KR100894755B1 - Combinatorial methods and compositions for treatmet of melanoma - Google Patents

Abstract

The present invention provides a theoretical basis for combining targeted therapies with selected chemotherapeutic agents, which currently do not exist for the treatment of melanoma. The present invention is based on the findings of the inventors that Akt3 regulates apoptosis and V599E B-Raf regulates growth and vascular development in melanoma. We first recognize a combination targeted therapeutic that is effective for treating melanoma. In one embodiment, the present invention provides a method of inducing apoptosis in melanoma tumor cells by reducing Akt3 activity. In another embodiment, the present invention provides a method of inducing apoptosis in melanoma tumor cells, including contacting melanoma tumor cells with an agent that reduces Akt3 activity. Thus, the provided methods allow the administration of low concentrations of chemotherapeutic agents resulting in reduced toxicity to patients by restoring normal apoptotic sensitivity to melanoma tumor cells. We administer to melanoma tumors an effective amount of an agent that induces apoptosis; Methods of treating melanoma tumors in mammals are considered, including administering to the melanoma tumors an effective amount of an agent that reduces angiogenesis and cell proliferation. In addition, an effective amount of an agent that reduces Akt3 activity is administered to the melanoma tumor of mammal; Disclosed herein are methods for treating melanoma in a mammal, including treating melanoma tumors by administering to the mammalian melanoma tumor an effective amount of an agent that reduces V599E B-Raf activity. In another aspect, the invention provides an agent that reduces Akt3 activity; And it provides a pharmaceutical composition for treating melanoma tumors comprising a carrier.

Description

Combination methods and compositions for treating melanoma {COMBINATORIAL METHODS AND COMPOSITIONS FOR TREATMET OF MELANOMA}

Of the three major forms of skin cancer, malignant melanoma has the highest risk of death from metastasis (Schalick et al., Blackwell Science, Inc. Malden, MA ISO-348 (1998); Jemal et al., J. Nat. Cancer Inst. 93: 678-683 (2001); and Jemal et al., Ca: a Cancer Journal for Clinicians 52: 23-47 (2002)). The prognosis of the patient at the end of the disease has a very poor life expectancy of 6 to 10 months (Jemal et al., Ca: A Cancer Journal for Clinicians 52: 23-47 (2002); and Soengas et al. , Oncogen 22: 3138-3151 (2003). At present, despite numerous clinical trials examining the efficacy of a variety of therapies ranging from surgical operations to immuno-, radio- and chemotherapy, no effective long-term therapy exists for patients at advanced stages of the cancer (Soengas et al. Oncogen 22: 3138-3151 (2003); Serrone et al., Melanoma Res 9: 51-58 (1999); Grossman et al., Cancer Metastasis Rev 20: 3-11 (2001); Helmbach et al., Int J Cancer 93: 617-622 (2001); Ballo et al., Surgical Clinics North Am 83: 323-342 (2003); and Hersey, P., Int Med J 33: 33-43 (2003). The lack of an effective treatment regimen is due, in part, to the lack of information about predominant genes that have been altered during the development of melanoma, and the lack of specifically targeted therapies to correct the defect (Serrone et al., J Exp Clin Cancer Res 19: 21-34 (2000); and Atkins et al., Nature Rev. Drug Dis 1: 491-492 (2002)).

Patients with metastatic (stage IV) malignant melanoma have an average life expectancy of approximately one year (Balch et al., 1993; Koh, 1991). Current general treatments are interleukin-2 (IL-2) or interferon-.alpha. Combination chemotherapy with agents such as cisplatin, DTIC and BCNU, with or without cytokines such as (IFN-.alpha.) (Balch et al., 1993; Koh, 1991; Legha and Buzaid, 1993) . The response rate to chemotherapy was reported to be 60%, but only about 5% of patients survive long term despite the treatment regimen being applied. Conventional chemotherapy attempts to regulate cancer growth by targeting rapidly growing cells. However, this function is not specific because many normal cells, such as bone marrow and intestinal epithelium, also have basal levels of proliferation. Thus, many normal cells of the body can also be affected by the toxic effects of chemotherapy, and conventional chemotherapy can provide a substantial degree of morbidity to the patient. Clearly, new approaches are needed to treat metastatic melanoma.

The Akt protein kinase family consists of three members, Aktl / PKBα, Akt2 / PKBβ and Akt3 / PKBγ, which share a high degree of structural similarity (Brazil et al., Cell 111: 293-303 (2002); and Nicholson et al) , Cell Signal 14: 381-395 (2002)). Members of the family share broad structural similarities to each other and exhibit greater than 80% homology at the amino acid level (Nicholson KM, Anderson NG. Cell Signal. 14 (5): 381-95 (2002), Datta SR et al. Genes Dev. 13 (22): 2905-27 (1999). All Akt isotypes share major structural features with three different domains of action (Testa JR, Bellacosa. A. Proc Natal Acad Sci USA. 98 (20): 10983-5 (2001), Nicholson KM: Anderson NG Cell Signal. 14 (5): 381-95 (2002), Scheid MP, Woodgett JR.Nat Rev Mol Cell Biol. 2 (10): 760-8 (2001), Scheid MP, Woodgett JR.FEBS Lett.546 (1): 108-12 (2003), Bellacosa A et al. Cancer Biol Ther. 3 (3): 268-75.Epub 2004 (2004), Brazil DP et al. Trends Biochem Sci. 29 (5): 233 -42 (2004), Brazil, DP et al. Cell 111: 293-303 (2002), Brazil DP, Hemmings BA.Trends Biochem Sci. 26 (11): 657-64 (2001), Datta SR et al. Genes Dev. 13 (22): 2905-27 (1999). One is the amino-terminal pleckstrin homology domain (PH) that mediates protein-protein and protein-lipid interactions. This domain consists of about 100 amino acids and is similar to the three phosphoinsitide binding domains in other signal molecules (Lietzke SE et al. Mol Cell. 6 (2): 385-94 (2000), Ferguson KM et al. Mol Cell. 6 (2): 373-84 (2000). The second domain is a carboxy-terminal kinase catalytic region that mediates phosphorylation of the substrate protein. This shows a high degree of similarity to protein kinase A (PKA) and protein kinase C (PKC) (Jones PF et al. Cell Regul. 2 (12): 1001-9 (1991)., Andjelkovic M, Jones PF, Grossniklaus U, Cron P, Schier AF, Dick M, Bilbe G, Hemmings BA.Developmental regulation of expression and activity of multiple forms of the Drosophila RAC protein kinase.J Biol Chem. 270 (8): 4066-75 (1995)) . The third domain is a tail region with important regulatory tasks. This region is often referred to as the tail or regulatory domain. Within the latter two regions are serine and threonine residues that require phosphorylation for Akt activation. This site is slightly different depending on the specific Akt isotype. The first site for all three isotypes is threonine at amino acid positions 308/309/305 for each of Akt1 / 2/3. The second site is a serine that occurs within the hydrophobic C-terminal tail at amino acid positions 473/474/472 for each of Akt1 / 2/3. Phosphorylation occurring at both sites in response to growth factors or other extracellular stimuli is essential for maximum Akt activation (Alessi DR, Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P, Hemmings BA. Mechanism of activation of protein kinase B by insulin and IGF-1.EMBO J. 15 (23): 6541-51 (1996)). Akt can also be phosphorylated at other residues; However, the functional significance of this phosphorylation is an area of ongoing research (Alessi DR, Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P, Hemmings BA. Mechanism of activation of protein kinase B by insulin and IGF- EMBO J. 15 (23): 6541-51 (1996). In addition, splice variants of Akt3 lacking the serine 472 phosphorylation site have been identified, but the cellular role of the variant remains unknown (Brodbeck D, Hill MM, Hemmings BA. J Biol Chem. 276 (31): 29550). -Epub 2001 (2001)). It is not known whether such variants exist or play a role in melanoma cells.

All isotypes can be expressed in specific cell types, but only certain isotypes can be active. In addition, each isotype has been shown to be unique and able to perform common functions in cells (Brazil et al., Cell 111: 293-303 (2002); and Nicholson et al., Cell Signal 14: 381). -395 (2002); Chen et al., Genes Dev 15: 2203-2208 (2001); and Cho et al., Science 292: 1728-1731 (2001)). Knockout mice lacking Akt1 delayed growth and increased the rate of spontaneous apoptosis in the testes and thymus (Chen et al., Genes Dev 15: 2203-2208 (2001); Cho et al., J Biol Chem 276: 38349). 38352 (2001); Peng et al., Genes Dev 17: 1352-1365 (2003). In contrast, Akt2 knockout mice had impaired insulin control and consequently exhibited a lowering of incomplete blood glucose levels due to deficiencies in insulin action on liver and skeletal muscle (Cho et al., Science 292: 1728-1731 (2001). Peng et al., Genes Dev 17: 1352-1365 (2003). At present, there are no published reports describing phenotypes associated with Akt3 knockout mice; Thus little is known about the specific function of Akt3 or its role in human cancer.

Genetic amplification that increases the expression of Aktl or Akt2 has been reported in gastric cancer, ovarian cancer, pancreatic cancer and breast cancer (Staal, SP, Proc Nat Acad Sciences ISA 84: 5034-5037 (1987); Cheng et al., Proc Nat Acad Sciences USA 89: 9267-9271 (1992); Cheng et al., Proc Nat Acad Sciences USA 93: 3636-3641 (1996); Lu et al., Chung-Hua I Hsueh Tsa Chih [Chinese Medical Journal] 75 : 679-682 (1995); Bellacosa et al., Int J Cancer 64: 280-285 (1995); and van Dekken et al., Cancer Res 59: 749-752 (1999). No activating mutations of Akt have been identified in melanoma (Waldmann et al., Arch Dermatol Res 293: 368-372 (2001); Waldmann et al., Melanoma Res 12: 45-50 (2002)), but in targeting P13K Blocking the entire Akt function (using the P13K inhibitor Wortmarmin or LY-294002) inhibits cell proliferation and reduces the melanoma cell's susceptibility to UV irradiation (Krasilnikov et al., Mol Carcinogenesis 24: 64-69). 1999). Total Akt activity can also be observed in melanoma using immunohistochemistry demonstrating increased levels of phosphorylated total Akt in severe dysplastic nevus and metastatic melanoma relative to normal or mild dysplastic nevus (Dhawan et al., Cancer Res 62: 7335-7342 (2002)). However, the tasks performed by individual Akt isotypes in melanoma and the mechanisms that induce degradation of specific Akt isotypes are not known. Recently, phosphoinositide 3-kinase (PI3K) / Akt signaling pathways have been shown to play an important role in melanoma tumorigenesis (Stahl et al., Cancer Res 63: 2891-2897 (2003)). Deregulated Akt activity through loss of PTEN phosphatase, a negative regulator of P13K / Akt signaling, has been found to regulate melanoma tumorigenesis by reducing apoptotic capacity of melanoma cells (Stahl et al. Cancer Res 63: 2891-2897 (2003).

The Raf protein serine / threonine kinase family consists of three members, A-Raf, B-Raf and C-Raf (Mercer et al., Biochim Biophys Acta 1653: 25-40 (2003)). Raf family members are the MAPK (Ras / Raf / MAPK kinase (MEK) / extracellular signal-regulated kinase (ERK) pathways, which are signal traits that relay extracellular signals from the cell membrane to the nucleus through a series of sequenced phosphorylation events. (Mercer et al., Biochim Biophys Acta 1653: 25-40 (2003), Smalley. Int J Cancer 104: 527-32 (2003)). Typically, extracellular ligands bind to their tyrosine kinase receptors to initiate cascades of Ras activation and phosphorylation events (Mercer et al., Biochim Biophys Acta 1653: 25-40 (2003), Smalley. Int J Cancer 104 : 527-32 (2003). Activated Ras causes phosphorylation and activation of Raf, which in turn phosphorylates and activates MEK1 MEK2. MEK kinase also phosphorylates and activates EPK1 and EPK2 (Chong et al, Cell Signal 15: 163-69 (2003)), which phosphorylates several cytoplasmic and nuclear targets and ultimately plays an important role in cell growth and survival. Express the protein (Chang et al., Int J Oncol 22: 469-80 (2003)).

Mutations that induce the activation of B-Raf have been found in B-RAF, the most mutated gene in melanoma at the rate of mutations of most sporadic melanoma, mainly 60-90% (Davies et al., Nature 417: 949-). 54 (2002); Pollock et al., Nat Genet 33: 19-20 (2003); Brose et al., Cancer Res 62: 6997-7000 (2002); and Yazdi et al., J Invest Dermatol 121: 1160- 62 (2003). Most B-RAF mutations occur as a result of signal base missense substitutions that convert T to A in nucleotide 1796 with valine instead of glutamic acid in codon 599 (V599E) of exon 15 (Davies et al., Nature 417: 949). -54 (2002)). These mutations increase the basic kinase activity of B-Raf, resulting in overactivity of the MAPK pathway, evidenced by constitutively elevated levels of downstream kinases MEK and ERK (Davies et al., Nature 417: 949-). 54 (2002)). B-RAF mutations are acquired as post-conjugation events in the body that have not been identified in family melanoma (Lang et al. Hum Mutat 21: 321-30 (2003); Laud et al, Cancer Res 63: 3061-65 (2003) and Meyer et al, Int J Cancer 106: 78-80 (2003).

RAN interference (RNAi) causes polylysis of specific messenger RNA (mRNA), reducing the expression of the desired target polypeptide encoded by mRNA, polynucleotide sequence-specific post-transcriptional gene silencing performed by double-stranded RNA silencing mechanism (see, eg, WO 99/32619; WO 01/75164; US Pat. No. 6,506,559; Fire et al., Nature 391: 806-11 (1988); Sharp, Genes Dev. 13: 139-41 (1999); Elbashir et al. Nature 411: 494-98 (2001); Harborth et al., J. Cell Sci. 114: 4557-65 (2001). RNAi is mediated by double-stranded polynucleotides, eg, double-stranded RNA (dsRNA) having a sequence corresponding to an exon sequence encoding a portion of a polypeptide whose expression is compromised, as described herein below. Reported RNAi is not performed by double-stranded RNA polynucleotides that share sequence identity with introns or promoter sequences (Elbashir et al., 2001). RNAi pathways are best defined in Drosophila and Caenorhabditis elegans , but "small interfering RNAs" (which interfere with the expression of certain polypeptides in higher eukaryotes, such as mammals (including humans)). siRNA) were also contemplated (eg, Tuschl, 2001 Chembiochem. 2: 239-245; Sharp, 2001 Genes Dev. 15: 485; Bernstein et al., 2001 RNA 7: 1509; Zamore, 2002 Science 296: 1265; Plasterk) , 2002 Science 296: 1263; Zamore 2001 Nat. Struct. Biol. 8: 746; Matzke et al., 2001 Science 293: 1080; Scadden et al., 2001 EMBO Rep. 2: 1107).

According to current non-limiting models, double-stranded nucleotide base pair lengths of about 18 to 27 (eg, 19, 20, 21, 22, 23, 24, 25, 26, etc.) called small interfering RNA (siRNA) The RNAi pathway is initiated by ATP-dependent progressive cleavage of long dsRNA into fragments (see Hutvagner et al., Curr. Opin. Gen. Dev. 12: 225-32 (2002); Elbashir et al., 2001; Nyknen et al., Cell 107: 309-21 (2001); Bass, Cell 101: 235-38 (2000); Zamore et al., Cell 101: 25-33 (2000)). In drosophila, an enzyme known as “Dicer” cleaves longer double-stranded RNA into siRNAs; Dicer belongs to the dsRNA-specific endonuclease of the RNase III family (WO 01/68836; Bernstein et al., Nature 409: 363-66 (2001)). Further according to this non-limiting model, siRNA duplexes are incorporated into the protein complex followed by ATP-dependent unwinding of the siRNA, followed by generation of an active RNA-induced silent complex (RISC) (WO01 / 68836). ). The complex recognizes and cleaves target RNA complementary to the guide strand of the siRNA, thus interfering with the expression of specific proteins (Hutvagner et al., Detailed above).

Seed. In elegans (C.elegans) and draw small pillars, RNAi is a long double-stranded RNA may be mediated by the polynucleotide (WO 99/32619; WO 01/75164; Fire et al, 1998; Clemens et al. , Proc. Natl. Acad. Sci. USA 97: 6499-6503 (2000); Kisielow et al., Biochem. J. 363: 1-5 (2002); see also WO 01/92513 (RNAi-mediated silencing in yeast). )). However, transfection with long dsRNA polynucleotides (ie, more than 30 base pairs) in mammalian cells globally blocks the initiation of protein synthesis and activates a nonspecific sequence response that causes mRNA degradation (Bass, Nature). 411: 428-29 (2001). Transfection of human and other mammalian cells using double-stranded RNA, about 18 to 27 nucleotide base pairs in length, sequence-expresses the expression of a particular polypeptide encoded by messenger RNA (mRNA) containing the corresponding nucleotide sequence. Interfere in a specific way (WO 01/75164; Elbashir et al., 2001; Elbashir et al., Genes Dev. 15: 188-200 (2001); Harborth et al., J. Cell Sci. 114: 4557- 65 (2001); Carthew et al., Curr. Opin. Cell Biol. 13: 244-48 (2001); Mailand et al., Nature Cell Biol. Advance Online Publication (Mar. 18, 2002); Mailand et al. 2002 Nature Cell Biol. 4: 317).

siRNA polynucleotides may provide certain advantages over other polynucleotides known in the art for use in sequence-specific alteration or modification of gene expression to yield altered levels of encoded polypeptide products. These advantages include lower concentrations of effective siRNA polynucleotides, improved stability of siRNA polynucleotides, and shorter siRNA polynucleotides compared to such other polynucleotides (eg, antisense, ribozyme, or triplex polynucleotides). . As a simple preliminary knowledge, an "antisense" polynucleotide binds to a target nucleic acid such as mRNA or DNA in a sequence-specific manner to inhibit transcription of DNA or translation of mRNA (see, eg US Pat. No. 5,168,053; US Pat. No. 5,190,931; US Pat. No. 5,135,917; US Pat. No. 5,087,617; see also, e.g., Clusel et al., 1993 Nucl.Acids Res. 21: 3405-11, "dumbbell" antisense oligonucleotides. Description). A "ribozyme" polynucleotide can be targeted to any RNA transcript and catalytically cleave the transcript, thereby impairing the translation of mRNA (see, eg US Pat. No. 5,272,262; US Pat. No. 5,144,019; and US Pat. Nos. 5,168,053, 5,180,818, 5,116,742 and 5,093,246; US 2002/193579). "Triplex" DNA molecules refer to signal DNA strands that bind to duplex DNA to form collinear triplex molecules and inhibit transcription (see, eg, US Pat. No. 5,176,996, a synthetic that binds to a target site on duplex DNA). Oligonucleotides are described). The triple-stranded structure is unstable and only forms temporarily under physiological conditions. Since single-stranded polynucleotides do not readily diffuse into cells and thus are susceptible to nuclease digestion, the development of single-stranded DNA in antisense or triplex techniques is often chemically improved to improve stability and uptake by cells. Require modified nucleotides. In contrast, siRNAs that are readily taken up by intact cells are effective at interfering with the expression of certain polypeptides at concentrations several tens lower than those required for antisense or ribozyme polynucleotides, and require the use of chemically modified nucleotides. I never do that.

Malignant melanoma is a skin cancer with the most significant impact on humans, with the highest risk of death from metastasis. Both incidence and mortality are increasing each year without any obvious long-term treatment. In part, this reflects the identification of critical genes and the lack of specific therapies targeted to correct the defects. Accordingly, the need for identification of the critical genes involved in the defects and the specific therapies targeted to fix them and the targeted reduction of identified gene (s) as key to resolution in the PI3K / Akt and MEK / ERK signaling pathways are It exists in the field. Identifying genes as selective targets provides new therapeutic opportunities for melanoma patients.

Thus, improving the state of the art is the most important object, feature or advantage of the present invention.

It is a further object, feature or advantage of the present invention to provide a method of reducing Akt3 activity in cancer cells to restore normal apoptotic sensitivity to cancer cells.

A further object, feature or advantage of the present invention is to provide a method of inducing apoptosis in cancer cells using agents that reduce Akt3 activity.

A further object, feature or advantage of the invention is to restore normal apoptotic sensitivity to melanoma tumor cells, reduce cell proliferation and growth of melanoma tumor cells, and inhibit melanoma by melanoma tumor cells. To provide a combinatorial approach to treating species.

A further object, feature or advantage of the present invention is to provide a method of treating melanoma which reduces tumor size more effectively than conventional methods.

It is a further object, feature or advantage of the present invention to provide a method of treating melanoma which requires a lower concentration of the chemotherapeutic agent to be used to reduce toxicity to the patient.

Further objects, features or advantages of the invention will be apparent from the following description of the invention.

Summary of the Invention

The present invention provides a reasonable basis for combining targeted therapies with selected chemotherapeutic agents that are not present to treat melanoma. The present invention is based on the findings of the inventors that Akt3 regulates apoptosis and V599E B-Raf regulates melanoma growth and vascular development. We first recognized a combination targeted therapeutic that is effective for treating melanoma. In one embodiment, the invention provides a method of inducing apoptosis of melanoma tumor cells by reducing Akt3 activity. In another embodiment, the present invention provides a method of inducing apoptosis of melanoma tumor cells, including contacting melanoma tumor cells with an agent that reduces Akt3 activity. As a result, the provided methods restore normal apoptotic sensitivity to melanoma tumor cells, allowing the patient to administer low concentrations of chemotherapeutic agents resulting in reduced toxicity.

We administer to melanoma tumors an effective amount of an agent that induces apoptosis; Methods of treating melanoma tumors in mammals are considered, including administering to the melanoma tumors an effective amount of an agent that reduces angiogenesis and cell proliferation.

Administering to the mammalian melanoma tumors an effective amount of an agent that reduces Akt3 activity; Also described herein are methods for treating melanoma in a mammal, including treating melanoma tumors by administering to the mammalian melanoma tumor an effective amount of an agent that reduces V599E B-Raf activity.

In another aspect, the present invention provides a pharmaceutical composition for treating melanoma tumors comprising an agent and a carrier for decreasing Akt3 activity.

These and other embodiments of the invention will become apparent by reference to the following detailed description. All references described herein are incorporated herein by reference in their entirety as if each were individually incorporated.

Brief description of the drawings

1 shows the identification of Akt3 involvement in malignant melanoma. A. In melanoma cell line UACC 903, Akt activity is regulated by PTEN. Western blot analysis shows expression of phosphorylated-Akt, total Akt, PTEN and α-enolase (loading control). The 36A, 29A and 37A cell lines are genetically related cell lines generated from the UACC 903 parent cell line lacking PTEN. Tumorogenic return mutant cell lines derived from the 36A cell line are considered to be different homogenes only in PTEN expression. Melanocytes serve as controls for normal cells. The graph shows densitometry scans from separate three western blots quantitatively demonstrating phosphorylated levels for total Akt in each cell line; Bar, ± SEM; Statistical, one-way ANOVA followed by Dunnet's multiple comparisons to melanocyte control, * P <0.5. SiRNA for each of the Akt isotypes demonstrates the specificity of knockdown of the Akt isotypes expressed separately in the UACC 903 cell line. Constructs expressing tagged tagged HA-Akt1, HA-Akt2 or HA-Akt3 were co-nucleofected with UACC903 cells with siRNA specific for HA-Akt1, HA-Akt2 or HA-Akt3. Controls are cells that are not nucleofected or only vectors that are nucleofected. Western blots were probed with HA using antibodies to detect α-enolase that functions as a loading control as well as proteins expressed elsewhere. C. Phosphorylated Akt3 is reduced when PTEN protein is present in the UACC 903 (PTEN) tumorigenic model. Akt3 and Akt2 are immunoprecipitated from cell lines of the UACC 903 (PTEN) tumorigenic model and analyzed by western blotting using antibodies that recognize phosphorylated Akt. PTEN expressing 36A, 29A and 37A cell lines are derived from UACC 903 parent cell line lacking PTEN protein. Two tumorigenic reverted cell lines are derived from the 36A cell line and no longer express PTEN. Negative antigen controls are shown with positive and negative controls for Akt3 and Akt2. Controls for Akt3 and Akt2 are HEK 298T or LNCaP cells, respectively, either untreated or treated with LY-294002 (negative), an inhibitor of P13K. D. siRNA mediated knockdown of Akt3 but not Akt1 or Akt2 alters the level (activity) of phosphorylated Akt in melanoma cell lines UACC 903, WM1 15 and SK-MEL-24. Western blot analysis shows expression of phosphorylated-Akt1, Akt3, Akt2 and α-enolase after nucleofection with 50 (left) or 100 pmole (right) for individual siRNA, respectively. Controls are cells that are not nucleofected or nucleofected with scrambled siRNA. The data represent at least two separate experiments. The loading control of the experiment is α-enolase. E. Akt3 activity is reduced in the presence of PTEN in the UACC 903 (PTEN) tumorigenic model. Immunoprecipitated Akt3 was used in an in vitro kinase assay in which Crosstide was phosphorylated by Akt3 to estimate activity. Plot shows activity after not excluding antigen control; Bar, ± SEM; Statistical, Onenet ANOVA followed by Dunnet's multiple comparisons to melanocyte control, * P <0.05.

2 shows increased Akt3 expression and activity that occurs during melanoma tumor development. A. An increase in phosphorylated (active) Akt levels occurs during the radial growth phase of the melanoma tumor development model. Western blots compare the amount of phosphorylated Akt in melanocytes with low passage melanoma cell lines established from primary tumors in the radial (WM35 and WM3211) and vertical (WM115, WM98.1 and WM278) growth phases. Total Akt is shown as a control. B. Comparison of Akt3 to Akt2 Expression in Melanoma Tumor Development Model. Western blots showing expression levels of Akt3 and Akt2 are shown using α-enolase together as a loading control. C. Akt3 is preferentially activated in cell lines of the melanoma tumor development model compared to Akt2. Akt3 and Akt2 are immunoprecipitated from each cell line and analyzed by western blot to determine the amount of phosphorylated Akt in the immunoprecipitate.

3 shows the relative intensity and Akt-expression and activity of p-Akt staining in metastases from general nevus, dysplastic nevus, primary melanoma and melanoma patients.

4 shows a mechanism supporting deregulated Akt3 activity in malignant melanoma. A. Reduced PTEN expression (activity) specifically increases Akt3 activity in melanocytes: B. Radial growth phase WM35 (radial growth phase) cells. SiRNA mediated reduction of PTEN is shown alone (control) or with scrambled siRNA or siRNA for Akt1, Akt2 or Akt3. Western blot analysis shows expression of phosphorylated Akt1, Akt3, Akt2 and PTEN. α-enolase functions as a loading control. C. Overexpression of Akt3 in human melanocytes increases the level of phosphorylated Akt. Wild type Akt3, dead Akt3 (inactive) or myristoylated Akt3 (active) were nucleofected with melanocytes. Similar constructs for Akt2 serve as controls (data not shown). Akt phosphorylation (activity) was determined by Western blot analysis, which measures the level of phosphorylated Akt. Arrowheads indicate endogenously active Akt3 positions, while arrows indicate active HA-tagged Akt3 expressed elsewhere.

5 demonstrates that liposomes alone are nontoxic to melanoma cells. The addition of varying concentrations of liposomes did not reduce the number of viable cells. In fact, they increased cell viability by 48 hours at all concentrations. Methods: Toxicity of liposomes at 1205 Lu was assessed using MTS assay at 24, 48 and 72 hours after liposome addition at 6.25, 12.5, 25 and 50 μM concentrations.

6 demonstrates that melanoma cells readily absorb liposomes. Methods: Labeled liposomes (green) were added to UACC 903 melanoma cells growing in culture. The image shows the cell nuclei on the left (counter counterstained with DAPI) and the cells that absorbed the labeled liposomes on the right: magnification, 40 ×. Approximately 99% of cells absorbed liposomes.

7 shows quantification of liposome uptake by melanoma cells. Methods: Liposomes containing labeled liposomes or labeled siRNAs were added to cells growing in culture at a concentration of 20 nM. After 1 hour, cells were fixed with 5% paraformaldehyde, counterstained with DAPI, and the percentage of cells that absorbed the labeled product was recorded.

8 demonstrates size equality and size distribution of liposomes. Method: Top: Scanning electron micrograph showing uniform size of liposomes. Bottom: Size distribution of liposomes determined by light scattering analysis. The graph shows the size range of liposomes with an average size of 70 to 80 nm.

9 demonstrates liposomes that deliver a pool of siRNA to melanoma cells. Methods: Red and green labeled siRNAs were added to melanoma cells growing in culture. One hour after uptake, cells were fixed in 4% paraformaldehyde and counterstained with DAPI. Left shows cell nuclei stained blue, followed by red siRNA and green siRNA. The last column is a fused image with a magnification of 40X.

10 demonstrates the duration of stealth siRNA knockdown of protein expression in 1205 Lu melanoma cells. Method: The duration of protein knockdown by stealth siRNA from Invitrogen was determined to be greater than 8 days. siRNA was transferred to 1205 Lu melanoma cells by nucleofection. Western blot analysis of B-Raf protein levels was measured at 2 day intervals up to 8 days. SiRNA against C-Raf served as a control. In addition to reduced B-Raf expression, the activity of pErk 1 '/ 2 downstream in the signaling pathway was also reduced for 8 days. Ekr-2 served as a protein loading control.

FIG. 11 demonstrates knockdown of protein expression following liposome mediated delivery of siRNA to melanoma cells. SiRNA liposome complexes targeted to mutant B-Raf can be knocked down with 50% protein expression at 200 nM. This represents a baseline; Higher concentrations will increase knockdown. Methods: siRNA liposome complexes were added to cells at concentrations of 100 or 200 nM. After 72 hours the lysates were collected and analyzed by Western blot.

12 shows that siRNA mediated reduction of mutant ^V599E B-Raf reduces downstream activity of MEK and ERK in melanoma. The siRAN mediated knockdown of B-Raf and C-Raf levels the levels of each individual protein 24 and 48 hours after nucleofection in melanoma cell lines UACC 903 (A), 1205 Lu (B) and C8161 (C). Reduced. Scrambled siRNA was used as a control while Lamin A / C siRNA was used as an additional control for UACC 903 cells. Only siRNA against B-Raf reduced the levels of BK-Raf's active (phosphorylated) MEK and ERK downstream in UACC 903 and 1205 Lu cells containing the mutant ^V599E B-Raf. ERK2 was used as a loading control.

13 shows that the development of melanoma tumors is inhibited by siRNA for ^V599E B-Raf but not by siRNA or scrambled siRNA for C-RAF. SiRNA mediated knockdown of B-Raf protein survived for 6-8 days after nucleofection with UACC 903 (A) and 1205 Lu (B) cell lines growing in culture. A corresponding decrease was observed at phosphorylated ERK1 / ERK2 level (B). ERK2 served as a loading control. SiRNA mediated reduction of B-Raf reduced the likelihood of tumorigenesis of UACC 903 (C) and 1205 Lu (D) cells. SiRNA and scrambled siRNA for B-Raf, C-Raf were introduced into UACC 903 or 1205 Lu cells (white arrow) and 36 hours later cells were injected into nude mice (black arrow). Tumor size was measured at two day intervals. SiRNA mediated down-regulation of B-Raf reduced the likelihood of tumorigenesis of UACC 903 and 1205 Lu melanoma cells. Control cells were nucleofected with buffer alone or with siRNA against scrambled siRNA or C-Raf. Values are the average of at least 12 injection sites in six mice in two separate experiments. Bar ± SE.

14 shows that pharmacological inhibition of B-Raf activity with BAY 43-9006 inhibits melanoma tumor development. A. BAY 43-9006 inhibits both wild type and mutant ^V599E B-Raf activity. HA-tagged wild type or mutant ^V599E B-Raf was expressed in HEK 293T cells exposed to 5 μmol / L BAY 43-9006 or DMSO vehicle. HA represents B-Raf protein expressed elsewhere. Activation or inhibition of the MAPK pathway was determined by comparing the levels of pMEK and pERK, ERK2, functioning as loading controls; B. BAY 43-9006 decreases pMEK and pERK (activity) levels in UACC 903 melanoma cells containing mutant ^V599E B-Raf in a dose response manner. Western blot analysis of decreased pMEK and PERK levels in UACC 903 cells with increasing concentrations of BAY 43-9006. The loading control is ERK2. C, pretreatment of mice with BAY 43-9006 inhibits the development of melanoma tumors. Four days prior to injection of 5 × 10 ⁸ UACC 903 cells, mice were pre ip treated twice with 50 mg / kg BAY 43-9006 or DMSO vehicle and continued every two days (arrowheads). Tumor size is shown at 2 day intervals up to 22 days. Bar, ± SE D, reduced tumor cell proliferation is accompanied by siRNA mediated inhibition of melanoma tumor development. 5- to 8-fold reduction occurs in bromodeoxyuridine-positive cells after siRNA mediated inhibition of B-Raf but not C-Raf or scrambled siRNA. * P <0.05. Column, mean from six different tumors with 4 to 6 counts relative to tumor; Bar, ± SE.

15 shows that inhibition of B-Raf activity with BAY 43-9006 inhibits melanoma tumor development. The effect of treatment of BAY 43-9006 on UACC 903 (A) and 1205 Lu (B) tumor development is indicated. UACC 903 and 1205 Lu cells were injected into nude mice to develop tumor development on day 6, at which point the mice were injected ip every two days with BAY 43-9006 dissolved in DMSO (arrowheads). Control conditions were only DMSO treatment. Raf kinase inhibitor BAY 43-9006 reduces the tumorigenic potential of melanoma cells containing mutant ^V599E B-Raf protein at concentrations of 50 mg / kg or more. C, Reduced amounts of phosphorylated (active) ERK were observed for these cells after treatment with BAY 43-9006 rather than vehicle treatment. Immunohistochemical comparison of pERK-positive cell numbers in UACC 903 tumor sections treated with 50 mg / kg BAY 43-9006 (DMSO) or DMSO vehicle only. Three fold differences were detected between control vehicle and BAY 43-9006 treated cells (D). * P <0.05. Column, mean from six different tumors with 4 to 6 counts relative to tumor; Bar, ± SE.

FIG. 16 shows the mechanisms supporting the inhibition of melanoma tumor development after inhibition of pharmacological or siRNA mediated mutant ^V599E B-Raf in melanoma tumors. Comparison of Vascular Development (A), Apoptosis (B) and Proliferation Rate (C) in Temporally and Spatially Matched Tumors Exposed to BAY 43-9006 or Vehicle (DMSO). Simultaneously developing size- and time-matched tumors were compared to determine the effect of B-Raf inhibition on tumor development. Differences in vascular development were first observed with statistical significance (*, P <0.05) after treatment of UACC 903 tumors with BAY 43-9006, after which apoptosis was increased (*, P <0.05) and cell proliferation was reduced ( *, P <0.05). Column, mean from two separate experiments with 4 to 6 lines analyzed from each of the six tumors per experiment; Bar, ± SE.

17 shows that pharmacological inhibition of siRNA and ^V599E B-Raf reduces VEGF secretion from melanoma cells. VEGF secretion was measured from UACC 903 or 1205 Lu cells growing in culture after nucleofection with B-Raf or VEGF siRAN (A) or after treatment with increased concentrations of BAY 43-9006 (B). C-Raf and scrambled siRNA served as controls. Bars, ± SD. The effect of reduced VEGF expression is shown for UACC 903 (C) and 1205 Lu (D) tumor development. Tumor size is shown at two-day intervals up to 17.5 days. A decrease in VEGF expression inhibits melanoma tumor development in a manner that occurs after a decrease in ^V599E B-Raf expression. Point, mean from six different tumors; Bar, ± SE.

18 depicts regions of Akt3 causing preferential activation in melanoma. Activation is measured as the level of phosphorylation: darker bands show higher activity. Lower bands indicate endogenous Akt activity. The domain of Akt3 was switched to the domain of Akt2 and the construct containing the chimeric construct was nucleofected with the melanoma cell line WM35. Myristoylated Akt3 and Akt2 served as positive controls. Dead Akt3 (T305A / S472A) and Akt2 (T309A / S474A) served as negative controls. Migration of wild type Akt3 resulted in increased activity in contrast to wild type Akt2. A construct in which the flextrin homology (PH) domain from Akt3 was switched to the domain from Akt2 was used to identify regions of Akt3 that result in activation in melanoma cells. Note that only the constructs containing the catalytic and regulatory (C / R) domains (amino acids 111-497) of Akt3 result in activation. This maps amino acid 111-497 regions important for activation of Akt3 in human melanoma. This is an important site for therapeutic targeting that will specifically inhibit Akt3 in melanoma. Methods: HA-tagged wild-type constructs, and chimeric constructs PH-Akt3-C / R-Akt2 and PH-Akt2-C / R-Akt3, with a flextrin homology (PH) domain (amino acids 1-110) and catalytic domain ( 111-479 of Akt3 or 481 of Akt2). The constructs were nucleofected with WM35 melanoma cell line using Amaxa NHEM-NEO NucleoFactor Reagent, and analyzed by Western blot analysis after 48 hours probing with ser-473 of Akt with antibody.

Detailed Description of the Preferred Embodiments

The present invention is in part related to the discovery that Akt3 is an important serine / threonine protein kinase and that melanoma tumor cells play a role in the survival of melanoma to withstand apoptosis. The melanoma model, which reflects the importance of Akt in melanoma tumorigenesis, was used to identify Akt3 as a predominant dominant isotype during melanoma tumorigenesis. Selective knockdown of Akt3 but not Akt1 or Akt2, as demonstrated herein, reduced the level of phosphorylated total Akt and lowered the tumorigenic potential of melanoma cells. As a result, Akt3 provides a therapeutic target for melanoma cancer.

The invention also relates in part to the discovery that V599E B-Raf plays a role in the growth and proliferation of melanoma. It has now been found that inhibition or reduction of B-Raf expression reduces tumor cell proliferation and formation of new blood vessels (angiogenesis). Note that the substitution of valine (V) with glutamic acid (E) in B-Raf actually corresponds to codon 600 and nucleotide 1799 (not 1796) in the correct version shown in NCBI Gene Bank Accession No. NT_007914 due to incorrect sequence data. shall. Kumar et al., Clinical Cancer Research, 9: 3362-3368 (2003). However, the inventors herein used nucleotide and codon numbers that were not corrected throughout for historical reasons and familiarity.

We contemplate combination therapies for treating tumor cells that induce apoptosis and reduce cell proliferation and angiogenesis. In one embodiment, apoptosis is induced by decreasing Akt3 activity and cell proliferation and angiogenesis is reduced by decreasing V599E B-Raf activity. We also consider that reducing Akt3 activity in tumor cells reduces apoptotic thresholds in tumor cells, especially melanoma cells, allowing the application of much lower doses of chemotherapy than those based on conventional treatment. do. Thus, patients will experience less side effects from toxic chemotherapy drugs while receiving more effective treatment.

To help understand the specification and claims, the following definitions are provided.

Justice

The term "siRNA" as used herein refers to (i) 18 base pairs, 19 base pairs, 20 base pairs, 21 base pairs, 22 base pairs, 23 base pairs, 24 base pairs, 25 base pairs, 26 base pairs, 27 bases. Double-stranded RNA oligonucleotides or polynucleotides that are base pairs, 28 base pairs, 29 base pairs, or 30 base pairs in length and that can interfere with the expression and activity of Akt3 polypeptides or Akt3 polypeptide variants, wherein a single strand of siRNA is an Akt3 polypeptide, Variants, or portions of RNA polypeptide sequences encoding sequences complementary thereto); (ii) 18 base pairs, 19 base pairs, 20 base pairs, 21 base pairs, 22 base pairs, 23 base pairs, 24 base pairs, 25 base pairs, 26 base pairs, 27 base pairs, 28 base pairs, 29 base pairs Or single stranded oligonucleotides that anneal complementary sequences that are 30 base pairs in length and that result in dsRNA that may interfere with the expression and / or activity of the target Akt3 polypeptide, or variants of the Akt3 polypeptide, or may interfere with the expression of the target polypeptide, or Polynucleotides, wherein the single stranded oligonucleotide comprises a portion of an RNA polynucleotide sequence that encodes a PTP-1B polypeptide, variant thereof, or a sequence complementary thereto; Or (iii) the oligonucleotide or polynucleotide of (i) or (ii), wherein said oligonucleotide or polynucleotide has one, two, three or four nucleic acid alterations or substitutions therein.

As used herein, “nucleic acid” or “polynucleotide” refers to purine- and pyrimidine-polyribonucleotides or polydeoxyribonucleotides or mixed polyribo-polydeoxyribonucleotides containing polymers of any length. . It includes single- and double-stranded molecules, ie DNA-DNA, DNA-RNA and RNA-RNA hybrids, as well as "protein nucleic acids" (PNAs) formed by conjugating bases to amino acid backbones. It also includes nucleic acids containing modified bases.

"Gene" refers to the assembly of nucleotides encoding a polypeptide and includes cDNA and genomic DNA nucleic acids.

"Vector" is any means by which nucleic acid is transferred to a host cell. The vector may be a replicon in which another DNA segment may be attached to it and cause replication of the attached segment. A "replicon" is any genetic element (eg, plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, that is, can be replicated under self-regulation. The term "vector" includes both viral and non-viral means for introducing nucleic acids into cells in vitro, in vitro or in vivo. Viral vectors include retroviruses, adeno-associated viruses, fox, baculovirus, vaccinia, simple herpes, Epstein-Barr and adenovirus vectors. Non-viral vectors include, but are not limited to, plasmids, liposomes, electrically charged lipids (cytofectin), DNA-protein complexes, and biopolymers. In addition to nucleic acids, the vector may also contain one or more regulatory regions, and / or optional markers useful for screening, measuring, and monitoring the results of nucleic acid migration (migration to tissue, duration of expression, etc.).

"Cassette" refers to a segment of DNA that can be inserted into a vector at specific restriction sites. Segments of DNA encode the polypeptide of interest, and cassettes and restriction sites are designed to be responsible for insertion of the cassettes in a reading frame suitable for transcription and translation.

When exogenous or heterologous DNA is introduced into a cell, the cell is "transfected" by the DNA. When the phenotype of the transfected DNA changes, the cell is "transformed" by exogenous or heterologous DNA. The transformed DNA can be integrated (covalently bound) into the chromosomal DNA that makes up the genome of the cell.

A “nucleic acid molecule” is a ribonucleoside (adenosine, guanosine, uridine or cytidine; “RNA molecule”) or deoxyribonucleoside (deoxy) in single-stranded form, or in the form of a phosphate ester polymer in a double-stranded helix. Adenosine, deoxyguanosine, deoxythymidine or deoxycytidine; "DNA molecule"), or any phosphoester analogue thereof, such as phosphorothioate and thioester. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular the DNA or RNA molecule, refers only to the primary and secondary structure of the molecule and does not limit it to any particular tertiary form. Thus, the term includes, inter alia, double stranded DNA found as linear or circular DNA molecules (eg, restriction fragments), plasmids, and chromosomes. In discussing the structure of a particular double-stranded DNA molecule, the sequence is used herein in the normal practice of providing only sequences in the 5 'to 3' direction along the non-transcribed strand of DNA (ie, the strand having a sequence homologous to the mRNA). Can be described accordingly. A "recombinant DNA molecule" is a molecular biologically engineered DNA molecule.

The present invention contemplates isolation from melanoma of genes encoding human Akt3 proteins or polypeptides of the invention, including full-length or naturally occurring forms of Akt3, and any human Akt3-specific antigenic fragments thereof. As used herein, "Akt3" refers to an Akt3 polypeptide and "akt3" refers to a gene that encodes an Akt3 polypeptide.

The term “Akt3” refers to Akt3 nucleic acids (DNA and RNA), proteins (or polypeptides), polymorphic variants, alleles, mutations, and two homologues having the following: (i) Accession No. AJ245709 ( Homo sapiens mRNA gi│5804885│emb│AJ245709.1│HSA245709 [5804885]) for serine / threonine kinase Akt-3 (Akt3 gene); Accession number AF135794 (Homo sapiens AKT3 protein kinase mRNA, full cds gi│4574743│gb│AF135794.1│AF135794 [4574743]); Accession No. NM_005465 (Homo sapiens v-akt murine thymomas virus oncogene homolog 3 (protein kinase B, gamma) (AKT3), transcription variant 1, mRNA gi│32307164│ref│NM_005465.3│ [32307164]); Accession number NM_181690 (Homo sapiens v-akt murine thymomas virus oncogene homolog 3 (protein kinase b, gamma) (AKT3), transcription variant 2, mRNA gi│32307162│ref│NM_181690.1│ [32307162]); Accession number AY005799 (Homo sapiens protein kinase B gamma 1 (AKT3) mRNA, full cds, alternatively spliced gi│15072339│gb│AY005799.1│ [15072339]); Nucleotide sequence substantially homologous to the nucleotide sequence of Accession No. AF124141 (Homo sapiens protein kinase B gamma mRNA, full cds gi│4757578│gb│AF124141.1│AF124141 [4757578]); Or (ii) Accession No. CAB53537 (Akt-3 protein [Homo sapiens] gi│5804886│emb│CAB53537.1│ [5804886]); Accession number Ad24196 (AKT3 protein kinase [homo sapiens] gi│4574744│gb│AAD24196.1│AF135794_1 [4574744]); Accession number AAF91073 (protein kinase B gamma 1 [homo sapiens] gi│15072340│gb│AAF91073.1│ [15072340]); Accession number AAD29089 (protein kinase B gamma [homo sapiens] gi│4757579│gb│AAD29089.1│AF124141_1 [4757579]); Accession No. NP_005456 (v-akt murine thymomas virus oncogene homolog 3 isoform 1; protein kinase B gamma; RAC-gamma serine / threonine protein kinase; serine threonine protein kinase, Akt-3 [homo sapiens] gi│488549│ ref | NP_005456.1 | [4885549]); Accession No. NP_859029 (v-akt murine thymomas virus oncogene homolog 3 isoform 2; protein kinase B gamma; RAC-gamma serine / threonine protein kinase; serine threonine protein kinase, Akt-3 [homo sapiens] gi│32307163│ a sequence substantially homologous to the amino acid sequence encoding ref│NP_859029.1│ [32307163]).

The term “B-Raf” refers to B-Raf nucleic acids (DNA and RNA), proteins (or polypeptides), polymorphic variants, alleles, mutations, and two homologs having the following: (i) Nucleotide sequence substantially homologous to the nucleotide sequence of Genbank (NM_004333) Homo sapiens v-raf murine seed virus oncogene homolog B1 (BRAF), mRNA, gi│33188458│ref│NM_00433.2│ [33188458]. Homologous protein sequence for B-Raf is Genbank Accession No. P15056.

One B-Raf protein found in Jenbank is M95712 Homo sapiens B-Raf protein (BRAF) mRNA, full cds gi│41387219│gb│M95712.2│HUMBRAF [41387219].

"Control sample" refers to a sample of biological material that represents a healthy, cancer-free animal. The Akt3 or B-Raf level, or corresponding encoding gene copy number, of the control sample is preferably representative of the general population of subjects who do not have normal cancer of the same species. The sample may be collected from the animal for use in the methods described herein, or may be any biological material representative of an animal obtained for other reasons that does not have normal cancer suitable for use in the methods of the present invention. Control samples may also be obtained from normal tissue of an animal that has or is at risk of developing cancer. The control sample may also display a predetermined level of Akt3 representing a population of non-cancer subjects that has already been established based on measurements from subjects not having normal cancer. Alternatively, a biological control sample may refer to a sample obtained from different individuals or whose levels have been normalized based on reference data obtained from a population. In addition, control samples may be defined by specific age, gender, race or other demographic parameters. In some cases, the control is absolute for certain measurements. An example of an implicit control is when the detection method is able to detect only Akt3 or detect the corresponding gene copy number when there is a higher level than a subject not suffering from normal cancer. Typical control levels for genes are two copies of the cells. Another example is where control levels for assays are known in relation to immunohistochemical assays. Other cases of the control are within the knowledge of those skilled in the art.

The level of Akt3 or B-Raf polypeptide or polynucleotide "expected" in the control sample indicates the level of the sample in which no conventional cancer is present, from which the elevated or diagnostic presence of the Akt3 polypeptide or polynucleotide can be distinguished. Preferably the “expected” level will be adjusted for the particular biological subject being tested as well as factors such as the age, sex, medical history, etc. of the mammal.

The term "tumor cell" is a cell that is a component of a tumor in a subject, or a cell that is determined to be a component of a tumor, that is, a cell that is a component of a precancerous lesion in a subject.

"cDNA" refers to complementary or copy DNA produced from an RNA template by the action of an RNA-dependent DNA polymerase (reverse transcriptase). Thus, "cDNA clone" refers to a duplex DNA sequence that is complementary to an RNA molecule of interest, carried or PCR amplified by a cloning vector. The term includes genes from which intervening sequences have been removed.

A "cloning vector" refers to a plasmid or phage DNA or other DNA sequence that can be replicated in a host cell. The cloning vector features one or more endonuclease recognition sites, wherein the DNA sequence can be determined without loss of essential biological function of the DNA, which may contain markers suitable for use in identifying transformed cells. Can be cut.

An "expression vector" refers to a vehicle or vector similar to a cloning vector but capable of expressing the cloned nucleic acid sequence after transformation into a host. The nucleic acid sequence is “expressed” when it can be transcribed to provide an mRNA sequence. In most cases, such transcripts are translated to provide amino acid sequences. Cloned genes are generally placed under the control of (ie, operably linked) expression control sequences.

An "expression control sequence" or "regulatory sequence" refers to a nucleotide sequence that controls or regulates the expression of a structural gene when operably linked to said gene. This includes, for example, the lac system, trp system, major operator and promoter regions of phage lambda, regulatory regions of fd coat proteins, and other sequences known to regulate expression of genes in prokaryotic or eukaryotic cells. Expression control sequences will vary depending on whether the vector is designed to express a gene operably linked in a prokaryotic or eukaryotic host, and may include transcriptional elements such as enhancer elements, termination sequences, tissue-specific elements or translation initiation and termination sites. It may contain.

"Operably linked" means that the promoter regulates the onset of gene expression. When the promoter, upon introduction into a host cell, determines the transcription of adjacent DNA sequence (s) into one or more RNA species, the promoter is operably linked to the sequence of adjacent DNA. A promoter is one that is operably linked to a DNA sequence if the promoter can initiate transcription of the DNA sequence.

"Host" means eukaryotes. The term includes an organism or cell that is the receptor of a replicable expression vector.

Introduction of nucleic acids into host cells by any method known in the art, including those described herein, will be referred to herein as “transformation”. Cells into which the nucleic acids described above have been introduced are also intended to include the progeny of said cells.

An “isolated” nucleic acid referred to herein is a nucleic acid isolated from a nucleic acid of genomic DNA or cellular RNA of source origin (eg, it is present in a mixture of nucleic acids such as cells or libraries) and can be further processed. As used herein, “isolated” refers to a nucleic acid or amino acid sequence that is at least 60% free, preferably 75% free, and most preferably 90% free of other naturally related components. “Isolated” nucleic acids (polynucleotides) are essentially the methods described herein, including pure nucleic acids, nucleic acids produced by chemical synthesis, nucleic acids produced by a combination of biological and chemical methods, and isolated recombinant nucleic acids, Nucleic acids obtained by similar or other suitable methods. Nucleic acids, referred to herein as "recombinants", include nucleic acids produced by procedures that rely on artificial replication methods such as polymerase chain reaction (PCR) or cloning into vectors using restriction enzymes, such as by recombinant DNA methods. Produced nucleic acid. "Recombinant" nucleic acids are also those resulting from recombinant events that occur through the natural mechanisms of the cell but are selected after introduction of the nucleic acid into the cell designed to enable or probable the desired recombinant event. Isolated nucleic acid moieties encoding polypeptides having specific functions are described, for example, in Jasin, M., et al., U.S. Pat. 4,952,501] can be identified and isolated.

As used herein, the terms "protein" and "polypeptide" are synonymous. A "peptide" is defined as a fragment or portion of a polypeptide, preferably a fragment or portion having one or more functional activities (eg, proteolysis, attachment, fusion, antigenic or intracellular activity) as a complete polypeptide sequence.

The terms "patient" or "subject" are used interchangeably and refer to mammals, such as human patients and non-human primates, as well as experimental and other animals, such as rabbits, rats, and mice.

As used herein, a "biological sample" is a sample of biological tissue or fluid containing, for example, Akt3 and / or B-Raf nucleic acid or polypeptide of a melanoma cancer protein, polynucleotide or transcript. The sample includes, but is not limited to, tissue isolated from a human. Biological samples may also include biopsy and autopsy samples, frozen sections obtained for histological purposes, tissue sections such as blood, plasma, serum, sputum, feces, mucus, hair, skin, and the like. Biological samples also include sections derived from patient tissue and primary and / or transformed cell cultures. Biological samples are typically eukaryotic organisms, preferably eukaryotes, such as fungi, plants, insects, protozoa, birds, fish, reptiles and preferably mammals such as rats, mice, cattle, dogs, guinea pigs or rabbits, And most preferably from primates such as chimpanzees or humans.

"Cancer" or "malignant tumor" is used synonymously with any of the uncontrolled abnormal proliferation of cells, as well as the ability of infected cells to spread (ie metastasize) to other parts of the body locally or through the bloodstream and lymphatic system. Reference is made to any of a number of diseases characterized by a number of structural and / or molecular characteristics characteristic. A "cancerous" or "malignant cell" is understood as a cell that does not differentiate and has certain structural properties that can invade and metastasize. Examples of cancers include skin cancer, kidney cancer, colon cancer, breast cancer, prostate cancer and liver cancer (see DeVita, V. et al. (Eds.), 2001, Cancer Principles and Practice of Oncology, 6th. Ed., Lippincott Williams & Wilkins, Philadelphia, Pa .; the above references are incorporated herein by reference in their entirety for all purposes).

"Apoptosis" and "cell proliferation (PCD)" are used as synonyms and describe molecular and morphological processes that induce controlled cell self-destruction (see, eg, Kerr JFR et al., 1972, Br J Cancer. 26: 239-257). Apoptotic cell death can be induced by various stimuli such as ligation of cell surface receptors, starvation, growth factor / survival deprivation, heat shock, hypoxia, DNA damage, viral infections, and cytotoxic / chemotherapeutic agents. Apoptotic processes involve embryonic formation, differentiation, proliferation / always, removal of defects and thus noxious cells, and in particular the regulation and function of the immune system. Thus, dysfunction or deregulation of apoptotic programs is associated with various pathological conditions such as immunodeficiency, autoimmune diseases, neurodegenerative diseases and cancer. Apoptotic cells can be recognized by homotypical morphological changes: cell contractions indicating malformations and incorrect contact with their neighboring cells. Its chromatin diminishes and finally fragments into dense membrane-sealed tissue called "apoptotic sieves" containing the cytoplasm, diminished chromatin and organelles. Apoptotic bodies are phagocytosed by macrophages and do not cause inflammatory responses and are removed from tissues. This is in contrast to the manner of necrosis of cell death in which cells suffer major damage that results in loss of membrane integrity, expansion and destruction of the cells. During necrosis, the cell contents are released unregulated out of the cell, which causes damage to surrounding cells and a strong inflammatory response in the corresponding tissue. See, eg, Tomei L. D. and Cope F. O., eds., 1991, Apoptosis: The Molecular Basis of Cell Death, Plainville, N. Y .: Cold Spring Harbor Laboratory Press; Isaacs J. T., 1993, Environ Health Perspect. 101 (suppl5): 27-33; Each of which is incorporated herein by reference in its entirety for all purposes. Various apoptosis assays are well known to those of skill in the art (eg, DNA fragmentation assays, radioactivity proliferation assays, DNA laddering assays for treated cells, 4′-6-diimidino-2-phenylindole (DAPI)). Fluorescence microscopic assay of stained cells, etc.).

“Conservatively modified variants” apply to both amino acid and nucleic acid sequences. In the context of certain nucleic acid sequences, conservatively modified variants refer to nucleic acids that encode identical or essentially identical amino acid sequences, or if the nucleic acid does not encode amino acids, to essentially identical sequences. Due to the degradation of the genetic code, multiple functionally identical nucleic acids encode any given polypeptide. For example, codons CGU, CGC, CGA, CGG, AGA, and AGG all encode the amino acid arginine. Thus, at all positions where arginine is specified by a codon, the codon can be altered to any corresponding codon described without altering the polypeptide to be encoded. The nucleic acid mutation is a "silent substitution" or "silent variation" which is one "conservatively modified variation". All polynucleotide sequences described herein as encoding polypeptides can describe all silent variations unless otherwise noted. Thus, silent substitution is an implicit feature of all nucleic acid sequences encoding amino acids. Those skilled in the art will appreciate that standard techniques can modify each codon of a nucleic acid (except AUG, which is usually only a codon for methionine) to produce functionally identical molecules. In some embodiments, the nucleotide sequence encoding the enzyme is preferably optimized for expression in the particular host cell (eg, yeast, mammal, plant, fungus, etc.) used to provide the enzyme.

With respect to amino acid sequences, those skilled in the art will appreciate that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide or protein sequence that alters, adds or deletes a single amino acid or a small proportion of amino acids in the encoded sequence, are such chemical modifications It will be appreciated that "conservatively modified variations" result in substitution of amino acids with similar amino acids. Conservative substitution lists that provide functionally similar amino acids are well known in the art. See, for example, Davids et al., Basic Methods in Molecular Biology "Appleton & Lange, Norwalk, Connecticut (1994). The above conservatively modified variants are in addition to the polymorphic variants of the present invention, two species. Homologs and alleles are not excluded.

Each of the following eight groups contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); And 8) cystine (C), methionine (M) (see, eg, Creighton, 1984, Proteins).

The term "identical" or percent "identity" with respect to two or more nucleic acid or polypeptide sequences is the same as measured using a BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection. About 70% identity to a particular region (e.g., the sequence of the melanoma-associated Akt3 gene) with a certain percentage of identical amino acid residues or nucleotides (ie, comparing and aligning the maximum match for a comparison window or directed region, Preferably 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , 99%, or more identity) two or more sequences or sequences. This sequence is then referred to as "substantially identical." This definition also refers to the complement of the test sequence. The definition also includes sequences with substitutions as well as sequences with deletions and / or additions. As described below, the preferred algorithm can account for gaps and the like. Preferably, identity is present over a region of at least about 25 amino acids or nucleotides in length, or more preferably between 50 and 100 amino acids or nucleotides in length.

For sequence comparison, typically one sequence functions as a control sequence and the test sequence is compared to it. When using a sequence comparison algorithm, test and control sequences are entered into a computer, if necessary, partial coordinates are displayed and sequence algorithm program parameters are displayed. Default program parameters may be used or alternative parameters may be indicated. The sequence comparison algorithm then calculates the percent sequence identity of the test compound relative to the control sequence based on the program parameters.

As used herein, “comparative window” includes a reference to any one segment of the number of consecutive positions selected from the group consisting of 20 to 600, generally about 50 to about 200, more generally about 100 to about 150; , Sequences can be compared with the same number of control sequences in consecutive positions after the two sequences are optimally aligned. Methods of aligning sequences for comparison are well known in the art. Optimal alignment of sequences for comparison is described, for example, in Smith & Waterman, 1991, Adv. Appi. Math. 2: 482, by the homology alignment algorithm of Needleman & Wunsch, 1970, J. Mol. Biol. 48: 443, by the search for similarity method of Pearson & Lipman, 1988, Proc. Nat'l. Acad. Sci. USA 85: 2444, by computerized implementations of these algorithms (GAP, BESTFIT, PASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.) And visual investigation (see, eg, Current Protocols in Molecular Biology (Ausubel et al., Eds. 1995 supplement).

Another algorithm suitable for determining percent sequence identity and sequence similarity is the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., 1977, Nuc. Acids Res. 25: 3389-3402 and Altschul et al., 1990, J. Mol. Biol. 215: 403-410, respectively. Software for performing BLAST analyzes is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). The algorithm involves identifying high scoring sequence pairs (HSPs) by first identifying short words of length W in the subject sequence, which is characterized by several positive-values when aligned with words of equal length in the database sequence. Comparable to or meet threshold score T. T is referred to as the neighborhood word score threshold (Altschul et al., Detailed above). The first neighbor word hit acts as a seed to initiate the search to find longer HSPs containing them. The word hits extend in both directions along each sequence only while the cumulative alignment score can be increased. Cumulative scores are calculated using the parameters M (compensation score for matching residue pairs; always> 0) and N (penalty score for mismatching residues; always <0) for nucleotide sequences. For amino acid sequences, the scoring matrix is used to calculate the cumulative score. When the cumulative alignment score drops from its maximum achieved value to X; When the cumulative score is less than or equal to zero due to accumulation of one or more negative-scoring residue alignments; Or when reaching the end of the sequence, the extension of the word hit in each direction is stopped. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (relative to nucleotide sequence) uses the word length (W) 11, predetermined value (E) 10, M = 5, N = -4 and comparisons of both strands as defaults. For amino acid sequences, the BLASTP program includes word length 3, a predetermined value (E) 10, and a BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989, Proc. Natl. Acad. Sci. USA 89: 10915). A comparison value of 50, predetermined value (E) 10, M = 5, N = -4, and both strands is used as a default.

The BLAST algorithm also performs statistical analysis of the similarity between the two sequences (see, eg, Karlin & Altschul, 1993, Proc. Nat'1. Acad. Sci. USA 90: 5873-5787). One dimension provided by the BLAST algorithm is the smallest total probability (P (N)), which indicates the probability by which a match between two nucleotide or amino acid sequences will occur by chance. For example, a nucleic acid is considered to be similar to a control sequence if the smallest total probability for comparison of test nucleic acid and control nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.

Meaning that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross-reactive with the antibody produced against the polypeptide encoded by the second nucleic acid as described below. Thus, the polypeptide is typically substantially the same as the second polypeptide, eg, the two peptides differ only in conservative substitutions. Another meaning that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under the stringent conditions described below. Another meaning that the two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequences.

The expression “selectively (or specifically) hybridizes” binds, duplexes, or binds a molecule only to a specific nucleotide sequence under stringent hybridization conditions when the sequence is present in a complex mixture (eg, whole cell or library DNA or RNA). Reference hybridization.

The expression “stringent hydration conditions” typically refers to conditions under which a probe hybridizes to its target subsequence, not to another sequence, in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and will vary in different situations. Long sequences hybridize specifically at higher temperatures. Extensive guidance on hybridization of nucleic acids is described in Tijssen, 1993, "Overview of principles of hybridization and the strategy of nucleic acid assays" in Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes. In general, stringent conditions are selected about 5-10 ° C. below the thermal melting point (T _M ) for a particular sequence at a defined ionic strength pH. T _M is the temperature at equilibrium (target sequence is present in excess in T _M and 50% of the probe is equilibrium) at which 50% of the probes complementary to the target hybridize to the target sequence (defined ionic strength, pH and Nucleic acid concentration). Stringent conditions have a salt concentration of less than about 1.0 M sodium ion concentration, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at a pH of 7.0 to 8.3, and for short probes (eg, 10 to 50 nucleotides) The temperature will be at least about 30 ° C. and for long probes (eg, greater than 50 nucleotides) at least about 60 ° C. Stringent conditions can also be achieved by adding destabilizing agents such as formamide. For selective or specific hybridization, the positive signal is at least 2 background, optionally 10 background hybridizations. Exemplary stringent hybridization conditions may be as follows: 50% formamide, 5X SSC, and 1% SDS, incubation at 42 ° C or 5X SSC, 1% SDS, incubation at 65 ° C, wash with 0.2X SSC, and 0.1% SDS at 65 ° C. The washing may be performed for 5, 15, 30, 60, 120 minutes or more. For PCR, the annealing temperature can vary from about 32 ° C. to 48 ° C. depending on the primer length, but a temperature of about 36 ° C. is typical for less stringent amplification. For more stringent PCR amplification, the more stringent annealing temperature may vary from about 50 ° C. to about 65 ° C., depending on the length and specificity of the primer, but a temperature of about 62 ° C. is typical. Conventional cycle conditions for both more stringent and less stringent amplifications include: denaturation for 30 seconds to 2 minutes at 90 ° C. to 95 ° C., annealing for 30 seconds to 2 minutes, and 1-2 minutes at about 72 ° C. During the extension.

Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is produced using the maximum codon degeneration allowed by the genetic code. In such cases, the nucleic acid is usually hybridized under moderately stringent hybridization conditions. Exemplary “moderately stringent hybridization conditions” include hybridization in a buffer of 40% formamide, 1M NaCl, 1% SDS at 37 ° C., and washing in 1 × SSC at 45 ° C. The washing may be performed for 5, 15, 30, 60, 120 minutes or more. Positive hybridization is in the background at least twice. Those skilled in the art will readily appreciate that alternative hybridization and washing conditions may be used to provide similar stringent conditions.

Standard references describing the general principles of recombinant DNA technology include: J. Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY ; P.B. Kaufinan et al., (Eds), 1995, Handbook of Molecular and Cellular Methods in Biology and Medicine, CRC Press, Boca Raton; M.J. McPherson (ed), 1991, Directed Mutagenesis: A Practical Approach, IRL Press, Oxford; J. Jones, 1992, Amino Acid and Peptide Synthesis, Oxford Science Publications, Oxford; B.M. Austen and O.M.R. Westwood, 1991, Protein Targeting and Secretion, IRL Press, Oxford; D. N Glover (ed), 1985, DNA Cloning, Volumes I and II; M.J. Gait (ed), 1984, Oligonucleotide Synthesis; B.D. Hames and S.J. Higgins (eds), 1984, Nucleic Acid Hybridization; Wu and Grossman (eds), Methods in Enzymology (Academic Press, Inc.), Vol. 154 and Vol. 155; Quirke and Taylor (eds), 1991, PCR-A Practical Approach; Hames and Higgins (eds), 1984, Transcription and Translation; R.I. Freshney (ed), 1986, Animal Cell Culture; Immobilized Cells and Enzymes, 1986, IRL Press; Perbal, 1984, A Practical Guide to Molecular Cloning; J.H. Miller and M.P. Calos (eds), 1987, Gene Transfer Vectors for Mammalian Cells, Cold Spring Harbor Laboratory Press; M.J. Bishop (ed), 1998, Guide to Human Genome Computing, 2d Ed., Academic Press, San Diego, Calif .; L.F. Peruski and A.H. Peruski, 1997, The Internet and the New Biology: Tools for Genomic and Molecular Research, American Society for Microbiology, Washington, D.C.

As used herein, the term "reduce Akt3 activity" refers to a reduction of about 25% to about 100% of Akt3 activity. The present invention relates to an Akt3 produced by a cell when (a) the agent reduces the level of Akt3 mRNA produced by the cell or the level of Akt3 protein when the agent is administered to the cell, or (b) the Akt3 produced by the cell when the agent is administered to the cell. any agent that affects the level of Akt3 mRNA or protein via the PI3K / Akt signal transduction pathway leading to a decrease in the level of mRNA or Akt3 protein, or (c) the activity of Akt3 via, for example, phosphorylation or dephosphorylation. Inhibition of Akt3 by any agent that decreases is contemplated. Agents that reduce the activity of the downstream pathway that removes products of Akt3 activity and that reduce the activity of the upstream pathway that provide a reactant for Akt3 are also within the scope of this term. Reduction or change in Akt3 activity can be measured by any known method, including but not limited to kinase assays, phosphorylation status in Western blots or protein expression levels.

The term "reduces V599E B-Raf activity" is used herein to refer to about 25% to about 100% reduction in B-Raf activity. The present invention relates to an agent that (a) reduces the level of V599E B-Raf mRNA or V599E protein produced by the cell when the agent is administered to the cell, or (b) the agent is administered by the cell when the agent is administered to the cell. Any agent that affects the level of B-Raf mRNA or protein via the MAPK or ERK signal transduction pathway resulting in a decrease in the level of V599E B-Raf mRNA or V599E protein levels produced, or (c) such as phosphorylation or Inhibition of B-Raf by any agent that reduces the activity of B-Raf via dephosphorylation is contemplated. Agents that reduce the activity of the downstream pathway to remove products of V599E B-Raf activity and to reduce the activity of the upstream pathway to provide a reactant for V599E B-Raf are also within the scope of the term. Reduction or change in B-Raf activity can be measured by any known method, including but not limited to kinase assays, phosphorylation status in western blots or protein expression levels.

The term “treatment of melanoma” refers to blocking, alleviating, ameliorating, arresting, inhibiting, retarding or diverting, or reducing the progression of tumors in mammals, increasing or inducing apoptosis in tumor cells. .

As used herein, the term "angiogenesis", when used with respect to reducing angiogenesis, lowers the amount of new angiogenesis that occurs in the presence of an agent than the amount of angiogenesis that occurs in the absence of an exogenously added agent. It means to reduce. Methods of measuring the amount of blood vessel formation in tissues by quantifying the number of blood vessels positively stained for CD-31 antigen or the area of tumors occupied by CD-31 positive blood vessels, including immunohistochemical methods, are widely used. Known.

Detection of Akt3 and / or B-Raf Nucleic Acids

In some embodiments of the invention, nucleic acids encoding full length Akt3 or B-Raf proteins derived from melanoma cells, or Akt3 or B-Raf polypeptides comprising any derivative, variant, homolog, or fragment thereof are used. will be. The nucleic acid can be used to generate Akt3 or B-Raf proteins, diagnostic assays, therapeutic applications, Akt3-specific or B-Raf-specific probes, assays for Akt3 or B-Raf binding and / or regulatory compounds, and other species. Or for identifying and / or isolating Akt3 or B-Raf homologs from mice and in any number of other applications, including other applications.

A. General Recombinant DNA Methods

Numerous applications of the present invention include cloning, synthesis, maintenance, mutation and other manipulations of nucleic acid sequences that can be performed using techniques conventional in the field of recombinant genes. Basic documents describing the general methods used in the present invention include Sambrook et al., Molecular Cloning, a Laboratory Manual (2nEd. 1989); Kriegler, 1990, Gene Transfer and Expression: a Laboratory Manual; and Current Protocols in Molecular Biology, 1995, (Ausubel et al., eds.).

Sizes for nucleic acids are given in kilobases (kb) or base pairs (bp). These are estimates derived from agarose or acrylamide gel electrophoresis, sequenced nucleic acids or published DNA sequences. The size for the protein is given as the number of kilo Daltons (kDa) or amino acid residues. Protein size is estimated from gel electrophoresis, sequenced protein, derived amino acid sequence, or published protein sequence.

Commercially available oligonucleotides are described for the first time in Beaucage & Caruthers, 1981, Tetrahedron Letts. 22: 1859-1862, using an automated synthesizer, as described in Van Devanter et al., 1984, Nucleic Acids Res. 12: 6159-6168, which may be chemically synthesized according to the solid phase phosphoramidite triester method described in the following. Purification of oligonucleotides is described in Pearson & Reanier, 1983, J. Chrom. 255: 137-149, by native acrylamide gel electrophoresis or anion-exchange HPLC.

Sequences of cloned genes and synthetic oligonucleotides can be demonstrated after cloning using, for example, a chain termination reaction that sequenced the double stranded template of Wallace et al., 1981, Gene 16: 21-26.

B. Isolation and Detection of Akt3 and / or B-Raf nucleotide Sequences

In some embodiments of the invention, Akt3 and / or B-Raf nucleic acids will be isolated and cloned using recombinant methods. Such embodiments may be used to isolate Akt3 and / or B-Raf polynucleotides, for example, during protein expression or to generate variants, derivatives, expression cassettes or other sequences derived from Akt3 and / or B-Raf. To monitor Raf gene expression, to determine Akt3 and / or B-Raf sequences in various species, for diagnostic purposes in patients, ie to detect mutations in Akt3 and / or B-Raf, or genotype And / or for forensic applications.

Polymorphic variants, alleles, and two homologs and nucleic acids substantially identical to Akt3 or B-Raf genes can be isolated using Akt3 or B-Raf nucleic acid probes and oligos by screening libraries under stringent hybridization conditions Nucleotides can be isolated. Alternatively, the expression library can be used to immunologically detect expressed homologs using antisera or purified antibodies prepared against Akt3 or B-Raf polypeptides that recognize and selectively bind Akt3 or B-Raf homologs. Can be used to clone Akt3 or B-Raf proteins, polymorphic variants, alleles and two homologs.

To prepare an Akt3 cDNA library, a source rich in Akt3 RNA should be selected. To prepare a B-Raf cDNA library, a source rich in B-Raf RNA must be selected. The mRNA is then cDNA using reverse transcriptase, ligated to the recombinant vector and transfected into the recombinant host for proliferation, screening and cloning. Methods for preparing and screening cDNA libraries are well known (see, eg, Gubler & Hoffman, 1983, Gene 25: 263-269; Sambrook et al., supra; Ausubel et al., supra).

For genomic libraries, DNA is extracted from tissue and mechanically sheared or enzymatically digested to produce fragments of about 12-20 kb. The fragments are then separated from the desired size by gradient centrifugation and composed of bacteriophage lambda vectors. The vector and phage are packaged in vitro. Recombinant phage is described in Benton & Davis, 1977, Science 196: 180-182. Colony hybridization is carried out as generally described in Grunstein et al., 1975, Proc. Natl. Acad. Sci. USA., 72: 3961-3965. By plaque hybridization.

More indirectly related Akt3 or B-Raf homologs may hybridize Akt3 probes or B-Raf probes using genome or cDNA libraries under moderately stringent conditions or from regions selective for Akt3 or B-Raf under less stringent conditions. Can be identified by any of a number of well-known techniques, including hybridization using specific probes generated with a probe, such as a C-terminal domain. Indirect homologs can also be amplified from nucleic acid libraries using a set of degenerate primers, ie, primers that include all possible codons that encode a given amino acid sequence based on a highly conserved amino acid stretch. Such primers are well known to those skilled in the art, and numerous programs are sold for the degenerate primer design, such as on the Internet.

In certain embodiments, Akt3 or B-Raf polynucleotides will be detected using a hybridization-based method, such as measuring Akt3 or B-Raf RNA levels, or detecting specific DNA sequences, such as for diagnostic purposes. For example, gene expression of Akt3 and / or B-Raf can be determined by quantitative PCR analysis (eg reverse transcriptase-TAQMAN ^™ amplification), dot blotting, in situ hybridization, RNase protection, Can be analyzed by techniques known in the art, such as Northern blotting, reverse transcription of mRNA and PCR amplification, including probing DNA microchip arrays and the like.

In another embodiment, high density oligonucleotide analysis techniques (eg, GeneChip ^™ ) can be used to identify orthologs, alleles, conservatively modified variants and polymorphic variants of Akt3 and / or B-Raf or Akt3 And / or to monitor the level of B-Raf mRNA. If homologs are associated with known diseases such as melanoma, they can be used in GeneChip ^™ as a diagnostic tool in detecting melanoma in biological samples, see, eg, Gunthand et al., 1998, AIDS Res. Hum. Retroviruses 14: 869-876; Kozal et al., 1996, Nat. Med. 2: 753-759; Matson et al., 1995, Anal. Biochem. 224: 110-106; Lockhart et al., 1996, Nat. Biotechnol. 14: 1675-1680; Gingeras et al., 1998, Genome Res. 8: 435-448; Hacia et al., 1998, Nucleic Acids Res. 26: 3865-3866.

Detection of Akt3 and / or B-Raf polynucleotides and polypeptides can include quantitative or qualitative detection of the polypeptide or polynucleotide, can include substantial comparisons with control values, or alternatively the detection itself is essentially It may be performed to indicate increased levels of Akt3 and / or B-Raf.

In certain embodiments, for example in the diagnosis of melanoma cancer, the level of Akt3 and / or B-Raf polynucleotide, polypeptide, or protein activity will be quantified. In this embodiment, the difference between elevated levels of Akt3 and / or B-Raf and normal control levels will preferably be statistically significant. Typically, at least about a level of Akt3 and / or B-Raf polypeptide or polynucleotide in a biological sample is present in a diagnostic sample, i.e., overexpression or increase in Akt3 and / or B-Raf polypeptide or nucleic acid is expected in a noncancerous sample. An increase of 1.5, 2, 3, 5, 10 or more times is shown. Detection of Akt3 and / or B-Raf may be performed in vitro, ie, in cells or in vivo in biological samples obtained from a patient. In one embodiment, the increased levels of Akt3 and / or B-Raf are used as diagnostic markers of Akt3 and / or B-Raf, respectively. As used herein, “the presence of a diagnostic phase” refers to any Akt3 and / or B-Raf level that is higher than expected in noncancerous samples. In one embodiment, the assay for Akt3 or B-Raf polypeptide or polynucleotide in a biological sample detects that the level of normal Akt3 or B-Raf polypeptide or polynucleotide, ie, noncancerous, i.e., typical levels of a sample without cancer. Under conditions that do not. Thus, in this assay, the detection of any Akt3 and / or B-Raf polypeptide or nucleic acid in a biological sample is indicative of diagnostic presence, or increased levels.

As described below, any of a number of methods for detecting Akt3 and / or B-Raf can be used. Akt3 and / or B-Raf polynucleotide levels can be detected by detecting any homologue Akt3 or B-Raf DNA or RNA, including Akt3 genomic DNA, mRNA, and cDNA. Akt3 or B-Raf polypeptides can be detected by detecting Akt3 and / or B-Raf polypeptides themselves or by detecting Akt3 and / or B-Raf protein activity. Detection may include quantification of Akt3 and / or B-Raf levels (eg, genomic DNA, cDNA, mRNA, or protein levels, or protein activity), or alternatively qualitative of Akt3 and / or B-Raf levels Assessment, or in particular the assessment of the presence or absence of Akt3 and / or B-Raf compared to control levels. Any number of methods for detecting any of the above can be used as described below. Such methods include, for example, hybridization, amplification, and other assays.

In certain embodiments, the ability to detect increased levels, or diagnostic presence in cells, is used as a marker for cancer cells, ie to monitor the number or localization of cancer cells in a patient as detected in vivo or in vitro. Used for.

Typically, the Akt3 polynucleotide or polypeptide detected herein is at least about 50, 100, 200 or more nucleotides, or at least about 70% identical over a region of 20, 50, 100 or more amino acids, to the naturally occurring Akt3 gene, Preferably 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , 99% or more the same. Such polynucleotides or polypeptides may represent Akt3, or any variant, derivative or fragment thereof, in functional or non-functional form.

1. Detection of copy number

In one embodiment, eg, to confirm the diagnosis or presence of cancer, the number of copies, ie the number of Akt3 genes in a cell, is measured. In general, for a given common gene, the animal has two copies of each gene. However, copy number may be increased, for example, by gene amplification or duplication in cancer cells, or may be reduced by deletion. Methods of assessing the number of copies of a particular gene are well known to those skilled in the art, and among others, hybridization- and amplification-based assays.

a) hybridization-based assay

Any number of hybridization-based assays can be used to detect the copy number of the Akt3 gene or Akt3 gene in cells of a biological sample. One such method is Southern blot. In Southern blots, genomic DNA is typically fragmented, separated by electrophoresis, transferred to the membrane, and then hybridized to Akt3-specific probes. For determination of the number of copies, the intensity of the hybridization signal from the probe for the target region is compared with the signal from the control probe for normal genomic DNA regions (eg, unamplified portions of the same or related cells, tissues, organs, etc.). Compare relative Akt3 copy numbers. Southern blot methods are well known in the art and are described, for example, in Ausubel et al., Or Sambrook et al., Detailed above.

An alternative method for determining the copy number of the Akt3 gene in a sample is in situ hybridization or FISH, such as fluorescent in situ hybridization. In situ hybridization assays are well known (eg, Angerer, 1987, Meth. Enzymol 152: 649). In situ hybridization generally involves the following main steps: (1) fixation of the tissue or biological structure to be analyzed; (2) charge hybridization of biological structures to increase accessibility of target DNA and reduce nonspecific binding; (3) hybridization of nucleic acid mixtures to nucleic acids in biological structures or tissues; (4) post-hybridization washes to remove unbound nucleic acid fragments in hybridization; And (5) detection of hybridized nucleic acid fragments.

The probes used for this application are typically labeled with, for example, radioisotopes or fluorescent reporters. Preferred probes are sufficiently long, such as from about 50, 100, or 200 nucleotides to about 1000 or more nucleotides, specifically hybridizing to the target nucleic acid (s) under stringent conditions.

The present invention contemplates a “comparison probe” method, for example where comparative genomic hybridization (CGF) is used to detect Akt3 gene amplification. In comparative genomic hybridization methods, a "test" collection of nucleic acids is labeled with a first label, while a second collection (eg, obtained from healthy cells or tissues) is labeled with a second label. The rate of hybridization of the nucleic acid is determined by the ratio of the first and second labels that bind each fiber in the array. For example, test samples detect differences in signal ratios from two labels due to gene amplification, which provides a measure of the number of Akt3 gene copies.

Hybridization protocols suitable for use in the methods of the present invention are described, for example, in Albertson, 1984, EMBO J. 3: 1227-1234; Pinkel, 1988, Proc. Natl. Acad. Sci. USA 85: 9138-9142; EPO Pub. No. 430,402; Methods in Molecular Biology, Vol. 33: In Situ Hybridization Protocols, Choo, Ed., 1994, Humana Press, Totowa, N.J. And the like.

b) amplification-based assay

In another embodiment, an amplification-based assay is used to detect Akt3 or determine the number of copies of the Akt3 gene. In this assay, the Akt3 nucleic acid sequence functions as a template for an amplification reaction (eg, polymerase chain reaction, or PCR). In quantitative amplification, the amount of amplification product will be proportional to the amount of template of the original sample. Comparison with the appropriate control provides a measure of the copy number of the Akt3 gene. Quantitative amplification methods are well known to those skilled in the art. Detailed protocols for quantitative PCR are provided in, for example, Innis et al., 1990, PCR Protocols: A Guide to Methods and Applications, Academic Press, Inc. N.Y. The nucleic acid sequence for Akt3 is sufficient for those skilled in the art to routinely select primers for amplifying any portion of the gene.

In some embodiments, TaqMan based assays are used to quantify Akt3 polynucleotides. TaqMan based assays utilize fluorescent oligonucleotide probes containing a 5 'fluorescent dye and a 3' quenching agent. The probe hybridizes to the PCR product but cannot extend itself due to the blocking agent at the 3 'end. When the PCR product is amplified in subsequent cycles, the 5 ′ nuclease activity of the polymerase, such as AmpliTaq, results in cleavage of the TaqMan probe. This cleavage separates the 5 'fluorescent dye and the 3' quenching agent, thereby increasing the fluorescence as a function of amplification (see, eg, Perkin-Elmer, such as the literature provided at www.perkin-elmer.com).

Other suitable amplification methods contemplated by the present invention include ligase chain reaction (LCR) (Wu and Wallace, 1989, Genomics 4: 560, Landegren et al., 1988, Science 241: 1077, and Barringer et al. , 1990, Gene 89: 117), transcriptional amplification (Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86: 1173), self-floating sequence replication (Guatelli et al., 1990, Proc. Nat. Acad. Sci. USA 87: 1874), dot PCR, and linker adapter PCR, and the like.

2. Detection of Akt3 and / or B-Raf Expression

a) direct hybridization-based assay

Methods of detecting and / or quantifying the levels of Akt3 and / or B-Raf gene transcripts (mRNA or cDNA produced therefrom) using nucleic acid hybridization techniques are known to those skilled in the art (see Sambrook et al., 1989). , Molecular Cloning: A Laboratory Manual, 2D Ed., Vols 1-3, Cold Spring Harbor Press, New York.

For example, one method of measuring the presence, absence, or amount of Akt3 cDNA is the Northern blot. In short, in a typical embodiment, mRNA is isolated from a given biological sample, electrophoresis separates the mRNA species and is transferred from the gel to the nitrocellulose membrane. Labeled Akt3 probes are then hybridized to the membrane to identify and / or quantify mRNA.

b) amplification-based assay

In another embodiment, Akt3 and / or B-Raf transcripts (eg Akt3 mRNA) are detected using amplification-based methods (eg RT-PCR). RT-PCR methods are well known to those skilled in the art (see for example Ausubel et al., Detailed above). Preferably, quantitative RT-PCR can be used to compare the level of mRNA in a sample to a control sample or value.

3. Detection of Akt3 and / or B-Raf Polypeptide Expression

In addition to the detection of Akt3 and / or B-Raf genes and gene expression using nucleic acid hybridization techniques, Akt3 and / or B-Raf levels can be detected and / or quantified by detecting or quantifying polypeptides. Akt3 and / or B-Raf polypeptides are detected and quantified by any of a number of means well known to those skilled in the art. These include analytical biochemistry such as electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), high diffusion chromatography, or fluid or gel precipitin reactions, immunodiffusion (single or dual). ), Immunoelectrophoresis, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, Western blot and the like. Akt3 polypeptide detection is discussed below.

C. Expression in Prokaryotes and Eukaryotes

In some embodiments, it is desirable to prepare Akt3 and / or B-Raf polypeptides using recombinant techniques. In order to obtain high levels of expression of a cloned gene or nucleic acid, such as cDNA encoding an Akt3 or B-Raf polypeptide, Akt3 or B-Raf sequences are typically potent promoters for transcription, transcription / translation terminator, and When associated with a nucleic acid encoding a protein, it is subcloned into an expression vector containing a ribosomal binding site for initiation of translation. Suitable bacterial promoters are well known in the art and are described, for example, in Sambrook et al. and Ausubel et al. Bacterial expression systems are available, for example, for expressing Akt3 proteins of E. coli , Bacillus sp. And Salmonella (Palva et al., 1983, Gene 22: 229-235; Mosbach et al., 1983, Nature 302: 543-545). Kits for such expression systems are commercially available.

Eukaryotic expression systems for mammalian cells, yeast and insect cells are well known in the art and are also commercially available. In one embodiment, the eukaryotic expression vector is an adenovirus vector, adeno-associated vector or retroviral vector.

For therapeutic applications, Akt3 and / or B-Raf nucleic acids are introduced into cells in vitro, in vivo or ex vivo, wherein infection with viral vectors, liposome-based methods, biolistic particle acceleration (genes) Total), and any of a number of methods, including but not limited to naked DNA injections. Such therapeutically useful nucleic acids include coding sequences for full length Akt3 or B-Raf, coding sequences for Akt3 or B-Raf fragments, domains, derivatives or variants, Akt3 or B-Raf antisense sequences, Akt3 or B-Raf siRNA Sequences, and Akt3 or B-Raf ribozymes, but are not limited to these. Typically, the sequence will be operably linked to a promoter, but in many applications the nucleic acid will be administered directly to a therapeutically effective cell, such as a specific antisense, siRNA or ribozyme molecule.

The promoter used for direct expression of heterologous nucleic acid depends on the particular application. The promoter is arbitrarily positioned at about the same distance from the heterologous transcription initiation site as it comes from the transcription initiation site in its natural setting. However, as is known in the art, slight variations in the distance can be accommodated without compromising promoter function.

In addition to the promoter, the expression vector typically contains a transcription unit or expression cassette containing all the additional elements required for the expression of Akt3-encoding or B-Raf-encoding nucleic acid in the host cell. Thus, conventional expression cassettes contain promoters operably linked to nucleic acid sequences encoding Akt3 or B-Raf polypeptides, and signals required for effective polyadenylation, ribosomal binding sites, and translation termination of transcripts. Nucleic acid sequences encoding Akt3 or B-Raf polypeptides can be linked to cleavable signal peptide sequences to facilitate secretion of the protein encoded by the transfected cells. Additional elements of the cassette may include enhancers and introns and receptor sites with functional splice donors when genomic DNA is used as the structural gene.

In addition to the promoter sequence, the expression cassette must also contain the transcription termination region downstream of the structural gene to provide effective termination. The termination region can be obtained from the same gene as the promoter sequence or from different genes.

The particular expression vector used to carry the genetic information into the cell is not particularly important. Any conventional vector used for expression in prokaryotic or eukaryotic cells can be used. For example, useful expression vectors may consist of chromosomal segments, non-chromosomes, and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids such as E. coli plasmid col E1, pCRI, pBR322, pMal-C2, pET, pGEX (Smith et al., 1988, Gene 67: 31-40) , plasmids such as pMB9 and derivatives thereof, RP4; Phage DNAS such as numerous derivatives of phage 1 such as NM989, and other phage DNA such as M13 and filamentary single stranded phage DNA; Yeast plasmids such as 2m plasmid or derivatives thereof; Vectors useful for eukaryotic cells, such as vectors useful for insect or mammalian cells; Vectors derived from a combination of plasmid and phage DNA, such as plasmid modified to apply phage DNA or other expression control sequences; And so on. For example, a mammalian expression vector contemplated for use in the present invention may be a vector having an inducible promoter such as a dihydrofolate reductase (DHFR) promoter, such as any expression vector with a DHFR expression vector, or a DHFR. / Methotrexate co-amplification vectors such as pED (PstI, SalI, SbaI, SmaI, and EcoRI cloning sites, vectors that express both cloned genes and DHFR; see Kaufman, Current Protocols in Molecular Biology, 16.12 (1991)) have. Alternatively, glutamine synthetase / methionine sulfoximine co-amplification vectors such as pEE14 (HindIII, XbaI, SmaI, SbaI, EcoRI, and BclI cloning sites, wherein the vector expresses glutamine synthase and cloned genes; Celltech There is). In another embodiment, a vector that induces episomal expression under the control of Epstein Barr virus (EBV), such as pREP4 (BamHl, SfiI, XhoI, NotI, NheI, HindIII, NheI, PvuII, and KpnI cloning site, constituent loose) Sarcoma virus long terminal repeat (RSV-LTR) promoter, hygromycin selective marker; Invitrogen), pCEP4 (BanmH1, SfiI, XhoI, NotI, NheI, HindIII, NheI, PvuII, and KpnI cloning site, constituent human cytomegalovirus (hCMV) immediate early gene, hygromycin selective marker; Invitrogen), pMEP4 (KpnI, PvuI, NheI, HindIII, NotI, XhoI, SfiI, BamHl cloning site, inducible metallothionein IIa gene promoter, hygromycin Selective marker; Invitrogen), pREP8 (BamHl, XhoI, NotI, HindIII, NheI, and KpnI cloning site, RSV-LTR promoter, histidinol selective marker; Invitrogen), pREP9 (KpnI, NheI, HindIII, NotI, XhoI , SfiI, and BamHI cloning site, RSV-LTR promo , G418 selection marker; Invitrogen a); Invitrogen), and pEBVHis (RSV-LTR promoter, hygromycin N- terminal peptide selection markers, can be purified by ProBond resin and cleaved by enterokinase are kinases. Selective mammalian expression vectors for use in the present invention include pRc / CMV (HindIII, BstXI, NotI, SbaI, and ApaI cloning sites, G418 selection; Invitrogen), pRc / RSV (HindIII, SpeI, BstXI, NotI, XbaI cloning Sites, G418 selection; Invitrogen), and others, but not limited to these. Vaccinia virus mammalian expression vectors (see, KauEinan, 1991, detailed above) contemplated herein include pSC11 (SmaI cloning site, TK- and .beta.-gal selection), pMJ601 (SalI, SmaI, AflI, NarI, BspMII, BamHI, ApaI, NheI, SacII, KpnI, and HindIII cloning sites; TK- and beta (β) -gal selection), and pTKgptFlS (EcoRI, PstI, SalI, AccI, HindII, SbaI, BamHII, and Hpa cloning sites , TK or XPRT), but is not limited thereto.

Elements commonly included in expression vectors also include insertions of replicons that function in E. coli , genes encoding antibiotic resistance that allow selection of bacteria that provide recombinant plasmids, and eukaryotic sequences. There is a unique restriction site of the non-essential region of the permissible plasmid. The particular antibiotic resistance gene chosen is not critical and any of a number of resistance genes known in the art are suitable. Prokaryotic sequences are optionally chosen so that they do not interfere with the replication of DNA in prokaryotic cells, if necessary.

Once a particular recombinant DNA molecule has been identified and isolated, various methods known in the art can be used to propagate it. Once suitable host systems and growth conditions are established, recombinant expression vectors can be propagated to produce large amounts. To mention some of those known to those skilled in the art as expression vectors that can be used, there are but are not limited to the following vectors or derivatives thereof: human or animal viruses such as vaccinia virus or adenovirus; Insect viruses such as baculovirus; Yeast vectors; Bacteriophage vectors (eg, lambda), plasmid and cosmid DNA vectors.

In addition, host cell strains may be selected that modulate the expression of the inserted sequences or modify and process the gene product in the specific manner desired. Different host cells have characteristic and specific mechanisms for translation and post-translational processing and modification of proteins. Suitable cell lines or host systems can be chosen to ensure the desired modification and processing of the foreign protein expressed. Expression in yeast can provide a biologically active product. Expression in eukaryotic cells can increase the likelihood of "unique" folding. Moreover, expression in mammalian cells can provide a tool for reconstituting or constructing Akt3 and / or B-Raf activity in melanoma. In addition, different vector / host expression systems can perform processing reactions such as proteolytic cleavage to different degrees.

Standard transfection methods are used to generate bacterial, mammalian, yeast or insect cell lines expressing large amounts of Akt3 or B-Raf proteins, which are then purified using standard techniques (see, eg, Colley et al., 1989). , J. Biol. Chem. 264: 17619-17622; "Guide to Protein Purification," in Methods in Enzymology, Vol. 182, 1990 (Deutscher, Ed.)). Transformation of eukaryotic and prokaryotic cells is performed according to standard techniques (see, eg, Morrison, 1977, J. Bact. 132: 349-351; Clark-Curtiss & Curtiss, Methods in Enzymology 101: 347-362,1983 (Wu et al., eds.)).

Any well known process for introducing a foreign nucleotide sequence into a host cell can be used. This includes reagents such as Superfect (Qiagen), liposomes, calcium phosphate transfection, polybrene, protoplasm fusion, electroporation, microinjection, plasmid vectors, viral vectors, bioplastic particle acceleration (gene guns) Or the use of other well known methods of introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into host cells (see, eg, Sambrook et al., Detailed above).

After introducing the expression vector into the cells, the transfected cells are cultured under conditions that promote expression of Akt3 and / or B-Raf polypeptide and recovered from the culture using standard techniques identified below. Methods of culturing prokaryotic or eukaryotic cells are well known and are described, for example, in Ausubel et al., Sambrook et al., And in Freshney, 1993, Culture of Animal Cells, 3. sup.rd.Ed., A Wiley- Liss Publication.

Any well known process for introducing a foreign nucleotide sequence into a host cell can be used to introduce a vector, such as a target vector, into a cell. Any well-known process of introducing a foreign nucleotide sequence into a host cell can be used. As provided below, nucleic acids of the invention can be introduced into cells via any gene transfer mechanism, such as virus mediated gene transfer, calcium phosphate mediated gene transfer, electroporation, microinjection or proteoliposomes. The transduced cells can then be fused (eg, in a pharmaceutically acceptable carrier) or transplanted homotopically back into the subject by standard methods for the cell or tissue type. Standard methods for implantation or fusion of various cells into a subject are known.

Delivery of nucleic acids or vectors to cells can be accomplished by a variety of mechanisms. As an example, commercially available liposome preparations such as lipofectin, lipofectamine (GIBCO-BRL, Inc., Gaithersburg, Md.), Superfects (Qiagen, Inc. Hilden, Germany) and transfectam (Promega Biotec, Inc. , Madison, Wis.) As well as via liposomes developed according to standard procedures in the art. In addition, the nucleic acid or vector of the present invention is gentronics, Inc. It can be delivered in vivo by a sonoporation machine (ImaRx Pharmaceutical Corp., Tucson, Ariz.) As well as electroporation, a technology commercially available from Genetronics, Inc., San Diego, Calif.

As an example, vector delivery can be via a viral system such as a retroviral vector system capable of packaging a recombinant retroviral genome (see eg, 62, 63). Recombinant retroviruses can then be used to infect and deliver nucleic acids to infected cells. Of course, the exact method of introducing nucleic acids into mammalian cells is not limited to the use of retroviral vectors. Other techniques can be widely used in the process, including the use of adenovirus vectors, adeno-associated virus (AAV) vectors, lentiviral vectors, pseudotype retroviral vectors. Physical transduction techniques such as liposome delivery and receptor mediated and other endocytosis mechanisms can also be used. The present invention can be used with any of the above or other gene delivery methods commonly used.

Induction of Apoptosis in Cancer Cells by Reducing Akt3 Activity Levels in Cells

In one embodiment, the present invention provides a method of inducing apoptosis in melanoma tumor cells by contacting a cell with an agent that reduces Akt3 activity. In a preferred embodiment, the agent is an siRNA molecule.

siRNA polynucleotides are RNA nucleic acid molecules that mediate the effects of RNA interference, a gene silencing mechanism after transcription. siRNA polynucleotides preferably include, but are not intended to include, but are not limited to, double stranded RNA (dsRNA) (see, eg, Martinez et al. Cell 110: 563-74 (2002)). siRNA polynucleotides are nucleotides provided herein (ribonucleotides or deoxyribonucleotides or a combination of both) and / or nucleotide analogues (such as oligonucleotides or polynucleotides, etc., typically 5 'to 3' phosphodiester bonds) Other naturally occurring recombinant or synthetic single stranded or double stranded polymers. Thus, certain exemplary sequences described herein as DNA sequences capable of inducing transcription of embodiments of siRNA polynucleotides of the invention also provide corresponding RNA sequences and theirs, provided the well established nature of complementary nucleotide base pairs is provided. It will be understood that it is intended to represent the complement. siRNA can be transcribed using as a template DNA (genome, cDNA or synthetic) containing an RNA polymerase promoter, eg, a U6 promoter or an H1 RNA polymerase III promoter, or the siRNA is synthetically derived RNA It may be a molecule. In certain embodiments, siRNA polynucleotides of the invention may have blunt ends, that is, each nucleotide in one strand of the duplex is perfectly complementary to the nucleotides of the opposite strand (eg, Watson). By creep base pairs). In another specific embodiment, one or more strands of the siRNA polynucleotides of the invention are “overhanged” (ie, complementary to the opposite strand) of one or preferably both strands of the siRNA polynucleotides. One or more, and preferably two nucleotides. In another specific embodiment of the invention, each strand of the siRNA polynucleotide duplex has a 2-nucleotide protruding at the 3 'end. The 2-nucleotide overhang may preferably also include thymidine dinucleotide (TT), but other bases such as TC dinucleotide or TG dinucleotide or any other dinucleotide. For a discussion of the 3 'end of siRNA polynucleotides see eg WO 01/75164.

Preferred siRNA polynucleotides are from about 18 to 30 nucleotide base pairs, preferably from about 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 base pairs, and in other preferred embodiments about 19, 20, 21, 22 or 23 base pairs, or about 27 base pairs of double stranded oligomeric nucleotides, wherein the use of the "about" described above indicates, in certain embodiments, the expression of a selected polypeptide under certain conditions. Processing steps that can generate functional siRNA polynucleotides that may interfere may not be effective at all. Thus, according to a non-limiting theory, depending on differences in processing, biosynthesis or artificial synthesis, for example, "about" 18, 19, 20, 21, 22, 23, 24 or 25 base pairs of siRNA polynucleotides are one in length. And one or more siRNA polynucleotide molecules, which may differ by two, three or four base pairs (eg, by nucleotide insertion or deletion). SiRNA polynucleotides contemplated herein may also include polynucleotide sequences that differ by one, two, three or four nucleotides differing from a particular sequence (eg, by nucleotide substitutions including variations or modifications). And the difference is the position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 of the specific siRNA polynucleotide sequence, regardless of whether it is placed in the sense or antisense strand of the double stranded polynucleotide. , Any of 13, 14, 15, 16, 17, 18, or 19, or depending on the length of the molecule, occurs at positions 20, 21, 22, 23, 24, 25, 26, or 27 of the siRNA polynucleotides. . Nucleotide substitutions may be found in only one strand of a double stranded polynucleotide as an example in the antisense strand, and the complementary nucleotides in which the substitution nucleotides typically form hydrogen bond base pairs may not necessarily be correspondingly substituted in the sense strand. In a preferred embodiment, siRNA polynucleotides are homologous to a particular nucleotide sequence. As described herein, preferred siRNA polynucleotides interfere with the expression of Akt3 polypeptides of the invention. The polynucleotide may also be used as a probe or primer.

Polynucleotides, which are siRNA polynucleotides of the invention, in certain embodiments include single stranded oligonucleotide fragments (e.g., about 18 to 30 nucleotides, including any and all integers in between, including 18 and 30) Should be understood) and typically its reverse complement separated by a spacer sequence. According to this particular embodiment, cleavage of the spacer provides single stranded oligonucleotide fragments and their inverse complements, which form the double stranded siRNA polynucleotides of the invention (optionally the 3 'end and / or 5 of each strand or both strands). 'With an additional processing step capable of adding or removing one, two, three or more nucleotides from the ends). In certain embodiments, the spacers anneal the fragment and its inverse complement to add the cleavage (and, optionally, one, two, three, four or more nucleotides from the 3 'end and / or 5' end of each strand or both strands, or Having a length capable of forming a double stranded structure (such as, for example, hairpin polynucleotides) prior to subsequent processing steps that can be removed. Thus, the spacer sequence can be any polynucleotide sequence provided herein that is placed between two complementary polynucleotide sequence regions comprising siRNA polynucleotides when annealed to a double stranded nucleic acid. Preferably the spacer sequence is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21-25, 26-30, 31-40, 41-50, 51-70, 71-90, 91-110, 111-150, 151-200 or more nucleotides, but may include four or more nucleotides. Examples of siRNA polynucleotides derived from a single nucleotide strand comprising two complementary nucleotide sequences separated by a spacer are described in, eg, Brummelkamp et al., 2002 Science 296: 550; Paddison et al., 2002 Genes Develop. 16: 948; Paul et al. Nat. Biotechnol. 20: 505-508 (2002); Grabarek et al., BioTechniques 34: 734-44 (2003).

Polynucleotide variants may contain one or more substitutions, additions, deletions and / or insertions without substantially degrading the activity of the siRNA polynucleotides as described above. The effect on the activity of siRNA polynucleotides can be generally assessed as described herein or using conventional methods. The variant preferably exhibits at least about 75%, 78%, 80%, 85%, 87%, 88% or 89% identity with a portion of the polynucleotide sequence encoding native Akt3, more preferably at least about 90 %, 92%, 95%, 96%, 97%, 98% or 99% identity. Percent identity can be readily determined by comparing the sequences of polynucleotides with corresponding portions of full-length Akt3 polynucleotides, such as those known in the art and cited herein, wherein computer algorithms such as the NCBI Web, which are well known to those skilled in the art Align or BLAST algorithms (Altschul, J. Mol. Biol.) Commercially available at the site (see [Online] Internet: <URL: http: //www/ncbi.nlm.nih.gov/cgi-bin/BLAST). 219: 555-565, 1991; Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915-10919, 1992). Default parameters can be used.

Certain siRNA polynucleotide variants are substantially homologous to some of the native PTP1B genes. Single-stranded nucleic acids derived from (eg, by thermal denaturation) polynucleotide variants can be hybridized to naturally occurring DNA or RNA sequences (or complementary sequences) encoding native Akt3 polypeptides under moderately stringent conditions. Polynucleotides detectably hybridized under moderately stringent conditions are 10 or more consecutive nucleotides complementary to a particular polynucleotide, more preferably 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 Have a nucleotide sequence comprising 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides. In certain preferred embodiments, the sequence (or complement thereof) will be unique to an Akt polypeptide in which interference of expression is desired, and in certain preferred embodiments, the sequence (or complement thereof) is Akt3 and one in which interference of polypeptide expression is desired It can be shared by the above Akt3 isoforms. In certain preferred embodiments, the sequence (or complement thereof) will be unique to a B-Raf polypeptide in which interference of expression is desired, and in certain preferred embodiments, the sequence (or complement thereof) is B in which interference of polypeptide expression is desired. -Raf and one or more B-Raf isotypes.

Moderately stringent conditions that are considered suitable include, for example, pre-washing in a solution of 5 × SSC, 0.5% SDS, 1.0 mM EDTA, pH 8.0; Hybridization (eg overnight) at 50 ° C.-70 ° C., 5 × SSC for 1-16 hours; This is followed by one or two washes with at least one of 2x, 0.5x and 0.2x SSCs containing 0.05-0.1% SDS, respectively, for 20-40 minutes at 22-65 ° C. To be more stringent, the conditions may include washing in 0.1 × SSC and 0.1% SDS at 50-60 ° C. for 15-40 minutes. As is known to those skilled in the art, differences in stringency of hybridization conditions can be achieved by changing the time, temperature and / or concentration of the solution used in the pre-hybridization, hybridization and washing steps. Suitable conditions will also depend in part on the probe used and the particular nucleotide sequence of the blotted and probanded nucleic acid sample. Thus, suitably stringent conditions are readily available without undue experimentation, based on their ability to hybridize to one or more specific proband sequences when the desired selectivity of the probe is identified, but not to other specific proband sequences. It will be appreciated that it may be chosen.

Sequence specific siRNA polynucleotides of the invention can be designed using one or more of several standards. For example, to design an siRNA polynucleotide having 19 consecutive nucleotides identical to the sequence encoding the polypeptide of interest (eg, Akt3 and other polypeptides described herein), one or more open reading frames of the polynucleotide sequence may be used. Scanning may be performed for 21-base sequences having the following characteristics: (1) an A + T / G + C ratio of approximately 1: 1, but no more than 2: 1 or 1: 2; (2) AA dinucleotide or CA dinucleotide at the 5 'end; (3) internal hairpin loop melting temperature of less than 55 ° C; (4) homodimer melt temperatures below 37 ° C. (melt temperature calculations described in (3) and (4) can be determined using computer software known to those skilled in the art); (5) 16 or more consecutive nucleotide sequences identified as not present in any other known polynucleotide sequence (such assessments may be performed using computer programs available to those of skill in the art such as BLAST searching for publicly available databases) Can be easily determined). Alternatively, siRNA polynucleotide sequences can be designed and selected using computer software commercially available from various vendors (eg, OligoEngine.TM. (Seattle, Wash.); Dharmacon, Inc. (Lafayette, Colo.); Ambion Inc. (Austin, Tex.); And QIAGEN, Inc. (Valencia, Calif.)). (See Additional References Elbashir et al., Genes & Development 15: 188-200 (2000); Elbashir et al., Nature 411: 494-98 (2001); and [online] Internet: URL <http://www.mp -ibpc.gwdg.de/abteilungen/100/105/Tuschl_MTV2(3) sub.-002.pdf.) and then siRNA polynucleotides that interfere with the expression of the target polypeptide according to methods known in the art and described herein. Test their abilities. Determination of the effectiveness of siRNA polynucleotides not only considers their ability to interfere with polypeptide expression, but also allows siRNA polynucleotides to have undesirable undesirable toxic effects, for example, cell death is not the desired effect of RNA interference (eg, Akt3 in cells). Disturbance of expression) includes consideration of whether they exhibit apoptosis of cells.

Those skilled in the art will also readily understand that, as a result of the degeneracy of the genetic code, many nucleotide sequences can encode the polypeptides described herein. In other words, an amino acid may be encoded by one of several different codons, and one of ordinary skill in the art may recognize that one particular nucleotide sequence may be different from another (while determined by alignment methods described herein and known in the art). ), It can be readily determined that the sequences can encode polypeptides having the same amino acid sequence. By way of example, the amino acid leucine in a polypeptide may be encoded by six different codons (TTA, TTG, CTT, CTC, CTA, and CTG) and so may serine (TCT, TCC, TCA, TCG, AGT, and AGC). have. Four different codons (for example, proline, alanine, and valine) may have four different codons (CCT, CCC, CCA, CCG for proline; GCT, GCC, GCA, GCG for alanine; and GTT, GTC, GTA for valine , GTG). Some of these polynucleotides have minimal homology to the nucleotide sequence of any native gene. Nevertheless, polynucleotides that differ due to differences in codon usage are specifically contemplated in the present invention.

Any polynucleotide comprising a target polynucleotide (such as a polynucleotide capable of encoding a target polypeptide of interest) will be particularly useful for preparing desired siRNA polynucleotides and for identifying and selecting the desired sequences for use in siRNA polynucleotides. It can be manufactured using various techniques. For example, polynucleotides can be amplified from cDNA prepared from suitable cell or tissue types. The polynucleotides can be amplified through polymerase chain reaction (PCR). For this approach, sequence-specific primers can be designed and purchased or synthesized based on the sequences provided herein. The amplified portion can be used to isolate the full length gene, or desired portion thereof, using well known techniques from a suitable library (eg, human melanoma cDNA). Within this technique, the library (cDNA or genome) is screened using one or more probes or primers suitable for amplification. Preferably, libraries comprising larger molecules are size-selected. Random priming libraries may also be preferred for identifying 5 'and upstream regions of genes. Genomic libraries are preferred for obtaining introns and extending 5 'sequences. Also suitable sequences for siRNA polynucleotides contemplated herein may be selected from a library of siRNA polynucleotide sequences.

For hybridization techniques, partial sequences can be labeled using well known techniques (eg, nickel-translation or end-labels using ³² P). The bacterial or bacteriophage library can then be screened by hybridizing to a filter containing denatured bacterial colonies (or Lawn containing phage plaques) with labeled probes (see, eg, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, 2001). Hybridization colonies or plaques are selected and expanded and DNA is isolated for further analysis. Clones can be analyzed to determine the amount of additional sequences using primers from partial sequences and primers from vectors, for example by PCR. Restriction maps and partial sequences can be generated to identify one or more overlapping clones. Full length cDNA molecules can be generated by ligation of suitable fragments using well known techniques.

Alternatively, numerous amplification techniques are known in the art to obtain full length coding sequences from partial cDNA sequences. Within this technique, amplification is generally performed via PCR. One such technique is known as "rapid amplification of cDNA ends" or RACE. The technique involves the use of internal and external primers and hybridizes to polyA regions or vector sequences to identify sequences that are 5 'and 3' of known sequences. Any of a variety of commercially available kits can be used to perform the amplification step. Primers can be designed using, for example, software well known in the art. Primers (including oligonucleotides contemplated for other uses herein, such as probes and antisense oligonucleotides) are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, It is preferably 27, 28, 29, 30, 31 or 32 nucleotides in length, with a GC content of at least 40% and annealed to the target sequence at a temperature of about 54 ° C to 72 ° C. The amplified region can be sequenced as described above, and the overlapping sequences are combined into contiguous sequences. Certain oligonucleotides contemplated by the present invention in some preferred embodiments 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33-35, 35 It has a nucleotide length of -40, 41-45, 46-50, 56-60, 61-70, 71-80, 81-90 or more.

The nucleotide sequences described herein can be linked to a variety of other nucleotide sequences using established recombinant DNA techniques. For example, polynucleotides can be cloned into any of a variety of cloning vectors, including plasmids, phagemids, lambda phage derivatives and cosmids. Vectors of particular interest are expression vectors, replication vectors, probe generation vectors, and sequencing vectors. In general, suitable vectors contain a functional origin of replication in one or more organisms, convenient restriction endonuclease sites, and one or more optional markers (see, eg, WO 01/96584; WO 01/29058; US Pat. 6,326,193; US 2002/0007051).

Other elements depend on the desired use and will be apparent to those skilled in the art. For example, the present invention contemplates the use of siRNA polynucleotide sequences in the manufacture of recombinant nucleic acid constructs comprising vectors that interfere with the expression of the desired target polypeptide, such as Akt3 or B-Raf polypeptide in vivo; The invention also relates to siRNA transgenic or “knock-out” animals and cells (eg, cells, cell clones, major or lineages or organisms in which the expression of one or more desired polypeptides (eg, target polypeptides) is completely or partially impaired). Consider creation. Thus, siRNA polynucleotides that may interfere with the expression of a desired polypeptide (eg, target polypeptide) provided herein may be used in a subject or biological subject provided herein for a sufficient time under conditions for the target polypeptide expression to occur in the absence of siRNA polynucleotides. When contacted with a source, it includes any siRNA polynucleotide that results in a statistically significant decrease (alternatively referred to as "knockdown" of expression) in the level of target polypeptide expression that can be detected. Preferably said reduction is greater than 10% relative to the expression level of the polypeptide detected in the absence of siRNA, more preferably 20, using conventional methods of measuring polypeptide expression known in the art and provided herein. More than%, more preferably more than 30%, more preferably more than 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or 98% do. Preferably, the presence of siRNA polynucleotides in the cell does not cause or cause apoptosis or lethality of the cell when any undesirable toxic effect, eg apoptosis, is not the desired effect of RNA interference.

Exemplary 19-mer sequences for Akt3 siRNAs described herein include human Akt3 (NM_005465): Akt3 duplex 2: CUAUCUACAUUCCGGAAAG; Akt3 duplex 4: GAAUUUACAGCUCAGACUA; And Akt3 duplex 5: CAGCUCAGACUAUUACAAU.

Exemplary 25-mer sequences for Akt3 siRNAs described herein are as follows:

Exemplary 25-mer sequences for Akt3 siRNAs described herein are human mutant B-Raf 5 'GGUCUAGCUACAGAGAAAUCUCGAU 3' and human wild type B-Raf 5 'GGACAAAGAAUUGGAUCUGGAUCAU 3'.

The invention also relates to the use of virus mediated methods of causing silencing of the target gene, PTEN, via siRNA. The use of this method results in a markedly decreased expression of PTEN, leading to an increase in total phosphorylated Akt. The virus mediated methods are useful for identifying mechanisms that underlie Akt3 deregulation of melanoma to design biological processes or provide therapy for the cancer.

The present invention also includes constructs comprising or encoding vectors and siRNA polynucleotides of the invention, and in particular any DNA polynucleotide segments that can be transcribed in accordance with the invention provided above to provide Akt3 polynucleotide-specific siRNA polynucleotides. To a "recombinant nucleic acid construct" comprising a nucleic acid of; These are genetically engineered into host cells using the vectors and / or constructs of the invention to produce siRNA polynucleotides, polypeptides, and / or fusion proteins of the invention, or fragments or variants thereof, by recombinant techniques. SiRNA sequences described herein as RNA polynucleotides are engineered using well established methods such as those described herein to provide corresponding DNA sequences. Thus, for example, a DNA polynucleotide may be generated from any siRNA sequence described herein, and it will be appreciated that this siRNA sequence also provides a corresponding DNA polynucleotide (and complement thereof). Thus, such DNA polynucleotides are contemplated for inclusion in the present invention and are included, for example, in the recombinant nucleic acid constructs of the present invention in which siRNAs can be transcribed.

In another embodiment, the agent is an siRNA molecule wherein the siRNA molecule comprises a polynucleotide or complement thereof having a sequence of 5 'GGUCUAGCUACAGAGAAAUCUCGAU 3'. In another embodiment, the agent is an siRNA molecule wherein the siRNA molecule comprises a polynucleotide or complement thereof having a sequence of 5 'CUAUCUACAUUCCGGAAAG 3'. In another embodiment, the agent is an siRNA molecule wherein the siRNA molecule comprises a polynucleotide or complement thereof having a sequence of 5 'GAAUUUACAGCUCAGACUA 3'. In yet another embodiment, the agent is an siRNA molecule wherein the siRNA molecule comprises a polynucleotide or complement thereof having a sequence of 5 'CAGCUCAGACUAUUACAAU 3'. In another embodiment, the agent is an siRNA molecule wherein the siRNA molecule comprises a polynucleotide or complement thereof having a sequence of 5 'CUUGGACUAUCUACAUUCCGGAAAG 3'. In yet another embodiment, the agent is an siRNA molecule wherein the siRNA molecule comprises a polynucleotide or complement thereof having a sequence of 5 ′ CUUUCCGGAAUGUAGAUAGUCCAAG 3 ′. In yet another embodiment, the agent is an siRNA molecule wherein the siRNA molecule comprises a polynucleotide or complement thereof having a sequence of 5 ′ GAUGAAGAAUUUACAGCUCAGACUA 3 ′. In yet another embodiment, the agent is an siRNA molecule wherein the siRNA molecule comprises a polynucleotide or complement thereof having a sequence of 5 'UAGUCUGAGCUGUAAAUUCUUCAUC 3'. In yet another embodiment, the agent is an siRNA molecule wherein the siRNA molecule comprises a polynucleotide or complement thereof having a sequence of 5 'AAUUUACAGCUCAGACUAUUACAAU 3'. In yet another embodiment, the agent is an siRNA molecule wherein the siRNA molecule comprises a polynucleotide or complement thereof having a sequence of 5 'AUUGUAAUAGUCUGAGCUGUAAAUU 3'. In a preferred embodiment, the agent is contacted with the cell using any well known process of introducing a foreign nucleotide sequence into a host cell. These include liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, nanoparticles, calcium phosphorus-silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline particulates, semiconductor nanoparticles, nanodendrimers, viruses, Calcium phosphate nucleotide mediated nucleotide delivery, poly (D-arginine), electroporation and microinjection are, but are not limited to. The use of nanoliposomes, nanoparticulates, nanodendrimers to deliver agents to cells is demonstrated in FIGS. 5-11 and further described in Provisional Application No. 10 / 835,520, filed Apr. 26, 2004, incorporated herein by reference. It is.

Antisense polynucleotides

In another embodiment, the agent is an antisense polynucleotide.

Particularly contemplated embodiments relate to downregulation of Akt3 activity with antisense polynucleotides, ie, nucleic acids that are complementary to, and preferably specifically hybridize to, coding mRNA nucleic acid sequences such as Akt3 mRNA or subsequences thereof. . Binding of antisense nucleotides to Akt3 mRNA decreases the propagation and / or stability of Akt3 or B-Raf mRNA.

In the context of the present invention, antisense polynucleotides may comprise naturally occurring nucleotides, or synthetic species formed from naturally occurring subunits or homologs in close proximity thereof. Antisense polynucleotides may also have altered sugar residues or sugar-to-sugar bonds. Exemplary of these are phosphorothioate and other sulfur containing species well known for use in the art. All such analogues are contemplated by the present invention as long as they effectively function to hybridize Akt3 or B-Raf mRNA. For a general review, see Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression, CRC Press, 1989; and Synthesis 1: 1-5 (1988).

Antagonist

The present invention also contemplates embodiments in which the agent that decreases Akt3 activity is an antisense polynucleotide. The invention also relates to Akt3 protein variants that function as Akt3 antagonists. Variants of the Akt3 protein may be produced by bimutation (eg, isolated point mutation or cleavage of the Akt3 protein). Antagonists of the Akt3 protein may inhibit one or more activities of the naturally occurring form of Akt3 protein by, for example, competitively binding to downstream or upstream members of the signaling cascade of cells comprising the Akt3 protein. Thus, certain biological effects can be induced by treatment with limited function variants. The present invention contemplates that treating a subject with a variant having a subset of the biological activity of the naturally occurring form of the protein exhibits fewer side effects in the subject as compared to treating the naturally occurring form of the Akt3 protein.

By screening combinatorial libraries of mutations (such as cleavage mutations) of Akt3 protein for Akt3 antagonist activity, variants of Akt3 protein that function as Akt3 antagonists can be identified. The present invention contemplates that a library of altered Akt3 variants is generated by combinatorial mutations at the nucleic acid level and encoded by the altered gene library. Libraries of altered Akt3 variants can be generated, for example, by enzymatic ligation of synthetic oligonucleotide mixtures into gene sequences, whereby a modified set of potential Akt3 sequences can be generated as individual polypeptides or a set of Akt3 sequences therein. It can be expressed (eg for phage display) with a larger set of fusion proteins containing it. There are a variety of methods that can be used to generate libraries of potential Akt3 variants from modified oligonucleotide sequences. Chemical synthesis of the altered gene sequence can be performed in an automated DNA synthesizer, which is then ligated to the appropriate expression vector. The use of altered sets of genes makes it possible to supply all sequences encoding a desired set of potential Akt3 sequences in one mixture. Methods of synthesizing modified oligonucleotides are well known in the art. See, eg, Narang, 1983. Tetrahedron 39: 3; Itakura, et al., 1984. Annu. Rev. Biochem. 53: 323; Itakura, et al., 1984. Science 198: 1056; Ike, et al., 1983. Nucl. Acids Res. 11: 477].

Ribozyme

In another embodiment, the agent is a ribozyme. Ribozymes can be used to target and inhibit transcription of Akt3. Ribozymes are RNA molecules that enzymatically cleave other RNA molecules. Different types of ribozymes have been described, including group I ribozymes, hammerhead ribozymes, hairpin ribozymes, RNase P and axhead ribozymes (see, for example, Castanotto et al. For a general review of the properties of ribozymes). 1994, Adv. In Pharmacology 25: 289-317).

General characteristics of hairpin ribozymes are described, for example, in Hamel et al., 1990, Nucl. Acids Res., 18: 299-304; Hampel et al., 1990, European Patent Publication No. 0 360 257; U.S.Pat.No. 5,254,678. Methods of preparation are well known to those skilled in the art (see, eg, Wong-Staal et al., WO 94/26877; Ojwang et al., 1993, Proc. Natl. Acad. Sci. USA, 90: 6340-6344; Yamada et. al., 1994, Human Gene Therapy 1: 39-45; Leavitt et al., 1995, Proc. Natl. Acad. Sci. USA, 92: 699-703; Leavitt et al., 1994, Human Gene Therapy 5: 1151 And 120, and Yamada et al., 1994, Virology 205: 121-126.

Inhibitors of Akt3 Polypeptide Activity

In another embodiment, Akt3 activity is reduced by an agent that is an inhibitor of Akt3 polypeptide. This can be established in any number of ways, including providing a form of dominant negative Akt3 polypeptide, such as Akt3, which is inactive on its own and when present as functional Akt3 in the same cell, reduces or eliminates Akt3 activity of functional Akt3. have. The design of the dominant negative form is well known to those skilled in the art and is described, for example, in Herskowitz, 1987, Nature, 329: 219-22. Inactive polypeptide variants (muteins) can also be used by screening for the ability to inhibit Akt3 activity. Methods of making muteins are well known to those skilled in the art (see, eg, U.S. Pat. Nos. 5,486,463, 5,422,260, 5,116,943, 4,752,585, 4,518, 504). In addition, any small molecule, such as any peptide, amino acid, nucleotide, lipid, carbohydrate, or any other organic or inorganic molecule, can be screened for the ability to bind Akt3 or inhibit Akt3 activity.

Peptide

In another embodiment, the peptide corresponding to the plextrin homology domain, or the contiguous amino acid sequence of the catalytic or regulatory domain of Akt3, as an agent will reduce Akt3 activity. Without wishing to be bound by this theory, it is contemplated that peptides act as pseudosubstrate or competitive inhibitors to inhibit Akt3 activity. In another embodiment, the peptide functions as a pseudosubstrate for the Akt3 catalyst or regulatory (tail) domain. In another embodiment, the peptide functions as a competitive inhibitor for the catalytic domain of Akt3. The present invention also contemplates that the peptide will function as a competitive inhibitor for the flextrin homologous domain of Akt3. In another embodiment, the peptide functions as a competitive inhibitor for the regulatory domain of Akt3. One skilled in the art can readily devise and determine whether the peptide reduces the activity of Akt3. Obata T et al. J Biol Chem. 275 (46): 36108-15 (2000), Niv MY et al. J Biol Chem. 279 (2): 1242-55. Epub 2003 (2004), Luo Y et al. Biochemistry. 43 (5): 1254-63 (2004)].

For example, cells are incubated with peptides under conditions suitable for assessing the activity of Akt3. The activity of Akt3 is assessed by western blot analysis with antibodies recognizing threonine 305 or serine 472 and compared to the activity of the same cells incubated under the same conditions in the absence of a suitable control such as a peptide or scrambled peptide. Antibodies that recognize Akt3 are available from a number of sources including, for example, Stratagene (La Jolla, Calif.) And IzenX, Inc. Palo Alto. Alternatively, AKt3 activity immunoprecipitates Akt3 and in vitro kinase assay to estimate activity by phosphorylating, by Akt3, a cross-linked synthetic peptide substrate for Akt3 available from Discover Rx Corporation (Fremont, CA). Can be assessed by using immunoprecipitates. Higher or lower activity of phosphorylation compared to the control indicates that the test peptide reduced the activity of the Akt3.

The peptide is about 5 to 30 amino acid residues in length, preferably 10 to 20 amino acids in length. Peptide sequences of the invention can be synthesized by other suitable techniques including solid phase peptide synthesis (eg, BOC or FMOC) methods, solution phase synthesis, or a combination of the above methods. BOC and FMOC methods already established and widely used are described in Merrifield, J. Am. Chem. Soc. 88: 2149 (1963); Meienhofer, Hormonal Proteins and Peptides, C.H. Li, Ed., Academic Press, 1983, pp. 48-267; and Barany and Merrifield, in The Peptides, E. Gross and J. Meienhofer, Eds., Academic Press, New York, 1980, pp. 3-285. Solid phase peptide synthesis methods are described in Merrifield, R. B., Science, 232: 341 (1986); Carpino, L. A. and Han, G. Y., J. Org. Chem., 37: 3404 (1972); and Gauspohl, H. et al., Synthesis, 5: 315 (1992). The description of this reference is incorporated herein by reference.

Small molecule

The present invention also contemplates embodiments in which the agent that reduces Akt3 activity is a small molecule. Small molecules can be used, for example, to modulate the function of the disclosed kinases, kinase receptors, molecules that interact with kinase receptors, and molecules in the signaling pathways of kinase receptors. Those skilled in the art will understand how to produce small molecules of this type and how to isolate exemplary libraries and small molecule modulators. As used herein, “small molecule” preferably binds to Akt3 and / or B-Raf and inhibits one or more of its functions.

Modulators and Binding Compounds

The compound tested as a modulator of Akt3 and / or B-Raf protein may be any small chemical compound, or biological entity such as a protein, sugar, nucleic acid or lipid. Typically, the test compound will be small chemical molecules and peptides. In essence most compounds may be dissolved in aqueous or organic (especially DMSO-based) solutions, but any chemical compound may be used as a potential regulator or binding compound in the assays of the present invention. The assay is designed to screen large chemical libraries by automating the assay step and providing the compounds to assays that are run in parallel in any convenient source, such as in microtiter format on a microtiter plate of a robotic assay. It became. Sigma (St. Louis, Mo.), Aldrich (St. Louis, Mo.), Sigma-Aldrich (St. Louis, Mo.), Fluka Chemica-Biochemica Analities (Buchs, Switzerland) It will be appreciated that there are many sources of chemical compounds involved.

The present invention contemplates a high throughput screening method comprising providing a combinatorial chemical or peptide library containing a number of potential therapeutic compounds (potential modulators or binding compounds). The “combination chemical library” is then screened with one or more assays described herein to identify library members (especially chemical species or subclasses) that exhibit the desired characteristic activity. Thus, the identified compounds can function as conventional "lead compounds" and can be used as potential or substantial therapeutic agents by themselves.

Combination chemical libraries are collections of various chemical compounds produced by chemical or biological synthesis that combine a number of chemical "building blocks" such as reagents. For example, linear combinatorial chemical libraries, such as polypeptide libraries, are formed by combining a series of chemical building blocks (amino acids) in all possible ways for a given compound length (ie, the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through this combinatorial mixing of chemical building blocks.

The preparation and screening of combinatorial chemical libraries is well known to those skilled in the art. Such combinatorial chemical libraries are described in peptide libraries (see, eg, US Pat. No. 5,010,175, Furka, 1991, Int. J. Pept. Prot. Res. 37: 487-493 and Houghton et al., 1991, Nature 354: 84- 88), including but not limited to. Other chemical properties can be used that produce a variety of chemical libraries. Such chemical properties include peptoids (eg PCT Publication No. WO 91/19735), encoded peptides (eg PCT Publication No. WO 93/20242), random bio-oligomers (eg PCT Publication No. WO 92/00091). ), Benzodiazepines (eg US Pat. No. 5,288,514), diversomers such as hydantoin, benzodiazepines and dipeptides (Hobbs et al., 1993, Proc. Nat. Acad. Sci. USA 90: 6909-6913), Vinyllocation polypeptides (Hagihara et al., 1992, J. Amer. Chem. Soc. 114: 6568), non-peptide peptidomimetics with glucose scaffolding (Hirschmann et al., 1992, J. Amer. Chem. Soc. 114: 9217-9218), organic compounds similar to small compound libraries (Chen et al., 1994, J. Amer. Chem. Soc. 116: 2661), oligocarbamates (Cho et al., 1993, Science 261: 1303), and / or peptidyl phosphonate (Campbell et al., 1994, J. Org. Chem. 59: 658), nucleic acid libraries (see Ausubel, Berger and Sambrook, all described above) ), Peptide nucleic acid libraries (see, eg, US Pat. No. 5,539,083), antibody libraries (see, eg, Vaughn et al., 1996, Nature Biotechnology, 14: 309-314 and PCT / US96 / 10287), carbohydrate libraries (see Liang et al., 1996, Science, 274: 1520-1522 and US Pat. No. 5,593,853, small organic molecular libraries (see, for example, benzodiazepines, Baum, 1993, C & EN, January 18, page 33; isoprenoids, U.S. Pat. 5,569,588; thiazolidinones and metathiazanones, U.S. Pat. 5,549,974; pyrrolidines, U.S. Pat. Nos. 5,525,735 and 5,519,134; morpholino compounds, U.S. Pat. 5,506,337; benzodiazepines, U.S. Pat. 5,288,514, etc.), but is not limited thereto.

Devices for making combinatorial libraries are commercially available (see, for example, 357 MPS, 390 MPS, Advanced Chem Tech, Louisville Ky., Symphony, Rainin, Woburn, Mass., 433A Applied Biosystems, Foster City, Calif., 9050 Plus, Millipore, Bedford, Mass.). In addition, numerous combinatorial libraries are commercially available (see, eg, ComGenex, Princeton, NJ, Tripos, Inc., St. Louis, Mo., 3D Pharmaceuticals, Exton, Pa., Martek Biosciences, Columbia, Md., Etc.). ).

Chemotherapy

In another embodiment, apoptosis is induced by reducing Akt3 activity using chemotherapeutic agents. As used herein, chemotherapy includes treatment with a single chemotherapeutic agent or combination of agents. Chemotherapeutic agents that can be used in the present invention include alkylating agents, anti-metabolic agents, antibiotics, natural or plant-derived products, hormones and steroids (including synthetic analogues), and Soengas MS, Lowe SW. Apoptosis and Melanoma Chemoresistance. Oncogene. 2003 May 19; 22 (20): 3138-51, but is not limited to this. Examples of agents of this class are provided below. Alkylating agents include, but are not limited to, nitrosoureas, nitrogen mustards, and triazenes. Nitrosoureas include, but are not limited to, for example, carmustine, lomustine and semustine. Nitrogen mustards include, but are not limited to, for example, cyclophosphamide. Triazenes include, but are not limited to, for example, dacarbazine and temozolomide. The FDA has approved the use of dacarbazine in the treatment of melanoma. Antimetabolic agents include folic acid antagonists, pyrimidine analogs, purine analogues, and adenosine deaminolase inhibitors: methotrexate, 5-fluorouracil, phloxuridine, cytarabine, 6-mercaptopurine, 6-thioguanine, fludarabine phosphate , Pentostatin, and gemcitabine. Antibiotics that can be used in the present invention include, but are not limited to, anthracyclines, for example. Examples of anthracyclines include, but are not limited to, doxorubicin (Adriamycin). Natural or plant-derived products that can be used in the present invention include, but are not limited to, for example, vinca alkaloids, epipodophyllotoxins, taxanes. Examples of vinca alkaloids include, but are not limited to, vincristine and vinblastine. Examples of epipodophyllotoxins include, but are not limited to, for example, epitopes. Taxanes include, but are not limited to, for example, taxol, paclitaxel and docetaxel. Hormonal analogs and steroids that may be used in the present invention are, for example, antiestrogens, 17 alpha-ethynylestradiol, diethylstilbestrol, testosterone, prednisone, fluoxymesterone, drostatanolone propionate, testosterone , Megestrol acetate, tamoxifen, methylprednisolone, methyltestosterone, prednisolone, triamcinolone, chlorotrianicene, hydroxyprogesterone, aminoglutetinimid, esturamustine, methoxyprogesterone acetate, leuprolide, flutamide, toremifene And zoladex, including but not limited to. Platinum drugs that can be used in the present invention include, but are not limited to, for example, cisplatin, carboplatin, hydroxyurea, amsacrine, procarbazine, mitotans, mitoxanthrone, levamisol and hexamethylmelamine. .

Safe and effective methods of administering most of the above chemotherapeutic agents are known to those skilled in the art. In addition, their administration is described in the standard literature. For example, the administration of many chemotherapeutic agents is described in "Physicians' Desk Reference" (PDR), such as 1996 edition (Medical Economics Company, Montvale, N. J. 07645-1742, USA); The contents of which are incorporated herein by reference.

Irradiation

Irradiation may optionally be added to the treatment regimen of the present invention. The term "irradiation" as used herein has its usual meaning and is limited only to the extent that X-irradiation has sufficient energy to penetrate the body and can induce tumor-specific antigen release in vivo. Optimal irradiation intensities that damage certain types of tumors are known to those skilled in the art.

Apoptosis

One skilled in the art will appreciate various methods such as those described in Dengler et al., (1995) Anticancer Drugs. 6: 522-32 using the propidium iodide flow cytometry assay described in Gorczyca, (1993) Cancer Res 53: 1945-51, or in situ terminal deoxynucleotides as described in It will be understood how to detect and / or measure apoptosis by transferase and gap translation assay (TUNEL analysis).

Treatment of melanoma tumors

The present invention is based in part on our observation that Akt3 regulates apoptosis and ^V599E B-Raf regulates growth and vascular development. This is a meaningful finding since it was the first to recognize a combined effective targeted therapy for melanoma. As discussed below, reducing Akt3 activity would increase the sensitivity of melanoma cells to apoptosis; Agents that function through apoptosis, such as conventional chemotherapeutic agents, are more effective when Akt3 activity is reduced in melanoma cells. In one embodiment, the present invention is directed to administering an effective amount of an agent to reduce V599E B-Raf activity in a mammalian tumor; Provided are methods for treating melanoma tumors in a mammal, including reducing the size of the tumor by administering an effective amount of an agent that reduces Akt3 activity to the tumor in the mammal.

In a preferred embodiment, the agent that reduces Akt3 activity is an siRNA molecule. In another embodiment, the agent is an siRNA molecule and the siRNA molecule that reduces Akt3 activity comprises a polynucleotide having the following sequence:

In one embodiment, the agent that reduces B-Raf activity is an siRNA molecule. In a preferred embodiment, the agent is an siRNA molecule and the siRNA molecule that reduces B-Raf activity comprises a polynucleotide having 5 'GGUCUAGCUACAGAGAAAUCUCGAU 3' and / or 5 'GGACAAAGAAUUGGAUCUGGAUCAU 3'.

In a preferred embodiment, the agent that reduces Akt3 is contacted with the cell using any well known process of introducing a foreign nucleotide sequence into a host cell. These include liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, nanoparticles, calcium phosphorus-silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline particulates, semiconductor nanoparticles, nanodendrimers, viruses, Calcium phosphate mediated nucleotide delivery, poly (D-arginine), electroporation and microinjection are, but are not limited to. The use of nanoliposomes, nanoparticulates, nanodendrimers to deliver agents to cells is demonstrated in FIGS. 5-11 and further disclosed in Provisional Application No. 10 / 835,520, filed April 26, 2004, which is incorporated herein by reference. Described.

In a preferred embodiment, an agent that reduces B-Raf activity is contacted with the cell using any well known process of introducing a foreign nucleotide sequence into a host cell. These include liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, nanoparticles, calcium phosphorus-silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline particulates, semiconductor nanoparticles, nanodendrimers, viruses, Calcium phosphate mediated nucleotide delivery, poly (D-arginine), electroporation and microinjection are, but are not limited to. The use of nanoliposomes, nanoparticulates, nanodendrimers to deliver agents to cells is demonstrated in FIGS. 5-11 and further disclosed in Provisional Application No. 10 / 835,520, filed April 26, 2004, which is incorporated herein by reference. Described.

In a preferred embodiment, the present invention provides a method of using nanotechnology as a method of administering multiple agents for inhibiting melanoma tumor development and increasing or inducing apoptosis. Combinations of Akt3 peptides; Akt3 siRNA, V599E B-Raf siRNA, paclitaxel, carboplatin, carmustine, dacarbazine or vinblastine are simultaneously loaded into non-toxic liposomes. These liposomes effectively deliver the load to melanoma cells growing in culture. This is the first demonstration of simultaneous delivery of different therapeutic agents to cancer cells using a single delivery agent. Liposomes comprising the combination therapy enter the tumor vasculature that travels in the bloodstream and is absorbed by exposed melanoma cells. This results in targeted lethality of melanoma cells in the tumor and leads to tumor degeneration. The clinical use of this approach is to deliver combination therapies to tumors. Anti-CD63 antibodies will be covalently bound to pegalation segments extending from liposomes to induce preferential uptake by melanoma cells. Thus, matrix tissue absorbs little or no liposomes, which demonstrates targeted delivery of liposomes. Immune liposomes can improve uptake into melanoma tumor cells compared to control stromal tissue.

In another embodiment, the agent that decreases Akt3 activity is an antisense polynucleotide. In one embodiment, the agent that reduces B-Raf activity is an antisense polynucleotide.

In another embodiment, the agent that reduces Akt3 activity is ribozyme. In one embodiment, the agent that reduces B-Raf activity is ribozyme. Ribozymes can be used to target and inhibit transcription of Akt3, B-Raf or both.

In yet another embodiment, Akt3 activity is reduced by an agent that is an inhibitor of Akt3 polypeptide. This can be established in any number of ways, including providing a form of dominant negative Akt3 polypeptide, such as Akt3, which is inactive on its own and when present as functional Akt3 in the same cell, reduces or eliminates Akt3 activity of functional Akt3. have. In another embodiment, B-Raf activity is reduced by an agent that is an inhibitor of B-Raf polypeptide. In a preferred embodiment, the B-Raf inhibitor is BAY 43-9006. Inhibitors of B-Raf include, but are not limited to, BAY 43-9006 or other commercially available B-Raf inhibitors available from BAYER. Inhibitors of B-Raf may further include competitive B-Raf inhibitors and non-competitive B-Raf inhibitors. Competitive B-Raf inhibitors are molecules in which substrate binding binds to B-Raf enzyme in a mutually exclusive manner. Typically competitive inhibitors of B-Raf will bind to the active site. Uncompetitive B-Raf inhibitors may inhibit the binding of B-Raf but its binding to the enzyme is not mutually exclusive with respect to substrate binding. B-Raf inhibitors contemplated herein are compounds that do not have any significant effect on other cellular activities at least in comparable concentrations and which reduce B-Raf activity of animal cells. However, this inhibition provides a form of dominant negative B-Raf polypeptide, such as B-Raf, which is inactive on its own and reduces or eliminates B-Raf activity of functional B-Raf when present as functional B-Raf in the same cell. It can be established in many arbitrary ways, including doing so.

In another embodiment, the agent that decreases Akt3 activity is a peptide corresponding to the concomitant amino acid sequence of the flextrin homologous domain, or the catalytic or regulatory domain of Akt3.

The present invention also contemplates embodiments where the agent that reduces Akt3 activity is a small molecule. In another embodiment, the present invention also contemplates embodiments in which the agent that reduces B-Raf activity is a small molecule.

In another embodiment, the method of treating melanoma tumors comprises administering a chemotherapeutic agent. As used herein, chemotherapy includes treatment with a single chemotherapeutic agent or combination of agents. Chemotherapeutic agents that can be used include alkylating agents, anti-metabolic agents, antibiotics, natural or plant-derived products, hormones and steroids (including synthetic analogues), and Soengas MS, Lowe SW. Apoptosis and Melanoma Chemoresistance. Oncogene. 2003 May 19; 22 (20): 3138-51, but is not limited to this.

In another embodiment, the method of treating melanoma tumors in a mammal is irradiation therapy.

In a preferred embodiment, the methods of the present invention can be used to treat melanoma by showing significant effects on cell death (eg by apoptosis) as well as proliferation and angiogenesis. Those skilled in the art will be familiar with methods of measuring tumor size, for example, to measure the regression or reduction of tumor size, angiogenesis and apoptosis. Preferably, the chemotherapeutic agent may be administered at relatively low doses (and / or less frequently) to minimize potential toxic side effects on normal untransformed cells.

Thus, the present invention also includes significant levels of cancer cell death (eg apoptosis) in subjects with melanoma, including simultaneously or sequentially administering an effective amount of an agent that reduces Akt3 activity and an agent that reduces B-Raf activity. And to inhibit melanoma tumor development. As used herein, “simultaneous” refers to different times at the same time point or during a common treatment schedule; When administering one of the agents of the method of decreasing Akt3 or B-Raf activity and additional agents that decrease B-Raf or Akt3 activity, the second agent may actually be administered immediately after the first agent, or the second The agent may be administered after an effective period after the first agent; The effective period is the period during which the maximum benefit from the administration of the first agent is realized.

Targeting Akt3 with the mutant ^V599E B-Raf and selected chemotherapeutic agents is synergistic and has a more effective and prolonged effect than targeting alone. This provides a rationale for combining targeted therapies with selected chemotherapeutic agents that do not currently exist for melanoma.

Use of Akt3 and / or B-Raf Proteins and Akt3-Related and / or B-Raf-Related Proteins

Proteins of the invention have many different specific uses. Both Akt3 and B-Raf are important proteins that contribute to melanoma development. Akt3 and / or B-Raf proteins and Akt3 or B-Raf related proteins are used in methods to describe malignant phenotypes by measuring the status of Akt3 and / or B-Raf gene products in normal tissues compared to cancerous tissues. Typically polypeptides from specific regions of Akt3 or B-Raf proteins can be used to assess the presence of agitation (eg, deletions, insertions, point mutations, etc.) in these regions (eg, regions containing one or more motifs). Non-limiting examples include one or more biological motifs contained within Akt3 and / or B-Raf polypeptide sequences, respectively, for assessing features from these regions of normal tissue relative to cancerous tissue or for inducing an immune response to epitopes, respectively. And the use of antibodies targeting Akt3 and / or B-Raf proteins and Akt3-related and / or B-Raf-related proteins comprising amino acid residues of. Alternatively, factors in which Akt3-related and / or B-Raf-related proteins containing amino acid residues of one or more biological motifs of each of the Akt3 and / or B-Raf proteins interact with the Akt3 and / or B-Raf regions It is used to screen.

To identify agents or cellular factors that both Akt3 and B-Raf protein fragments / partial sequences bind to Akt3 or B-Raf or to specific structural domains thereof, domain-specific antibodies (eg, Akt3 or B-Raf proteins) Antibodies that recognize extracellular or intracellular epitopes) and are particularly useful for a variety of therapeutic and diagnostic purposes, including but not limited to diagnostic assays, cancer vaccines, and methods of making such vaccines. .

Proteins encoded by the Akt3 and / or B-Raf genes, or analogs, homologs, or fragments thereof, generate ligands and other agents and cell components that produce antibodies and bind to Akt3 and / or B-Raf gene products. It has a variety of uses, including but not limited to methods of identifying them. Antibodies generated against Akt3 or B-Raf proteins or fragments thereof are useful for imaging methods in diagnostic and prognostic assays, and in the treatment of human melanoma cancer characterized by expression of Akt3 or B-Raf proteins.

Useful for the detection of Akt3 and / or B-Raf proteins, including various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescence assays (ELIFA), immunocytochemical methods, and the like Various immunological assays can be used. The antibody can be labeled and used as an immunological imaging reagent capable of detecting Akt3 or B-Raf expressing cells.

Antibodies to Akt3 and / or B-Raf in Melanoma

According to the present invention, Akt3 and / or B-Raf polypeptides encoded by each of the Akt3 isoforms or B-Raf isoforms found in melanoma comprise fragments thereof comprising a fusion protein, which are used to generate antibodies. It can be used as an antigen or an immunogen. Preferably, the antibody specifically binds to the human Akt3 isotype but does not bind to other forms of Akt. Preferably, the antibody specifically binds to a human B-Raf isotype but not to other forms of B-Raf.

Molecules are "antigenic" when they can specifically interact with antigen recognition molecules of the immune system, such as immunoglobulins (antibodies) or T cell antigen receptors. An antigenic polypeptide or peptide contains at least about 5, preferably at least about 10 amino acids. The antigenic portion of the molecule can be a portion that is immunodominant for antibody or T cell receptor recognition, or can be the portion used to conjugate the antigenic portion to a carrier molecule for immunization to produce an antibody against the molecule. Molecules that are antigenic themselves are not immunogenic, i.e., do not need to elicit an immune response without a carrier.

Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and Fab expression libraries. Anti-Akt3 antibodies of the invention can be cross reactive, such as they can recognize Akt3 from different species. Similarly, anti-B-Raf antibodies of the invention can be cross reactive, such as they can recognize B-Raf from different species. Polyclonal antibodies will have greater cross reactivity. Alternatively, the antibodies of the invention can be specific for a single form of Akt3 or B-Raf. Preferably, the antibody is specific for human melanoma Akt3 or B-Raf.

Various processes known in the art can be used to generate polyclonal antibodies. To produce antibodies, various host animals, including but not limited to rabbits, mice, rats, sheep, goats, and the like, can be immunized by injecting Akt3 or B-Raf polypeptides, or derivatives thereof (such as fragments or fusion proteins). have. In one embodiment, an Akt3 or B-Raf polypeptide or fragment thereof can be conjugated to an immunogenic carrier such as bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Freund (complete and incomplete), depending on the host species, to increase the immune response, mineral gels such as aluminum hydroxide, surface active substances such as lysocithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemoshi In addition, various adjuvant may be used, including but not limited to dinitrophenol, and potentially useful human adjuvant such as bacille Calmette-Guerin (BCG) and Corynebacterium parvum .

To prepare monoclonal antibodies against Akt3 or B-Raf polypeptides, or fragments, analogs, or derivatives thereof, any technique that provides for the production of antibody molecules by successive cell lines of culture may be used. These include the hybridoma technology (Nature 256: 495-497 (1975)) first developed by Kohler and Milstein, as well as trioma technology, human B-cell hybridoma technology [Kozbor et al. , Immunology Today 4: 72 1983); Cote et al., Proc. Natl. Acad. Sci. U.S.A. 80: 2026-2030 (1983), and EBV-hybridoma technology providing human monoclonal antibodies [Cole et al., In Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 (1985), but is not limited to such. In a further embodiment of the present invention, monoclonal antibodies can be produced in sterile animals. WO 89/12690, published Dec. 28, 1989]. Indeed, according to the present invention, a technique developed for the production of “chimeric antibodies” that splice genes from mouse antibody molecules specific for Akt3 polypeptides with genes from suitable biologically active human antibody molecules [Morrison et al. , J. Bacteriol. 159: 870 (1984); Neuberger et al., Nature 312: 604-608 (1984); Takeda et al., Nature 314: 452-454 (1985) can be used; Such antibodies are within the scope of the present invention. Such human or humanized chimeric antibodies are preferred for use in the treatment of human diseases (described below) because they induce an immune response, in particular their own allergic response, than heterologous antibodies.

Methods described for the preparation of single chain Fv (scFv) antibodies [U.S. Pat. Nos. 5,476,786 and 5,132,405 to Huston; U.S.Pat.No. 4,946,778 may be suitable for preparing Akt3 polypeptide-specific single chain antibodies. Further embodiments of the present invention use techniques to construct Fab expression libraries that enable the rapid and easy identification of monoclonal Fab fragments with the desired specificity for Akt3 polypeptides, or derivatives or analogs thereof. et al., Science 246: 1275-1281 (1989).

Antibody fragments containing the genotype of an antibody molecule can be produced by known techniques. For example, the fragments may be F (ab ') ₂ fragments that can be produced by pepsin digestion of antibody molecules; Fab 'fragments that can be produced by reducing the disulfide bridges of F (ab') ₂ fragments, and Fab fragments that can be produced by treating antibody molecules with pepsin and reducing agents.

In the production of antibodies, the screening of the desired antibodies can be performed using techniques known in the art, such as radioimmunoassay, ELISA (enzyme-linked immunosorbent assay), "sandwich" immunoassay, immunoradiosystem assay, gel diffusion precipitin. Reaction, immunodiffusion assay, in situ immunoassay (including colloidal gold, enzyme or radioisotope labeling), western blot, precipitation reaction, aggregation assay (eg gel aggregation assay, hemagglutination assay), complement fixation assay, immunoassay Fluorescence assays, Protein A assays, immunoelectrophoresis assays, and the like. In one embodiment, the antibody assay is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting the binding of a reagent to a secondary antibody or primary antibody. In further embodiments, the secondary antibody is labeled. Many methods for detecting binding in immunoassays are known in the art and are within the scope of the present invention. For example, to select antibodies that recognize specific epitopes of Akt3 or B-Raf polypeptides or peptides, hybridomas generated for products that bind to Akt3 or B-Raf polypeptide fragments containing the epitopes are assayed. can do. To select antibodies specific for an Akt3 or B-Raf polypeptide or peptide from an animal of a particular species, based on positive binding with an Akt3 or B-Raf polypeptide or peptide expressed by or isolated from cells of said animal species Can be selected.

Identification of molecules that interact with Akt3 or B-Raf

Protein and nucleic acid sequences for Akt3 or B-Raf found in melanoma allow those skilled in the art to identify proteins, small molecules, and other agents that interact with Akt3 or B-Raf, as well as various Either protocol allows identification of pathways activated by Akt3 or B-Raf. For example, one skilled in the art can use one of the so-called interactive trap systems (also referred to as "2-hybrid assays"). In this system, the molecules interact to reconstruct transcription factors that induce the expression of the reporter gene, at which time the expression of the reporter gene is assayed. Other systems identify protein-protein interactions in vivo through the reconstitution of eukaryotic transcriptional activators, see, eg, U.S. Pat. 5,955,280 issued Sep. 21, 1999, U.S. Pat. 5,925,523 issued Jul. 20, 1999, U.S. Pat. 5,846,722 issued Dec. 8, 1998 and U.S. Pat. 6,004,746 issued Dec. 21,1999]. Algorithms for genome-based prediction of protein function can also be used in the art (see, eg, Marcotte, et al., Nature 402: 4 November 1999, 83-86).

Alternatively, one of skill in the art can screen peptide libraries to identify molecules that interact with Akt3 or B-Raf protein sequences. In this method, peptides that bind Akt3 or B-Raf are identified by screening libraries encoding a random or controlled collection of amino acids. Peptides encoded by the library are expressed as fusion proteins of the bacteriophage coat protein, and then the bacteriophage particles are screened for each of the Akt3 or B-Raf protein (s).

Thus, peptides of various uses, such as therapeutic, prognostic, or diagnostic reagents, can be identified without any prior information about the structure of the expected ligand or receptor molecule.

Pharmaceutical composition

In one embodiment, the pharmaceutical composition for treating melanoma tumors comprises an agent that reduces Akt3 activity; Carrier provided. Suitable carriers for use in the present invention will be known to those skilled in the art. The carrier includes liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, nanoparticles, calcium phosphorus-silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline fine particles, semiconductor nanoparticles, poly (D- Arginine), nanodendrimers, virals, and calcium phosphate nucleotide mediated nucleotide delivery.

In another embodiment, the pharmaceutical composition includes agents including but not limited to siRNA molecules, antisense molecules, antagonists, ribozymes, inhibitors, peptides and small molecules. In another embodiment, small interfering RNA (siRNA) molecules comprise the following polynucleotides or complements thereof:

In another embodiment, the pharmaceutical composition comprises an agent that is a peptide that acts as a pseudo substrate for Akt3. In another embodiment, the peptide acts as a pseudo substrate for the catalytic domain of Akt3.

In yet another embodiment, the agent that reduces Akt3 activity is a peptide that acts as a competitive inhibitor for Akt3. We expect that peptides can act as competitive inhibitors for the catalytic domain of Akt3, the flextrin homologous domain of Akt3, and / or the regulatory domain of Akt3. In another embodiment, the pharmaceutical composition includes an agent that reduces B-Raf activity. We contemplate that the agent includes siRNA molecules, antisense molecules, antagonists, ribozymes, inhibitors, peptides and small molecules. In another embodiment, the agent that decreases B-Raf activity is a small interfering RNA (siRNA) molecule comprising:

Polynucleotide 5 'GGUCUAGCUACAGAGAAAUCUCGAU 3', or complement thereof or polynucleotide 5 'GGACAAAGAAUUGGAUCUGGAUCAU3', or complement thereof.

The following examples are provided for illustrative purposes and do not limit the invention.

Example for Akt3

Materials and methods

EXAMPLES siRNA Mediated Downregulation of Akt Isotypes

To demonstrate the specificity of siRNAs for Aktl, Akt2 and Akt3 (Dharmacon) in UACC 903 cells, HA-tagged Aktl, Akt2 or Akt3 constructs were co-nucleofected with each individual siRNA. The Akt constructs used in this study have already been described (Sun et al., Am J Path 159: 431-437 (2001); Mitsuuchi et al., J Cellular Biochem 70: 433-441 (1998); and Brodbeck et al., J Biol Chem 274: 9133-9136 (1999)). Each construct (5 μg) alone or with each individual siRNA of 100 pmol or 200 pmol was introduced into 7 × 10 ⁵ UACC 903 cells via nucleofection with Amaxa Nucleofector. Transfection efficiencies obtained with constructs expressing GFP were> 60%. Protein lysates were recovered after 72 hours and Western blot analysis was performed as previously described (Stahl et al., Cancer Res 63: 2891-2897 (2003)). Nucleofection with siRNA knocked down endogenous expression of the Akt3 isoform and / or PTEN in melanocytes and melanoma cell lines UACC 903, SK-MEL-24, WM115 and WM35. Amacasa nucleofection reagents and protocols for melanocytes were also used for WM35 cells while other cell lines were nucleofected using Amacasa Solution R / Program K-17. Growth conditions for such cell lines have already been described (Stahl et al., Cancer Res 63: 2891-2897 (2003); Hsu et al., In Human Cell Culture, JRW MaB Palsson, editor.Great Britain: Kluwer Academic Publishers. 259 -274 (1999)).

Example 2: Western blotting, immunoprecipitation and kinase assays:

Except for Akt2 (SantaCruz) and Akt3 (Upstate Biotech), the Western blot process and antibodies used have already been described (Stahl et al., Cancer Res 63: 2891-2897 (2003)). For immunoprecipitation, protein lysis buffer (50 mM Tris-HCl pH 7.5, 0.1% Triton X-100, 1 mM EDTA, 1 mM EGTA, 50 mM NaCl, 10 mM sodium β-glycerol phosphate, 5 mM sodium pyrophosphate, Protein was collected by adding 1 mM sodium orthovanadate, 0.1% 2-mercaptoethanol, and 0.5% protease inhibitor cocktail (Sigma) to the plate of cells and then snap frozen in liquid nitrogen. Cell debris was pelleted by centrifugation of lysate (≧ 10,000 × g) and quantified using the Biorad BCA protein assay. Protein for immunoprecipitation (100 μg) was incubated overnight at 4 ° C. with constant mixing with 2 μg Akt2 or 5 μl Akt3 antibody. 15 μl of equilibrated GammaBind G Sepharose beads (Amersham Biosciences) was then added to each tube and incubated for 2 hours (4 ° C.) with constant mixing. The pelleted beads were washed twice with lysis buffer to remove unbound antibodies and proteins. The sample was then resuspended and electrophoresed under reducing conditions according to the protocol provided by NuPage Gel System from Invitrogen Life Technologies. Western blots were probed with in-Akt and quantified by densitometry as previously described (Stahl et al., Cancer Res 63: 2891-2897 (2003)).

For the Akt kinase assay, 15 μl of equilibrated gamma carbide g Sepharose beads were washed with 200 μl of lysis buffer, followed by constant mixing in a volume of 400 μl with 2 μg of Akt2 or 5 μl of Akt3 antibody. Incubate at 4 ° C. for at least 2 hours. Microcystine (1 μM) from MP biomedical was added to the lysis buffer to ensure complete inactivation of the cells PP1 and PP2 phosphatase. The antibody / sepharose complexes were washed twice with 750 μl of lysis buffer and then incubated for more than 1.5 hours at 4 ° C. with constant mixing in a volume of 400 μl with 100 μg of protein. The complex was washed with 500 μl of lysis buffer and then (3 ×) 1 with 500 μl of assay dilution buffer (20 mM MOPS, pH 7.2, 25 mM μ-glycerol phosphate, 1 mM sodium orthovanadate, and 1 mM DTT). Washed twice. PKA inhibitor peptide from Santa Cruz (10 μM), 37.5 μM ATP, 17 mM MgCl ₂ , 0.25 μCi / μγ γ- ³² P-ATP, and 90 μM of Akt specific substrate cloted from UIpstate Biotechnology assay dilution buffer To the tube and continued mixing and incubated at 35 ° C. for 10 m. Next, 20 μl of liquid was transferred to phosphocellulose paper, which was washed 3 × for 5 m with 40 ml of 0.75% phosphoric acid. After a 5 m acetone wash, the phosphocellulose was allowed to dry, transferred to a flash vial with 5 ml of Amersham bioscience scintillation fluid and cpm measured in a Beckman Coulter LS 3801 Liquid Scintillation System.

Example 3: Tumor Studies and Apoptosis Measurements:

The collection of melanoma tumors from human patients is described by the Penn State Human Subjects Protection Office, the Dana-Farber Cancer Institute Protocol Administration Office. ), And a protocol approved by the Cooperative Human Tissue Network. Melanoma samples from archives impregnated in formalin-fixed paraffin were used for immunohistochemistry to measure phosphorylated Akt. Immunization with an in-Akt (Ser473) monoclonal antibody (Cell Signaling Technology) was used to collect samples of melanocyte lesions impregnated into 63 formalin-fixed paraffins at a titer of 1:50 according to the manufacturer's recommended protocol. It was used for histochemical experiments. Specificity and intensity of staining were determined by qualitative comparison with internal vascular endothelial, squamous epithelium or smooth muscle control present in each sample.

Tumor proteins for western blotting or immunoprecipitation, consisting of> 60% of tumor material, were collected using mortar and pestle cooled in liquid nitrogen for grinding the tumor material flash frozen in liquid nitrogen. 1 ml of protein lysis buffer was added to all 200 mg of tissue powder and sonicated for 2 m (15 second intervals) in an ice-filled sonicator bath. Samples were centrifuged at 4 ° C. for 10 minutes (˜12,000 × g). Supernatants were transferred to clean tubes and quantified using Biorad BCA protein validation.

Animal experiments were performed according to a protocol approved by the Institutional Animal Care and Youth Commit at the Pennsylvania State College of Medicine. Athymic female nude mice were purchased from Harlan Sprague Dawley and sc injected into the left and right rib cages of ^1-6 10 cells in 0.2 ml of DMEM containing 10% FBS over 4-6 week old Noose mice. Tumor response rate was measured. For animal experiments involving siRNA 1 × 10 ⁶ UACC 903 cells were nucleofected with siRNA for the Akt isotype, and 48 hours later, nucleofected cells in 0.2 ml DMEM containing 10% FBS were left of nude mice. And sc injection on the right rib cage. The size of the developing tumor was measured every other day using a caliper. In measuring apoptosis, 5 × 10 ⁶ cells were injected per site and 4-6 tumors were recovered after 4 days. Apoptosis was measured using the Roche TUNEL TMR Red Apoptosis kit described above on formalin-fixed, paraffin-embedded tumor sections (Stahl et al., Cancer Res 63: 2891-2897). (2003). At least 8-fields from 3 or 4 different tumor sections were counted and the number of TUNEL positive cells was expressed as a percentage of apoptotic cells.

Example 4: Statistics

For statistical analysis, the Student's t-test was used for pairwise comparisons, and either member ANOVA or Kruskal-Wallis ANOVA for ranks was used for pairwise comparison, followed by appropriate post hoc. The test (Dunnett's or Dunn's) was performed. The results were considered significant at P-values less than 0.05.

Table 1. Relative intensity of p-Akt staining in metastases from general nevus, dysplastic nevus, primary melanoma and melanoma patients

Category (# of samples) p-Akt staining intensity (%) Normal to weak ¹ Strong ² Common birthmark (14) 100 0 ^a Hyperplasia Nevus (25) 88 12 ^b Primary melanoma (15) 47 53 ^c Metastatic melanoma (9) 33 67 ^d

¹ Tumor cells were stained with similar intensity as the perivascular cells proximal to the vessels in the tumor section.

² Tumor cells were stained with greater intensity than perivascular cells proximate the vessels of the tumor section.

Statistics, P <0.5 for ^a vs ^{c, d} and ^b vs ^d .

Experiment result

Example 5: Isotype-specific siRNA Characterizing Akt3 Involvement in Melanoma

In the recently described experimental gene melanoma model (Stahl et al., Cancer Res 63: 2891-2897 (2003)), deregulated Akt activity (due to PTEN loss) reduces the apoptotic capacity of melanoma cells. Has been shown to play an important role in melanoma tumorigenesis (Stahl et al., Cancer Res 63: 2891-2897 (2003)). The inventors determined that this model reflects the importance of Akt in melanoma tumorigenesis, and that deregulated activity can be used to identify specific Akt isotypes that control melanoma tumor development. From a valid initial study (Stahl et al., Cancer Res 63: 2891-2897 (2003)), parent UACC 903 (-PTEN) cells showed elevated phosphorylated total Akt expression (measurement of activity) (FIG. 1A). . PTEN expression in UACC 903 cells resulted in decreased Akt activity in three independently derived cell lines (36A, 29A, and 37A) that were converted into reverted cell lines that lost functional PTEN activity (36A reverted mutation) during tumorigenesis. Caused.

To identify dominant Akt isotype activity in melanoma, we used siRNAs specific for each Akt isotype to reduce the extent to which each isoform reduces the amount of phosphorylated (active) Akt in the parent UACC 903 (-PTEN) cell line. Measured. Specificity of knockdown expression for each Akt isotype in UACC 903 cells by co-nucleolation of constructs expressing tagged HA-Aktl, HA-Akt2 or HA-Akt3 with siRNAs specific for each isotype Decided. In demonstrating specificity, each Akt siRNA was shown to only reduce the expression of the Akt isotype prepared as shown in FIG. 1B. Next, the siRNA for each Akt isotype was nucleofected with UACC 903 cell line as well as two additionally derived melanoma cell lines (WM115 and SK-MEL-24) so that siRNA was phosphorylated (active) in the cells. ) Was measured to lower the level of Akt (FIG. 1C). While siRNAs on Akt1 or Akt2 had a negligible effect that could only be ignored, siRNAs on Akt3 significantly reduced the level of phosphorylated total Akt, indicating that Akt3 prevented tumor development in the UACC 903 (PTEN) model. It is proposed to regulate isotypes (Stahl et al., Cancer Res 63: 2891-2897 (2003)). Since all three independently derived melanoma cell lines showed that Akt3 was the dominant active isoform in melanoma, subsequent experiments focused on investigating Akt3 deregulation, where Akt2 was amplified in various types of cancer. It was reported that it was used as a control for comparison (Chen et al., Proc Nat Acad Sciences USA 89: 9267-9271 (1992); Cheng et al., Proc Nat Acad Sciences USA 93: 3636-3641 (1996) Lu et al., Chung-0Hua I Hsueh Tsa Chih [Chinese Medical Journal] 75: 679-682 (1995); Bellacosa et al., Int J Cancer 64: 280-285 (1995); and van Dekken et al. Cancer Res 59: 748-752 (1999).

To further confirm that Akt3 is a dominant isoform that is specifically reduced by PTEN in the UACC 903 (PTEN) tumorigenic model, Akt3 activity is measured by immunoprecipitation of total Akt3 or Akt2 from cell lysates. The amount of Akt phosphorylated (active) in immunoprecipitates was determined by Western blot (FIG. 1D). Phosphorylated Akt3 levels other than Akt2 were increased in the parental UACC 903 cell line as well as in two oncogenic remutant 36A cell lines lacking PTEN. In contrast, little detectable levels of phosphorylated Akt3 were observed in 36A, 29A or 37A cell lines, which had a superficially low level of Akt activity due to PTEN expression (Stahl et al., Cancer Res 63: 2891-). 2897 (2003). To demonstrate that the levels of phosphorylated Akt3 reflect active Akt, immunoprecipitated Akt3 and Akt2 were assayed by an in vitro kinase assay and the results for Akt3 are shown in FIG. 1E. A statistically significant difference was observed in Akt3 that was not Akt2 activity (data not shown) in the reverse mutation (-PTEN) compared to PTEN expressing cells (P <0.05). Taken together, the results indicate that Akt3 activity was specifically regulated by PTEN in the UACC 903 (PTEN) tumorigenic model.

Example 6: Increased Akt3 activity occurs early during melanoma tumor progression.

It is believed that melanocytes can be directly converted to melanoma (Herlyn, M., Molecular and cellular biology of melanoma: Austin: R. G. Landes Co. (1993)). Alternatively, melanocytes can follow a tumor progression model that evolves in a sequential fashion from normal birthmarks to atypical birthmarks, in situ melanoma (radial and vertical growth phase), and finally metastatic melanoma (Herlyn, M. , Molecular and cellular biology of melanoma: Austin: RG Landes Co. (1993)). Regardless of the process, the evolution of more aggressive tumor cells requires the accumulation of modifications that affect tumor suppressor genes and oncogenes. In other words, they result in cells of the sub-individual population with survival biases that promote more-increasing selective growth or tumorigenic processes.

To demonstrate the selective involvement of Akt3 during melanoma tumor progression, Akt3 and Akt2 expression and activity were measured in a melanoma tumor progression model (typically provided by Dr. Meinhard Hurlin) (Herlyn, M., Molecular and cellular biology of melanoma: Austin: RG Landes Co. (1993); Hsu et al., In Human Cell Culture JRW MaB Palsson, editor.Great Britain: Kluwer Academic Publishers. 259-274 (1999). In this progression model, melanocytes were compared with low passage cell lines established from primary melanoma tumors in the radial (WM35 and WM3211) and vertical (WM115, WM98.1 and WM278) growth phases. In comparison to melanocytes, FIG. 2A shows that one of the two radial growth phase cell lines and both vertical growth phase cell lines had elevated phosphorylated Akt, indicating that Akt activity was initially expressed during primary melanoma development of the radial growth phase. Suggest increasing. Next, expression of the Akt3 isotype was examined by Western blot and compared with Akt2 expression in this cell line (FIG. 2B). Akt3 expression was elevated in melanocytes in all cell lines except WM98.1 radial growth cell line. Since expression does not necessarily reflect activity, the amount of active Akt3 was measured by measuring the level of phosphorylated Akt3 in immunoprecipitates by Western blot analysis followed by immunoprecipitation of Akt3 or Akt2. In comparison to melanocytes, Akt3 activity was elevated in all cell lines except WM35 radial growth cell line (FIG. 2C). It should be noted that although Akt3 protein expression in the WM98.1 vertical growth cell line is similar to that observed in melanocytes, Akt3 activity is markedly high. In contrast to the Akt3 results, Akt2 expression was elevated only in the radial growth cell line compared to melanocytes (FIG. 2B). However, only the WM3211 radial growth cell line showed a corresponding increase in Akt2 activity, but also had elevated Akt3 activity compared to melanocytes. The data suggest that Akt3 was dominantly related Akt isotype activity in the melanoma tumor progression model.

Example 7: Frequency of Akt3 Deregulation in Tumors from Melanoma Patients

Since the experiment identified Akt3 as the dominantly active Akt3 isotype in both UACC 903 (PTEN) oncogenesis and melanoma tumor progression models, subsequent in vivo studies were directed to deregulating Akt3 in tumors from melanoma patients. The focus was on establishing the frequency of The relative intensity of total phosphorylated Akt was first assessed in melanocyte lesions by immunohistochemical analysis of metastases from general nevus, dysplastic nevus, primary melanoma and melanoma patients to determine the frequency of Akt activation (Table 1 ). Moderate levels of staining were detected in 100% general nevus, whereas strong staining was observed in 12% dysplastic nevus, 53% primary melanoma and 67% metastatic melanoma. The results suggest that Akt activity may play a somewhat undefined role in birthmark development, while deregulated Akt activity plays a more important role in the progression of melanoma.

From published reports, analysis of genomic regions containing Aktl, Akt2 and Akt3 genes (Bastian et al., Cancer Res 58: 2170-2175 (1998)) did not find amplification. However, the lq43-44 region containing Akt3 experienced an increase in copy number (Bastian et al., Cancer Res 58: 2170-2175 (1998); Thomson et al., Cancer Genet Cytogenet 83: 93-104 (1995) Mertens et al., Cancer Res 57: 2765-2780 (1997)), suggesting that overexpression contributes to increased Akt3 activity in melanoma as a mechanism. In contrast, the 14q32 region containing Akt1 and the l9ql3 region containing Akt2 tend to remain unchanged or to undergo loss (Bastian et al., Cancer Res 58: 2170-2175 (1998); Thomson et al. Cancer Genet Cytogenet 83: 93-104 (1995); Mertens et al., Cancer Res 57: 2765-2780 (1997)). To confirm whether increased Akt3 expression could be a selective mechanism for inducing increased activity, protein lysates from tumors of melanoma patients were extracted and compared with expression and activity levels of Akt3 and Akt2. Proteins were extracted from 31 metastatic melanoma and analyzed by Western blot to determine expression and activity levels of Akt3 and Akt2 in tumor material.

Three independent western blots were used to quantify expression in each sample and compare it to expression in melanocytes. Overall, 61% (12/31) tumors showed elevated Akt3 protein expression, which was a 2-9 fold increase over the expression observed in melanocytes compared to 10% (3/31) for Akt2. The results are consistent with the type of copy number increase in the chromosome lq43-44 region containing the Akt3 gene reported in the melanoma tumors (Bastian et al. Cancer Res 58: 2170-2175; Thomson et al., Cancer Genter Cytogenet 83: 93-104 (1995); and Mertens et al., Cancer Res 57: 2765-2780 (1997)). Approximately 55% (6/11) of primary site melanoma and 65% (13/20) of melanoma metastases showed increased Akt3 expression. In contrast, negligible fluctuations were observed when comparing Akt2 expression in tumors versus melanocytes. Next, activity levels were measured by quantifying phosphorylated Akt in Akt3 or Akt2 immunoprecipitates. Remarkably, phosphorylated (active) Akt3 was detected in 62 ± 0.02% (SE) of the samples. In contrast, phosphorylated Akt2 (except for the positive control) was not detected in the tumor. Moreover, ˜35% of tumors increased Akt3 activity compared to melanocytes grown in culture. The data demonstrate the involvement of Akt3 deregulation in> 60% of tumors from patients with advanced stages of melanoma and suggest that increased expression is one of the mechanisms contributing to deregulated Akt3 activity in melanoma.

Example 8: Mechanisms Underlying Akt3 Deregulation in Melanoma

The experiment revealed that Akt3 is the dominantly active isotype in in vitro cell culture models and in vivo patient tumors. Thus, we next focused on measuring the mechanisms that induce deregulated Akt3 activity in melanoma. Since early UACC 903 (PTEN) tumorigenic models suggested that PTEN plays an important role in regulating Akt activity in melanoma, we believe that reduced expression of PTEN directly and specifically increases Akt3 activity. Was examined. To achieve this goal, PTEN expression (activity) was knocked down by siRNA in melanocytes and radial growth stage melanoma cells (WM35) to determine the effect on the level of phosphorylated Akt. WM35 cell lines were chosen because they express negligible Akt3 activity and express the TPEN protein (see FIG. 1C). As expected, FIGS. 4A and 4B show an insignificant effect that siRNA mediated downregulation of PTEN induced an increase in phosphorylated total Akt (lanes 4 and 11), while the scrambled siRNA control was negligible (lane 2). And 9). Co-nucleofection of siRNA against PTEN with dominant Akt isotypes activated following PTEN downregulation along with siRNAs for Akt1 (lanes 5 and 12), Akt2 (lanes 6 and 13) or Akt3 (lanes 7 and 14) Determined by. Only the siRNA induced for Akt3 (lanes 7 and 14) to the level of phosphorylated Akt up to the level observed in the nucleofected cells with either soapocfected cells (lanes 1 and 8) or scrambled siRNAs only (lanes 2 and 9). Lowered. In contrast, a decrease in Akt1 or Akt2 protein levels did not reduce the amount of phosphorylated Akt, which reaffirms the selective selection of Akt3 deregulation. Thus, because PTEN loss increases Akt3 activity without overexpression, selective regulation of Akt3 activity by PTEN is an important mechanism for activating Akt3 in melanoma. Thus, a decrease in PTEN, in other words, leads to an increase in cellular PIP ₃ (phosphatidylinositiated 3,4,5-triphosphate) concentration, which would be effective to specifically increase Akt3 activity in melanoma. The mechanisms underlying this specificity are currently unknown.

Studies on tumor material from melanoma patients indicate that increased expression of Akt3 may also play an important role in increasing Akt3 activity in melanoma. To study this possibility, Akt3 was overexpressed in WM35 cells (not shown) expressing melanocytes and PTEN protein. Kinase lethal versions of HA-tagged wild type Akt3, Akt3 T305A / S472A (inactive) or myristoylated Akt3 (active) were overexpressed in melanocytes (FIG. 4C). Cells were deficient from growth factors for 24 hours, refilled with complete medium and lysates were recovered after 10 minutes. Equivalent constructs for Akt2 were used as controls (data not shown), overexpression of wild-type Akt3 and myristoylated Akt3 resulted in an increase in total phosphorylated Akt3 as compared to cells alone or nucleofected with kinase lethal Akt3. Induced levels. Moreover, siRNA mediated knockdown of PTEN with Akt3 overexpression induced higher levels of phosphorylated Akt compared to expression of wild type Akt3 alone (data not shown). Thus, overexpression of Akt3 alone, or overexpression of Akt3 in combination with PTEN loss, is an additional mechanism contributing to elevated Akt3 activity in melanoma.

Example 9: Increased Akt3 Activity Reduces Apoptosis to Promote Melanoma Tumor Formation.

Since deregulated Akt3 activity is consistently observed in melanoma tumors, subsequent studies have focused on determining the mechanism by which increased Akt3 activity promotes tumorigenesis. Cell lines from the UACC 903 (PTEN) tumorigenic model were used to demonstrate whether elevated Atk3 activity promotes melanoma tumorigenicity in nude mouse models. One million cells from the parental UACC 903 (-PTEN), 36A (+ PTEN) or 36A reverted mutant (-PTEN) cell line were injected under the skin of 4-6 week old female nude mice and the tumor size formed was measured 10 days later. It was. 36A cells with reduced Akt3 activity were non-tumorogenic compared to parental UACC 903 and reverted mutant 36A cells with elevated Akt3 activity (P <0.5). While the tumorigenic potential of 36A reverted mutant cells was significantly increased compared to 36A cells, tumor development remained delayed due to retention of the second melanoma suppressor gene on chromosome 10 used to generate the model ( Robertson et al., Cancer Res 59: 3596-3601 (1999). To confirm this observation and to demonstrate the specificity of Akt3 involvement in melanoma tumorigenesis, we prepared a UACC 903 (Akt) model using siRNA. SiRNA mediated reduction of Akt3 expression in UACC 903 cells significantly slowed tumor development compared to cells that were nucleofected with buffer, scrambled siRNA or siRNA against Akt2 or Akt1 (P <0.05). Thus, specifically decreasing Akt3 activity or increasing PTEN expression using siRNA against Akt3 inhibited melanoma tumor development in nude mice.

To determine whether increased apoptosis is the dominant mechanism underlying tumor suppression in vivo after a decrease in Akt3 activity (Stahl et al., Cancer Res 63: 2891-2897 (2003)), apoptosis was determined by UACC 903 with different Akt3 activity. (PTEN) (FIGS. 4C, 4E) and UACC 903 (Akt) models (FIGS. 4D, 4F) were investigated. Subcutaneous injections of non-tumorigenic 36A and oncogenic UACC 903 and 36A remutant cell lines into nude mice and recovery of apoptosis measured by TUNEL after 4 days of concurrently developing temporally and spatially matching tumor masses from each cell type. Size was compared (Stahl et al., Cancer Res 63: 2891-2897 (2003)). 36A (+) with a significantly higher number of apoptotic cells in tumors with high Akt3 activity (FIGS. 4C, 4E) and formed from parental UACC 903 (-PTEN) or 36A revertant (-PTEN) cell lines. PTEN) was observed in tumor mass (P <0.05). Similar results were observed in UACC 903 cells where siRNA against Akt3 was used to lower Akt3 expression (activity). Cells nucleofected with siRNA for buffer or Akt2 had 5 to 7 times less apoptotic cells than UACC 903 cells treated with siRNA for Akt3 (P <0.05). Thus, the results demonstrate that Akt3 activity favors survival of melanoma cells and promotes tumorigenesis by preferentially controlling the degree of apoptosis.

Experimental Discussion of AKT3

In the present invention, we indicate that Akt3 is an important survival kinase that contributes in part to melanoma development. Akt3 was identified as a dominant isotype deregulated during melanoma tumor formation using the UACC 903 (PTEN) melanoma model, which reflects the importance of Akt in melanoma tumorigenesis. The use of siRNA showed that selective knockdown of Akt3 but not Akt1 or Akt2 reduced the level of total phosphorylated Akt and reduced the likelihood of tumorigenesis of melanoma cells. Similar results were found in two independently derived melanoma cell lines (WM115 and SK-MEL-24), which further supported the salience of this finding. The clinical relevance of this observation was confirmed by demonstrating that selective inhibition of Akt3 expression (by siRNA knockdown) or activity (by PTEN expression) significantly reduced melanoma tumor development.

Two separate mechanisms leading to Akt3 activity in melanoma have been identified in this study. The first mechanism is structurally dependent on overexpression of normal Akt3 protein. Analysis of developmental melanoma from human patients showed increased expression in excess of 60% of cases. Overexpression of Akt3 in melanocytes and WM35 cells results in increased activity resulting in human tumor results. Overexpression of Akt is not specific for melanoma but has been documented in numerous studies reporting amplification of the Akt isoform in several human cancers. Akt1 amplification has been reported in gastric cancer [Staal, SO, Proc Nat Acad Sciences USA 84: 5034-5037 (1987)], and Akt2 gene amplification has been found in cancers of the ovary, pancreas, stomach and breast [Cheng et al., Proc Nat Acad Sciences USA 89: 9267-9271 (1992); Chent et al., Proc Nat Sciences USA 93: 3636-3641 (1996); Lu et al., Chung-Hua I Hsueh Tsa Chih [Chinese Medical Journal] 75: 679-682 (1995); Bellacosa et al., Int J Cancer 64: 280-285 (1995); van Dekken et al., Cancer Res 59: 748-752 (1999). Although amplification of genomic regions containing the Akt gene is not reported in melanoma, several reports describe an increase in the number of copies of the armband of chromosome 1 containing the Akt3 gene [Bastian et al., Cancer Res 58: 2170-2175 (1998); Thompson et al., Cancer Genet Cytogenet 83: 93-104 (1995); Mertens et al., Cancer Res 57: 2765-2780 (1997). In contrast, the armbands of chromosome 14 and chromosome 19 containing Akt1 and Akt2 genes, respectively, tend to be unaltered or lost [Bastian et al., Cancer Res 58: 2170-2175 (1998); Thompson et al., Cancer Genet Cytogenet 83: 93-104 (1995); Mertens et al., Cancer Res 57: 2765-2780 (1997). Thus, increasing the number of copies of the Akt3 gene is one of the mechanisms that contribute to increasing the expression and activity of Akt3 in melanoma development.

The second mechanism confirmed that selective Akt3 activity reduced some PTEN activity in the UACC 903 (PTEN) model. Relevant observations in melanocytes and primary melanoma cells that delay PTEN expression (WM35) indicate that siRAN mediated reduction of PTEN increased Akt3 phosphorylation (activity), in particular, which also indicates the importance of Akt3 involvement in melanoma development. Strengthen. Published studies that characterize genetic changes that occur in tumor material from melanoma patients provide additional support for reduced PTEN expression that plays an important role in early melanoma development [Bastian et al., Cancer Res 58 : 2170-2175 (1998); Thompson et al., Cancer Genet Cytogenet 83: 93-104 (1995); Mertens et al., Cancer Res 57: 2765-2780 (1997); Parmiter et al., Cancer Genet Cytogenet 30: 313-317 (1988). Specifically, the loss of one allele of PTEN or the lack of PTEN half occurs usually in early melanoma through loss of the entire copy of chromosome 10 [Bastian et al., Cancer Res 58: 2170-2175 (1998) ; Thompson et al., Cancer Genet Cytogenet 83: 93-104 (1995); Mertens et al., Cancer Res 57: 2765-2780 (1997); Parmiter et al., Cancer Genet Cytogenet 30: 313-317 (1988). Under these conditions, loss of chromosome 10 is predicted to decrease PTEN expression in subpopulations that develop into melanoma cells resulting in increased Akt3 activity and that these cells provide selective growth and survival benefits. Therefore, reduced expression due to lack of PTEN or loss of activity in melanoma plays an important role in melanoma tumor progression, specifically by increasing Akt3 activity.

The underlying molecular basis for displaying selective Akt3 activity and decreasing PTEN expression compared to Akt1 and Akt2 in melanoma is unknown. However, the inventors speculate that the mechanism that leads to this specificity involves the preferential interaction of other proteins with PIP ₃ or flextrin homology (PH) domains. The amino-terminal PH domain mediates protein-protein and PIP ₃ lipid-protein interactions. The PH domain of human Akt3 is ˜104 amino acids long (NCBI Accession No .: NP — 005456), 84% and 78% identical to Akt1 and Akt2, respectively [Brazil et al., Cell 111: 293-303 (2002); And Nicholson et al., Cell Signal 14: 381-395 (2002). Moreover, there are phosphorylation sites in the PH domain that differ between Akt isoforms and have yet to be characterized. For example, ceramide-derived, PKC zeta-dependent phosphorylation sites in threonine 34 (in the PH domain) result in inactivation of Akt1 by preventing binding to PIP ₃ [Powell et al., Mol Cell Biol 23: 7794- 7808 (2003). On the other hand, Akt2 and Akt3 have serine at this position, which can be phosphorylated and be adjusted differently. Analysis of other possible phosphorylation in the PH domain of the three Akt isotypes is consistent with three possible unique Akt3 sites. The remainder of Akt3 is asparagine and the same site of Akt1 and Akt2 is threonine. Moreover, threonine 31 and tyrosine 49 of Akt3 were found to be different from the other two Akt isotypes [Asn31 and Ser31 of Akt1 and Akt2, respectively; Ala50 and Pro50 of Akt1 and Akt2, respectively. Thus, different regulation of putative phosphorylation sites within the PIP ₃ lipid binding PH domain may provide a basis for the specificity of Akt3 activity in melanoma. In addition, unexpected interactions between known oncogenes can selectively modulate Akt isoform activity in melanoma. For example, TCL1 has been shown to selectively bind Akt3 PH domains and promote hetero-oligomerization of Akt1 with Akt3, resulting in transphosphorylation of Akt molecules in leukemia induction [Laine et al., J Biol Chem 277: 3743-3751 (2002)]. Other uncharacterized factors in TCL1 or melanoma cells can selectively promote Akt3 activity in a similar manner.

Increased Akt3 activity also plays an important role in progression to more advanced aggressive tumors. Testing of Akt3 expression and activity in metastatic melanoma has shown that uncontrolled expression or activity occurs in advanced stages of metastatic melanoma that exceed 60%. However, it is not currently known whether the presence of elevated Akt3 activity can predict disease prediction or the results of a therapeutic sample. Determination of Akt3 activation in melanoma is novel and is currently in use at the Breslow depth (e.g., measured in millimeters from the granular cell layer to the deepest tumor cells) and ulcers (melanoma with excessive epithelial loss) It provides a more accurate predictive indicator of disease outcomes than histopathological measurements such as. Molecular testing to assess the activation state of Akt3 in melanocyte lesions will be more sensitive and less subjective than histological evaluation. This method can also be used to select appropriate patients for clinical trials using drugs designed with targeted activated Akt3 or other membranes of the signal pathway.

These studies have shown that the use of siRNA or the expression of PTEN with lower Akt3 activity can effectively reduce the tumorigenic potential of melanoma cells by altering apoptotic sensitivity. Thus, melanoma cells with high levels of Akt3 activity are more suitable for survival in the tumor environment in vivo, and inhibition of Akt3 activity either directly or by interfering with upstream modulators is an effective anticancer strategy for melanoma patients. Soengas et al., Oncogen 22: 3138-3151 (2003); Johnstone et al., Cell 108: 153-164 (2002). In addition, since most chemotherapeutic agents act by inducing apoptosis, the inhibition of Akt3 selectively provides a mechanism for target melanoma cells, such that a threshold dose of drug or radiation is required for effective chemo- or radio-therapy. Is expected to be lower (Soengas et al., Oncogen 22: 3138-3151 (2003)). Therefore, therapeutically targeted Akt3 activity alone or in combination with chemotherapeutic agents may be a potentially important therapy for melanoma patients (Soengas et al., Oncogen 22: 3138-3151 (2003)). In summary, we have identified Akt3 as a specific pro-survival kinase, and its increased activity in melanoma tumors is associated with tumor progression and provides cells with selective advantages to increase environmental stress and survive.

Example for B-RAF

Substances and Methods

Example 10 Cell Lines, Culture Conditions and B-Raf Mutation States:

Human melanoma cell lines UACC 903, 1205 Lu, C8161 and HEK 293T cells were maintained in DMEM (Invitrogen, Carlsbad, Calif.) Supplemented with 10% FBS (Hyclone, Logan, UT). The presence or absence of T1796A B-RAF in UACC 903 and C8161 cell lines was performed as described above [Miller CJ et al. J Invest Dermatol. 123: 990-2 (2004). Moreover, the presence of such variants in UACC 903 and 1205 Lu cells has been described above [Miller CJ et al. J Invest Dermatol. 123: 990-2 (2004)., Tsao H et al. J Invest Dermatol. 122: 337-41 (2004)., Krasilnikov M et al. Oncogene. 22: 4092-101 (2003).

Example 11: In Vitro SiRNA Studies:

SiRNA (100 pmol) is described in Stahl JM et al. Cancer RE. 64: 7002-10 (2004) via 1 × 10 ⁶ UACC 903, via nucleofection with Amaxa Nucleofector (Koeln, Germany) using solution R / program K-17. Introduced into 1205 Lu or C8161 cells. The transfection efficacy obtained was> 90%. After nucleofection, cells were replated for 24 to 48 hours before protein lysates were harvested for Western blot analysis. To determine the duration of siRNA knockdown, cells were nucleofected with siRNA against B-Raf or C-Raf and harvested after 0, 2, 4, 6 and 8 days and Western blot analysis was performed. Duplexed Stealth siRNA (Invitrogen, Carlsbad, Calif.) Is described for this study in Hinorani SR et al. Cancer Res .; 63: 5198-202 (2003) with a modified B-Raf sequence. The siRNA sequences used are as follows: WT B-RAF (COM4 or 4) -GGACAAAGAAUUGGAUCUGGAUCAU; MUT B-RAF (MuA or A) -GGUCUAGCUACAGAGAAAUCUCGAU; C-RAF-GGUCAAUGUGCGAAAUGGAAUGAGC; LAMIN A / C-GAGGAACUGGACUUCCAGAAGAACA; And VEGF-GCACATAGGAGAGATGAGCTTCCTA.

Example 12 Western Blot Analysis:

For Western blot analysis, the cell lysates were 50 mM HEPES (pH 7.5), 150 mM NaCl, 10 mM EDTA, 10% glycerol, 1% Triton X-100, 1 mM Sodium Orthovandate, 0.1 mM Sodium Molybdate, 1 mM Harvest was done in a Petri dish by adding lysis buffer containing phenylmethylsulfonyl fluoride, 20 μg / ml aprotinin, and 5 μg / ml leupeptin. Total cell lysates were centrifuged at 4 ° C. for 10 minutes (≧ 10,000 × g) to remove cell debris. Proteins were quantified using BAC assay from Pierce (Rockford, IL) and 30 μg of lysate per lane was NuPage Gel Life Technologies, Inc .; Carlsbad, Calif. Loaded onto the bed. After electrophoresis, the samples were transferred to a polyvinylidene difluoride membrane (Pall Corporation, Pensacola, FL). Blots were probed with antibodies according to the instructions of each supplier: anti-pErk and anti-pMek from Cell Signaling Technologies (Beverly, Mass.); Antibodies against B-Raf, C-Raf, Erk2 and α-enolase from Santa Cruz Biotechnology (Santa Cruz, Calif.); And antibodies against lamin A / C from Biomeda Corp (Foster City, Calif.). The second antibody was conjugated with horseradish peroxidase and obtained from Santa Cruz Biotechnology. Immunoblots were developed using an improved chemiluminescence detection system (Amersham Pharmacia Biotech, Piscataway, NJ).

Example 13: In vivo SiRNA Studies:

Animal experiments were performed in accordance with protocols allowed by the Institutional Animal Care and Use Committe at the University of Pennsylvania Medical College. Tumor dynamics were measured by subcutaneous injection of 1 × 10 ⁶ UACC 903 or 1205 Lu cells nucleofected with siRNA in 0.2 ml of DMEM supplemented with 10% FBS in both left and right rib cages of 4-6 week old nude mice [ Harlan Sprague Dawley, Indianopolis. IN]. Dimensions of developing tumors were measured every other day using calipers. For mechanism studies, 5 × 10 ⁶ UACC 903 cells nucleofected with siRNA were injected into mice, and as previously described [Stahl JM et al. Cancer Res. 64: 7002-10 (2004)., Stahl JM et al. Cancer Res. 63: 2881-90 (2003)], tumors were harvested 4 days after injection of cells to measure changes in cell proliferation and apoptosis.

Example 14 In Vitro and In Vivo BAY 43-9006 Studies

The BAY 43-9006 compounds used for this study are described in Bankston D et al. Organic Process Res Dev. 6: 777-81 (2002). To assess the inhibitory effect of BAY 43-9006 on wild-type and mutant B-Raf, HEK 293T cells were previously described [Robertson GP et al. Proc Natl Acad Sci USA. 95: 9418-23 (1998)], using calcium phosphate was transfected with HA-tagged wild type B-RAF, mutant ^V599E B-RAF or vector (pcDNA3). After transfection (72 hours), the medium was replaced with DMEM medium supplemented with 10% FBS and 5 μM BAY 43-9006 or DMSO vehicle. After two hours, protein lysates were collected for Western blot analysis. Levels of phosphorylated Mek and Erk were quantified from 3 independent blots and evaluated after fold differences under different conditions were generalized to the Erk 2 loading control.

The effect of BAY 43-9006 on tumor development was measured by subcutaneous injection of 5 × 10 ⁶ UACC 903 or 1 × 10 ⁶ 1205 Lu cells into nude mice. Six days after the development of a small tumor (50-100 mm ³ ), mice receive 50 μl of vehicle (DMSO), or 10, 50 or 100 mg / kg body weight for UACC 903 cells and 50 mg / for 1205 Lu cells. Intraperitoneal injections consisting of the drug BAY 43-9006 were given every other day at a concentration of kg body weight. For studies involving pretreatment with BAY 43-9006, 50 mg / kg body weight drug was injected intraperitoneally twice (-4 days and -2 days) before subcutaneous injection of UACC 903 or 1205 Lu cells. The mechanism by which pharmacological inhibition of mutant ^V599E B-Raf inhibited tumor development was elucidated in comparison to tumors of the same size, which developed in parallel. This is achieved on day 6 by intraperitoneal injection of 50 mg / kg of BAY 43-9006 every two days after subcutaneous injection of 5 × 10 ⁶ UACC 903 cells. To temporally and spatially match control DMSO with drug-treated tumors, 1 × 10 ⁶ , 2.5 × 10 ⁶ , or 5 × 10 ⁶ million USCC 903 cells were injected subcutaneously and treated intraperitoneally with DMSO vehicle every 6 days from day 6 It was. The same sized drug or vehicle treated tumors, which develop side by side, were harvested on days 9, 11, 13 and 15 for comparison. At each time point, tumors from vehicle or drug treated mice were harvested as previously described for analysis of cell proliferation, apoptosis and vascular development [Stahl JM et al. Cancer Res. 64: 7002-10 (2004), Stahl JM et al. Cancer Res. 63: 2881-90 (2003).

Example 15 Apoptosis, Cell Proliferation and Vascular Density Measurements in Tumors

Apoptosis measurements on formalin-fixed paraffin-inserted tumor sections were performed as previously described using the Tunnel TMR Red Apoptosis Kit from Roche (Manheim, Germany) [Stahl JM et al. Cancer Res. 64: 7002-10 (2004), Stahl JM et al. Cancer Res. 63: 2881-90 (2003). Cell proliferation rates in formalin-fixed tumor sections were measured using the RPN 20 cell proliferation kit (Amersham Biosciences, Piscataway, NJ) using BrdU introduction and immunocytochemistry. Two hours prior to lethality, 0.2 ml of BrdU was injected intraperitoneally into mice and tumors were treated according to the instructions in the propagation kit. The number of BrdU stained cells was calculated as the total percentage of tumor cells treated with BAY 43-9006 or vehicle (DMSO). Quantification of blood vessel density using purified rat anti-mouse CD31 (PECAM-1) monoclonal antibody (Pharmingen, San Diego, Calif.) Has been described previously [Stahl JM et al. Cancer Res. 64: 7002-10 (2004), Stahl JM et al. Cancer Res. 63: 2881-90 (2003). The proportional area of tumor occupied by blood vessels relative to the total area was calculated using the IP Lab imaging software program. For all tumor analyzes, analyzes were made from at least six different tumors with 4 to 6 fields per tumor and the results are expressed as mean ± standard deviation.

Example 16: In vivo pErk Measurements:

To quantify changes in pErk levels in formalin-fixed and paraffin-embedded tumor sections, antigen recovery was performed with 0.01 M citrate buffer for 20 minutes at pH 6.0 in a 95 ° C. water bath. The slides were cooled for 20 minutes, rinsed in PBS and then incubated for 10 minutes in 3% H ₂ O ₂ to quench endogenous peroxidase activity. Sections were then blocked with 1% BSA for 30 minutes and incubated overnight at 4 ° C. with anti-pERK antibody at 1: 100 dilution (Cell Signaling Technologies, Beverly, Mass.). After rinsing in PBS, sections were incubated with biotinylated anti rabbit IgG for 1 hour, rinsed in PBS again, and incubated with peroxidase labeled streptavidin for 30 minutes. Visualization was performed for 5-10 minutes using AEC (aminoethyl carbazole) substrate kit [Zymed laboratories Inc., South San Francisco, CA] and hematoxylin prior to mounting the coverslips using an aqueous mounting solution. Counterstaining. The average percentage ± standard deviation of cells stained positive for pErk was calculated from a minimum of six different tumors with 4 to 6 fields controlled per tumor.

Example 17: In vitro Doubling Time and In Vivo Tumor Incubation Period

In vitro doubling time of UACC 903 cells was assessed by plating 5 × 10 ³ cells / well in 200 μl of DMEM supplemented with 10% FBS to several rows of wells in five 96-well plates. Growth is measured every 24 hours over 5 days using a colorimetric assay on one plate using a sulforodamine B (SRB) binding assay (Sigma Chemical Co., St Louis, Mo.) and doubling time is conventional As described [Stahl JM et al. Cancer Res. 63: 2881-90 (2003). Tumor incubation in vivo was determined by assessing the number of days required for the mean tumor size to reach 10 mm ³ .

Example 18 BAY 43-9006 Growth Inhibition / IC-50 of UACC 903 Melanoma Cells

To measure the growth inhibitory effect or IC-50 of BAY 43-9006 on UACC 903 cells, 5 × 10 ³ cells / well were plated in 96-well plates. After 24 hours, various concentrations of BAY 43-9006 (0, 0.02, 0.1, 0.4, 1.6, 6.3, 25 or 100 μM) were added to the duplicate 8-strip wells in the plate. After growing for 72 hours at 37 ° C. in a 5% CO ₂ humidified atmosphere, the medium was removed and the cells fixed with 10% trichloroacetic acid. Cell survival at each concentration of drug was calculated using the SRB binding assay (Stahl JM et al. Cancer Res. 63: 2881-90 (2003)). Western blot analysis was used to increase the concentration of BAY 43-9006 (5, 10, 15 or 20 μM) on phosphorylation levels of Mek 1/2 and Erk 1/2 in UACC 903 cells after 2 hours of drug exposure. Indicated.

Example 19: VEGF Expression Analysis

Human VEGF Quantikine kit (DVE00) was used to determine the amount of VEGF secreted by cells after siRNA mediated knockdown of B-Raf protein or after treatment with BAY 43-9006 [ R & D Systems Inc., Minneapolis, MN]. UACC 903 or 1205 Lu cells (5 × 10 ⁵ ) nucleofected with various siRNAs were plated in 60 mm Petri dishes and the media was changed to DMEM containing 2% FBS after 24 hours. After an additional 24 hours, the medium was changed again and media adjusted for ELISA analysis were collected after 24 and 48 hours. For the BAY 43-9006 study, 3 × 10 ⁵ UACC 903 or 1205 Lu cells were plated in 60 mm Petri dishes and after 24 hours the medium was changed to DMEM containing 2% FBS. After an additional 24 hours, the medium was changed to either DMEM alone supplemented with 2% FBS or in combination with BAY 43-9006 (5, 10, 15 μM) or DMSO vehicle. After 12 or 24 hours, conditioned media was collected for ELISA analysis. The medium was cleared by centrifugation at 14,000 rpm (4 ° C.) for 5 minutes and stored at -80 ° C. VEGF ELISA assays were performed three times on duplicate experiments according to manufacturer's instructions.

Example 20 Statistics

For statistical analysis, the Student's t-test is used for pairwise comparisons, and ANOVA or Kruskal-Wallis test is used for pairing, followed by appropriate post hoc. ) Tests (Dunnett's, Tukey's or Dunn's) were performed. The results were considered significant at P-values less than 0.05.

Experiment result

Example 21 SiRNA Mediated Targeting of Mutant ^V599E B-Raf Inhibits Melanoma Tumor Development

Table 2. Growth characteristics of UACC 903 cells treated with siRNA for B-Raf, C-Raf or scrambled siRNA

SiRNA treatment In vitro Doubling Time (Days) % ± standard deviation of cell proliferation in tumor on day 4 Incubation period for tumor formation (days) ¹ scramble 1.25 (30) 10 ± 0.7 5 C-Raf 1.1 (26) 15 ± 0.6 5 B-Raf (4) 1.6 (38.4) 2 ± 0.6 14 B-Raf (A) 1.7 (40.8) 2 ± 0.4 16 1: The incubation period for tumor formation is defined as the number of days required for the average tumor size to reach 10 mm ³ .

The role of mutant ^V599E B-Raf in melanoma tumorigenesis is currently unknown. To address this problem, the inventors thought that inhibition of the expression or activity of the mutant ^V599E B-Raf protein could be used to identify the role that such protein plays in melanoma tumorigenesis. siRNA mediated methods are used for knockdown expression of mutant ^V599E B-Raf in UACC 903 and 1205 Lu cell line containing mutant proteins or knockdown expression of B-Raf in C8161 cell line lacking T1796A mutation. MuA or A siRNAs are designed to reduce the expression of wild type and mutant proteins whereas Com4 or 4 siRNAs only degrade the expression of mutant proteins as described above [Hingorani SR et al. Cancer Res .; 63: 5198-202 (2003). SiRNA for this study was introduced into the cell line via nucleofection resulting in greater than 90% transfection efficiency (data not shown), Stahl JM et al. Cancer Res. 64: 7002-10 (2004). The effect of siRNA to reduce the expression of B-Raf and C-Raf proteins in UACC 903 (FIG. 12A), 1205 Lu (FIG. 12B) and C8161 (FIG. 12C) cells after nucleofection was measured by Western blot analysis. . 24 and 48 hours after nucleofection, each siRNA only reduced the expression of the protein relative to the beginning, thereby confirming the specificity and effect of siRNA knockdown in each of these cell lines. In UACC 903 and 1205 Lu cells, only siRNA against B-Raf reduced the phosphorylation (activity) levels of downstream target Mek and Erk, whereas siRNA against scrambled siRNA or C-Raf had no effect on these proteins. 12A and 12B. The maximum reduction in phosphorylation (activity) levels of Mek and Erk in UACC 903 and 1205 Lu cells was observed 48 hours after nucleofection. In contrast, reduced expression of B-Raf or C-Raf in C8161 has a negligible notable effect on the levels of phosphorylated Mek and Erk [FIG. 12C]. Thus, inhibition of ^V599E B-Raf expression in melanoma cell lines containing mutant proteins results in decreased activity of Mek and Erk, and reduction of expression of B-Raf protein in melanoma cells lacking T1796A mutations is downstream. It did not appear to affect the activity of the target.

To measure the effect of reducing a ^V599E B-Raf expression (activity) for the melanoma tumor development, UACC 903 and 1205 ^V599E B-Raf expression in Lu cell line it was inhibited by using siRNA, the present applicant since the prior reported Mice were injected subcutaneously using the instant knockdown method [Stahl JM et al. Cancer Res. 64: 7002-10 (2004). SiRNA mediated knockdown of protein expression lasted for at least 8 days in UACC 903 (FIG. 13A) and 1205 Lu (FIG. 13B). Moreover, a corresponding decrease in pErk levels was also observed for the same period of time (FIG. 13B). Developmental tumor size was measured every other day until 17.5 days after nucleofection to determine the effect of B-Raf knockdown on melanoma tumorigenesis. A decrease in tumor development was observed in both UACC 903 (FIG. 13C) and 1205 Lu (FIG. 13D) cells, and mutant ^V599E B-Raf expression knocked down. In contrast, siRNA mediated inhibition of C-Raf, scrambled siRNA or buffer control did not alter tumor development. The lack of the effect of knockdown of C-Raf suggests that signaling through ^V599E B-Raf is particularly essential for tumor development. Thus, siRNA mediated reduction of ^V599E B-Raf expression (activity) in melanoma cells prior to injection into mice inhibited tumorigenesis.

Similar experiments were attempted to inhibit the activity of B-Raf protein in UACC 903, 1205 Lu or C8161 cells using a Raf kinase inhibitor of BAY 43-9006. These compounds, originally identified on screens for Raf kinase inhibitors, have been shown to effectively inhibit the activity of wild-type B-Raf proteins [Lowinger TB et al. Curr Pharm Des. 8: 2269-78 (2002)., Lyons JF et al. Endocr Relat Cancer. 8: 219-25 (2001). Initially, we measured the concentration of BAY 43-9006, aka IC-50, in which the survival of UACC 903 cells was halved, confirming that it was 5-6 μM (data not shown). Therefore, a concentration of 5 μM was chosen in subsequent in vitro studies. Next, we expressed HA-tagged wild type or mutant ^V599E B-Raf constructs in HEK 293T cells, indicating that BAY 43-9006 inhibited the activity of both mutant and wild type to a similar range (FIG. 14A). . As previously reported, we observed that the level of phosphorylated (active) Erk or Mek is 5-7 times higher in cells expressing ^V599E B-Raf than in cells transfected with wild type B-RAF alone. Davies H et al. Nature. 417: 949-54 (2002). HEK 293T cells expressing wild-type or mutant ^V599E B-Raf protein were exposed for 2 hours at 5 μM BAY 43-9006 to examine the effect on the activity of the signal pathway. Exposure to BAY 43-9006 reduced the levels of phosphorylated Mek and Erk of cells expressing wild type or mutant ^V599E B-Raf proteins 5-6 fold and 3-4 fold, respectively (FIG. 14A). Thus, BAY 43-9006 inhibits the activity of both wild type and mutant B-Raf.

To determine that BAY 43-9006 inhibits the mutant ^V599E B-Raf protein signal in UACC 903 cells, in vitro cultures were exposed for 2 hours with increasing concentrations of BAY 43-9006. BAY 43-9006 reduced the levels of phosphorylated (active) Mek and Erk in UACC 903 cells in a dose response manner (FIG. 14B). The inhibitory effect of BAY 43-9006 on MAP kinase signal persisted for at least 2-3 days in UACC 903 and 1205 Lu cell lines (data not shown). We next measured the effects of animals pretreated with BAY 43-9006 prior to subcutaneous injection of UACC 903 or 1205 Lu cells. For this experiment, mice were exposed to 50 mg / kg BAY 43-9006 for 4 days prior to subcutaneous injection of 5 × 10 ⁶ cells followed by intraperitoneal injection of the drug every 2 or 3 days up to 22 days. UACC 903 (FIG. 14C) and 1205 Lu (data not shown) tumor development was significantly inhibited (student t-test; p <0.05), and comparison of matched UACC 903 tumor size was compared with BAY 43 compared to vehicle treated control (not shown). -9006 treatment reduced proliferation and decreased vascular development in tumors. Moreover, tumor size slowly increased up to 8 days after stabilization without statistical difference between subsequent tumor measurements (ANOVA; P> 0.05). Therefore, pharmacological inhibition of mutant ^V599E B-Raf activity by pre-treatment as a host animal as BAY 43-9006 had significantly reduced the tumor formation potential of melanoma expressing a mutant ^V599E B-Raf cell.

Tumor cell proliferation and apoptosis rates were measured 4 days after subcutaneous injection in UACC 903 tumors to identify the mechanism that results in tumor suppression in cells pretreated with siRNA to knock down ^V599E B-Raf activity. Apoptosis rates detected using the TUNEL assay did not differ (1-2%) (data not shown). However, UACC 903 cells treated with siRNA for B-Raf had 5 to 6 times less proliferating cells than control cells nucleofected with buffer, scrambled siRNA or C-RAF siRNA (FIG. 14D). Next, in vitro doubling time, in vivo proliferation rate and tumor incubation time were compared to determine whether reduced growth caused delayed tumor development (FIG. 2). UACC 903 cells nucleofected with siRNA or scrambled siRNA for C-RAF doubled in vitro every 1.2 days (or ˜29 hours), whereas cells nucleofected with siRNA for B-RAF It doubled every 1.65 days (or ˜40 hours), with a delay of ˜38%. In contrast, analysis of cell proliferation in tumors showed a significant difference between control tumors nucleofected with siRNA or scrambled siRNA for C-Raf (ANOVA; p <0.05), B with 2-3% proliferating cells. It had 10-15% of proliferating cells compared to tumor cells nucleofected with siRNA against -Raf. A ˜82% reduction in the proliferative capacity of cells nucleofected with B-RAF siRNA can cause a delayed incubation period of tumor development. As a result, for day 5 tumors of the same size as the control, cells nucleofected with siRNA for B-RAF required an additional 10 days to form tumors of the same size (Table 2). Since tumor development was delayed> 200%, the decreased growth rates observed in vitro and in vivo may be responsible for the reduced likelihood of tumor formation of these cells. Therefore, inhibition of mutant ^V599E B-Raf expression (activity) of melanoma cells prior to tumor formation reduces the likelihood of cell growth in vivo, thereby delaying tumorigenesis.

Example 22 Inhibition of Melanoma Tumor Development by Targeting Mutant ^V599E B-Raf in Existing Tumors

Whether targeting of mutant ^V599E B-Raf in a preexisting melanoma tumor that has occurred can delay tumor development, and in this case whether the mechanism is the same as what occurs when targeting ^V599E B-Raf in cells prior to tumor formation Currently unknown Therefore, we next tested whether pharmacologically targeting of B-Raf in tumors that already exist inhibits tumor development with a similar mechanism. Five million UACC 903 cells, one million 1205 Lu cells or five million C8161 cells were injected subcutaneously into 4-6 week old female nude mice. On day 6, mice (DMSO) or BAY 43-9006 compound (10, 50 or 100 mg / kg) dissolved in vehicle were administered to mice via intraperitoneal injection every 48 hours. 48 hours were chosen between drug administrations because the inhibitory effect on the MAP kinase signal pathway in UACC 903, 1205 Lu and C8161 cells persists for at least this period (data not shown). The size of the developed tumor was measured every other day using a caliper. FIG. 15A shows results for UACC 903 cells and FIG. 15B for 1205 Lu cells. All concentrations of BAY 43-9006 compound reduced UACC 903 tumor development, while only concentrations above 50 mg / kg caused tumor development in the plane 7 days after initiation of treatment. Tumor development in mice treated with 10 mg / kg BAY 43-9006 was delayed by ~ 1 week, but UACC 903 tumors continued to increase in size and were euthanized on day 27 when the tumor size exceeded 2,400 mm ³ . . For UACC 903 cells, a small increase in tumor size occurred up to 13 days; After 1 week after drug treatment, tumor size stabilized and there was no statistically significant increase in tumor size between days 13 and 31 (FIG. 15A) (ANOVA; P> 0.05). Treatment of 1205 Lu tumors with 50 mg / kg BAY 43-9006 also reduced tumor development in a similar manner resulting in planarization of tumor size from days 17-31 (FIG. 15B) (ANOVA; P = 0.12). In contrast, while BAY 43-9006 inhibited pMek and pErk levels in C8161 cells, no difference was observed in the kinetics of tumor formation (data not shown). Thus, pharmacological inhibition of mutant ^V599E B-Raf activity delays tumor development in already existing melanoma tumors, but does not degrade tumors. In contrast, inhibition of B-Raf in melanoma cells lacking T1796A mutation did not appear to alter the tumorigenic potential.

To confirm that BAY 43-9006 compound affects the activity of the mutant ^V599E B-Raf signal pathway in tumors, the percentage of elevated cell expression of phosphorylated Erk is 50 mg / kg containing vehicle (DMSO) or vehicle. Nine days after initiation of treatment with BAY 43-9006 were counted in tumors from mice (FIG. 15C). Quantification of the number of pErk positive cells showed that BAY 43-9006 treated tumors had ˜3 times less pErk positive cells than control vehicle treated tumors (FIG. 15D) (Student t-test; P <0.05). Significantly large numbers of phosphorylated Erk positive cells in vehicle treated tumors indicate that BAY 43-9006 inhibits the activity of the mutant ^V599E B-Raf signaling pathway in vivo. Thus, these results indicate that pharmacological inhibition of mutant ^V599E B-Raf to BAY 43-9006 mediates tumor inhibition by reducing MAP kinase pathway signals in tumors.

Example 23: Mechanistically, BAY 43-9006 increases apoptosis by inhibiting vascular development of already existing melanoma tumors

The experiment shows a constant relationship between inhibition of mutant ^V599E B-Raf activity and reduced tumor development; Therefore, subsequent studies focus on identifying mechanisms that occur in melanoma tumors in which the mutant ^V599E B-Raf is present. For this study, in order to identify important events that delay the growth of established tumors presenting transiently and spatially matched UACC 903 tumors exposed to vehicle or BAY 43-9006, apoptosis and apoptosis rate were identified. Was analyzed. Matched tumors are harvested every 2 days beginning on day 9 and until day 15; Apoptosis rate, growth and vascular development were compared at each time point (FIG. 16). Statistically significant differences in vessels on day 9 were observed in vehicle and BAY 43-9006 treated tumors (FIG. 16A) (Student t-test; P <0.05). In contrast, the statistically significant difference between the control and BAY 43-9006 treated tumors was found in the number of proliferating cells in the tumor mass (student t-test; P = 0.61) or in the apoptotic region (student t-test; P = 0.15) on day 9 Was not detected (FIG. 16B or 16C). However, for all assays from day 11, a statistically significant difference was observed between the control and drug treated tumors (Student's t-test; P <0.05). Collectively, these data suggest that the significantly reduced vascular development observed on day 9 in BAY 43-9006 treated tumors is an initiating event resulting in delayed tumor growth. Apoptosis was evident in BAY 43-9006 treated tumors on day 11 and occupied up to 25% of tumor area on day 15 (FIG. 16B). On day 20, ˜50% of tumor areas progressed apoptosis (data not shown). BAY 43-9006 also affected tumor cell proliferation of already existing tumors, reducing the percentage of proliferating cells by 32-57% (FIG. 16C). Collectively, these data led to the conclusion that inhibition of vascular development is an important issue leading to growth inhibition of already existing melanoma tumors.

Because vascular development in tumors occurs through angiogenesis or growth of new blood vessels from the surrounding vascular layer and is caused by angiogenic factors secreted by tumor cells [Carmeliet P, Jain RK. Nature. 407: 249-57 (2000), we anticipated that BAY 43-9006 and siRNA mediated inhibition of ^V599E B-Raf reduced the activity of important angiogenic factors, thereby reducing vascular development [Kranenburg]. O et al. Biochim Biophys Acta. 1654: 23-37 (2004)., Jain RK. Semin Oncol. 29: 3-9 (2002). To test this possibility, ELISA assays were used to determine whether the secretion of VEGF would subsequently reduce the inhibition of ^V599E B-Raf. Initially, UACC 903 and 1205 Lu cells in which ^V599E B-Raf expression was inhibited using siRNA were tested and showed a significant decrease in VEGF secretion compared to the control (FIG. 17A). Next, the effects of BAY 43-9006 mediated inhibition of ^V599E B-Raf UACC 903 and 1205 Lu cells were tested and found to reduce VEGF secretion in a dose dependent manner (FIG. 17B). In order to determine whether siRNA mediated reduction of VEGF results in tumor suppression similar to that shown for ^V599E B-Raf inhibition, siRNA against VEFG was nucleofected with UACC 903 or 1205 Lu cells. Reduced VEGF expression was observed using VEGF specific siRNA (FIG. 17A), which was then followed by tumors of UACC 903 (FIG. 17C) and 1205 Lu (FIG. 17D) in the same manner as resulting in reduced ^V599E B-Raf expression. Reduced the likelihood of formation. Thus, decreased VEGF secretion mediated by reduced ^V599E B-Raf activity resulted in inhibition of vascular development and consequently affected melanoma tumor development.

Experimental Discussion of B-Raf

This study demonstrates that the use of siRNA and pharmacological inhibition of mutant ^V599E B-Raf expression (activity) effectively reduces the tumorigenic potential of melanoma cells by reducing tumor cell proliferative and / or angiogenic capacity. As such, melanoma cells with mutant ^V599E B-Raf are more suitable for proliferation in tumor environments in vivo. We have found that targeted reduction of ^V599E B-Raf expression in melanoma cells prior to tumor development significantly reduces the growth potential of melanoma cells, thereby inhibiting tumor development. In contrast, apoptosis does not play a significant role in this process. Moreover, inhibition of tumor development was observed only in cells that knocked down mutant ^V599E B-Raf expression and did not knock down C-Raf or knocked down B-Raf in melanoma cells lacking the T1796A B-RAF mutation. Therefore, it is clear that the signal through ^V599E B-Raf is particularly necessary for melanoma tumor development. These data are consistent with the above studies showing that siRNA mediated inhibition of ^V599E B-Raf in WM793 melanoma cells reduces the growth potential of these cells in vitro [Hingorani SR et al. Cancer Res .; 63: 5198-202 (2003). Similar in vitro studies with UACC 903 cells in this report confirm earlier observations. ^{Knockdown of} mutant ^V599E B-Raf expression (activity) also specifically reduces constitutive Erk signals resulting in reduced growth, which does not cause knockdown of C-Raf. Thus, mutant ^V599E B-Raf promotes the growth of melanoma cells both in vitro and in vivo; Moreover, targeted inhibition prior to tumor development inhibits oncogenesis mediated through reduced growth of tumor cells.

Target mutation ^V599E B-Raf stopped growing in established tumors already present; Growth inhibition played only a partial role in this process. More specifically, comparison of size and time matched tumors has shown that inhibition of vascular development plays an initiating role in delaying tumor growth. As with all solid tumors, vascular development occurs through angiogenesis, where the growth of new blood vessels from the surrounding vascular layer is driven by angiogenic factors secreted by tumor cells [Carmeliet P, Jain RK. Nature. 407: 249-57 (2000). In this study, we found that inhibition of ^V599E B-Raf reduced VEGF secretion by UACC 903 and 1205 Lu melanoma cells. B-Raf has been reported to play an important role in early vascular development because B-RAF knockout mice show significant endothelial cell death leading to bleeding and fetal fatal wounds [Wojnowski L et al. Nat Genet; 16: 293-7 (1997). However, we did not observe significant endothelial cell death in tumor vessels already present after inhibition of ^V599E B-Raf using BAY 43-9006. In addition, inhibition of ^V599E B-Raf inhibited angiogenesis [Kranenburg O et al. Biochim Biophys Acta. 1654: 23-37 (2004)., Jain RK. Semin Oncol. 29: 3-9 (2002) were mediated through reduced VEGF secretion by tumor cells. This observation is supported by published evidence, where reduced VEGF secretion results in decreased angiogenesis, thereby inhibiting the tumorigenic potential of cancer cells [Heidenreich R et al. Int J Cancer. 111: 348-57 (2004)., Inai T et al. Am J Pathol. 165: 35-52 (2004). Thus, reduced VEGF secretion mediated by a decrease in mutant ^V599E B-Raf signal results in inhibition of angiogenesis and stops the growth of already existing melanoma tumors.

The study also shows that BAY 43-9006 inhibits ^V599E B-Raf in vitro and in vivo, resulting in reduced phosphorylation of downstream targets Mek and Erk that slow melanoma tumor development. We observed that pretreatment of animals with BAY 43-9006 reduced melanoma tumor development in a manner similar to siRNA mediated inhibition. However, BAY 43-9006 treatment only delays the development of established tumors by dividing this vascular development. Complete degeneration of the tumor did not occur, but rather the tumor size became relatively stable after treatment. This observation is consistent with prior data from clinical trials, where BAY 43-9006 monotherapy was relatively ineffective for the treatment of patients with developmental melanoma [Tuveson DA et al. Cancer Cell. 4: 95-8 (2003)., Ahmad T et al. Proc Am Soc Clin Oncol. 23: 708 (2004). However, in combination with conventional chemotherapy (paclitaxel and carboplatinum), 50% response rate occurred in patients [Tuveson DA et al. Cancer Cell. 4: 95-8 (2003). Flaherty K et al. Proc Am Soc Clin Oncol. 23: 708 (2004). Therefore, while BAY 43-9006 slows tumor development, drugs will need to be combined with other synergistic therapies to cause the degeneration of already established tumors [Tuveson DA et al. Cancer Cell. 4: 95-8 (2003)., Bollag G et al. Curr Opin Investig Drugs. 4: 1436-41 (2003)., Lyons JF et al. Endocr Relat Cancer. 8: 219-25 (2001). In addition, the route of drug administration could alter the efficacy of BAY 43-9006 in melanoma patients. The study was administered via peritoneal injection every two to three days while the clinical trial included oral administration of the drug. Alternative routes of administration may be more effective by increasing the local biocompatibility of the drug [Sparreboom A et al. Proc Natl Acad Sci USA. 94: 2031-5 (1997)., Bardelmeijer HA et al. Cancer Research. 62: 6158-64 (2002)., Hale JT et al. Bioch Pharm. 64: 1493-502 (2002)., Kimira Y et al. Cancer Chemother Pharm. 49: 322-8 (2002). Therefore, therapeutic targeting ^V599E B-Raf activity in combination with chemotherapeutic agents may provide an effective method for reducing established melanoma tumors containing such mutant proteins.

In conclusion, we have identified a mechanism that shows how mutant ^V599E B-Raf promotes melanoma tumor development and that this variation provides melanoma cells and angiogenic benefits with selective growth in the tumor environment.

Example 24 Akt3 Domain Exchange Experiments, Results, and Discussion

Domain switching between Akt isoforms has identified regions of Akt3 that lead to preferential activation of Akt3 but not Akt 1 or Akt2 in melanoma. Activity is measured as the level of phosphorylation of threonine 308 or serine 472 in Akt3; Crosstide after immunoprecipitation of Akt3 is measured by an in vitro kinase assay in which phosphorylation is carried out to the activity expected by Akt3. The domain of Akt3 was switched to that of Akt2 or Akt1 and the chimeric gene containing construct was nucleofected with the melanoma cell line WM35 or UACC 903. Myristoylated Akt3 and Akt2 served as positive controls and killed Akt3 (T305A / S472A) and Akt2 (T309A / S474A) served as negative controls. Migration of wild type Akt3 resulted in increased activity as opposed to wild type Akt2, indicating specificity for Akt3 activity in melanoma cells. The construct where the flextrin homology domains (amino acids 1-110) from Akt3 were linked to the catalytic-regulatory domain of Akt2 did not result in activity. In contrast, the construct in which the flextrin homology domain (amino acids 1-110) from Akt2 was linked to the catalyst-regulatory domain (amino acids 111-497) of Akt3 was activated. This represents an important region resulting in preferential Akt3 activity of melanoma from amino acids 111-497. This is the area where therapeutics can be targeted, especially in melanoma to inhibit Akt3 activity.

As long as the present invention is described in connection with the specific embodiments described above, many alternatives, variants and variants thereof will be apparent to those skilled in the art. All such alternatives, variants, and variants are intended to fall within the spirit and scope of the invention. All documents cited herein (eg, publications and patent applications) are incorporated by reference in the same range as indicated by the individual documents in detail and individually.

References:

SEQUENCE LISTING <110> Pennsylvania State Research Foundation <120> Combinatorial Methods and Compositions for Treatment of Melanoma <130> P06710WO0 <140> PCT / US 05/08950 <141> 2005-03-18 <150> US 60 / 554,509 <151> 2004-03-19 <160> 16 <170> PatentIn version 3.3 <210> 1 <211> 19 <212> RNA <213> Homo Sapiens <400> 1 cuaucuacau uccggaaag 19 <210> 2 <211> 19 <212> RNA <213> Homo Sapiens <400> 2 gaauuuacag cucagacua 19 <210> 3 <211> 19 <212> RNA <213> Homo Sapiens <400> 3 cagcucagac uauuacaau 19 <210> 4 <211> 25 <212> RNA <213> Homo Sapiens <400> 4 cuuggacuau cuacauuccg gaaag 25 <210> 5 <211> 25 <212> RNA <213> Homo Sapiens <400> 5 cuuuccggaa uguagauagu ccaag 25 <210> 6 <211> 25 <212> RNA <213> Homo Sapiens <400> 6 gaugaagaau uuacagcuca gacua 25 <210> 7 <211> 25 <212> RNA <213> Homo Sapiens <400> 7 uagucugagc uguaaauucu ucauc 25 <210> 8 <211> 25 <212> RNA <213> Homo Sapiens <400> 8 aauuuacagc ucagacuauu acaau 25 <210> 9 <211> 25 <212> RNA <213> Homo Sapiens <400> 9 auuguaauag ucugagcugu aaauu 25 <210> 10 <211> 25 <212> RNA <213> Homo Sapiens <400> 10 ggucuagcua cagagaaauc ucgau 25 <210> 11 <211> 25 <212> RNA <213> Homo Sapiens <400> 11 ggacaaagaa uuggaucugg aucau 25 <210> 12 <211> 6 <212> RNA <213> Homo Sapiens <400> 12 cuugga 6 <210> 13 <211> 25 <212> RNA <213> Homo Sapiens <400> 13 aauuuacagc ucagacuauu acaau 25 <210> 14 <211> 25 <212> RNA <213> Homo Sapiens <400> 14 ggucaaugug cgaaauggaa ugagc 25 <210> 15 <211> 25 <212> RNA <213> Homo Sapiens <400> 15 gaggaacugg acuuccagaa gaaca 25 <210> 16 <211> 25 <212> DNA <213> Homo Sapiens <400> 16 gcacatagga gagatgagct tccta 25

Claims (59)

Or a siRNA molecule comprising a polynucleotide selected from the group having a complementary sequence thereof, the siRNA molecule reducing Akt3 activity; And a carrier for treating melanoma tumors. delete delete delete The method of claim 1, wherein the carrier is liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, nanoparticles, calcium phosphorus-silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline fine particles, semiconductor nanoparticles Pharmaceutical composition selected from the group consisting of poly (D-arginine), nanodendrimers, viruses, and calcium phosphate nucleotide-mediated nucleotide delivery. delete delete delete delete delete delete 2. A pharmaceutical composition according to claim 1, which is administered in combination with an alkylating agent, an antimetabolite, an antibiotic, a natural or plant derived product, a hormone and a chemotherapeutic agent selected from the group consisting of steroids and platinum drugs. 13. The pharmaceutical composition of claim 12, wherein the chemotherapeutic agent is dacarbazine. The pharmaceutical composition according to claim 1, which is administered in combination with irradiation. Decreases Akt3 activity leading to apoptosis, Or an effective amount of siRNA comprising a polynucleotide selected from the group having a complementary sequence thereof; And Decreases angiogenesis and cell proliferation by reducing V599E B-Raf activity, A pharmaceutical composition for treating melanoma tumors in a mammal, comprising BAY 43-9006 or an effective amount of a siRNA molecule comprising a polynucleotide having a sequence of 5 'GGUCUAGCUACAGAGAAAUCUCGAU 3' or 5 'GGACAAAGAAUUGGAUCUGGAUCAU 3'. delete delete delete delete The method of claim 15, wherein siRNA molecules that reduce Akt3 activity are liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, nanoparticulates, calcium phosphorus-silicate nanoparticulates, calcium phosphate nanoparticulates, silicon dioxide nanoparticulates, nanoparticles Pharmaceutical compositions introduced into melanoma tumors using crystalline microparticles, semiconductor nanoparticulates, poly (D-arginine), nanodendrimers, viruses, calcium phosphate nucleotide-mediated nucleotide delivery, electroporation, and microinjection. delete delete delete delete delete delete The pharmaceutical composition of claim 15, which is administered in combination with an chemotherapeutic agent selected from the group consisting of alkylating agents, anti-metabolic agents, antibiotics, natural or plant derived products, hormones and steroids and platinum drugs. The pharmaceutical composition according to claim 15, which is administered in combination with irradiation. delete The method of claim 15, wherein the siRNA molecules that reduce V599E B-Raf activity are liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, nanoparticles, calcium phosphorus-silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles. Pharmaceutical compositions introduced into melanoma tumors using microparticles, nanocrystalline particulates, semiconductor nanoparticulates, poly (D-arginine), nanodendrimers, viruses, calcium phosphate nucleotide-mediated nucleotide delivery, electroporation, and microinjection. The pharmaceutical composition of claim 15, wherein the siRNA molecule that reduces V599E B-Raf activity comprises a polynucleotide having the sequence of 5 ′ GGUCUAGCUACAGAGAAAUCUCGAU 3 ′. The pharmaceutical composition of claim 15, wherein the siRNA molecule that reduces B-Raf activity comprises a polynucleotide having a sequence of 5 ′ GGACAAAGAAUUGGAUCUGGAUCAU 3 ′. delete delete The pharmaceutical composition of claim 15, wherein siRNA that reduces Akt3 activity and siRNA molecule that reduces V599E B-Raf activity or BAY 43-9006 are administered simultaneously or sequentially. delete delete delete The method of claim 1 wherein the small interfering RNA (siRNA) molecule is a polynucleotide Or a complementary sequence thereof. The method of claim 1 wherein the small interfering RNA (siRNA) molecule is a polynucleotide Or a complementary sequence thereof. The method of claim 1 wherein the small interfering RNA (siRNA) molecule is a polynucleotide Or a complementary sequence thereof. The method of claim 1 wherein the small interfering RNA (siRNA) molecule is a polynucleotide Or a complementary sequence thereof. The method of claim 1 wherein the small interfering RNA (siRNA) molecule is a polynucleotide Or a complementary sequence thereof. The method of claim 1 wherein the small interfering RNA (siRNA) molecule is a polynucleotide Or a complementary sequence thereof. The method of claim 1 wherein the small interfering RNA (siRNA) molecule is a polynucleotide Or a complementary sequence thereof. The method of claim 1 wherein the small interfering RNA (siRNA) molecule is a polynucleotide Or a complementary sequence thereof. The method of claim 1 wherein the small interfering RNA (siRNA) molecule is a polynucleotide Or a complementary sequence thereof. The method of claim 1 wherein the small interfering RNA (siRNA) molecule is a polynucleotide Or a complementary sequence thereof. The method of claim 1 wherein the small interfering RNA (siRNA) molecule is a polynucleotide Or a complementary sequence thereof. delete delete delete delete delete delete The pharmaceutical composition of claim 1, further comprising a siRNA molecule that reduces B-Raf activity and comprises a polynucleotide having a sequence of 5 ′ GGUCUAGCUACAGAGAAAUCUCGAU 3 ′ or 5 ′ GGACAAAGAAUUGGAUCUGGAUCAU 3 ′. delete The polynucleotide of claim 56, wherein the small interfering RNA (siRNA) molecule is polynucleotide Or a complementary sequence thereof. The polynucleotide of claim 56, wherein the small interfering RNA (siRNA) molecule is polynucleotide Or a complementary sequence thereof.