 11152BP), which was produced, was taken and centrifuged at 8,000 rpm for 5 minutes to recover the cells in the form of precipitate. Cell precipitates were suspended using 1 ml of mM Tris-HCl (pH 4.0) buffer and the cells were disrupted using sonication. Application conditions of the ultrasonic pulverization method was repeated 20 minutes to break the cells and stop for 5 seconds by applying ultrasonic waves for 20 seconds. The supernatant was recovered by centrifuging the whole cell lysate (10,000 × g, 5 min) once again, and the activity of the expressed antimicrobial protein was confirmed using the supernatant thus obtained. The bacteria used to confirm the lytic activity were three Staphylococcus aureus strains, which the present inventors have clinically isolated from cow's milk infected cow's milk on farms in Gyeonggi-do and Gangwon-do.

실험방법은 TSA 배지에 600 ㎚에서 흡광도가 1 정도 되는 황색포도상구균 배양액 1 ㎖을 각각 평판배지에 도말하여 말린 후, 앞에서 준비한 세포 파쇄액의 원심분리 후의 상등액 5 ㎕를 떨어뜨린 후 37℃ 배양기에서 밤새도록 배양하여 황색포도상구균의 용균 정도를 확인하였다. 그 결과로 도 8에 제시된 바와 같이 항균 단백질에 의한 용균 작용으로 투명해 지는 용균반이 형성되는 것을 확인할 수 있었다. In the test method, 1 ml of Staphylococcus aureus culture medium having absorbance at 600 nm in TSA medium was plated and dried on a plate medium, and 5 µl of the supernatant after centrifugation of the cell lysate was prepared. Incubation overnight to determine the degree of lytic staphylococcus aureus. As a result, as shown in FIG. 8, it was confirmed that lysate plaques were formed by lysis by antibacterial proteins.

추가로 용균 활성이 확인된 항균 단백질의 모체가 되는 SAP-2 박테리오파지와 용균 활성을 비교해 보았다. 이를 위해 앞서 분석한 방법과 동일하게 각 세균을 배양한 후 평판배지에 도말한 다음, 항균 단백질액(여기서는 앞 실험에서의 세포 파쇄액의 원심분리 후의 상등액에 해당)과 SAP-2 박테리오파지를 포함한 용액 5 ㎕씩을 각각 떨어뜨린 후 37℃에서 밤새도록 배양하여 항균 단백질의 용균 활성을 조사하였다. 그 결과가 도 9에 정리되어 있다. 이번 비교 실험에는 소에서 분리된 황색포도상구균 5종 및 사람에게서 분리된 황색포도상구균 3종을 대상으로 하였다. 결과에서 알 수 있듯이 박테리오파지 자체보다는 용균 단백질이 더 많은 황색포도상구균에 대하여 용균 활성을 보였다. 이로서 본 발명에서 개시된 항균 단백질은 그 기원이 되는 박테리오파지 자체보다 용균 작용의 대상이 더 넓다고 할 수 있다.In addition, we compared the lytic activity with SAP-2 bacteriophage, which is the parent of the antibacterial protein whose lytic activity was confirmed. To this end, incubate each bacterium in the same manner as in the above-described method, and plate it on a plate medium, and then contain an antimicrobial protein solution (which corresponds to the supernatant after centrifugation of cell disruption solution in the previous experiment) and a solution containing SAP-2 bacteriophage. 5 μl each was dropped and incubated overnight at 37 ° C. to investigate the lytic activity of the antimicrobial protein. The results are summarized in FIG. The comparative experiments included five Staphylococcus aureus isolates from cattle and three Staphylococcus aureus isolates from humans. As can be seen from the results, the lytic protein showed more lytic activity against Staphylococcus aureus than the bacteriophage itself. Thus, the antimicrobial protein disclosed in the present invention can be said to have a wider target of lytic action than the bacteriophage itself.

실시예Example 6: 발현된 용균 단백질의 분리 정제 6: Separation and Purification of Expressed Lysis Protein

LB 배지를 이용하여 배양한 형질전환체(KCTC 11152BP)의 배양액 500 ㎖을 8,000 rpm에서 5분간 원심분리하여 세포 침전물을 얻었다. 이를 6 ㎖의 80 mM 트리스-염산(Tris-HCl, pH 4.0) 완충액에 부유시켰다. 이렇게 준비된 세포 부유액을 실시예 5에서와 동일하게 초음파 분쇄법을 이용하여 세포를 파쇄하고 이를 8,000 rpm에서 5분간 원심분리하여 세포 찌꺼기를 제거하였다. 이 원심분리를 통하여 얻어진 상등액은 30%(w/v)의 암모늄 설페이트 침전법으로 발현된 항균 단백질을 농축하였다. 이를 자세히 설명하면, 최종 농도가 30%(w/v)가 되게 암모늄 설페이트를 첨가한 후, 그 암모늄 설페이트 첨가액을 얼음 속에 15분간 정치시켜 단백질이 원활히 침전되도록 하였다. 15분간의 정치 후, 혼합액을 10,000× g에서 15분간 원심분리하여 침전물을 회수하였다. 이를 크로마토그라피에서 사용할 흡착 완충액(adsorption buffer; 25 mM 인산나트륨(sodium phosphate), pH 5.8) 2 ㎖을 사용하여 녹였다. 이렇게 준비된 단백질 용액에 과량 포함된 암모늄 설페이트를 제거하기 위해 간간이 흡착 완충액을 교환해 주면서 4℃에서 밤새도록 투석을 실시하였다. 투석이 완료된 단백질 용액을 10,000× g에서 25분간 원심분리하여 불용성 물질을 제거해 주었다. 이렇게 준비된 단백질 용액을 마지막으로 0.2 ㎛ 필터로 여과한 다음 양이온-교환 크로마토그라피(cation-exchange chromatography)를 수행하였다. 이때, 양이온-교환 수지(resin)로는 HiTrap SPFF(GE Healthcare사)을 사용하였으며, 이는 강한(strong) 양이온-교환 수지에 해당한다. 크로마토그라피는 칼럼을 흡착 완충액으로 미리 평형화시킨 다음 실시하였고, 항균 단백질액을 칼럼에 적하한 다음에는 100 ㎖의 흡착 완충액으로 세척 단계를 실시하였다. 이 조건에서는 대장균 유래의 다른 단백질은 거의 칼럼의 충진 수지에 붙지 않았다. 최종적으로 항균 단백질은 0.2 에서 0.8 M까지 농도를 변화시킨 염화칼륨을 포함한 25 mM의 인산나트륨 용액(pH 5.8)을 사용하여 용출하였다. 용균 단백질을 포함한 용출액 분획(fraction)은 25 mM의 인산나트륨 용액 (pH 5.8)에 대하여 간간히 인산나트륨 용액을 교환해 주면서 4℃에서 밤새도록 투석하여 항균 단백질의 용출에 사용된 염화칼륨을 제거하였고, 이 투석액을 건조한 폴리에틸렌 글리콜 20,000에 대하여 투석을 한 번 더 실시하여 마지막으로 농축하였다. 분리, 정제의 결과가 도 10에 제시되어 있다.500 ml of the culture medium of the transformant (KCTC 11152BP) cultured using LB medium was centrifuged at 8,000 rpm for 5 minutes to obtain cell precipitates. It was suspended in 6 ml of 80 mM Tris-HCl (Tris-HCl, pH 4.0) buffer. The cell suspension prepared as described above was crushed by ultrasonic grinding in the same manner as in Example 5 and centrifuged at 8,000 rpm for 5 minutes to remove cell debris. The supernatant obtained through this centrifugation concentrated the antimicrobial protein expressed by the 30% (w / v) ammonium sulfate precipitation method. In detail, the ammonium sulfate was added to a final concentration of 30% (w / v), and then the ammonium sulfate solution was left in ice for 15 minutes to allow the protein to precipitate smoothly. After standing for 15 minutes, the mixed solution was centrifuged at 10,000 x g for 15 minutes to recover a precipitate. This was dissolved using 2 ml of adsorption buffer (25 mM sodium phosphate, pH 5.8) for use in chromatography. Dialysis was performed overnight at 4 ° C. while the adsorption buffer was exchanged occasionally to remove the ammonium sulfate contained in the protein solution thus prepared. The dialysis protein solution was centrifuged at 10,000 × g for 25 minutes to remove insoluble matters. The protein solution thus prepared was finally filtered through a 0.2 μm filter, followed by cation-exchange chromatography. At this time, HiTrap SPFF (GE Healthcare Co., Ltd.) was used as the cation-exchange resin, which corresponds to a strong cation-exchange resin. Chromatography was performed after the column was equilibrated with adsorption buffer in advance, and the antimicrobial protein solution was added to the column, followed by a washing step with 100 ml of adsorption buffer. Under these conditions, E. coli-derived other proteins hardly adhered to the column's filling resin. Finally, the antimicrobial protein was eluted using a 25 mM sodium phosphate solution (pH 5.8) containing potassium chloride with varying concentrations from 0.2 to 0.8 M. The eluate fraction containing the lysate protein was dialyzed overnight at 4 ° C. while exchanging the sodium phosphate solution for 25 mM sodium phosphate solution (pH 5.8) to remove the potassium chloride used for elution of the antimicrobial protein. The dialysate was finally concentrated by dialysis once more against 20,000 dry polyethylene glycols. The results of separation and purification are shown in FIG. 10.

실시예Example 7: 황색포도상구균에 특이적인 항균 단백질을 이용한 황색포도상구균의 감염 예방에 대한 7: Prevention of infection of Staphylococcus aureus using antibacterial protein specific to Staphylococcus aureus 적용예Application example

9 ㎖의 영양배지(Nutrient broth: Beef extract 3 g/L, peptone 5 g/L) 하나에는 실시예 5에서 얻어진 항균 단백질을 포함한 세포 추출액의 원심분리 후의 상등액 100 ㎕를 넣어주고, 또 하나에는 실시예 6에서 얻은 순수 분리한 항균 단백질 용액 100 ㎕를 넣어주고, 대조실험의 배지에는 아무 것도 추가로 넣어주지 않은 시료를 각각 준비하였다. 여기에 최종적으로 600 nm에서 흡광도가 0.5 정도가 되도록 황색포도상구균액(실시예 2에서 사용한 황색포도상구균 부유액)을 넣어준 다음 황색포도상구균의 배양 상태를 관찰해 보았다. 표 4의 결과에서 보는 바와 같이, 아무 것도 추가로 첨가해 주지 않은 배지에서는 60분 후 600 nm에서의 흡광도가 0.8 정도가 될 정도로 황색포도상구균이 매우 잘 성장하는 반면에 항균 단백질을 포함한 상등액이나 순수 분리한 항균 단백질 용액을 첨가해 준 영양배지에서는 10분경과 후 600 nm에서의 흡광도가 0.1 정도 수준으로, 60분 후에는 0.05 수준으로 감소하는 것을 관찰할 수 있었다. 이 결과로부터 실시예 5(세포 파쇄액의 원심분리 후의 상등액) 및 실시예 6(순수 분리한 항균 단백질)에서 얻어진 본 발명의 항균 단백질이 황색포도상구균의 성장을 저해할 뿐만 아니라 사멸시킬 수 있는 능력이 있어 황색포도상구균의 감염을 막는데 매우 효과적임을 알 수 있었다. In 9 ml of nutrient broth (Nutrient broth: Beef extract 3 g / L, peptone 5 g / L), 100 μl of the supernatant after centrifugation of the cell extract containing the antimicrobial protein obtained in Example 5 was added. 100 µl of the purely isolated antimicrobial protein solution obtained in Example 6 was added, and each sample was prepared by adding nothing to the medium of the control experiment. Finally, after adding a staphylococcus aureus solution (a staphylococcus aureus suspension used in Example 2) so that the absorbance was about 0.5 at 600 nm, the culture state of Staphylococcus aureus was observed. As shown in the results of Table 4, in the medium to which nothing was added, Staphylococcus aureus grows very well such that the absorbance at 600 nm is about 0.8 after 60 minutes, whereas supernatant or pure water containing antibacterial protein is obtained. In the nutrient medium to which the antimicrobial protein solution was added, the absorbance at 600 nm after 10 minutes decreased to about 0.1 level and after 60 minutes to 0.05 level. From these results, the ability of the antimicrobial protein of the present invention obtained in Example 5 (supernatant after centrifugation of cell lysate) and Example 6 (pure separated antibacterial protein) not only inhibited the growth of Staphylococcus aureus but also killed it. It was found to be very effective in preventing the infection of Staphylococcus aureus.

황색포도상구균 사멸 능력(OD₆₀₀ 흡광도 값)Staphylococcus aureus killing ability (OD ₆₀₀ absorbance value) 구분division 배양 0시간Incubation 0 hours 배양후 10분10 minutes after incubation 배양후 60분60 minutes after incubation 대조군(무처리)Control (no treatment) 0.50.5 0.60.6 0.80.8 실험군 1(실시예 5)Experimental Group 1 (Example 5) 0.50.5 0.120.12 0.080.08 실험군 2(실시예 6)Experimental Group 2 (Example 6) 0.50.5 0.10.1 0.050.05

실시예Example 8: 황색포도상구균에 특이적인 항균 단백질을 이용한 황색포도상구균의 감염에 기인한 질환의 치료에의 8: Use of antibacterial protein specific for Staphylococcus aureus for the treatment of disease caused by Staphylococcus aureus infection 적용예Application example

황색포도상구균이 주요 원인균인 젖소유방염에 감염된 젖소 15두를 대상으로 실시예 6에서 얻은 항균 단백질이 유방염 치료에 효과적인지 여부에 대해 조사해 보았다. 젖소를 5두씩 세 그룹으로 나누어 한 그룹은 실시예 6에서 얻어진 항균 단백질 농축액을 50 mM의 인산나트륨 용액(pH 6.5)을 이용하여 100배 희석한 용액 10 ㎖을 매일 감염부위에 분무해 주었고, 다른 하나의 5두로 구성된 비교 그룹에는 항균 단백질이 포함되지 않은 50 mM의 인산나트륨 용액(pH 6.5)을 매일 동일한 양인 10 ㎖씩 감염부위에 분무해 주었으며, 나머지 5두로 구성된 대조 그룹에는 항균 단백질이 포함되지 않은 통상의 인산완충식염수를 동일한 양인 10 ㎖씩을 매일 감염부위에 분무해 주었다. 이와 같은 처치를 10일간 해준 다음 젖소 유방염에 감염된 젖소로부터 얻어진 우유에 포함된 황색포도상구균의 수를 조사해 본 결과, 하기 표 5의 결과에서 보는 바와 같이 항균 단백질을 포함한 액을 분무해 준 경우에만 유의적 수준으로 유방염 치료 효과가 있는 것을 확인할 수 있었다. 이 결과로부터 실시예 6에서 얻어진 본 발명의 항균 단백질이 황색포도상구균을 원인으로 하는 감염성 질환의 치료에도 매우 효과적이라는 것을 알 수 있었다.We examined whether the antimicrobial protein obtained in Example 6 is effective for the treatment of mastitis in 15 cows infected with cow mastitis. The cows were divided into three groups of five cows, and one group sprayed 10 ml of the solution 100 times diluted with the antimicrobial protein concentrate obtained in Example 6 with 50 mM sodium phosphate solution (pH 6.5) daily to the infected site. One five-head comparison group was sprayed with 50 mM sodium phosphate solution (pH 6.5) containing no antimicrobial protein (10 ml) daily to the affected area, while the other five heads did not contain antimicrobial proteins. Normal phosphate buffered saline was sprayed to the infected area every day with the same amount of 10 ml. After this procedure for 10 days, the number of Staphylococcus aureus contained in the milk obtained from cows infected with cow mastitis was checked, and only when sprayed with an antimicrobial protein solution as shown in Table 5 below. It was confirmed that the effect of treating mastitis at an enemy level. From this result, it was found that the antimicrobial protein of the present invention obtained in Example 6 was also very effective in the treatment of infectious diseases caused by Staphylococcus aureus.

황색포도상구균 감염 질환 치료 능력(황색포도상구균 수)Staphylococcus Aureus Infection Disease Capability 구분division 처치전Before kill 처치후After treatment 대조군(인산완충식염수)Control group (phosphate buffered saline) 1.6× 10⁴cfu/㎖1.6 × 10 ⁴ cfu / ml 1.7× 10⁴ cfu/㎖1.7 × 10 ⁴ cfu / ml 실험군 (실시예 6에서 얻은 항균 단백질 농축액의 100배 희석액)Experimental group (100-fold dilution of the antimicrobial protein concentrate obtained in Example 6) 1.7× 10⁴ cfu/㎖1.7 × 10 ⁴ cfu / ml 1.3× 10² cfu/㎖1.3 × 10 ² cfu / ml 비교군(인산나트륨 용액)Comparative Group (Sodium Phosphate Solution) 1.5× 10⁴ cfu/㎖1.5 × 10 ⁴ cfu / ml 1.6× 10⁴ cfu/㎖1.6 × 10 ⁴ cfu / ml

이상으로 본 발명의 특정한 부분을 상세히 기술 하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that such a specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

도 1은 용균반 분석(plaque assay)에 의해 황색포도상구균에 특이적인 박테리오파지를 검출한 평판접시 사진이다.1 is a plate plate photograph of a bacteriophage specific for Staphylococcus aureus by a plaque assay.

도 2는 황색포도상구균을 특이적으로 사멸시킬 수 있는 박테리오파지의 분리 과정을 보여주는 모식도이다.Figure 2 is a schematic diagram showing the separation of bacteriophages that can specifically kill Staphylococcus aureus.

도 3은 용균반 분석에 의해 황색포도상구균에 특이적인 박테리오파지를 검출한 다음 이를 전자현미경으로 촬영한 사진이다.Figure 3 is a photograph taken by detecting the bacteriophage specific to Staphylococcus aureus by lytic plaque analysis.

도 4는 추출한 박테리오파지 유전체의 특성을 조사한 결과로서, 레인 g는 아무 처리도 하지 않은 유전체 그대로, 레인 D는 DNaseⅠ으로 처리한 유전체, 레인 R은 RNase A로 처리한 유전체, 레인 MB는 녹두 뉴클레아제로 처리한 유전체, 레인 M은 분자마커에 해당한다.4 is a result of examining the characteristics of the extracted bacteriophage genome, lane g is not treated as it is, lane D is treated with DNase I, lane R is treated with RNase A, lane MB is mung bean nuclease The treated dielectric, lane M, corresponds to the molecular marker.

도 5는 박테리오파지 유전체의 제한 효소에 의한 절단 양상을 보여주는 결과로서, 레인 M1은 분자마커, 레인 1은 SalⅠ에 의한 절단 양상, 레인 2는 NdeⅠ에 의한 절단 양상, 레인 3은 MboⅠ에 의한 절단 양상, 레인 4는 DraⅠ에 의한 절단 양상, 레인 5는 BamH I에 의한 절단 양상, 레인 6은 Acc I에 의한 절단 양상, 레인 7은 SAP-2 박테리오파지의 gDNA, 레인 M2는 분자마커이다.Figure 5 shows the cleavage pattern by restriction enzymes of the bacteriophage genome, lane M1 is the molecular marker, lane 1 is cleavage by Sal I, lane 2 is cleavage by Nde I, lane 3 is by Mbo I Cleavage aspect, lane 4 is cleavage by Dra I, lane 5 is cleavage by Bam H I, lane 6 is cleavage by Acc I, lane 7 is the gDNA of SAP-2 bacteriophage, lane M2 is the molecular marker.

도 6은 박테리오파지의 유전체 라이브러리의 구축을 위하여 사용한 방법을 순서대로 보여주는 모식도이다.Figure 6 is a schematic diagram showing in sequence the method used for the construction of the genome library of bacteriophage.

도 7은 발현된 항균 단백질을 단백질 전기영동으로 확인한 결과를 보여주는 사진으로서, 레인 M은 단백질 크기 마커(맨 위에서부터 198, 115, 90.5, 61.5, 46.2, 37.8, 26, 18.5, 및 9 kDa), 레인 1은 발현된 용균 단백질을 포함한 세포 파쇄물(cell lysate)을 보여준다. “*”표시는 과발현된 용균 단백질 위치를 가리킨다.Figure 7 is a photograph showing the result of confirming the expressed antibacterial protein by protein electrophoresis, lane M is a protein size marker (from the top 198, 115, 90.5, 61.5, 46.2, 37.8, 26, 18.5, and 9 kDa), Lane 1 shows the cell lysate containing the expressed lysate protein. “*” Indicates the location of the overexpressed lysate protein.

도 8은 임상 분리한 3 종의 황색포도상구균에 대한 용균 활성을 확인한 결과를 보여주는 사진으로서, 제시된 3 가지 실험에서 사용된 황색포도상구균은 각기 서로 다른 종이며, 투명한 용균반은 본 발명에서 분리한 용균 단백질의 용균 활성에 의해 생성된 것이다. Figure 8 is a photograph showing the results of confirming the lytic activity for three clinically isolated Staphylococcus aureus, Staphylococcus aureus used in the three experiments presented are different species, the transparent lytic plaque is isolated from the present invention It is produced by the lytic activity of lytic proteins.

도 9는 여러 종류의 황색포도상구균에 대한 용균 단백질의 용균 활성을 조사한 결과를 보여주는 것으로서, 소 유방염에서 분리된 5종 및 사람에게서 분리된 3종의 황색포도상구균에 대하여 용균 활성 조사를 실시한 결과이다. “Phage”라 표기된 것은 SAP-2 박테리오파지를 항균 물질로 사용한 경우이고 “Lysin”이라 표기된 것은 SAP-2 박테리오파지 유래의 항균 단백질을 항균 물질로 사용한 경우이다. Figure 9 shows the results of the lytic activity of the lytic protein against the various types of Staphylococcus aureus, the results of the lytic activity investigation for five species isolated from bovine mastitis and three species isolated from humans . The term “Phage” refers to the use of SAP-2 bacteriophage as an antimicrobial substance and the term “Lysin” refers to the use of antimicrobial proteins derived from SAP-2 bacteriophage as an antimicrobial substance.

도 10은 정제된 항균 단백질을 단백질 전기영동으로 확인한 결과를 보여주는 사진으로서, 레인 M은 단백질 크기 마커(맨 위에서부터 198, 115, 90.5, 61.5, 46.2, 37.8, 26, 18.5, 및 9 kDa)이고, 레인 1은 정제 전 시료이고, 레인 2는 정제 후 시료이다. 진하게 염색된 밴드가 과발현된 용균 단백질 위치를 가리킨다.Figure 10 is a photograph showing the results confirmed by protein electrophoresis of the purified antimicrobial protein, lane M is a protein size marker (198, 115, 90.5, 61.5, 46.2, 37.8, 26, 18.5, and 9 kDa from the top) , Lane 1 is a sample before purification, and lane 2 is a sample after purification. The deeply stained bands indicate the location of the lysed lytic protein.

<110> INTRON BIOTECHNOLOGY CO., LTD <120> Antimicrobial protein derived from podoviridae bacteriophage specific to staphylococcus aureus <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 17938 <212> DNA <213> Podoviridae bacteriophage <400> 1 taaatataat cggaaaaagt ttttgtaaat ttacacctcc ccaccgttta aaataaacga 60 ttatacaaat caaaacttat aaattaactt atcatttcta aactaaactt ataaaaaatg 120 ttcacctact ttcccaactt atctaaccta ttacatattc attaattaca aaatatatac 180 atctattgac ttttatccaa aattatgatt tgaaattaaa atctagtttc ttctattaaa 240 tagtagtttt aaattattta aactttttta cgatatttta ttgacaaaac atttaaacat 300 ttgctatact aagtatgtaa tcaaaacaag gaggtaacaa aaatgattaa tgttgataat 360 gcaccatcag aaaaaggtca agcatatact gaaatgttgc aattattcaa taaactgatt 420 caatggaatc cagcatatac gtttgataac gcaattaact tagtatctgc ttgtcaacaa 480 ctattattaa actataacag ttctgttgtt caattcttaa atgatgaact caacaacgaa 540 actaagccag aatctatttt agcttatatt gctggtgacg atgcaatcga acagtggaat 600 atgcacaaag gtttttatga aacgtataat gtttacgtat tttagaaagg aatgatataa 660 tgaaagctga tgacattata actttacgtg ttaaaggtta tatattccat tacttagatg 720 aatcaaatga atacattgaa gaatttatac cacttcacga gtatcattta actaaaacac 780 aagcaataga attattacct aacacatgta cactattatc aactacacgc aaaacgaaaa 840 aaatccaagt atattacaat gatttactac aaatttcaat taaagaggag aaataaaaaa 900 tgacaaacgt aaaagaaatt ttatcaagac accaaaatac aacagcgaga tttgaatttg 960 aggaaaaaga aagagaattt ataaaactat cagaattagt tgaaaaatac ggtattaaaa 1020 aagagtatat cgttagagca ttattcacaa acaaagaatc aaaattcggt gtacagggtg 1080 ttatcgtcac tgacgactat aatgtaaact taccgaacca cttaacagag ttaattaaag 1140 aaatgagatc agacgaggac gttgttaaca ttatcaatgc tggtgaagtg caatttacaa 1200 tttatgaata tgaaaacaaa aaaggtcaaa aaggttactc aatcaacttt ggtcaagtat 1260 cattttaata caatttcata ggggatattt atcccctatt ttatgaggtg ctaaacaatg 1320 gaaaaaatat acactgccgt attattatac aatgtatcaa ttaatgaaac atatgaacat 1380 gaaattgaac aattcgaaaa aataaataaa gttaaggtaa tatatagtta ttttgacgca 1440 aacttttaca aaaaaggtgc atataatttt ggtgtaaaat acattaagga gatataaaaa 1500 tgaatattac aacaacatta aacacaaaaa aattaattaa ttatatttta gataatagag 1560 attgttttat gaataaaata acaaaattta catcactaag tggaaaatgt gttgtttttg 1620 ttagatacgg tgaaatttct attgaatact atgatagtga tacaaaaaac aataatgatt 1680 tatttacttt agacattgac gttgatatta ataaacatgt ctttaattgt cttaaagttt 1740 attatataga acatacagaa gatataaaca taatatataa aaaaggtgta tacatggggt 1800 gtactattga tgatgtatta tcatattttg aaaaaccatt agaaagtgat attactatta 1860 tttaccaagg caaagttatt tatgaatacg ggaaagtaat agaccatgaa taacctacta 1920 gatattatta ttgttttcct tttagcattt ttaattacac ttgtaatact tatgacaatg 1980 tatatacgtg tgtcatttgg tgttttattt actacattta ttatattcta cattatcttt 2040 ttattggttg tatatgcttt atatggaggt tgataacatt ggtttagaca tacgtctgaa 2100 atggatagat ggaaaaaaga aagagaagct agaaaagaaa gagaagaaaa aaaatataaa 2160 aatgatttta gcggtatcaa ttttaaattt gacgataaag atttacaaga ggcttatatt 2220 gacgcatgga aacatttttc acatttacca catttaccaa aagaaaaaaa tgtatctcat 2280 gcaaacgctg tttcattagt tcgtggtaaa cgacataaaa aattaaatca tatactagaa 2340 atatataacc gtaatgataa taataacaaa aatgcaaaaa tgcataaata tgcattatat 2400 aatttacacg ccgaaaaaaa taaatcttca cttacaaaat atattaaaga aattgataac 2460 ttattttttg aaataggaaa atcagataga ccaaaaacaa caatagatga tatcaatgtt 2520 aggtataact ttttatatta tgcaacattt gaagaataac tttaatactg taaatgacat 2580 tataaactat tacaaggagc aaaaacatgg tgaaacaaaa tcgtttagac atggtaagag 2640 attatcaaaa tgcggtcaat catgtaagga aaaaaatacc agaaaactat aatcaaatag 2700 aattagttga tgaactcatg aatgatgata tagactatta tatatctatt tcaaaccgtt 2760 ctgacggaaa atcgttcaac tatgtttcat tttttattta tttagctatt aaacttgata 2820 taaaatttac tttattatca cgtcattata cattacgtga cgcttaccgt gattttattg 2880 aggaaatcat agataaaaac ccactattca aatctaagcg tgtcactttc agaagcgcta 2940 gagattattt agctattatc tatcaagata aagaaattgg cgtgattaca gatttgaata 3000 gcgctactga tttaaaatat cattctaact ttttaaaaca ctaccctatt attatatatg 3060 atgaattctt agcgcttgaa gatgactatt taattgatga gtgggacaag ttaaaaacaa 3120 tttatgaatc aatcgaccgt aaccatggta atgttgatta tattggtttt cctaaaatgt 3180 ttttactagg taatgctgtc aacttttcaa gtcctatatt atccaattta aatatttata 3240 atttattaca aaaacataaa atgaatacat caagacttta caaaaacatt tttttagaaa 3300 tgcgtcgaaa cgattacgtc aatgagaggc gtaatacacg tgcgtttaat tcaaatgatg 3360 acgctatgac aactggcgag tttgaattta acgaatataa tttggcagat gataatttaa 3420 gaaatcatat caaccaaaac ggtgattttt tctatattaa aactgacgat aaatatataa 3480 aaattatgta taatgttgat acatttaatg ctaacatcat tgtaatacct tatacaaaac 3540 aatatgagtt ttgcactaaa atcaaagata tcgatgacaa tgttatttat ctaagagaag 3600 atatgtttta taaagaaaac atggaacgat attactacaa tccaagtaat ttacattttg 3660 acaatgctta ttcaaaaaat tacgtggttg ataatgatag atatttatat ttagatatga 3720 ataaaattat aaaatttcat ataaaaaatg aaatgaagaa aaatattaac gaatttgaaa 3780 gaaaagaaaa gatatacgaa gataactata tagaaaatac aaagaagtat ttaatgaaac 3840 aatacggctt ataaaaggtg tgtaagatta tgggattact tgagtgtatg caatatcata 3900 aaaatcaacg taaaatgata ttgtactggg atattgaaac attatcgtac aataaaataa 3960 acggacgcaa taaaccaaca ttatataaaa acgtaacgta ttctgttgcg attggttggt 4020 ataatggtta cgaaattgat gttgaagtat tccccagttt tgaagccttt tatgatgatt 4080 ttttcaagta tgtttatcgc cgggatacaa tcacaaaatc aaaaacaaat attatcatga 4140 ttgcacataa ctgtaataaa tacgataatc attttttact taaagacacc atgcgttatt 4200 ttgataatat tacacgcgaa aatgtatatt taaaatctgc agaagaaaat gaacatacaa 4260 taaaaattca agaggctact attttagcca aaaatcaaaa tgtgatttta gaaaaacgtg 4320 ttaaatcttc aatcaattta gatttaacga tgtttttaaa tggttttaaa tttaatatca 4380 ttgataactt tatgaaaacc aatacatcaa tagcaacatt aggaaaaaag ctacttgacg 4440 ggggttattt aacagaaaac caacttaaaa cagattttaa ttatacaatt tttgataaag 4500 ataacgatat gtcagatagt gaagcttatg actatgctgt taagtgtttt gataatctta 4560 catctgaaca attaacctac attcataatg acgtgattat attaggtatg tgccatattc 4620 attatagtga catttttcca aattttgact ataacaaatt aacattctca ctaaatatca 4680 tggaatctta tttgaataat gaaatgactc gttttcagtt actcaatcaa tatcaagata 4740 ttaaaatatc ttatacacat tatcattttc atgatatgaa tttttatgac tatataaaat 4800 cattttatcg tggtggttta aatatgtata ataccaaata tatcaataaa cttattgatg 4860 aaccttgttt ttctatagac atcaattcga gttatcctta cgtgatgtat catgagaaaa 4920 ttccaacatg gttatacttt tatgagcatt actcaaaacc aacattaatc cctacttttt 4980 tagatgatga taattatttt tcattatata agattgataa agaggtattt aacgatgagg 5040 tattaattaa aatcaaatca cgcgtactac gtcagatgat tgttaaatac tacaataatg 5100 ataacgatta cgttaatatc aatacaaaca cattaagaat gatacaagac attacgggta 5160 ttgattgcac gcatatacgt gttaattcgt ttgttgtata tgaatgtgaa tactttcacg 5220 cacgagatat tatatttcaa aactatttta ttaaaacaca aggtaaatta aagaataaaa 5280 tcaatatgac aacaccttac gactatcaca ttacagatga aattaacgaa cacccctact 5340 caaatgaaga agttatgtta tcaaaagtcg ttttaaatgg tttatatggt atacctgctt 5400 tacgttcaca ctttaattta tttcgtttag atgaaaacaa cgaattgtat aacatcatta 5460 acggatacaa aaacacggaa cgtaatattt tattctctac atttgtcaca tcacgttcat 5520 tgtataactt attagtacct ttccaatact taacggaaag tgaaattgac gacaatttta 5580 tttattgcga cactgatagt ttgtatatga aatcagttgt aaagccctta ttgaacccca 5640 gtttattcga ccctatatca ttaggcaaat gggatattga aaacgaacag atagataaga 5700 tgtttgtact gaatcataaa aaatatgctt atgaagtgaa tggaaagatt aaaattgcgt 5760 ctgctggtat accgaaaaac gccaaaaata caagcgtcga ttttgaaacc tttgtacgtg 5820 aacaattttt tgacggtgca attatagaaa acaataaaag tatctataat aatcaaggta 5880 cgatatcaat ttatccgtca aaaacagaaa ttgtttgtgg taatgtatat gatgaatatt 5940 ttactgatga acttaattta aaacgtgaat ttatcttaaa agacgctaga gaaaattttg 6000 accatagtca atttgatgat attctttata ttgaaagtga tattggttca ttttcactca 6060 atgacttatt tccatttgaa cgttcagtac ataacaaatc tgatttgcat atattaaaac 6120 aacaacatga tgacatcaaa aaaggcaact gttaaaataa cagtcgcctt ttctttgaga 6180 taacatgaaa aatgtgtacg aaaattgatt atgttttgta ttttatttac tagcattact 6240 agcatgtgtt cattatagca taaatcttta tgcaatacca ctaaagaata caatattatc 6300 acctgcgttt tctggtacac cgttaatgag tgtatacaat aatacacgtg acggtgcaac 6360 gtatggtggt acattatagt ttgcgactaa gaatgaacca tcgtcaaaca cagcaacaac 6420 tacacccgtg tgaccgatac catatatgct tgcttgtaag tatggcggtt tactagagaa 6480 gccgtaacca acggtaggaa tatgtgttgt tttagcccct aattttttat aaacatacca 6540 cacacgttga ccgtttgtta cttgtccatc atcagttggt tgtctttttc catgtaattg 6600 tgacatatac gcccatgtta attctgtaca ctgaccagca ttaccagttt gagggaatat 6660 gttacccggt ttgtataaat attctttttt gaataaaggt acaccaattg cttttttata 6720 tttttctggt aattggtcat acgtccagtt accacctatc acacgaccac tttttccgtt 6780 tggtttcaca gatttacctc taatcgcatt atgctcacca tcgtcatcag tagggtttga 6840 acttccaccg tcatctattt gcacactatc aatgagcttt tttaatgagt cgagtagtcc 6900 aatcgtcatt ttaatatgat acgtgttgtt aaatgttttt tgtagtgtaa aataatcatt 6960 actaaaaaat ttatcactac caatactatg cacgtcccat tgtaatgcgt cttgaacttt 7020 ttttaataat tcttgcatgg cttgttttgc taaagcgagc agtgaactac cactgtcacc 7080 actactacca ctgtcagacg aatcactagg tgaaccacct ttaccgtcta atttaccacc 7140 ccatgctaaa atagtatttg caccgtctaa aaaaggatta ccatagtttt gtactttatt 7200 atatgacgct ttcaaaccta ggggataata tgccgcccaa gtagctgcag ccgttaatgg 7260 gatataagca cgtccaaccg taccagcttt catgttttta gcaaaatctg cattaccttt 7320 tctttgtacg ttttgaggta caaagtgaac gatgttacct gcgtcatacc aagacggttg 7380 tcctgcttgt tttgattgtg atacaagctt tctagctaca aatttagcgt ctgttaaata 7440 atcgccttgt gcagaagtat gatttaacca acctaaacct gcactgtatc cttcgttttt 7500 ttcatataca gcaattagcg taggtgaaac tcctatcgat ttaactgcat ttagaacttg 7560 tctgatttta ctttcattac cacctaacca aacattaaaa cgtccataac cttttacttt 7620 aggcactaac tggtctatcg ttaatccaaa gtcatcatta atataagaat gtgtaaattt 7680 atctatcttc tcttggtcgt tcatctttat cactcttttc agaatcgttt ttaattactc 7740 ttaatttatc tttaatttgt tctggcacta atacatccat ctctgcacaa ttttctacaa 7800 tagataaacc ctcattagca atataataga aaatcgtaat cataagtaga ccacctttta 7860 attgtaaaat ttggtcaatg atatttgcta gaataataat acagaatatg agtaattttt 7920 tagcgaaacc tctcattgat ttttttgacc atagattatt atttttaatg gcttttgaaa 7980 tacctgtaat aatatcaaca aacattaata taaataaaaa atatagtaat tttaaatctc 8040 ctgcatatat aaacatgtga aacacttctg tatctgtaaa cctgaatttt acttcattca 8100 tttttatacc ccctctctaa atttattatt taatggattt tgtaacatag ggttacctga 8160 accatcatta tgccaaaatc tcacaccaga ttccaaaata gcttttaatt gttccattaa 8220 catagggtca atgtcacgta ttgtatacgt acctgtacat tttaaatagt tgcatatagt 8280 catactgtta attggttcaa taaatgtatt atagtcattt acttcaaaac caaacaacat 8340 ataatatttt tgtaaaaatg taatttcttt aggtgacggt acactaattt tcattgttaa 8400 accgttaatg ctatttgcga tttggaaagc gttccccatt tctgactctg tcactgatgg 8460 tggttgtaag gctaaatctt tatattctgc ttgttgttgt ttgtagaaat tatattcttc 8520 attaaactta ccaaataaag cagttggact taaattactt gctacactta cagcgtcata 8580 aaaacgtgat tttgggtcac tgccatttaa tacattatct atacgacttg tgattaattg 8640 actttctgca ttacgctgtc tattggcttg ttgtgattgc cctaaaatac cgttattgat 8700 taaaattggt acttgtgcaa aactattaaa tgttatattt gtatttaaga atgaacctgt 8760 atcaattaat atatctttat tttttgcaag tatcggtcta tcattttcag cactgttata 8820 atctactgga taaactcgca cttcattatg ataaccaatg atggattttg tacgtaactt 8880 aacacctgtt ttttgtgaaa tcttaccagc gtctagtaac atagtattac cattccagtc 8940 ataaaaatca atcgtcatgt actcattacg tatcatatgg tcgcactcgt cttttttaga 9000 caacatcatc tcttgaagct ttgtgaaact taatgataaa tcgtttaaac tccattcttt 9060 tgattttcca ccttgtttta acgtctttaa tccagtaatt ttttcacttg tcttaacgtc 9120 ctctaaatct tttgtattaa tagaatcttt aggtaacatt tgaacctttt gaaagttttg 9180 tgtaatccat ggataggcac tcattttatc cataaagtta ataaagtcac catattccat 9240 aacgtataag ttgactggtg atgtgatatt gtcatatatt gtacctttag acgtatctaa 9300 gtttggctct tttttagtac caaatttctt tgataaatca gcacttgact ggaataacac 9360 taaattttcc aaaaactgtt gcatttggtt atacacatag tttttatttg atacttttaa 9420 cacatcatca ttgttacgta acattggtaa catatagtta tacgtgcgtt ttgataagtg 9480 ttgacgttca atattaacgt ttgagagttg ttctaataca ttaccttgtg tatacgtcat 9540 aatagtatca atcacaaaat atattttaac cacaacatca ttcacatatt cgatttgatt 9600 cacaaacgca taataacgtc tgtcctcaaa atctgataaa aacgtcatgt agttaatccc 9660 ttgtgcgtca tgccactgca tatcaacatt gatttccatt ctatcacgta taaaattata 9720 cggttgtttg gaatagtcta atgatttaaa atgacgtcca tttaaaaaat aatcatcacg 9780 ttcttgatta ctattaaaat gaatcgtatt ttgataatca gtaaacggtg tgttatagaa 9840 aaatttaaaa tttgttaatt ttctcatttt tacctccata aaaaatagtc gtataaatta 9900 tttatacgac tattataaca tttttattca atgatttgtg tatctattgc aaaactttta 9960 ttaccatttg aaagctcact atcactataa tttgatgtaa caaaatgtaa ttcattatta 10020 aagtttaaat ataatcttgt attaatcatt ttcgaatcaa tcgcacattg tgtgtagtga 10080 tgtgtagatt ttaagtttgc gttaatcgta cctaatttaa tatcaccgtt tttcttaatg 10140 ccttttaata ccccttttaa ttgtatggtt ttaacaccat taattgttaa aatacgatat 10200 tgcggtgcag gatatccaac gttgctatca cttgcaataa taccactttc taatgtaata 10260 tcttgccacc ctgtatcatt cacagttgtt ttattttcat taattgtatt taaaatttct 10320 attttatcat tagttattat agcagttaaa ttgttaatac tttgtgtatt attacctaca 10380 ctttcttttg tagctataat atcttgttta tttttttcaa tatcttcttc attttttgtg 10440 tttttatcat ctaatatatg aattgcagat tcatgattac ttagtttatt tgtatgttct 10500 gattgaacat ctgataaatt ttttattttt ttatcttgtt gcacattatc ttctttaata 10560 ttaataatgt ctgtagcgtt ttgagaaata ttatttttat ttgtagcgat atcattttta 10620 tttttattaa tgtcttttgt gttcgtatta attttactta ataattcatc tttaaaggtt 10680 aacttataat aatcctcatc acgtcttata taaatgttac cgtcctttgt agtaattaag 10740 tcatttgctt ctactaaatt atcatttaat ttatctacag agtcaatgtt gcgcaaactt 10800 ccttaaaatc caacaaccat tggttaaacc ttttatttta atgttttcca actaattcaa 10860 agaaaaattc tattttatca ttagttttta tagcagttaa attgttaata ctttgtgtat 10920 tattacctac actttctttt gtagctataa tatcttgttt atttttttca atatcttctt 10980 cattttttgt gtttttatca tctaatatat gaattgcaga ttcatgatta cttagtttat 11040 ttgtatgttc tgattgaaca tctgataaat tttttatttt tttatcttgt tgcacattat 11100 cttctttaat attaataatg tctgtagcgt tttgagaaat attattttta tttgtagcga 11160 tatcattttt atttttattt atgtcttttg tgttcgtatt aattttactt aataattcat 11220 ctttaaaggt taacttataa taatcctcat cacgtcttat ataaatgtta ccgtcctttg 11280 tagtaattaa gtcatttgct tctactaaat tatcatttaa tttatctaca gagtcaatgt 11340 tgcgcaaact tcttacaatt ctatcagcca ttgtttacac ctcttattta tatcgtttcc 11400 aactaaattc aaagaaaaat cctaaaatac ccattatgag aacacccccc aaggtacacc 11460 aatactatat gcattacctg tttttccgtt ccattgtcta actggtaaat aataacgagt 11520 tccttgccag ttataaccaa tccaaactaa cccatctgat aaacaaactt cgtcatatgg 11580 tgtatagccg tttggttgga accaatagcc attaggttca cttaatttag gactacagac 11640 acgtgcaaat attggtaaaa aaccacatgt aaatgttgcc ttttcgtttc tataatatgt 11700 gccgtattgg ttttgtttcc aattattagt tagttgaata ttttgttcta atactttact 11760 ttcactgttt gagaattttg ggcgaataaa atgtgtcaca ccgtcataat aatgtgttct 11820 aattgttgct ttttcccaac catcatatcc accattcaac cagttttgtt ctaaacatgt 11880 ataataatca agatttccac ttgttacaca ttggatatgt ccatattgag aatttgtgta 11940 tactgcaaca tcacctaatt gaggtttaaa gctcgatgta ttttcataca ccgttgctaa 12000 acctttaaag tcattattaa ttgcgtcttt agcattaccc cacatacgca ctttaccgtc 12060 agtaatataa tagatataag caacagctaa gtccatacat tgaaaaccat atgcaccatc 12120 aaagtcaaca ccaacacctt catgtttata tatccaatct ttagcttgtt gttgtgattt 12180 catttataac actcctattt tttatgtttt gctacccatt catattcacg atgttttgta 12240 tcagcgttca cattactgaa aaactcttta tattctgata tgttagcttc taatgtttgt 12300 ctcacttctc caactgcgtt accacttgac acacgtaacc atgcaccaac acgttttatt 12360 tcttccggtg cgtctttgaa taattccatt tggttgcctg taatataata ttctccgggt 12420 gttgtaacgt aagctatcca attattatat ttacttgctt ctaaatattc ttgatatggt 12480 gcgtctgttt tgattgttgt ccataaacca taatcccatt ttaacgtgaa tacatctagc 12540 gtcataccac gcataacttt taccatttta cgaccagttg aaaaacgtgt taattcttga 12600 acagtaccta atgtttgtgt tgtagggtat acattaatga aacaaccagc gtcaataatt 12660 tttttacttc catttgtagg catgttttta agcttttctg ccgtactacc gtcaatataa 12720 taaaatccag cttgcgttaa gtcatttaag tcgtcgatat ggtcaggtat agataatgca 12780 cgaccgtcat cttttgttaa tttataattt tgagaacctc ttgcacgtaa tgcttcaaaa 12840 tgttcatatt ctccaagttg gaagaaaccg tataagttat ggaatcgttt accaccaccg 12900 ccattagtca ttgcaagtaa taacgattta cgttttgttt ttgggtttgt ataaatacaa 12960 ataccctcag gctctttaaa attatcacgt gggaagttaa ttccgtcttg gtaagataac 13020 ttaaacgggt aatcgtataa cttttgacca gttgttaatg aatctttgcc aatttgcaca 13080 tgtgaattaa ctgaactgtt accacttaac cagtacaaat catcaccatc aacagcaata 13140 ccttgcatcc aacgtgcatc gttattttct gaattatcaa ttgtcatttc tttttctaca 13200 ttatcaatat gatttttaac atcagctctt gaacgtacct gtatcgtacc atcaccgaaa 13260 cgtaatacga gtttgtcatt tgcttcatca attaacggtg taaaagaatg tttgtttaaa 13320 agtgactgtg gtgtataatc tgttaaccct ttggcttctt ctaaatctaa tacatagtta 13380 tctttatatg ctacttgcaa cagttttgca acaccatcgt gatgtaacca tattttcatt 13440 tccccgtttg attgtctttc taatccgatt gttgtaccgt gaccaccttg tacaatacgc 13500 atactagaaa ttaaatcacc actaggcgtt aatttattaa tccaaaatcc ctcaggtgtt 13560 tgtgagtcgg attgtgttga gtacatttga ttcgtttctt tatcaatatt aatagattgg 13620 ttcacagcgt tacgaatacc cccaaagccc attacaaact taggttcaag ctcatttaat 13680 tcgaacccat taacaaaacg gttaatgtct ttaattaagt ctttaacttc tgctttaaaa 13740 tcattcattt gtttcatttc agcaacttta aataatgcaa atgcagatgt aagaccggca 13800 ctatatttag taaattcatc atgaataatg ttatctatcg taccatcatt taaccaacct 13860 ctaaataatt ctttagcttg gtctgggaat gctttcatta agtcgtccca atttttgaaa 13920 cgttttttta actcatcgtc atagtcccaa atacgatgtg ctaatacttc aatgagcttt 13980 gataatcttg aaatataatc ataatatgat tttgaattgg tattataatc tgctctatca 14040 tcgtaaaacg gtgtataacg ttctctcgtt ttatatattt cgtctaaaaa tggacgaatg 14100 tcgtcaaaat atttaaaatc gttttcatta tatgccataa ttttccacct ttaccaaatt 14160 tgtaaaaaac atttttttat caaattcatt taaaattttc tttcttaaat cgtatacttt 14220 atcaatatta tcaattaaat actgttttga aaattgtgtg cctttcgcat tacctttttg 14280 attttgatta cgttttacgt tttgattact ttcgttactt gatttattca cagttttacc 14340 gttatcaatc gtgttattgt ctgcaaattt taacgttgtt ttatctacat caatgttaac 14400 ctcgctttgt ggtaatgaca cataagcatt tctgttcgct gtcataccag ttgaattgtc 14460 taaagatgta gcattttgat ttgatgtttc atctgtgttg tttgttgtat cttcattatg 14520 ttctgtaaaa ccttgtgatt gtagatattt ttcaacttca cttgatgaat aaacaacatt 14580 caaataatcc tcatgtgtga tacatacagt aatcacttgc ataccaaatg cctcaactgt 14640 ttgtctgtta atctctctat ctaaaaaatg aatcgtaaat gattttttaa aaagtaagtc 14700 tgataaatct tctttcaatg aaaaaccttt aaatactttt tcattaacga tagctaaaac 14760 atctttatcg aatttcaaca ttttttgcat aaattgaaaa tcatcatcat aaaacgttaa 14820 tttattatca tttacaaatt cattgaaacc ttttttaata agctcagatt taataaaatc 14880 gtataaagtc attgtatatc tagccattta aatcactact ttcatctttt aaaagtgtgt 14940 caaccattga tattttagac gttgtttcat catcgtaata cggtttaata tctaaaccat 15000 agcgtttaga taaaaacgtg attggttcac gaccttttaa ataaatatta ctatttgatg 15060 ttgtaaaacc acgattactt ttagcttctt catctgatac accactttct ttatcaacag 15120 ctaaagagtt aatacctaaa tagttactta attcactaat cttattttga tactctcttt 15180 tcatctcagt taaagcagga atcacactat tacttgttaa atcaataatg tcatcttctg 15240 cattaaacat aggtgacatt ttaacaaatg gtgcaccgtt atatatttct gatacaagtt 15300 gattaattga ctcgtcatta atttctgatt taaatacctt gctaaatttc gcttgcataa 15360 tcaatgaaaa tcgagataaa acaacttcag ctaattcatc ggtatagtgt tcaatgattt 15420 caatatcact attatactgt ataggtttat tttgcataac aacaaagtta ccactcatac 15480 aattatcgta tagcttatga atttgtagac actcatcagg aattaaatag tcaggtacaa 15540 taaaataaat atcttctttt gttaatcgtt tttgaaattg gaaattaaag tttgatgaaa 15600 aatttggtgc ttgattaaaa taggtattat ttacataacc aagtatcata atttgtttat 15660 ttctagcttc accaaccact acattaatat tttgccttaa tgcagactct aactgtataa 15720 aatctatacc aaccgtatca cgattggtat agtttataag taggggtaaa aattccaaat 15780 aacgattaaa cataagacgt ttaaatctgt tgcgatgttc aacaactctt ttgttgattt 15840 cttttgataa ttcaacgttt aaacctcttt tatcgttgtt catatttacg ctccttttat 15900 tctgttgctt cttcctctag ttttggtgtt acatcttggt cagtaattaa tattttatta 15960 aagaatggac taatagcctt gaatgaataa taatgaatcc agtgtgtgac ctcatcaaat 16020 tcaccattat agaatggttg ttttaacata cctttggtat aacgtttgta tttaattgca 16080 ttaatatcta aaataaatgc gtataaatct gattttggtt taatttcttc aatgttacca 16140 gtaaactctt taagtttaga aacatcataa gtaaatactg caccaactgg aattgtgtca 16200 ccaatttgcg actgataatc accgtaagca cgtaagaaat caattgtctc ttgattttgt 16260 aatttaaatt cttttgttac tttaaacaca ccacctaaat catcaaaact tataacatgg 16320 tctgtaaaat caataccagc gatttggaat gtgttagcaa tttttgtatc taataggtaa 16380 gattttaaag aatctgttgt taaaataaca atatctttta acttagatac agttgtatat 16440 tgaccaattg caccaccaga agcacggtga acttcattgt atttagcgct gttgttttgt 16500 aagtttaaaa ttgcttcaaa tactttgctt gctaaatctt cttttgatgt tgttttacgt 16560 acgtttgact ctgataattg atttaatgag taatcaacta acattgctcg catttctttt 16620 tcttctaata cattaatatc agaaattttc tttttatata cacctaatgc gtaatttgtt 16680 gcgtctgcta atgtttggaa attgaaacgt gtatcattat tgtttaatgt gaatttttgt 16740 ttcttcacaa taccactacc atataactta gtagccatac gtggataatt acgtttcaac 16800 attaattcct cattttttga taaatccata ttaattggta ctgtatccat aatgacatat 16860 tcttcactat attgaccaat aaagtcttgt tctttagcta accaattaaa acggttacct 16920 aaagcaatat caattaataa tgtctcgtta atcttaggga ataaatattt atttacaaat 16980 gtttcaaaca ttgtattatt gttatcccat ttatcaccaa atgtccaaga ttttgaataa 17040 tcatggttaa aatcttgtaa tgccgacttt gcagattttg ctactaaaag agctgtttcg 17100 ttttttgtac ttgctggtgc cataatttat tattcctcct ctacgtctcc gctaaaagtt 17160 tgttttgaaa gtgaatggat ttgtacaccg tactcatctt cacttttgtt tacatctatt 17220 gacatatttt catttaattc agtacgttta tttaaacgtg aatcttcata tgatgtcccc 17280 atcatagaac gcatgttatt gccttcatac atattatttt cctcctaatc taaatctaac 17340 ttgtcaacta attcttcatc tgaatagtct ttatcttctt tgtcagcatt tgttacatct 17400 ggttgtgttt gttgtggttg ttgaatttgt gatgataaaa aagtagtcat ttgttgctct 17460 aatgatgtaa tacgttgttc taatataaca gggtcgaatt ttgaactatc ttcatctgtt 17520 atagtaggtt ctaatttatt cttattttct tcttcaattg tttctactgt tttatcttca 17580 gtaggttctt cagttggttc ttcagttggt tcttcagttg gttctttgtc gtctggtttt 17640 acgatttcct caaattctgt cattgtgaca cctccaaaat attttataac taattatatc 17700 atagaatatt taaataagta aattaaattt attaaaaagc gtgaacatag ttttcaataa 17760 aagtaaatag atgtatatat tttgtaatta atgaatatgt aataggttag ataagttgga 17820 aaagtaggtg aacatttttt ataagtttag tttagaaatg ataagttaat ttataagttt 17880 tgatttgtat aatcgtttat tttaaacggt ggggaggtgt aaatttacaa aaactttt 17938 <210> 2 <211> 750 <212> DNA <213> Antimicrobial gene <220> <221> gene <222> (1)..(750) <223> Antimicrobial Protein <400> 2 atgaaatcac aacaacaagc taaagattgg atatataaac atgaaggtgt tggtgttgac 60 tttgatggtg catatggttt tcaatgtatg gacttagctg ttgcttatat ctattatatt 120 actgacggta aagtgcgtat gtggggtaat gctaaagacg caattaataa tgactttaaa 180 ggtttagcaa cggtgtatga aaatacatcg agctttaaac ctcaattagg tgatgttgca 240 gtatacacaa attctcaata tggacatatc caatgtgtaa caagtggaaa tcttgattat 300 tatacatgtt tagaacaaaa ctggttgaat ggtggatatg atggttggga aaaagcaaca 360 attagaacac attattatga cggtgtgaca cattttattc gcccaaaatt ctcaaacagt 420 gaaagtaaag tattagaaca aaatattcaa ctaactaata attggaaaca aaaccaatac 480 ggcacatatt atagaaacga aaaggcaaca tttacatgtg gttttttacc aatatttgca 540 cgtgtctgta gtcctaaatt aagtgaacct aatggctatt ggttccaacc aaacggctat 600 acaccatatg acgaagtttg tttatcagat gggttagttt ggattggtta taactggcaa 660 ggaactcgtt attatttacc agttagacaa tggaacggaa aaacaggtaa tgcatatagt 720 attggtgtac cttggggggt gttctcataa 750 <210> 3 <211> 249 <212> PRT <213> Antimicrobial Protein <400> 3 Met Lys Ser Gln Gln Gln Ala Lys Asp Trp Ile Tyr Lys His Glu Gly 1 5 10 15 Val Gly Val Asp Phe Asp Gly Ala Tyr Gly Phe Gln Cys Met Asp Leu 20 25 30 Ala Val Ala Tyr Ile Tyr Tyr Ile Thr Asp Gly Lys Val Arg Met Trp 35 40 45 Gly Asn Ala Lys Asp Ala Ile Asn Asn Asp Phe Lys Gly Leu Ala Thr 50 55 60 Val Tyr Glu Asn Thr Ser Ser Phe Lys Pro Gln Leu Gly Asp Val Ala 65 70 75 80 Val Tyr Thr Asn Ser Gln Tyr Gly His Ile Gln Cys Val Thr Ser Gly 85 90 95 Asn Leu Asp Tyr Tyr Thr Cys Leu Glu Gln Asn Trp Leu Asn Gly Gly 100 105 110 Tyr Asp Gly Trp Glu Lys Ala Thr Ile Arg Thr His Tyr Tyr Asp Gly 115 120 125 Val Thr His Phe Ile Arg Pro Lys Phe Ser Asn Ser Glu Ser Lys Val 130 135 140 Leu Glu Gln Asn Ile Gln Leu Thr Asn Asn Trp Lys Gln Asn Gln Tyr 145 150 155 160 Gly Thr Tyr Tyr Arg Asn Glu Lys Ala Thr Phe Thr Cys Gly Phe Leu 165 170 175 Pro Ile Phe Ala Arg Val Cys Ser Pro Lys Leu Ser Glu Pro Asn Gly 180 185 190 Tyr Trp Phe Gln Pro Asn Gly Tyr Thr Pro Tyr Asp Glu Val Cys Leu 195 200 205 Ser Asp Gly Leu Val Trp Ile Gly Tyr Asn Trp Gln Gly Thr Arg Tyr 210 215 220 Tyr Leu Pro Val Arg Gln Trp Asn Gly Lys Thr Gly Asn Ala Tyr Ser 225 230 235 240 Ile Gly Val Pro Trp Gly Val Phe Ser 245 <110> INTRON BIOTECHNOLOGY CO., LTD <120> Antimicrobial protein derived from podoviridae bacteriophage specific to staphylococcus aureus <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 17938 <212> DNA <213> Podoviridae bacteriophage <400> 1 taaatataat cggaaaaagt ttttgtaaat ttacacctcc ccaccgttta aaataaacga 60 ttatacaaat caaaacttat aaattaactt atcatttcta aactaaactt ataaaaaatg 120 ttcacctact ttcccaactt atctaaccta ttacatattc attaattaca aaatatatac 180 atctattgac ttttatccaa aattatgatt tgaaattaaa atctagtttc ttctattaaa 240 tagtagtttt aaattattta aactttttta cgatatttta ttgacaaaac atttaaacat 300 ttgctatact aagtatgtaa tcaaaacaag gaggtaacaa aaatgattaa tgttgataat 360 gcaccatcag aaaaaggtca agcatatact gaaatgttgc aattattcaa taaactgatt 420 caatggaatc cagcatatac gtttgataac gcaattaact tagtatctgc ttgtcaacaa 480 ctattattaa actataacag ttctgttgtt caattcttaa atgatgaact caacaacgaa 540 actaagccag aatctatttt agcttatatt gctggtgacg atgcaatcga acagtggaat 600 atgcacaaag gtttttatga aacgtataat gtttacgtat tttagaaagg aatgatataa 660 tgaaagctga tgacattata actttacgtg ttaaaggtta tatattccat tacttagatg 720 aatcaaatga atacattgaa gaatttatac cacttcacga gtatcattta actaaaacac 780 aagcaataga attattacct aacacatgta cactattatc aactacacgc aaaacgaaaa 840 aaatccaagt atattacaat gatttactac aaatttcaat taaagaggag aaataaaaaa 900 tgacaaacgt aaaagaaatt ttatcaagac accaaaatac aacagcgaga tttgaatttg 960 aggaaaaaga aagagaattt ataaaactat cagaattagt tgaaaaatac ggtattaaaa 1020 aagagtatat cgttagagca ttattcacaa acaaagaatc aaaattcggt gtacagggtg 1080 ttatcgtcac tgacgactat aatgtaaact taccgaacca cttaacagag ttaattaaag 1140 aaatgagatc agacgaggac gttgttaaca ttatcaatgc tggtgaagtg caatttacaa 1200 tttatgaata tgaaaacaaa aaaggtcaaa aaggttactc aatcaacttt ggtcaagtat 1260 cattttaata caatttcata ggggatattt atcccctatt ttatgaggtg ctaaacaatg 1320 gaaaaaatat acactgccgt attattatac aatgtatcaa ttaatgaaac atatgaacat 1380 gaaattgaac aattcgaaaa aataaataaa gttaaggtaa tatatagtta ttttgacgca 1440 aacttttaca aaaaaggtgc atataatttt ggtgtaaaat acattaagga gatataaaaa 1500 tgaatattac aacaacatta aacacaaaaa aattaattaa ttatatttta gataatagag 1560 attgttttat gaataaaata acaaaattta catcactaag tggaaaatgt gttgtttttg 1620 ttagatacgg tgaaatttct attgaatact atgatagtga tacaaaaaac aataatgatt 1680 tatttacttt agacattgac gttgatatta ataaacatgt ctttaattgt cttaaagttt 1740 attatataga acatacagaa gatataaaca taatatataa aaaaggtgta tacatggggt 1800 gtactattga tgatgtatta tcatattttg aaaaaccatt agaaagtgat attactatta 1860 tttaccaagg caaagttatt tatgaatacg ggaaagtaat agaccatgaa taacctacta 1920 gatattatta ttgttttcct tttagcattt ttaattacac ttgtaatact tatgacaatg 1980 tatatacgtg tgtcatttgg tgttttattt actacattta ttatattcta cattatcttt 2040 ttattggttg tatatgcttt atatggaggt tgataacatt ggtttagaca tacgtctgaa 2100 atggatagat ggaaaaaaga aagagaagct agaaaagaaa gagaagaaaa aaaatataaa 2160 aatgatttta gcggtatcaa ttttaaattt gacgataaag atttacaaga ggcttatatt 2220 gacgcatgga aacatttttc acatttacca catttaccaa aagaaaaaaa tgtatctcat 2280 gcaaacgctg tttcattagt tcgtggtaaa cgacataaaa aattaaatca tatactagaa 2340 atatataacc gtaatgataa taataacaaa aatgcaaaaa tgcataaata tgcattatat 2400 aatttacacg ccgaaaaaaa taaatcttca cttacaaaat atattaaaga aattgataac 2460 ttattttttg aaataggaaa atcagataga ccaaaaacaa caatagatga tatcaatgtt 2520 aggtataact ttttatatta tgcaacattt gaagaataac tttaatactg taaatgacat 2580 tataaactat tacaaggagc aaaaacatgg tgaaacaaaa tcgtttagac atggtaagag 2640 attatcaaaa tgcggtcaat catgtaagga aaaaaatacc agaaaactat aatcaaatag 2700 aattagttga tgaactcatg aatgatgata tagactatta tatatctatt tcaaaccgtt 2760 ctgacggaaa atcgttcaac tatgtttcat tttttattta tttagctatt aaacttgata 2820 taaaatttac tttattatca cgtcattata cattacgtga cgcttaccgt gattttattg 2880 aggaaatcat agataaaaac ccactattca aatctaagcg tgtcactttc agaagcgcta 2940 gagattattt agctattatc tatcaagata aagaaattgg cgtgattaca gatttgaata 3000 gcgctactga tttaaaatat cattctaact ttttaaaaca ctaccctatt attatatatg 3060 atgaattctt agcgcttgaa gatgactatt taattgatga gtgggacaag ttaaaaacaa 3120 tttatgaatc aatcgaccgt aaccatggta atgttgatta tattggtttt cctaaaatgt 3180 ttttactagg taatgctgtc aacttttcaa gtcctatatt atccaattta aatatttata 3240 atttattaca aaaacataaa atgaatacat caagacttta caaaaacatt tttttagaaa 3300 tgcgtcgaaa cgattacgtc aatgagaggc gtaatacacg tgcgtttaat tcaaatgatg 3360 acgctatgac aactggcgag tttgaattta acgaatataa tttggcagat gataatttaa 3420 gaaatcatat caaccaaaac ggtgattttt tctatattaa aactgacgat aaatatataa 3480 aaattatgta taatgttgat acatttaatg ctaacatcat tgtaatacct tatacaaaac 3540 aatatgagtt ttgcactaaa atcaaagata tcgatgacaa tgttatttat ctaagagaag 3600 atatgtttta taaagaaaac atggaacgat attactacaa tccaagtaat ttacattttg 3660 acaatgctta ttcaaaaaat tacgtggttg ataatgatag atatttatat ttagatatga 3720 ataaaattat aaaatttcat ataaaaaatg aaatgaagaa aaatattaac gaatttgaaa 3780 gaaaagaaaa gatatacgaa gataactata tagaaaatac aaagaagtat ttaatgaaac 3840 aatacggctt ataaaaggtg tgtaagatta tgggattact tgagtgtatg caatatcata 3900 aaaatcaacg taaaatgata ttgtactggg atattgaaac attatcgtac aataaaataa 3960 acggacgcaa taaaccaaca ttatataaaa acgtaacgta ttctgttgcg attggttggt 4020 ataatggtta cgaaattgat gttgaagtat tccccagttt tgaagccttt tatgatgatt 4080 ttttcaagta tgtttatcgc cgggatacaa tcacaaaatc aaaaacaaat attatcatga 4140 ttgcacataa ctgtaataaa tacgataatc attttttact taaagacacc atgcgttatt 4200 ttgataatat tacacgcgaa aatgtatatt taaaatctgc agaagaaaat gaacatacaa 4260 taaaaattca agaggctact attttagcca aaaatcaaaa tgtgatttta gaaaaacgtg 4320 ttaaatcttc aatcaattta gatttaacga tgtttttaaa tggttttaaa tttaatatca 4380 ttgataactt tatgaaaacc aatacatcaa tagcaacatt aggaaaaaag ctacttgacg 4440 ggggttattt aacagaaaac caacttaaaa cagattttaa ttatacaatt tttgataaag 4500 ataacgatat gtcagatagt gaagcttatg actatgctgt taagtgtttt gataatctta 4560 catctgaaca attaacctac attcataatg acgtgattat attaggtatg tgccatattc 4620 attatagtga catttttcca aattttgact ataacaaatt aacattctca ctaaatatca 4680 tggaatctta tttgaataat gaaatgactc gttttcagtt actcaatcaa tatcaagata 4740 ttaaaatatc ttatacacat tatcattttc atgatatgaa tttttatgac tatataaaat 4800 cattttatcg tggtggttta aatatgtata ataccaaata tatcaataaa cttattgatg 4860 aaccttgttt ttctatagac atcaattcga gttatcctta cgtgatgtat catgagaaaa 4920 ttccaacatg gttatacttt tatgagcatt actcaaaacc aacattaatc cctacttttt 4980 tagatgatga taattatttt tcattatata agattgataa agaggtattt aacgatgagg 5040 tattaattaa aatcaaatca cgcgtactac gtcagatgat tgttaaatac tacaataatg 5100 ataacgatta cgttaatatc aatacaaaca cattaagaat gatacaagac attacgggta 5160 ttgattgcac gcatatacgt gttaattcgt ttgttgtata tgaatgtgaa tactttcacg 5220 cacgagatat tatatttcaa aactatttta ttaaaacaca aggtaaatta aagaataaaa 5280 tcaatatgac aacaccttac gactatcaca ttacagatga aattaacgaa cacccctact 5340 caaatgaaga agttatgtta tcaaaagtcg ttttaaatgg tttatatggt atacctgctt 5400 tacgttcaca ctttaattta tttcgtttag atgaaaacaa cgaattgtat aacatcatta 5460 acggatacaa aaacacggaa cgtaatattt tattctctac atttgtcaca tcacgttcat 5520 tgtataactt attagtacct ttccaatact taacggaaag tgaaattgac gacaatttta 5580 tttattgcga cactgatagt ttgtatatga aatcagttgt aaagccctta ttgaacccca 5640 gtttattcga ccctatatca ttaggcaaat gggatattga aaacgaacag atagataaga 5700 tgtttgtact gaatcataaa aaatatgctt atgaagtgaa tggaaagatt aaaattgcgt 5760 ctgctggtat accgaaaaac gccaaaaata caagcgtcga ttttgaaacc tttgtacgtg 5820 aacaattttt tgacggtgca attatagaaa acaataaaag tatctataat aatcaaggta 5880 cgatatcaat ttatccgtca aaaacagaaa ttgtttgtgg taatgtatat gatgaatatt 5940 ttactgatga acttaattta aaacgtgaat ttatcttaaa agacgctaga gaaaattttg 6000 accatagtca atttgatgat attctttata ttgaaagtga tattggttca ttttcactca 6060 atgacttatt tccatttgaa cgttcagtac ataacaaatc tgatttgcat atattaaaac 6120 aacaacatga tgacatcaaa aaaggcaact gttaaaataa cagtcgcctt ttctttgaga 6180 taacatgaaa aatgtgtacg aaaattgatt atgttttgta ttttatttac tagcattact 6240 agcatgtgtt cattatagca taaatcttta tgcaatacca ctaaagaata caatattatc 6300 acctgcgttt tctggtacac cgttaatgag tgtatacaat aatacacgtg acggtgcaac 6360 gtatggtggt acattatagt ttgcgactaa gaatgaacca tcgtcaaaca cagcaacaac 6420 tacacccgtg tgaccgatac catatatgct tgcttgtaag tatggcggtt tactagagaa 6480 gccgtaacca acggtaggaa tatgtgttgt tttagcccct aattttttat aaacatacca 6540 cacacgttga ccgtttgtta cttgtccatc atcagttggt tgtctttttc catgtaattg 6600 tgacatatac gcccatgtta attctgtaca ctgaccagca ttaccagttt gagggaatat 6660 gttacccggt ttgtataaat attctttttt gaataaaggt acaccaattg cttttttata 6720 tttttctggt aattggtcat acgtccagtt accacctatc acacgaccac tttttccgtt 6780 tggtttcaca gatttacctc taatcgcatt atgctcacca tcgtcatcag tagggtttga 6840 acttccaccg tcatctattt gcacactatc aatgagcttt tttaatgagt cgagtagtcc 6900 aatcgtcatt ttaatatgat acgtgttgtt aaatgttttt tgtagtgtaa aataatcatt 6960 actaaaaaat ttatcactac caatactatg cacgtcccat tgtaatgcgt cttgaacttt 7020 ttttaataat tcttgcatgg cttgttttgc taaagcgagc agtgaactac cactgtcacc 7080 actactacca ctgtcagacg aatcactagg tgaaccacct ttaccgtcta atttaccacc 7140 ccatgctaaa atagtatttg caccgtctaa aaaaggatta ccatagtttt gtactttatt 7200 atatgacgct ttcaaaccta ggggataata tgccgcccaa gtagctgcag ccgttaatgg 7260 gatataagca cgtccaaccg taccagcttt catgttttta gcaaaatctg cattaccttt 7320 tctttgtacg ttttgaggta caaagtgaac gatgttacct gcgtcatacc aagacggttg 7380 tcctgcttgt tttgattgtg atacaagctt tctagctaca aatttagcgt ctgttaaata 7440 atcgccttgt gcagaagtat gatttaacca acctaaacct gcactgtatc cttcgttttt 7500 ttcatataca gcaattagcg taggtgaaac tcctatcgat ttaactgcat ttagaacttg 7560 tctgatttta ctttcattac cacctaacca aacattaaaa cgtccataac cttttacttt 7620 aggcactaac tggtctatcg ttaatccaaa gtcatcatta atataagaat gtgtaaattt 7680 atctatcttc tcttggtcgt tcatctttat cactcttttc agaatcgttt ttaattactc 7740 ttaatttatc tttaatttgt tctggcacta atacatccat ctctgcacaa ttttctacaa 7800 tagataaacc ctcattagca atataataga aaatcgtaat cataagtaga ccacctttta 7860 attgtaaaat ttggtcaatg atatttgcta gaataataat acagaatatg agtaattttt 7920 tagcgaaacc tctcattgat ttttttgacc atagattatt atttttaatg gcttttgaaa 7980 tacctgtaat aatatcaaca aacattaata taaataaaaa atatagtaat tttaaatctc 8040 ctgcatatat aaacatgtga aacacttctg tatctgtaaa cctgaatttt acttcattca 8100 tttttatacc ccctctctaa atttattatt taatggattt tgtaacatag ggttacctga 8160 accatcatta tgccaaaatc tcacaccaga ttccaaaata gcttttaatt gttccattaa 8220 catagggtca atgtcacgta ttgtatacgt acctgtacat tttaaatagt tgcatatagt 8280 catactgtta attggttcaa taaatgtatt atagtcattt acttcaaaac caaacaacat 8340 ataatatttt tgtaaaaatg taatttcttt aggtgacggt acactaattt tcattgttaa 8400 accgttaatg ctatttgcga tttggaaagc gttccccatt tctgactctg tcactgatgg 8460 tggttgtaag gctaaatctt tatattctgc ttgttgttgt ttgtagaaat tatattcttc 8520 attaaactta ccaaataaag cagttggact taaattactt gctacactta cagcgtcata 8580 aaaacgtgat tttgggtcac tgccatttaa tacattatct atacgacttg tgattaattg 8640 actttctgca ttacgctgtc tattggcttg ttgtgattgc cctaaaatac cgttattgat 8700 taaaattggt acttgtgcaa aactattaaa tgttatattt gtatttaaga atgaacctgt 8760 atcaattaat atatctttat tttttgcaag tatcggtcta tcattttcag cactgttata 8820 atctactgga taaactcgca cttcattatg ataaccaatg atggattttg tacgtaactt 8880 aacacctgtt ttttgtgaaa tcttaccagc gtctagtaac atagtattac cattccagtc 8940 ataaaaatca atcgtcatgt actcattacg tatcatatgg tcgcactcgt cttttttaga 9000 caacatcatc tcttgaagct ttgtgaaact taatgataaa tcgtttaaac tccattcttt 9060 tgattttcca ccttgtttta acgtctttaa tccagtaatt ttttcacttg tcttaacgtc 9120 ctctaaatct tttgtattaa tagaatcttt aggtaacatt tgaacctttt gaaagttttg 9180 tgtaatccat ggataggcac tcattttatc cataaagtta ataaagtcac catattccat 9240 aacgtataag ttgactggtg atgtgatatt gtcatatatt gtacctttag acgtatctaa 9300 gtttggctct tttttagtac caaatttctt tgataaatca gcacttgact ggaataacac 9360 taaattttcc aaaaactgtt gcatttggtt atacacatag tttttatttg atacttttaa 9420 cacatcatca ttgttacgta acattggtaa catatagtta tacgtgcgtt ttgataagtg 9480 ttgacgttca atattaacgt ttgagagttg ttctaataca ttaccttgtg tatacgtcat 9540 aatagtatca atcacaaaat atattttaac cacaacatca ttcacatatt cgatttgatt 9600 cacaaacgca taataacgtc tgtcctcaaa atctgataaa aacgtcatgt agttaatccc 9660 ttgtgcgtca tgccactgca tatcaacatt gatttccatt ctatcacgta taaaattata 9720 cggttgtttg gaatagtcta atgatttaaa atgacgtcca tttaaaaaat aatcatcacg 9780 ttcttgatta ctattaaaat gaatcgtatt ttgataatca gtaaacggtg tgttatagaa 9840 aaatttaaaa tttgttaatt ttctcatttt tacctccata aaaaatagtc gtataaatta 9900 tttatacgac tattataaca tttttattca atgatttgtg tatctattgc aaaactttta 9960 ttaccatttg aaagctcact atcactataa tttgatgtaa caaaatgtaa ttcattatta 10020 aagtttaaat ataatcttgt attaatcatt ttcgaatcaa tcgcacattg tgtgtagtga 10080 tgtgtagatt ttaagtttgc gttaatcgta cctaatttaa tatcaccgtt tttcttaatg 10140 ccttttaata ccccttttaa ttgtatggtt ttaacaccat taattgttaa aatacgatat 10200 tgcggtgcag gatatccaac gttgctatca cttgcaataa taccactttc taatgtaata 10260 tcttgccacc ctgtatcatt cacagttgtt ttattttcat taattgtatt taaaatttct 10320 attttatcat tagttattat agcagttaaa ttgttaatac tttgtgtatt attacctaca 10380 ctttcttttg tagctataat atcttgttta tttttttcaa tatcttcttc attttttgtg 10440 tttttatcat ctaatatatg aattgcagat tcatgattac ttagtttatt tgtatgttct 10500 gattgaacat ctgataaatt ttttattttt ttatcttgtt gcacattatc ttctttaata 10560 ttaataatgt ctgtagcgtt ttgagaaata ttatttttat ttgtagcgat atcattttta 10620 tttttattaa tgtcttttgt gttcgtatta attttactta ataattcatc tttaaaggtt 10680 aacttataat aatcctcatc acgtcttata taaatgttac cgtcctttgt agtaattaag 10740 tcatttgctt ctactaaatt atcatttaat ttatctacag agtcaatgtt gcgcaaactt 10800 ccttaaaatc caacaaccat tggttaaacc ttttatttta atgttttcca actaattcaa 10860 agaaaaattc tattttatca ttagttttta tagcagttaa attgttaata ctttgtgtat 10920 tattacctac actttctttt gtagctataa tatcttgttt atttttttca atatcttctt 10980 cattttttgt gtttttatca tctaatatat gaattgcaga ttcatgatta cttagtttat 11040 ttgtatgttc tgattgaaca tctgataaat tttttatttt tttatcttgt tgcacattat 11100 cttctttaat attaataatg tctgtagcgt tttgagaaat attattttta tttgtagcga 11160 tatcattttt atttttattt atgtcttttg tgttcgtatt aattttactt aataattcat 11220 ctttaaaggt taacttataa taatcctcat cacgtcttat ataaatgtta ccgtcctttg 11280 tagtaattaa gtcatttgct tctactaaat tatcatttaa tttatctaca gagtcaatgt 11340 tgcgcaaact tcttacaatt ctatcagcca ttgtttacac ctcttattta tatcgtttcc 11400 aactaaattc aaagaaaaat cctaaaatac ccattatgag aacacccccc aaggtacacc 11460 aatactatat gcattacctg tttttccgtt ccattgtcta actggtaaat aataacgagt 11520 tccttgccag ttataaccaa tccaaactaa cccatctgat aaacaaactt cgtcatatgg 11580 tgtatagccg tttggttgga accaatagcc attaggttca cttaatttag gactacagac 11640 acgtgcaaat attggtaaaa aaccacatgt aaatgttgcc ttttcgtttc tataatatgt 11700 gccgtattgg ttttgtttcc aattattagt tagttgaata ttttgttcta atactttact 11760 ttcactgttt gagaattttg ggcgaataaa atgtgtcaca ccgtcataat aatgtgttct 11820 aattgttgct ttttcccaac catcatatcc accattcaac cagttttgtt ctaaacatgt 11880 ataataatca agatttccac ttgttacaca ttggatatgt ccatattgag aatttgtgta 11940 tactgcaaca tcacctaatt gaggtttaaa gctcgatgta ttttcataca ccgttgctaa 12000 acctttaaag tcattattaa ttgcgtcttt agcattaccc cacatacgca ctttaccgtc 12060 agtaatataa tagatataag caacagctaa gtccatacat tgaaaaccat atgcaccatc 12120 aaagtcaaca ccaacacctt catgtttata tatccaatct ttagcttgtt gttgtgattt 12180 catttataac actcctattt tttatgtttt gctacccatt catattcacg atgttttgta 12240 tcagcgttca cattactgaa aaactcttta tattctgata tgttagcttc taatgtttgt 12300 ctcacttctc caactgcgtt accacttgac acacgtaacc atgcaccaac acgttttatt 12360 tcttccggtg cgtctttgaa taattccatt tggttgcctg taatataata ttctccgggt 12420 gttgtaacgt aagctatcca attattatat ttacttgctt ctaaatattc ttgatatggt 12480 gcgtctgttt tgattgttgt ccataaacca taatcccatt ttaacgtgaa tacatctagc 12540 gtcataccac gcataacttt taccatttta cgaccagttg aaaaacgtgt taattcttga 12600 acagtaccta atgtttgtgt tgtagggtat acattaatga aacaaccagc gtcaataatt 12660 tttttacttc catttgtagg catgttttta agcttttctg ccgtactacc gtcaatataa 12720 taaaatccag cttgcgttaa gtcatttaag tcgtcgatat ggtcaggtat agataatgca 12780 cgaccgtcat cttttgttaa tttataattt tgagaacctc ttgcacgtaa tgcttcaaaa 12840 tgttcatatt ctccaagttg gaagaaaccg tataagttat ggaatcgttt accaccaccg 12900 ccattagtca ttgcaagtaa taacgattta cgttttgttt ttgggtttgt ataaatacaa 12960 ataccctcag gctctttaaa attatcacgt gggaagttaa ttccgtcttg gtaagataac 13020 ttaaacgggt aatcgtataa cttttgacca gttgttaatg aatctttgcc aatttgcaca 13080 tgtgaattaa ctgaactgtt accacttaac cagtacaaat catcaccatc aacagcaata 13140 ccttgcatcc aacgtgcatc gttattttct gaattatcaa ttgtcatttc tttttctaca 13200 ttatcaatat gatttttaac atcagctctt gaacgtacct gtatcgtacc atcaccgaaa 13260 cgtaatacga gtttgtcatt tgcttcatca attaacggtg taaaagaatg tttgtttaaa 13320 agtgactgtg gtgtataatc tgttaaccct ttggcttctt ctaaatctaa tacatagtta 13380 tctttatatg ctacttgcaa cagttttgca acaccatcgt gatgtaacca tattttcatt 13440 tccccgtttg attgtctttc taatccgatt gttgtaccgt gaccaccttg tacaatacgc 13500 atactagaaa ttaaatcacc actaggcgtt aatttattaa tccaaaatcc ctcaggtgtt 13560 tgtgagtcgg attgtgttga gtacatttga ttcgtttctt tatcaatatt aatagattgg 13620 ttcacagcgt tacgaatacc cccaaagccc attacaaact taggttcaag ctcatttaat 13680 tcgaacccat taacaaaacg gttaatgtct ttaattaagt ctttaacttc tgctttaaaa 13740 tcattcattt gtttcatttc agcaacttta aataatgcaa atgcagatgt aagaccggca 13800 ctatatttag taaattcatc atgaataatg ttatctatcg taccatcatt taaccaacct 13860 ctaaataatt ctttagcttg gtctgggaat gctttcatta agtcgtccca atttttgaaa 13920 cgttttttta actcatcgtc atagtcccaa atacgatgtg ctaatacttc aatgagcttt 13980 gataatcttg aaatataatc ataatatgat tttgaattgg tattataatc tgctctatca 14040 tcgtaaaacg gtgtataacg ttctctcgtt ttatatattt cgtctaaaaa tggacgaatg 14100 tcgtcaaaat atttaaaatc gttttcatta tatgccataa ttttccacct ttaccaaatt 14160 tgtaaaaaac atttttttat caaattcatt taaaattttc tttcttaaat cgtatacttt 14220 atcaatatta tcaattaaat actgttttga aaattgtgtg cctttcgcat tacctttttg 14280 attttgatta cgttttacgt tttgattact ttcgttactt gatttattca cagttttacc 14340 gttatcaatc gtgttattgt ctgcaaattt taacgttgtt ttatctacat caatgttaac 14400 ctcgctttgt ggtaatgaca cataagcatt tctgttcgct gtcataccag ttgaattgtc 14460 taaagatgta gcattttgat ttgatgtttc atctgtgttg tttgttgtat cttcattatg 14520 ttctgtaaaa ccttgtgatt gtagatattt ttcaacttca cttgatgaat aaacaacatt 14580 caaataatcc tcatgtgtga tacatacagt aatcacttgc ataccaaatg cctcaactgt 14640 ttgtctgtta atctctctat ctaaaaaatg aatcgtaaat gattttttaa aaagtaagtc 14700 tgataaatct tctttcaatg aaaaaccttt aaatactttt tcattaacga tagctaaaac 14760 atctttatcg aatttcaaca ttttttgcat aaattgaaaa tcatcatcat aaaacgttaa 14820 tttattatca tttacaaatt cattgaaacc ttttttaata agctcagatt taataaaatc 14880 gtataaagtc attgtatatc tagccattta aatcactact ttcatctttt aaaagtgtgt 14940 caaccattga tattttagac gttgtttcat catcgtaata cggtttaata tctaaaccat 15000 agcgtttaga taaaaacgtg attggttcac gaccttttaa ataaatatta ctatttgatg 15060 ttgtaaaacc acgattactt ttagcttctt catctgatac accactttct ttatcaacag 15120 ctaaagagtt aatacctaaa tagttactta attcactaat cttattttga tactctcttt 15180 tcatctcagt taaagcagga atcacactat tacttgttaa atcaataatg tcatcttctg 15240 cattaaacat aggtgacatt ttaacaaatg gtgcaccgtt atatatttct gatacaagtt 15300 gattaattga ctcgtcatta atttctgatt taaatacctt gctaaatttc gcttgcataa 15360 tcaatgaaaa tcgagataaa acaacttcag ctaattcatc ggtatagtgt tcaatgattt 15420 caatatcact attatactgt ataggtttat tttgcataac aacaaagtta ccactcatac 15480 aattatcgta tagcttatga atttgtagac actcatcagg aattaaatag tcaggtacaa 15540 taaaataaat atcttctttt gttaatcgtt tttgaaattg gaaattaaag tttgatgaaa 15600 aatttggtgc ttgattaaaa taggtattat ttacataacc aagtatcata atttgtttat 15660 ttctagcttc accaaccact acattaatat tttgccttaa tgcagactct aactgtataa 15720 aatctatacc aaccgtatca cgattggtat agtttataag taggggtaaa aattccaaat 15780 aacgattaaa cataagacgt ttaaatctgt tgcgatgttc aacaactctt ttgttgattt 15840 cttttgataa ttcaacgttt aaacctcttt tatcgttgtt catatttacg ctccttttat 15900 tctgttgctt cttcctctag ttttggtgtt acatcttggt cagtaattaa tattttatta 15960 aagaatggac taatagcctt gaatgaataa taatgaatcc agtgtgtgac ctcatcaaat 16020 tcaccattat agaatggttg ttttaacata cctttggtat aacgtttgta tttaattgca 16080 ttaatatcta aaataaatgc gtataaatct gattttggtt taatttcttc aatgttacca 16140 gtaaactctt taagtttaga aacatcataa gtaaatactg caccaactgg aattgtgtca 16200 ccaatttgcg actgataatc accgtaagca cgtaagaaat caattgtctc ttgattttgt 16260 aatttaaatt cttttgttac tttaaacaca ccacctaaat catcaaaact tataacatgg 16320 tctgtaaaat caataccagc gatttggaat gtgttagcaa tttttgtatc taataggtaa 16380 gattttaaag aatctgttgt taaaataaca atatctttta acttagatac agttgtatat 16440 tgaccaattg caccaccaga agcacggtga acttcattgt atttagcgct gttgttttgt 16500 aagtttaaaa ttgcttcaaa tactttgctt gctaaatctt cttttgatgt tgttttacgt 16560 acgtttgact ctgataattg atttaatgag taatcaacta acattgctcg catttctttt 16620 tcttctaata cattaatatc agaaattttc tttttatata cacctaatgc gtaatttgtt 16680 gcgtctgcta atgtttggaa attgaaacgt gtatcattat tgtttaatgt gaatttttgt 16740 ttcttcacaa taccactacc atataactta gtagccatac gtggataatt acgtttcaac 16800 attaattcct cattttttga taaatccata ttaattggta ctgtatccat aatgacatat 16860 tcttcactat attgaccaat aaagtcttgt tctttagcta accaattaaa acggttacct 16920 aaagcaatat caattaataa tgtctcgtta atcttaggga ataaatattt atttacaaat 16980 gtttcaaaca ttgtattatt gttatcccat ttatcaccaa atgtccaaga ttttgaataa 17040 tcatggttaa aatcttgtaa tgccgacttt gcagattttg ctactaaaag agctgtttcg 17100 ttttttgtac ttgctggtgc cataatttat tattcctcct ctacgtctcc gctaaaagtt 17160 tgttttgaaa gtgaatggat ttgtacaccg tactcatctt cacttttgtt tacatctatt 17220 gacatatttt catttaattc agtacgttta tttaaacgtg aatcttcata tgatgtcccc 17280 atcatagaac gcatgttatt gccttcatac atattatttt cctcctaatc taaatctaac 17340 ttgtcaacta attcttcatc tgaatagtct ttatcttctt tgtcagcatt tgttacatct 17400 ggttgtgttt gttgtggttg ttgaatttgt gatgataaaa aagtagtcat ttgttgctct 17460 aatgatgtaa tacgttgttc taatataaca gggtcgaatt ttgaactatc ttcatctgtt 17520 atagtaggtt ctaatttatt cttattttct tcttcaattg tttctactgt tttatcttca 17580 gtaggttctt cagttggttc ttcagttggt tcttcagttg gttctttgtc gtctggtttt 17640 acgatttcct caaattctgt cattgtgaca cctccaaaat attttataac taattatatc 17700 atagaatatt taaataagta aattaaattt attaaaaagc gtgaacatag ttttcaataa 17760 aagtaaatag atgtatatat tttgtaatta atgaatatgt aataggttag ataagttgga 17820 aaagtaggtg aacatttttt ataagtttag tttagaaatg ataagttaat ttataagttt 17880 tgatttgtat aatcgtttat tttaaacggt ggggaggtgt aaatttacaa aaactttt 17938 <210> 2 <211> 750 <212> DNA <213> Antimicrobial gene <220> <221> gene (222) (1) .. (750) <223> Antimicrobial Protein <400> 2 atgaaatcac aacaacaagc taaagattgg atatataaac atgaaggtgt tggtgttgac 60 tttgatggtg catatggttt tcaatgtatg gacttagctg ttgcttatat ctattatatt 120 actgacggta aagtgcgtat gtggggtaat gctaaagacg caattaataa tgactttaaa 180 ggtttagcaa cggtgtatga aaatacatcg agctttaaac ctcaattagg tgatgttgca 240 gtatacacaa attctcaata tggacatatc caatgtgtaa caagtggaaa tcttgattat 300 tatacatgtt tagaacaaaa ctggttgaat ggtggatatg atggttggga aaaagcaaca 360 attagaacac attattatga cggtgtgaca cattttattc gcccaaaatt ctcaaacagt 420 gaaagtaaag tattagaaca aaatattcaa ctaactaata attggaaaca aaaccaatac 480 ggcacatatt atagaaacga aaaggcaaca tttacatgtg gttttttacc aatatttgca 540 cgtgtctgta gtcctaaatt aagtgaacct aatggctatt ggttccaacc aaacggctat 600 acaccatatg acgaagtttg tttatcagat gggttagttt ggattggtta taactggcaa 660 ggaactcgtt attatttacc agttagacaa tggaacggaa aaacaggtaa tgcatatagt 720 attggtgtac cttggggggt gttctcataa 750 <210> 3 <211> 249 <212> PRT <213> Antimicrobial Protein <400> 3 Met Lys Ser Gln Gln Gln Ala Lys Asp Trp Ile Tyr Lys His Glu Gly 1 5 10 15 Val Gly Val Asp Phe Asp Gly Ala Tyr Gly Phe Gln Cys Met Asp Leu 20 25 30 Ala Val Ala Tyr Ile Tyr Tyr Ile Thr Asp Gly Lys Val Arg Met Trp 35 40 45 Gly Asn Ala Lys Asp Ala Ile Asn Asn Asp Phe Lys Gly Leu Ala Thr 50 55 60 Val Tyr Glu Asn Thr Ser Ser Phe Lys Pro Gln Leu Gly Asp Val Ala 65 70 75 80 Val Tyr Thr Asn Ser Gln Tyr Gly His Ile Gln Cys Val Thr Ser Gly 85 90 95 Asn Leu Asp Tyr Tyr Thr Cys Leu Glu Gln Asn Trp Leu Asn Gly Gly 100 105 110 Tyr Asp Gly Trp Glu Lys Ala Thr Ile Arg Thr His Tyr Tyr Asp Gly 115 120 125 Val Thr His Phe Ile Arg Pro Lys Phe Ser Asn Ser Glu Ser Lys Val 130 135 140 Leu Glu Gln Asn Ile Gln Leu Thr Asn Asn Trp Lys Gln Asn Gln Tyr 145 150 155 160 Gly Thr Tyr Tyr Arg Asn Glu Lys Ala Thr Phe Thr Cys Gly Phe Leu 165 170 175 Pro Ile Phe Ala Arg Val Cys Ser Pro Lys Leu Ser Glu Pro Asn Gly 180 185 190 Tyr Trp Phe Gln Pro Asn Gly Tyr Thr Pro Tyr Asp Glu Val Cys Leu 195 200 205 Ser Asp Gly Leu Val Trp Ile Gly Tyr Asn Trp Gln Gly Thr Arg Tyr 210 215 220 Tyr Leu Pro Val Arg Gln Trp Asn Gly Lys Thr Gly Asn Ala Tyr Ser 225 230 235 240 Ile Gly Val Pro Trp Gly Val Phe Ser 245

Claims

Staphylococcus aureus ) An antimicrobial protein having an amino acid sequence represented by SEQ ID NO: 3 with specific killing ability.

The antimicrobial protein according to claim 1, wherein the antimicrobial protein is derived from Podoviridae Bacteriophage (Accession No. KCTC 11154BP).

Gene encoding the antimicrobial protein of claim 1.

The gene according to claim 3, wherein the gene has a nucleotide sequence represented by SEQ ID NO.

E. coli transformant for the production of antimicrobial protein over-expressing the gene of claim 3 or claim 4 (Accession No. KCTC 11152BP).

A pharmaceutical composition for preventing or treating Staphylococcus aureus-induced diseases comprising the antimicrobial protein of claim 1 or 2 as an active ingredient.

The pharmaceutical composition according to claim 6, wherein the Staphylococcus aureus-induced disease is selected from the group consisting of mastitis, acute dermatitis, sepsis, purulent disease, food poisoning, pneumonia, osteomyelitis, impetigo, bacteremia, endocarditis and enteritis. .

An antibiotic comprising the antimicrobial protein of claim 1 or 2 as an active ingredient.

A disinfectant comprising the antimicrobial protein of claim 1 or 2 as an active ingredient.