KR100869564B1 - Production of transgenic Panax ginseng hairy roots using the activation tagging system - Google Patents
Production of transgenic Panax ginseng hairy roots using the activation tagging system Download PDFInfo
- Publication number
- KR100869564B1 KR100869564B1 KR1020020028182A KR20020028182A KR100869564B1 KR 100869564 B1 KR100869564 B1 KR 100869564B1 KR 1020020028182 A KR1020020028182 A KR 1020020028182A KR 20020028182 A KR20020028182 A KR 20020028182A KR 100869564 B1 KR100869564 B1 KR 100869564B1
- Authority
- KR
- South Korea
- Prior art keywords
- ginseng
- vector
- plant
- rhizogenes
- activation tagging
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Nutrition Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
본 발명은 뿌리에서 유용한 2차 대사산물을 생산하는 식물체를 활성표지법에 의해 돌연변이를 유도함으로써 2차 대사산물을 대량 생산하는 돌연변이를 얻을 수 있을 뿐 아니라 효과적으로 새로운 식물 유전자를 발견하고 그 기능을 구명할 수 있는 새로운 방법에 관한 것이다.The present invention can not only obtain mutations by mass-producing secondary metabolites by inducing mutations by active labeling of plants that produce useful secondary metabolites in roots, but also effectively discover new plant genes and investigate their function. It's about new ways you can.
본 발명은, (A) enhencer 및 선별마커를 포함하는 Activation Tagging vector를 제작하는 단계; (B) 상기 vector를 A. rhizogenes에 도입하는 단계; (C) 상기 vector가 도입된 A. rhizogenes을 식물 조직에 도입하는 단계; 및 (D) 상기 선별마커가 존재하는 식물 조직만이 생존하는 선별배지에서 상기 식물 조직을 배양하여 Activation Tagging된 모상근을 선별·유도하는 단계;를 포함하는 기능획득 돌연변이 식물 모상근의 획득 방법 및 이에 의해 획득된 식물체 전체 genome 돌연변이 라이브러리를 제공한다.
The present invention, (A) preparing an Activation Tagging vector comprising an enhencer and a selection marker; (B) introducing the vector into A. rhizogenes ; (C) introducing A. rhizogenes into which the vector is introduced, into plant tissues; And (D) culturing the plant tissue in a selection medium in which only the plant tissue in which the selection marker is present survives to select and induce activation-tagged hairy roots. Provide the entire plant genome mutation library obtained.
활성표지법, activation tagging, 돌연변이, 기능획득, 식물, 모상근, 인삼Activation tagging, activation tagging, mutation, function acquisition, plant, hairy root, ginseng
Description
도 1은 본 발명의 실시예에서 activation tagging vector를 제조하는 과정을 보여주는 모식도.1 is a schematic diagram showing a process of manufacturing an activation tagging vector in an embodiment of the present invention.
도 2는 비돌연변이 인삼 모상근 line의 진세노사이드 생산패턴을 보여주는 그래프.Figure 2 is a graph showing the ginsenoside production pattern of non-mutated ginseng hairy root line.
도 3은 본 발명에 의한 방법에 의해 획득된 돌연변이 인삼 모상근 line의 진세노사이드 생산패턴을 보여주는 그래프.
Figure 3 is a graph showing the ginsenoside production pattern of mutant ginseng hairy root line obtained by the method according to the present invention.
본 발명은 뿌리에서 유용한 2차 대사산물을 생산하는 식물체를 활성표지법에 의해 돌연변이를 유도함으로써 2차 대사산물을 대량 생산하는 돌연변이를 얻을 수 있을 뿐 아니라 효과적으로 새로운 식물 유전자를 발견하고 그 기능을 구명할 수 있는 새로운 방법에 관한 것이다. The present invention can not only obtain mutations by mass-producing secondary metabolites by inducing mutations by active labeling of plants that produce useful secondary metabolites in roots, but also effectively discover new plant genes and investigate their function. It's about new ways you can.
특정 유전자의 기능을 알아보기 위해서 특정 유전자의 기능을 없앤 기능손실 돌연변이체(loss-of-function mutant)를 이용한 유전학적, 분자생물학적 방법이 널리 사용되고 있다. 기능손실 돌연변이체의 제조방법으로는 상동 재조합(homologous recombination)을 이용한 knock-out 방법, EMS(ethyl methanesulfonate)와 같은 화학물질을 이용하거나, 감마선 조사와 같은 물리적인 방법, 혹은 T-DNA 표지(T-DNA tagging)와 같은 생물학적인 방법 등이 알려져 있다.Genetic and molecular biological methods using loss-of-function mutants that have eliminated the function of specific genes are widely used to investigate the function of specific genes. The production of functional mutants may include knock-out methods using homologous recombination, chemicals such as EMS (ethyl methanesulfonate), physical methods such as gamma irradiation, or T-DNA labeling (T). Biological methods such as DNA tagging, and the like are known.
그러나 이러한 기능손실 돌연변이체를 제조하여 특정 유전자의 기능을 연구하는 것은 여러 가지 장점에도 불구하고 기능손실 돌연변이체를 이용하여 해당 유전자의 기능을 알아내기 어려운 경우가 있다.However, it is difficult to find out the function of a gene by using a loss-of-function mutant, despite the advantages of preparing a loss-of-function mutant and studying the function of a particular gene.
예를 들면 첫째, 기능 손실 돌연변이체의 표현형은 돌연변이체의 자가수분을 통해 얻어진 후대세대에서만 관찰이 가능하므로 인삼과 같이 유전적으로 변이체를 제조하기가 어려운 식물체의 경우이다.For example, first, the phenotype of a loss-of-function mutant can be observed only in later generations obtained through self-pollination of the mutant, so it is the case of plants that are difficult to manufacture genetically, such as ginseng.
둘째, 어떤 유전자의 기능이 다른 유전자의 기능과 중복되는 경우이다. 즉, 그 유전자이외에도 유사한 역할을 하는 유전자가 존재(functional redundancy)하여 한 유전자의 기능상실만으로는 돌연변이체가 형질을 보이지 않는 경우이다.Second, the function of one gene overlaps with that of another gene. In other words, a gene having a similar role in addition to the gene exists (functional redundancy), so that a mutant does not show a trait only by the loss of function of a gene.
셋째, 배발생 초기에 발현하여 만약 그 유전자의 기능이 손실되었을 때 생물체의 발생이 전혀 이루어지지 않게 되는 유전자들의 경우이다. 이러한 경우 해당 유전자의 기능 손실 돌연변이체 제조를 시도하면 그 생물은 초기 배발달이 이루어지지 않게 되므로 해당 유전자의 돌연변이체를 전혀 얻을 수 없게 된다. 따라서 기능손실을 야기하는 일반적인 선별방법으로는 이러한 유전자를 분리하기란 매우 어렵다.Third, genes are expressed early in embryonic development, and if the gene's function is lost, no organism is produced. In this case, attempting to produce a loss-of-function mutant of the gene results in the initial development of the organism not being able to obtain a mutant of the gene at all. Therefore, it is very difficult to isolate these genes as a general screening method that causes loss of function.
이러한 이유로 기존의 기능손실 돌연변이체 선별 방법은 그 장점에도 불구하고 제한적으로 사용될 수 밖에 없다. 이러한 기능 손실 돌연변이체 선별방법의 대안으로서 활성표지 선발법 (Activation tagging system)이 확립되어 애기장대에 널리 활용되고 있다(Weigel et al., 2000). 이 활성 표지 선별 방법은 Cauliflower 모자익 바이러스의 35S 프로모터 enhancer 서열이 비교적 멀리 떨어져 있는 상태에서도 주변의 유전자의 전사를 활성화(transcription activation) 시킬 수 있다는 점을 이용하여 기능 획득 돌연변이체(gain-of-function mutant)를 얻는 방법이다.For this reason, the existing loss-of-function mutant selection method is limited in spite of its advantages. As an alternative to the loss-of-function mutant screening method, an activation tagging system has been established and widely used in Arabidopsis (Weigel et al., 2000). This activity marker screening method utilizes the gain-of-function mutant by exploiting the transcriptional activation of neighboring genes even when the 35S promoter enhancer sequence of Cauliflower mosaic virus is relatively far apart. ) Is how to get.
구체적으로 살펴보면, 상기 enhancer 서열을 함유하는 activation tagging vector를 제작하여 이를 Agrobacterium tumefaciens에 도입한다. 이어서 상기 A. tumefaciens를 식물체에 도입시켜 형질진환시킨 후 이로부터 캘러스를 유도하고, 캘러스를 재분화조건에서 배양하여 형질전환된 식물 개체를 얻는 것이다. 그 후 기능획득 발현 형질(표현형질)을 보이는 식물체를 선별하고 게놈 DNA를 회수하여 전사 활성화된 유전자를 클로닝하는 것이다.Specifically, an activation tagging vector containing the enhancer sequence is prepared and introduced into Agrobacterium tumefaciens . Subsequently, the A. tumefaciens is introduced into the plant, transformed therein, and the callus is derived therefrom, and the callus is cultured under regeneration conditions to obtain a transformed plant individual. After that, the plants showing the acquired expression traits (phenotypes) are selected and the genomic DNA is recovered to clone the transcriptionally activated genes.
이렇듯 활성표지 선별법을 통해 보다 효율적으로 식물체로부터 새로운 유전자를 발견하고 분석하는 것이 가능하게 되었다.As such, active labeling has made it possible to find and analyze new genes from plants more efficiently.
그러나, 이제까지의 활성표지 선별법은 신규 유전자의 발견 및 분석에 매우 유리한 방법이지만, ① 식물체 조직을 형질전환시킨 후 이로부터 캘러스를 유도하고, 캘러스로부터 재분화 개체를 획득해야 하기 때문에 장기간을 요하며, ② 모든 재분화 개체를 독립적으로 길러야 하기 때문에 넓은 작업장이 필요할 분 아니라, ③ 시각적으로 나타나지 않는 표현형, 예를들면, 특정 물질의 생산유무 또는 생산량의 증감 유무 등과 같은 표현형에 대한 유전자에 대한 연구에는 적합하지 않다는 단점이 있다.However, the active label screening method is a very advantageous method for the discovery and analysis of new genes, but it requires a long time since it is necessary to induce callus from transformed plant tissues and obtain redifferentiated individuals from callus. It is not necessary to have a large workplace because all of the redifferentiated individuals have to be raised independently, but they are not suitable for the study of genes for phenotypes that are not visible, such as the presence or absence of specific substances, or the increase or decrease in production. There are disadvantages.
인삼(Panax ginseng)은 고대로부터 우리나라와 중국, 일본에서 널리 이용된 매우 유용한 약용식물 중의 하나이다. 인삼뿌리의 활성물질은 항암, antistress, antiaging, 면역강화 증진에 효능이 있는 것으로 알려져 있으며 최근 들어 soup, drink, 화장품의 형태로 생산되어 강장제로 널리 보급되고 있다. Panax ginseng is one of the very useful medicinal plants widely used in Korea, China and Japan since ancient times. The active substance of ginseng root is known to be effective in anti-cancer, antistress, antiaging, and immunity enhancement. Recently, it is produced in soup, drink, and cosmetics and is widely used as a tonic.
인삼 재배는 4∼6년의 오랜 시간과 고가의 노동력이 요구되어 식물세포배양기술을 이용하여 인삼 사포닌을 비롯한 다양한 유효성분을 대량으로 생산하는 연구가 꾸준히 되어오고 있다(Wu and Zhong, 1999). 그러나 일반 식물세포 혹은 조직배양의 경우 지속적인 호르몬의 공급이 필요하며 오랜 계대배양을 거치는 동안 유전적으로 불안정하며 그 결과 유효성분 생산량이 감소하는 단점이 있다.Ginseng cultivation requires a long time and expensive labor for 4 to 6 years, and research has been steadily producing large amounts of various active ingredients including ginseng saponin using plant cell culture technology (Wu and Zhong, 1999). However, in the case of general plant cell or tissue culture, continuous supply of hormones is required and genetically unstable during long passages, resulting in a decrease in the production of effective ingredients.
이러한 단점을 보완하는 대체 배양기술로써 식물의 모상근 증후를 일으키는 Agrobacterium rhizogenes를 이용하여 이차 대사산물을 대량 생산하는 시스템이 알려져 있다(Giri and Narasu, 2000; Shanks and Morgan, 1999).As an alternative culture technique to compensate for these disadvantages, a system for mass production of secondary metabolites using Agrobacterium rhizogenes that causes hairy root symptoms of plants is known (Giri and Narasu, 2000; Shanks and Morgan, 1999).
모상근은 일반 뿌리보다 생장속도가 빠르며, 유전적으로 안정하고, 호르몬이 없는 배지에서도 성장이 가능하다. 또한 모상근은 식물체 뿌리조직의 모든 특성을 보유하고 있는 돌연변이 조직으로서 체세포변이 없이 식물체로의 재분화가 용이하며, 줄기 재분화에 영향을 주는 항생제의 사용없이 형질전환체 선택이 가능하다는 장점을 지니고 있다. Hairy roots grow faster than normal roots, are genetically stable, and can grow on hormone-free media. In addition, hairy root is a mutant tissue that possesses all the characteristics of plant root tissue, and it is easy to regenerate into plants without somatic lesions, and has the advantage of selecting transformants without using antibiotics that affect stem regeneration.
이러한 모상근의 장점을 이용하여 여러 식물체로부터 진세노사이드, 인돌알카로이드, 탄닌, 사포닌, 플라보노이드 등의 유용 이차대사 산물의 대량생산을 위한 연구가 활발히 진행되고 있다(Geerlings et al., 1999; Jouhikainen et al., 1999).Taking advantage of these hairy roots, research has been actively conducted for mass production of useful secondary metabolites such as ginsenosides, indole alkaloids, tannins, saponins, and flavonoids from various plants (Geerlings et al., 1999; Jouhikainen et al. , 1999).
그러나 A. rhizogenes로 유도된 모상근의 많은 장점에도 불구하고 종래 모상근 유도를 통한 유용한 이차대사 산물의 생산연구는 단순히 특정 식물체의 뿌리(예를들면 인삼)에서 생산되는 대사 산물을 관리하고 조작하기 편리한 "뿌리대용"의 모상근에서 생산하는 것일 뿐 더 이상의 부가적인 효과를 얻지는 못하고 있다.
However, despite the many advantages of hairy roots induced by A. rhizogene s, the study of the production of useful secondary metabolites through conventional hairy root induction is simply convenient to manage and manipulate metabolites produced in the roots of certain plants (eg ginseng). It is produced only from the hair root of "root substitute" and does not get any additional effects.
이에 본 발명은, 전술한 종래 기술의 단점을 해결한, 활성표지 선별법과 모상근 유도법을 결합시켜 모상근을 이용한 효율적인 이차대사산물 대량생산 돌연변이체를 획득하는 방법을 제공하는 것을 목적으로 한다.Accordingly, an object of the present invention is to provide a method for obtaining an efficient secondary metabolite mass production mutant using hairy roots by combining the active labeling method and hairy root induction method, which solve the above-mentioned disadvantages of the prior art.
또한 본 발명은 활성표지 선별법과 모상근 유도법을 결합시켜 인삼 모상근으로부터 이차대사산물 대량생산 돌연변이체를 획득하는 방법을 제공하는 것을 목적으로 한다.It is another object of the present invention to provide a method for obtaining secondary metabolite mass-producing mutants from ginseng hairy root by combining an active labeling method and hairy root induction.
또한 본 발명은 활성표지 선별법과 모상근 유도법을 결합시켜 식물체 전체 genome 돌연변이 라이브러리를 제공하는 것을 목적으로 한다.
In addition, an object of the present invention is to provide a whole plant genome mutant library by combining the activity labeling method and hairy root induction method.
상기와 같은 목적을 달성하기 위한 본 발명은, (A) enhencer 및 선별마커를 포함하는 Activation Tagging vector를 제작하는 단계; (B) 상기 vector를 A. rhizogenes에 도입하는 단계; (C) 상기 vector가 도입된 A. rhizogenes을 식물 조직에 도입하는 단계; 및 (D) 상기 선별마커가 존재하는 식물 조직만이 생존하는 선별배지에서 상기 식물 조직을 배양하여 Activation Tagging된 모상근을 선별·유도하는 단계;를 포함하는 기능획득 돌연변이 식물 모상근의 획득방법에 관한 것이다.
The present invention for achieving the above object, (A) preparing an Activation Tagging vector comprising an enhencer and a selection marker; (B) introducing the vector into A. rhizogenes ; (C) introducing A. rhizogenes into which the vector is introduced, into plant tissues; And (D) cultivating the plant tissue in a selection medium in which only the plant tissue in which the selection marker is present survives to select and induce activation-tagged hairy roots. .
본 발명에서 상기 enhancer 및 선별마커는 activation tagging system에 적합한 종래의 어떤 것, 장차 개발될 어떤 것이라도 사용할 수 있다. 본 발명에서는 예시적으로 pCAMBIA vector에 Cauliflower 모자익 바이러스의 35S 프로모터 enhancer인 CaMV 35S enhencer를 삽입시킨 플라스미드 pKH1를 제작하여 activation tagging vector로 사용한다.In the present invention, the enhancer and the screening marker may be used in the related art, which is suitable for the activation tagging system, and may be developed in the future. In the present invention, a plasmid pKH1 in which CaMV 35S enhencer, which is a 35S promoter enhancer of Cauliflower Mojak virus, is inserted into a pCAMBIA vector is prepared and used as an activation tagging vector.
상기 (B) 단계는 종래 알려진 방법에 따라, A. rhizogenes과 대상 식물체의 적절한 조직을 공동배양(coculture)하여 진행할 수 있다.Step (B) may be carried out by coculture of appropriate tissues of A. rhizogenes and the target plant according to a conventionally known method.
전술한 본 발명의 방법에 따르면, 이후 특정 이차대사 산물을 대량생산하는 돌연변이 모상근 세포계(line)을 분리함으로써, 짧은 시간내에, 콤팩트한 공간에서 뿌리에서 생산되는 유용한 이차대사 산물의 효과적인 대량 생산시스템을 구축할 수 있게 된다.
According to the method of the present invention described above, by separating the mutant hairy root cell line that mass-produces a particular secondary metabolite, an effective mass production system of useful secondary metabolites produced in the roots in a compact space within a short time is produced. You can build it.
본 발명에 의하면, 인삼을 대상식물체로 한 기능획득 돌연변이 인삼 모상근 의 획득방법을 제공한다.According to the present invention, there is provided a method for obtaining a function-gaining mutant ginseng hairy root of ginseng as a plant.
즉, 본 발명은 또한, (A) pCAMBIA vector에 CaMV 35S enhencer를 포함하여 Activation Tagging vector인 pKH1를 제조하는 단계; (B) 상기 vector pKH1을 A. rhizogenes R1000, A4, (CIP104786)에 도입하는 단계; (C) 상기 vector가 도입된 A. rhizogenes을 인삼의 자엽, 하배축, 잎, 엽병 등 인삼의 조직과 함께 공동배양하여 상기 조직에 도입하는 단계; 및 (D) cefotaxime이 첨가된 1/2MS 액체배지로 상기 조직을 세척한 후 cefotaxime이 첨가된 1/2MS 선택배지에서 상기 조직을 배양하여 Activation Tagging된 모상근을 선별·유도하는 단계;를 포함하는 기능획득 돌연변이 인삼 모상근의 획득방법에 관한 것이다.That is, the present invention also comprises the steps of (A) preparing a pKH1 Activation Tagging vector including a CaMV 35S enhencer in the pCAMBIA vector; (B) introducing the vector pKH1 into A. rhizogenes R1000, A4, (CIP104786); (C) co-culturing A. rhizogenes into which the vector has been introduced is co-cultured with the tissues of ginseng such as cotyledons, hypocotyls, leaves, and leaf diseases of ginseng; And (D) washing the tissue with a 1 / 2MS liquid medium to which cefotaxime is added, and then culturing the tissue in a 1 / 2MS selective medium to which cefotaxime is added to select and induce activation-tagged hairy roots. It relates to a method of obtaining mutant ginseng hairy roots.
구체적인 방법은 전술한 바와 같다.The specific method is as described above.
전술한 본 발명의 방법에 따르면, 이후 인삼의 이차대사 산물 예컨대, 사포닌을 대량생산하는 돌연변이 모상근 세포계(line)을 분리함으로써, 짧은 시간 내에, 콤팩트한 공간에서 유용한 이차대사 산물 예컨대, 사포닌의 효과적인 대량생산시스템을 구축할 수 있게 된다.
According to the method of the present invention described above, an effective mass of secondary metabolites such as saponins in a short space can be used in a compact space in a short time, by separating the secondary metabolites of ginseng such as mutant hairy root cell lines which mass produce saponins. The production system can be built.
또한 본 발명은 전술한 기능획득 돌연변이 식물(인삼) 제조방법에 의해 식물(인삼) 전체 genome 돌연변이 라이브러리를 제공한다.In another aspect, the present invention provides a whole genome mutant library of plants (ginseng) by the above-described method of producing mutant plants (ginseng).
상기 전체 게놈 돌연변이 라이브러리의 각각 구성 세포계(모상근 line)를 재분화시켜 발현된 표현형에 따라 관련 유전자를 연구할 수 있게 됨으로써 식물 기능유전체학에 획기적인 연구도구로 활용할 수 있게 된다. By re-dividing each constituent cell line (parental root line) of the whole genome mutant library to study related genes according to the expressed phenotype, it can be utilized as an innovative research tool in plant functional genomics.
이하 실시예를 들어 본 발명을 예시적으로 설명한다. 하기 실시예에서 사용되는 각종의 유전자, 벡터, 식물체 등은 본 발명을 설명하기 위한 예일 뿐 이에 의해 본 발명의 기술적 사상의 범위가 한정되는 것이 아님은 당업자에게 있어서 자명한 것이다.
The present invention will be exemplarily described with reference to the following examples. Various genes, vectors, plants, etc. used in the following examples are merely examples for describing the present invention, and thus the scope of the technical spirit of the present invention is not limited thereto.
실시예 1 : activation tagging vector의 제작 및 증폭Example 1 Preparation and Amplification of Activation Tagging Vector
Agrobacterum rhzogenes 균주에 도입되어 복제 전사될 수 있으며, 추후 식물체 세포에 도입되어 돌연변이를 유발할 수 있는 activation tagging vector(도 1)를 제작하였다. Agrobacterum rhzogenes strains can be introduced and cloned and transcribed, and later introduced into plant cells to produce an activation tagging vector (FIG. 1) capable of causing mutations.
Activation tagging vector pSKI015(Weigel et. al., 2000)의 enhancer부분을 BamHI과 PstI 제한효소 및 하기와 같은 서열을 가지는 프라이머를 이용하여 PCR 증폭하여 pCR2.1 TOPO vector내로 cloning을 하였다.Activation tagging vector Amplification of the enhancer of pSKI015 (Weigel et. Al., 2000) was performed by PCR amplification using primers with BamHI and PstI restriction enzymes and the following sequence, and cloned into pCR2.1 TOPO vector.
5'―TCTAGAACTAGTGGATCCCCAACATG－3' (서열 1)5'―TCTAGAACTAGT GGATCC CCAACATG-3 '(SEQ ID NO: 1)
5―CTGCAGAATATATCCTGTCAAACACTG―3' (서열 2)5―CTGCAGAATATATCCTGTCAAACACTG―3 '(SEQ ID NO: 2)
cloning된 vector를 TOP10 cell내로 도입시켜 플라스미드를 증폭시킨 후 BamHI과 PstI 제한효소를 처리하였다. agarose gel상에서 전기영동하여 vector로부터 enhancer fragment를 분리시키고 QIAquick gel extraction kit를 이용하여 1413 bp 크기의 fragment를 정제 회수하였다.The cloned vector was introduced into TOP10 cells to amplify the plasmid and then treated with BamHI and PstI restriction enzymes. Electrophoresis was performed on the agarose gel to separate enhancer fragments from the vector, and 1413 bp fragments were purified and recovered using a QIAquick gel extraction kit.
pCAMBIA2300 vector에 BamHI 과 PstI 제한효소를 처리한 후 enhancer fragment와 함께 16℃에서 약 14∼16시간 ligation반응을 시켰다. igation 반응물 을 DH10B competent cell로 도입하여 Kanamycin이 함유된 LB 선별배지에서 증폭시키므로써 pKH1을 제조하였다.
After treatment with BamHI and PstI restriction enzyme, pCAMBIA2300 vector was subjected to ligation reaction with enhancer fragments at 16 ℃ for about 14-16 hours. pKH1 was prepared by introducing the igation reaction into the DH10B competent cell and amplifying it in LB selection medium containing Kanamycin.
실시예 2 : Example 2: Agrobacterium rhizogenesAgrobacterium rhizogenes 의 형질전환Transformation of
실시예 1에서 제작된 activation tagging vector pKH1을, 모상근 유도를 위한 A. rhizogenes에 도입하였다.The activation tagging vector pKH1 prepared in Example 1 was introduced into A. rhizogenes for hairy root induction.
A. rhizogenes 균주는 생명공학연구원 부설유전자원센터(KCTC)로부터 분양 받은 A. rhizogenes R1000 (A4, CIP104786)를 이용하였다(기탁 번호 : KCTC2742). A. rhizogenes strain was used A. rhizogenes R1000 (A4, CIP104786), which was distributed from the Center for Genetic Resources (KCTC), Biotechnology Research Institute (Accession No .: KCTC2742).
A. rhizogenes를 3ml의 YEP 액체배지(Bacto-peptone 10g/L, Bacto-yeast extract 10g/L, NaCl 5g/L)에 접종하여 28℃, 180rpm으로 진탕배양하여 이용하였다. A. rhizogenes were inoculated in 3 ml of YEP liquid medium (Bacto-peptone 10g / L, Bacto-yeast extract 10g / L, NaCl 5g / L) and incubated at 28 ° C and 180rpm for shaking.
Competent cell를 만들기 위해 15∼24 시간 배양한 A. rhizogenes을 새로운 50 ml YEP 배지에 2 ml 접종하여 배양한 후 OD600=0.6∼1.0 이 되었을 때 수확하여 0.15M NaCl에 재 분주하여 얼음에 10분간 방치하였다. 박테리아는 다시 원심분리하여 수확한 후 1ml 20mM CaCl2에 분주하고 100 ㎕ 씩 나누어 액체질소에 얼린 후 ―70℃ deep freezer에 보관하여 c-cell로 사용하였다.
제작된 vector를 박테리아에 도입시키기 위해 100 ㎕의 A. rhizogenes 보관액에 약 1 ㎍의 DNA을 섞고 액체질소에서 약 2분간 얼린 후 37℃에서 5분간 녹이는 과정을 2회 반복하고 얼음에 30분간 방치하였다.To introduce the produced vector into bacteria, mix about 1 ㎍ of DNA in 100 μl of A. rhizogenes stock solution, freeze it for about 2 minutes in liquid nitrogen, and dissolve it for 5 minutes at 37 ℃, and leave it on ice for 30 minutes. It was.
상기 tube에 약 1 ml의 YEP배지를 넣고 약 2시간 배양후 박테리아만 수확하 여 선별배지에 도말하여 vector가 도입된 박테리아를 선별하였다.
About 1 ml of YEP medium was added to the tube, and after incubation for about 2 hours, only bacteria were harvested and plated on selection medium to select bacteria into which the vector was introduced.
실시예 3 : 인삼 조직에 Example 3 Ginseng Tissue A, rhizogenesA, rhizogenes 의 도입Introduction of
(1) 인삼 조직의 준비(1) Preparation of ginseng tissue
재료로 사용한 인삼(천풍(KG101))종자는 한국인삼연초연구원의 위탁 채종 포장인 대천의 인삼재배 농가로부터 분양 받았다. 천풍(KG101)은 인삼연초연구원이 품종화시킨 Open pollinated type으로 매우 균일한 생육특성과 많은 뇌두를 내는 대형종 인삼이다.The ginseng (Cheonpung (KG101)) seed used as a material was sold from a ginseng cultivation farm in Daecheon, a consigned rapeseed package of Korea Ginseng and Tobacco Research Institute. Cheonpung (KG101) is an open pollinated type that has been cultivated by the Ginseng and Tobacco Research Institute.
분양 받은 종자는 층적처리를 통해 개갑을 유도하여 실험재료로 사용하였다.Seeds received were used as experimental materials by inducing gaggae through stratification.
개갑된 인삼종자는 종피를 제거한 뒤, 30 초간 70% (v/v) ethanol로 세척 후, 15분간 0.4% 상용락스 용액에 침지 후 멸균증류수로 3회 세척하였다. 살균된 인삼종자는 접합자배를 1/2MS 배지(Murashige and Skoog, 1962)에서 무균발아시키고 모상근을 유도에 효율적인 조직으로 확인된 자엽, 하배축, 잎, 엽병 등을 재료로 이용하였다. 한편, 또 다른 재료로서, 4년근 성체인삼의 잎, 엽병, 줄기 등은 0,4% 상용 락스에 10∼15분 간 침지하여 살균하였다. 살균된 조직은 멸균 증류수로 3회 세척 후 약 0.5∼1 cm3 로 절단하여 A. rhzogenes와 공동 배양을 위한 재료로 사용하였다.
The ginseng seed was removed from the seedlings, washed with 70% (v / v) ethanol for 30 seconds, immersed in 0.4% commercial lac solution for 15 minutes, and washed three times with sterile distilled water. The sterilized ginseng seed germinated germ pear germ in 1 / 2MS medium (Murashige and Skoog, 1962) and used cotyledon, hypocotyl, leaf, and leaf disease, which were identified as efficient tissues to induce hairy root. On the other hand, as another material, the leaves, leaves, stems, etc. of 4 years old adult ginseng were sterilized by immersing in 0,4% commercial lacs for 10 to 15 minutes. The sterilized tissue was washed three times with sterile distilled water, cut into about 0.5-1 cm3, and used as a material for co-culture with A. rhzogenes .
(2) 인삼 조직과 (2) ginseng tissue A. rhzogenesA. rhzogenes 균주의 공동배양 및 모상근 line의 분리 Coculture of Strains and Isolation of Hairy Root Lines
전기 (1)에서 준비한 인삼 조직과 A. rhzogenes 균주를 공동배양하여 균주가 인삼 조직에 도입되도록 유도하였다.Ginseng tissue prepared in the first (1) and A. rhzogenes strains were co-cultured to induce the introduction of the strain into the ginseng tissue.
전기 실시예 2에서 준비된, 현탁배양한 A. rhizogenes 배양액을 1/25비율로 1/2 농도의 MS액체배지로 희석하여 공동배양액을 조성하고 약 30분간 상기 인삼 조직을 침지하였다. 이어서 상기 침지된 인삼 조직을 1/2salt의 MS고체배지에서 2일간 공동배양하였다.Suspension cultured A. rhizogenes culture solution prepared in Example 2 was diluted with 1/2 liquid MS liquid medium at a 1/25 ratio to form a co-culture solution and the ginseng tissue was soaked for about 30 minutes. The soaked ginseng tissue was then co-cultured for 2 days in 1/2 solid MS solid medium.
공동배양 된 인삼조직은 800mg/L cefotaxime이 첨가된 1/2MS 액체배지로 세척 후 3주일 간격으로 400mg/L cefotaxime이 첨가된 1/2MS 선택배지(1/2MSC400Km 100)에서 계대배양하면서 모상근을 유도하였다.Co-cultured ginseng tissue was 1 / 2MS liquid medium added with 800mg / L cefotaxime and washed after 3 weeks at 1 / 2MS selective medium (1 / 2MSC400Km 100) added with 400mg / L cefotaxime. It was.
공동배양 후 약 2주 후부터 인삼 조직으로부터 모상근의 발달이 관찰되었고, 1∼2달 후에 발달한 모상근은 분리하여 400mg/L cefotaxime과 50mg/l의 Km이 첨가된 1/2MS 배지에 계대배양하였다.About two weeks after coculture, hairy root development was observed from ginseng tissues. After 1-2 months, hairy roots were separated and subcultured in 1 / 2MS medium containing 400 mg / L cefotaxime and 50 mg / l Km.
이를 통해 총 950개의 activation tagging 모상근 line을 얻었으며, 안정화된 모상근은 100mg/L cefotaxime 이 첨가된 SH 배지를 이용하여 1달 간격으로 계대 배양하였다.
Through this, a total of 950 activation tagging hairy root lines were obtained, and the stabilized hairy roots were passaged at monthly intervals using SH medium containing 100 mg / L cefotaxime.
실시예 4 : 활성표지 (돌연변이) 모상근 line이 생산하는 이차대사산물의 분석Example 4 Analysis of Secondary Metabolites Produced by an Active Label (Mutation) Hairy Root Line
실시예 3에서 얻어진 돌연변이 인삼 모상근 line의 진세노사이드에 대한 표현형(생산량 및 생산 유형)의 변이를 분석하였다.Variation of the phenotype (production and production type) for ginsenosides of the mutant ginseng hairy root line obtained in Example 3 was analyzed.
(1) (비돌연변이) 인삼 모상근 line 등의 진세노사이드 표현형(1) Ginsenoside phenotypes such as (non-mutated) ginseng hairy root lines
모상근 형태가 아닌 캘러스 상태의 엠브리오제닉 캘러스(E.C) 및 돌연변이 되지 않은 인삼 모상근 line이 생산하는 진세노사이드의 종류별 함량과 생산 유형을 LC/MS 분석하여 도 2에 도시하였다.Contents and types of ginsenosides produced by Embrogenic callus (E.C) and non-mutated ginseng hairy root line of callus, which are not hairy root forms, are shown in FIG. 2 by LC / MS analysis.
도에서 볼 수 있듯이, E.C에서는 모든 종류의 진세노사이드가 거의 발견되지 않았으며, 비돌연변이 모상근 line(1-1∼1-181)에서는 상당한 정도의 진세노사이드가 종류별로 생산되고 있음을 알 수 있다. 그러나 각 모상근 line 마다 진세노사이드의 총 생산량에 차이가 다소 있기는 하지만 종류별로 진세노사이트를 생산하는 유형(pattern)이 거의 유사함을 알 수 있다. 이는 이들 모상근 line이 모두 진세노사이드에 관련된 유전자의 돌연변이체가 아님을 시사한다.
As can be seen in the figure, almost all ginsenosides were not found in EC, and a considerable amount of ginsenosides were produced by nonmutant hairy root lines (1-1 to 1-1-181). have. However, although the total production of ginsenosides differs for each hairy root line, the pattern for producing ginsenosides is almost similar. This suggests that these hairy root lines are not all mutants of genes related to ginsenosides.
(2) 활성표지 (돌연변이) 인삼 모상근 line의 진세노사이드 표현형 (2) Ginsenoside phenotype of active label (mutant) ginseng hairy root line
비활성표지(돌연변이 되지 않은) 인삼 모상근 line이 생산하는 진세노사이드의 종류별 평균 함량과 평균적인 생산 유형, 및 실시예 3에서 얻어진 활성표지(돌연변이된) 인삼 모상근 line 중 한 line의 진세노사이드에 대한 표현형(생산량 및 생산 유형)을 LC/MS 분석하여 도 3에 도시하였다.Mean content and average production type of ginsenosides produced by the inactive labeled (non-mutated) ginseng hairy root line, and the ginsenosides of one line of the active label (mutated) ginseng hairy root obtained in Example 3 Phenotypes (output and type of production) are shown in FIG. 3 by LC / MS analysis.
도에 나타나 있듯이, 활성표지(돌연변이) 모상근 line은 비활성표지(비돌연변이) 모상근 라인의 평균적인 진세노사이드 생산패턴과 비교하여 진세노사이드 Rb1, Rd 및 Rb2의 생산량이 비돌연변이 모상근의 생산량에 비해 월등히 높음을 알 수 있다.As shown in the figure, the active marker (mutant) hairy root line was compared with the average ginsenoside production pattern of inactive marker (non-mutant) hairy root line, compared to the production of ginsenosides Rb1, Rd and Rb2 compared to the production of non-mutant hairy root. You can see that it is much higher.
이는 상기 활성표지(돌연변이) 모상근 line은 진세노사이드 Rb1, Rd 및 Rb2 의 합성에 관여하는 유전자가 활성화(돌연변이)된 결과임을 추론할 수 있다.This can be inferred that the activity marker (mutant) hairy root line is the result of activation (mutation) of genes involved in the synthesis of ginsenosides Rb1, Rd and Rb2.
따라서 ① 상기 활성표지(돌연변이) 모상근 line을 이용한다면 인삼의 이차대사 산물 중 진세노사이드 Rb1, Rd 및 Rb2를 대량생산할 수 있는 시스템을 확립할 수 있게 되며, ② 상기 활성표지(돌연변이) 모상근 line에서 tagging된 관련 유전자를 분리하여 분석함으로써 새로운 유전자의 발견 및 특성분석이 가능하게 된다.
Therefore, ① the active marker (mutant) hairy root line can establish a system for mass production of ginsenosides Rb1, Rd and Rb2 of secondary metabolites of ginseng, and ② the active marker (mutant) hairy root line By separating and analyzing tagged genes, new genes can be found and characterized.
본 발명에 의한 활성표지 선별법 및 모상근 유도법의 조합법에 의하면 짧은 시간동안에 전체 식물 genome의 돌연변이 라이브러리를 용이하게 얻을 수 있게 된다.According to the combination method of the active label screening method and hairy root induction method of the present invention, it is possible to easily obtain a mutant library of the whole plant genome in a short time.
따라서 이를 활용하여 식물의 이차대사 산물을 효율적으로 생산할 수 있는 시스템을 확립할 수 있게 되며, 얻어진 기능획득 돌연변이체로부터 유전자를 분리하고 분석하는데 시간을 획기적으로 단축시킬 수 있기 때문에 향후 식물의 신규 유전자 발견 그 이용에 대한 유용성이 매우 높을 것으로 생각된다.Therefore, it is possible to establish a system that can efficiently produce secondary metabolites of plants by using it, and to significantly shorten the time required to separate and analyze genes from the acquired function mutants. The usefulness of the use is considered to be very high.
<110> Eugentech <120> Production of transgenic Panax <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tctagaacta gtggatcccc aacatg 26 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctgcagaata tatcctgtca aacactg 27 <110> Eugentech <120> Production of transgenic Panax <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tctagaacta gtggatcccc aacatg 26 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctgcagaata tatcctgtca aacactg 27
Claims (5)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020020028182A KR100869564B1 (en) | 2002-05-21 | 2002-05-21 | Production of transgenic Panax ginseng hairy roots using the activation tagging system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020020028182A KR100869564B1 (en) | 2002-05-21 | 2002-05-21 | Production of transgenic Panax ginseng hairy roots using the activation tagging system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20030090177A KR20030090177A (en) | 2003-11-28 |
| KR100869564B1 true KR100869564B1 (en) | 2008-11-21 |
Family
ID=32383800
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020020028182A KR100869564B1 (en) | 2002-05-21 | 2002-05-21 | Production of transgenic Panax ginseng hairy roots using the activation tagging system |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR100869564B1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11299700B1 (en) | 2021-02-19 | 2022-04-12 | Acequia Biotechnology, Llc | Bioreactor containers and methods of growing hairy roots using the same |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100869565B1 (en) * | 2002-06-10 | 2008-11-21 | 유진텍주식회사 | Rapid Production of transgenic hairy roots using the activation tagging system |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR950000443B1 (en) * | 1991-06-15 | 1995-01-20 | Baek Hwang | Method of propagating ginseng hairy root |
| JPH08140672A (en) * | 1994-11-16 | 1996-06-04 | Eniwa Res Business Park Kk | Culture of hairy roots of tochiba ninjin and production of panax saponin |
| US5998702A (en) | 1994-12-30 | 1999-12-07 | Seminis Vegetable Seeds, Inc. | Transgenic plants expressing ACC synthase gene |
| KR20000044063A (en) * | 1998-12-30 | 2000-07-15 | 박명규 | Manufacturing method of ginsenoside rg1 using ginseng hairy root kghr-8 |
-
2002
- 2002-05-21 KR KR1020020028182A patent/KR100869564B1/en not_active IP Right Cessation
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR950000443B1 (en) * | 1991-06-15 | 1995-01-20 | Baek Hwang | Method of propagating ginseng hairy root |
| JPH08140672A (en) * | 1994-11-16 | 1996-06-04 | Eniwa Res Business Park Kk | Culture of hairy roots of tochiba ninjin and production of panax saponin |
| US5998702A (en) | 1994-12-30 | 1999-12-07 | Seminis Vegetable Seeds, Inc. | Transgenic plants expressing ACC synthase gene |
| KR20000044063A (en) * | 1998-12-30 | 2000-07-15 | 박명규 | Manufacturing method of ginsenoside rg1 using ginseng hairy root kghr-8 |
Non-Patent Citations (2)
| Title |
|---|
| 논문: 식물학회지 제34권 제4호, p289~296 |
| 논문: 식물학회지 제36권 제1호, p75~81 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11299700B1 (en) | 2021-02-19 | 2022-04-12 | Acequia Biotechnology, Llc | Bioreactor containers and methods of growing hairy roots using the same |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20030090177A (en) | 2003-11-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cao et al. | Cut–dip–budding delivery system enables genetic modifications in plants without tissue culture | |
| An et al. | Transformation of tobacco, tomato, potato, and Arabidopsis thaliana using a binary Ti vector system | |
| Park et al. | Agrobacterium rhizogenes‐mediated transformation of opium poppy, Papaver somniferum L., and California poppy, Eschscholzia californica Cham., root cultures | |
| JP2009148274A (en) | Genetic sequence encoding flavonoid pathway enzyme and use therefor | |
| JP3431177B2 (en) | Plasmids producing transgenic plants altered in habit and yield | |
| CN110892074A (en) | Compositions and methods for increasing the shelf life of bananas | |
| CN112424364A (en) | Compositions and methods for reducing caffeine content in coffee beans | |
| CN115637269A (en) | Polycistron spacer region element and application thereof in plant breeding | |
| Lai et al. | Progress in biotechnology research in longan | |
| CN110204600B (en) | BnSPL14 gene, protein and application thereof in controlling cabbage type rape plant type | |
| KR100869564B1 (en) | Production of transgenic Panax ginseng hairy roots using the activation tagging system | |
| JP2001510021A (en) | Methods for genetically transforming banana plants | |
| Bae et al. | Agrobacterium rhizogenes-mediated genetic transformation of radish (Raphanus sativus L. cv. Valentine) for accumulation of anthocyanin | |
| Otto et al. | Barley (Hordeum vulgare L.) transformation using embryogenic pollen cultures | |
| KR100869565B1 (en) | Rapid Production of transgenic hairy roots using the activation tagging system | |
| Villao et al. | Genetic transformation of apical meristematic shoots in the banana cultivar ‘Williams’ | |
| Khlifa et al. | Agrobacterium rhizogenes-mediated transformation of Hypericum sinaicum L. for the development of hairy roots containing hypericin | |
| KR20190139756A (en) | Method for regenerating modified plant from cell having modified gene involved in flavonoid biosynthesis using CRISPR/Cas9 system in Petunia protoplast | |
| CN106459884A (en) | Agrobacterium and transgenic plant manufacturing method using such agrobacterium | |
| CN116376862B (en) | RdCHS4 protein related to rhododendron anthocyanidin metabolism, recombinant vector and application thereof | |
| Banihashemi et al. | Raise up of scopolamine in hairy roots via Agrobacterium rhizogenes ATCC15834 as compared with untransformed roots in Atropa komarovii | |
| CN116555301B (en) | SlMETS1 gene and application thereof in regulation and control of tomato growth and development | |
| CN116083452B (en) | Carrot gibberellin oxidase gene and expression and application thereof | |
| CN116179573B (en) | Application of carrot gibberellin oxidase gene DcGA2ox1 in regulation of plant growth and development | |
| JP2022185711A (en) | Genetically modified forsythia fruit and method for producing valuable secondary metabolite using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| E902 | Notification of reason for refusal | ||
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant | ||
| LAPS | Lapse due to unpaid annual fee |