KR100836669B1 - Japanese medaka dna microarray chip for assessment of endocrine disruption chemical toxicity - Google Patents

Abstract

A Japanese medaka DNA chip is provided to be used for evaluating toxicity of an environment hormone or an environmental stress inducing material and detecting the hormone or the inducing material. A DNA chip for evaluating toxicity of an environmental hormone consists of Japanese medaka cDNA having sequences of SEQ ID : NOs. 1 to 574. A method for preparing the DNA chip comprises the steps of: (a) synthesizing cDNA from mRNA extracted from a liver tissue of the Japanese medaka; (b) inserting the cDNA into a plasmid to construct a cDNA library; (c) sequencing the cDNA library to construct a local database including genetic information; (d) classifying the local database using a local BLAST function in a BIOEDIT(NCBI) program into cDNA groups, each of which is not overlapped with one another; and (e) spotting only representative cDNAs from the classified cDNA groups on a chip. Further, the environmental hormone is selected from a group consisting of 17beta-estradiol(E2), bisphenol A(BPA), 2-chlorophenol, Phenol and nonyl phenol.

Description

Japanese medaka DNA microarray chip for assessment of endocrine disruption chemical toxicity}

1 is a schematic diagram of a cDNA synthesis process for constructing a fern cDNA library according to the present invention.

Figure 2 shows a comparison with the killing cDNA Human placenta cDNA according to the present invention (a), amplification of cDNA by BLD PCR (b).

Figure 3 shows the cut range by size of cDNA for Ligation according to the present invention.

Figure 4 is an illustration of a trellis gene library truncated with sfiI restriction enzyme according to the present invention.

FIG. 5 shows the results of network visualization analysis of gene expression in a situation in which each cDNA group according to the present invention is exposed to five chemicals for one day.

FIG. 6 shows the results of network visualization analysis of user expression in a situation where each cDNA group according to the present invention is exposed to five chemicals for two days.

FIG. 7 shows the results of network visualization analysis of gene expression in a situation where each cDNA group according to the present invention is exposed to five chemicals for four days.

The present invention relates to an endocrine gene chip for assessing environmental hormone toxicity, and more particularly, to an endocrine gene chip for assessing environmental hormone toxicity including cDNA having a nucleotide sequence of SEQ ID NOs: 1 to 574 selected from a random cDNA library. .

In addition, the present invention relates to a method for fabricating a gene chip of a Japanese Medaka (Oriensis: Oryzias latipes ) whose gene sequence information is not fully disclosed for environmental stress analysis, in particular, for evaluation of toxic effects by environmental hormones. In detail, a random cDNA library was constructed (about 2000) from the mRNA pools of the ferns, and their sequence information was revealed to remove the duplicated libraries, followed by the screening process of 574 characteristic cDNAs, and then fixed on a glass substrate. The present invention relates to a chip fabrication method and a method for applying toxicity and hazard assessment of environmental toxic substances and environmental hormones using the same.

The rapid industrialization of Korea over the last 40 years has led to the rapid increase of water pollution as various pollutants are released into the surrounding environment, and environmental ecosystems including water ecosystems are rapidly destroyed. In particular, carcinogens such as dioxins and environmental hormones destroy and disrupt ecosystems even in a very small amount, and they can cause fatal harm to human health.However, existing instrumental methods require long analysis time and cost, and are difficult to analyze. There are limitations in analyzing the exact impacts of ecosystems (Sumpter and Jobling, 1995). In order to overcome these shortcomings, studies on environmentally sensitive species indicators have been introduced.However, the existing biotoxicity assessment method using existing species evaluates only the fractional toxicity of each toxic substance by using the species's life or death. The introduction of in-depth and complex toxicity assessment techniques is urgently needed. As a result, toxicity assessment techniques have been introduced, and vitellogenin, CYP1A and AhR genes are known as biomarker genes that are sensitive to environmental hormones. Currently, other biomarker genes are continuously searched. (Eason and O'Halloran, 2002; Todorov et al., 2002; Hemmer et al., 2001, 2002; Vethaak et al., 2002).

Toxicity assessments through these biomarker genes, however, show strength in measuring the extent of certain known toxic effects and their impact on a single gene, but the complex flexibility between genes involved in toxicity and the overall effects of toxicity in living organisms. There are limitations in explaining and evaluating relationships (Min et al, 2003). In developed countries such as Europe, the United States, and Japan, toxicological impact assessment by indicator organisms has been actively conducted. In particular, the G7 and EPA guidelines have established the test method and regulation, and research on molecular biomarkers using aquatic organisms such as halibut, eel and shellfish has been actively conducted. In the Ecological Toxicity Laboratory of Berlin University of Germany, the method of detecting fish yolk protein (vitellogenin) and the immune cell test of shellfish are applied. Especially, the Max Planck Institute develops a zebra fish gene chip for environmental toxicity evaluation. Is doing. In the United States, toxicological evaluation using gene chips of water fleas and rainbow trout sugar-frog frogs, which are widely used in existing biomarker studies, is being actively conducted in various groups, and in Japan, a consortium for making a trellis gene chip is established (Arukwe et al. , 1999; Kloasy et al., 1999; Oppen-Bernsten et al., 1999; Celius et al., 2000; Schultz et al., 2000; Lee et al., 2002). In developed countries, research using DNA chips and real-time plankton, which have high endurance to environmental changes but have high sensitivity to pollutants such as carcinogens, mutagens, and teratogenic agents, have been studied. It is made using advanced science technology based on genomic toxicology (Toxicogenomics) such as PCR. However, there is a limit to constructing a genetic chip with the composition of some genes and applying it to toxicity analysis in the situation where the genomic information is not completely known.

Therefore, the present inventors have made a thorough research to overcome the problems of the prior art, when using the cDNA gene chip of the killifish sensitive to environmental hormones, it can be used for the evaluation and detection of toxicity of environmental hormones or environmental stressor After confirming that it can, the present invention was completed.

Therefore, the main object of the present invention is to provide a gene chip for the evaluation of environmental hormone toxicity using the cDNA library of the ferns sensitive to environmental stress.

Another object of the present invention is to provide a method that can be applied when constructing a gene chip of other organisms whose sequence is not completely known by using the method for manufacturing the environmental hormone toxicity chip.

According to an aspect of the present invention, the present invention provides a gene chip for assessing environmental hormone toxicity, which consists of a fern cDNA having a nucleotide sequence of SEQ ID NOs: 1 to 574.

In the present invention, the gene chip extracts mRNA from the liver tissue of the fern to construct the fern cDNA library, obtains the total cDNA through a specially designed primer for reverse transcriptase and library construction, and the cDNAs thus obtained are suitable for random cloning. These bacteria are then transferred to the bacteria, which are then stored in a free-range gene bank that can be cryopreserved and used when needed. The separated and purified cDNA is characterized by being able to manufacture a gene chip in which the final 574 caudal cDNAs are integrated on a glass substrate by screening cDNAs having a sequential process.

In the genetic chip for evaluating environmental hormone toxicity of the present invention, the environmental hormone may be any environmental contaminant capable of disturbing the human endocrine system, but preferably 17β-estradiol (E2), bisphenol A (BPA), 2 It is characterized in that it is selected from the group consisting of chlorophenol (2CP), phenol (Phenol), nonyl phenol (NP).

In the present invention, as well as the representative environmental hormone 17β- estradiol, as well as the environmental stress chemicals such as bisphenol A, 2-chlorophenol, phenol, nonyl phenol and the like, it was confirmed that the application can be more than one complex It is shown in the Example of the invention and drawing (refer FIG. 5-7).

According to another aspect of the present invention, the present invention provides a cDNA gene having any one nucleotide sequence selected from the group consisting of the following sequence numbers:
SEQ ID NO: 120, SEQ ID NO: 123, SEQ ID NO: 126 to SEQ ID NO: 134, SEQ ID NO: 136 to SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147 to SEQ ID NO: 151, SEQ ID NO: 153 to SEQ ID NO: 154, SEQ ID NO: 156 to SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 163 to SEQ ID NO: 196, SEQ ID NO: 198 to SEQ ID NO: 202, SEQ ID NO: 204 to SEQ ID NO: 207, SEQ ID NO: 209 to SEQ ID NO: 211, SEQ ID NO: 213 to SEQ ID NO: 227, SEQ ID NO: 229 to SEQ ID NO: 231, SEQ ID NO: 234 to SEQ ID NO: 236, SEQ ID NO: 238 to SEQ ID NO: 253, SEQ ID NO: 255 to SEQ ID NO: 266, SEQ ID NO: 268 to SEQ ID NO: 269, SEQ ID NO: 271 to SEQ ID NO: 275, SEQ ID NO: 277 to SEQ ID NO: 279, SEQ ID NO: 281 to SEQ ID NO: 284, SEQ ID NO: 286, SEQ ID NO: 288, SEQ ID NO: 290 to SEQ ID NO: 291, SEQ ID NO: 293 to SEQ ID NO: 295 , SEQ ID NO: 298 to SEQ ID NO: 311, SEQ ID NO: 313, SEQ ID NO: 319 to SEQ ID NO: 330, SEQ ID NO: 332 to SEQ ID NO: 337, SEQ ID NO: 340 to SEQ ID NO: 352, SEQ ID NO: 357, SEQ ID NO: 359 to SEQ ID NO: 365, sequence SEQ ID NO: 367 to SEQ ID NO: 368, SEQ ID NO: 370 to SEQ ID NO: 374, SEQ ID NO: 376 to SEQ ID NO: 382, SEQ ID NO: 384 to SEQ ID NO: 397, SEQ ID NO: 399 to SEQ ID NO: 404, SEQ ID NO: 406 to SEQ ID NO: 494, SEQ ID NO: 496 To SEQ ID NO: 500, SEQ ID NO: 502 to SEQ ID NO: 514, SEQ ID NO: 516 to SEQ ID NO: 521, and SEQ ID NO: 523 to SEQ ID NO: 574.

In the present invention, SEQ ID NO: 120 ~ 574 revealed the sequence and function for the first time in the present invention, these cDNA genes can be used in various technical fields for the evaluation and detection of toxicity of environmental hormones, preferably environmental hormones Characterized in that it is used in the manufacture of genetic chips for the evaluation of toxicity.

According to another aspect of the present invention, the present invention comprises the steps of synthesizing cDNA from mRNA extracted from liver tissue of the fern; Inserting the cDNA into a plasmid to construct a cDNA library; Sequencing the cDNA library to construct a local database containing genetic information; Separating the non-overlapping cDNA groups into the local database by using a local BLAST function in a BIOEDIT (NCBI) program; And five steps of selecting only representative cDNAs for each of the classified cDNA groups and spatting them on a chip.

In the method for preparing a sally gene gene chip of the present invention, preferably in the step 2, the construction of the cDNA library is a method of making a cDNA-binding plasmid by inserting the synthesized cDNA into DNA ligase III, whole cDNA, and a plasmid; After carrying out the cleavage by electrophoresis, each of the fragments is put into a plasmid, and a method of making a cDNA-binding plasmid is used.

Hereinafter, the present invention will be described in more detail with reference to Examples. Since these examples are only for illustrating the present invention, the scope of the present invention is not to be construed as being limited by these examples.

Example 1. RNA Extraction and cDNA Synthesis Process

Species used to extract RNA were bred at 25 ° C. in a light cycle of 16 hours (persons): 8 hours (cancers) and Tetramin ™ was fed according to growth conditions in the morning and evening. The livers of 12 healthy male and female larvae and 12 female and female larvae exposed to toxic substances were dissected, and RNA was extracted from each of three liver tissues using QIAGEN RNeasy Mini Kit ™. RNA was collected in one place and used for the synthesis of cDNA. Synthesis of cDNA was performed with BD PowerScript Reverse Transcriptase and 3 'CDS III / 3' PCR Primer (5 'ATTCTAGAGGCCGAGGCGGCCGACATG-d (T) 30N-1N 3' in BD Creator SMART ™ cDNA Library Construction Kit) (N = A, G, C, or T; N.1 = A, G, or C) and the BD SMART IV Oligonucleotide in the 5 'direction (5' AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG 3 ') reverse transcription was performed at 42 ° C (Fig. 1), thus synthesized cDNA The adequacy of cDNA was less than that of cDNA synthesis using human plecenta mRNA as a control group, and the amount of cDNA was amplified by Primer Specific PCR in Advantage 2 PCR Kit. cDNA pool was prepared (Figure 2) The thus synthesized cDNA was digested with restriction enzyme sfiI and prepared for synthesis in pLIB vector (BD Bioscience Clontech) already digested with the same restriction enzyme.

Example 2 Insertion of cDNA into Plasmid Vectors

The cDNA prepared in Example 1 is purified and inserted into pLIB (BD Bioscience Clontech), an expression vector, through an ligation enzyme. The pLIB vector is a 4.7 kb bacterial plasmid that has the origin of pBR322 and is resistant to ampicillin and chloramphenicol, allowing the recombinant to be distinguished from the vector. The binding of vector and cDNA was performed using two methods. First, the synthesized cDNA was subjected to purification process, and then the whole was used to add DNA Ligase III, cDNA, and vector to overnight incubation at 16 ° C to form a binding plasmid. Second, the synthesized cDNA was subjected to electrophoresis. After cutting by size to separate and purified each section sample (Fig. 3) to prepare a binding plasmid using each cDNA. E. coli was used as the host cell for the plasmid, and E. coli can accept linear or circular DNA. This process is called transformation and is accomplished through the following steps.

E. coli is incubated at 0 ° C in the presence of Ca ⁺⁺ multivalent ions to make E. coli uptake DNA. The cation is expected to form a complex with the negatively charged phosphate of lipids in the E. coli membrane. The low temperature solidifies the cell membrane and stabilizes the distribution of charged phosphate, effectively shielding it by cation. At this time, when a heat shock is applied at 37 to 42 ° C., a thermal imbalance inside and outside of the E. coli membrane is generated, and the plasmid is sucked into the cell. DNA entering the host cell is identified by recombinant in a chloramphenicol-containing medium using a plasmid containing a chloramphenicol resistance gene. Recombinant Escherichia coli was incubated overnight in a medium containing chloramphenicol (100 μg / L), and about 20,000 single colonies were obtained for the first random cDNA plasmid, and for the second size cDNA. About 2,000 single colonies were obtained.

The obtained colonies were cultured overnight in LB media containing chloramphenicol and approximately 1,200 single colonies were seeded from about 1000 in the first series. Over night culture was centrifuged at 12000 G for 5 minutes, the supernatant was discarded, and the precipitate was separated using a QIAprep Spin Miniprep Kit. Prior to plasmid purification, each individual bacterium was transferred to another test tube, collected at OD (Optical density) 0.8, mixed with 25% Glycerol and 50% and stored in a freezer at -70 ° C. For confirmation of the prepared library, the plasmid was treated with sfiI restriction enzyme to confirm the cDNA portion that entered the plasmid (FIG. 4).

Example 3. Reproduction of cDNA from a Library

To produce cDNA chip, purely separated cDNA is required, and the prepared plasmid has a part containing each cDNA of each celery, and M13 (-20) Forward primer (5 'GTA) to obtain the inserted cine cDNA. CDNA was priming using AAA CGA CCA GT 3 ') and M13 (-20) Reverse primer (5' AAA CAG CTA TGA CCA TGT TCA 3 '), and PCR was performed using Takara Taq premixture. All of the plasmids used as templates were electrophoresed on agarose gel of 1 ~ 2% by digestion reaction with sfiI enzyme, and the size was confirmed by EtBR staining.

Example 4 Screening of Duplicate Libraries and Construction of Gene Chips

Each of 2000 cDNA libraries was sequenced, and using the base sequence information thus obtained, a local DB containing 2000 genetic information was constructed, and each local cLAST was bundled using the local BLAST function in the BIOEDIT program. lost. Each cDNA processed in this way was separated into 574 non-overlapping genetic information. Each of the isolated genetic information was subjected to nBLAST on NCBI to compare the base information with other organisms. Of these, 51 genes had similar or exactly identical information to the genes of the fern, and cDNAs showing similarities with other organisms were 68 455 independent genetic data were identified as cDNA, which did not show similarity with genetic information on NCBI. 574 cDNAs with final independent sequences from 2000 random cDNA libraries were commissioned to a chip manufacturing company (Genomic Tree, Daejeon). 574 cDNAs were checked for conformity through electrophoresis and refined to make a gene chip by repeating the poly L-lysine-coated glass slide (Corning) in a pinprint manner (Table 1, 2, 3).

Example 5. Application of the killary gene chip to 17β-estradiol

Gene chips were constructed based on the cDNA obtained in Example 4, and the gene was applied to the 17-beta estradiol known as an environmental hormone by using the gene chips for 17-beta estradiol. Hybridization was carried out on the developed Sary gene chip using RNA samples isolated from the liver tissues of female ferns exposed to 100 ppb of 17-β estradiol. RNA of the group exposed to 17-beta estradiol was labeled with Cy3 (F635 signal), and the control group was labeled with Cy5 (F532 signal), and then the expression results of the corresponding genes were expressed as log2 values. The results are summarized in Table 4. Therefore, we can compare the gene expression level of the killifish to toxic substances by using the manufactured gene chip, and according to the genetic information, the effects on various biological stresses such as environmental hormone effect, mutagenesis effect and metabolic regulation function field effect Can be evaluated. In addition, the killifish chip of the present invention can select a biomarker specific to stress, it is possible to present a detailed research direction on the biomarker.

The experimental data of F635, F532, and log2 (F635 / F532) were used in Table 4, the intensity of fluorescence of cDNA in the experimental group for F635, and the intensity of fluorescence of cDNA in the control group for F523. The value of log2 (F635 / F532) is log2 of (F635 / F532) ratio, and when the value is 1, (F635 / F532) = 2, indicating that the intensity of fluorescence in the experimental group is twice that of the control group. This means that the regulation of mRNA, or gene, of fish in experimental group treated with E2 was doubled in comparison with the control group. The increase and decrease of the data is represented by each of the responded log2 ratio values of 1 and 2 days, and in the case of more than 1 in both 1 and 2 days, it means overexpression of E2 on both days. When reacting on a specific day, the reaction with E2 by a specific time is shown.

Example 6 Analysis of Expression of Song-Cori Gene for Five Chemicals Including Environmental Hormones

In the same manner as in Example 5, five chemicals including environmental hormones (17-beta estradiol (E2), bisphenol A (BPA), 2-chlorophenol (2CP), phenol (Phenol), nonyl phenol ( The gene expression of the moribund gene for NP) was analyzed using a gene chip, and the overexpressed genes were selected according to each chemical substance, concentration, and exposure time (see Tables 5 to 9). Genetic chip experiments were performed by exposing RNA to the pods for 2, 4 days, and extracting RNA from the liver tissues of the pods to qualitatively express the expression patterns of the five chemicals, in particular the relationship between the overexpressed genes and chemicals. It is expressed in association with five chemicals using the Osprey: Network visualizatoin system: http://biodata.mshri.on.ca/osprey/servlet/Index. A network visualization analysis was performed to express genes simultaneously, which is described in detail as follows: Overexpressed groups of genes analyzed with gene chips under chemical exposure conditions were limited to twice as expressed compared to controls. Enter the list of chemicals and selected genes as nodes using the Ospray network visualization program, and perform the following steps to construct the nodes and the network of nodes, for example, gene A Overexpression in chemicals 1,2,3,4,5 creates an interaction edge between gene A and chemicals 1,2,3,4,5 Gene B overexpresses chemicals 1,3,5 If so, create a connection between gene B and chemicals 1, 3, and 5. Overexpressing the connection between selected genes and chemicals Create all of them and select the layout menu in the program, scrolled dual ring option, to draw a chemical visualization of the network visualization between the overexpressed gene and the chemical. 5, 6, and 7 is a schematic diagram of the gene-chemical network obtained through this process. 5 shows the results when five chemicals were exposed for one day, and FIGS. 6 and 7 show the results when they were exposed for two days and four days, respectively. To explain this in detail, a large node surrounded by small nodes means each chemical substance, and a small node around it means an overexpressed gene. Different chemicals are represented by different colors and the same chemical, but at different concentrations, similar colors. Genes overexpressed in each chemical are represented by small nodes surrounded by the chemical, and the color of the node is the same as the color of the large connected node. When the connection line between the gene and the chemical is formed by the above process, a schematic diagram of the genetic chemical network visualization as shown in FIG. 5 is drawn. Overexpression genes may appear in only one chemical and at a concentration, but may be overexpressed in more than one chemical and at a concentration. Such genes may be connected by two or more connecting lines by chemical and concentration. For example, the gene 11011 simultaneously overexpressed in BPA 7.5 ppb and E2 1 ppb in FIG. 5 is simultaneously connected to a large red node and a large yellow node, and is displayed in orange, which is a mixed color of each node. Also, when overexpressed in various chemical exposure situations, small nodes are located close to the center and are represented by the mixed color of each connected large node. Through this process, the gene chip constructed from the random cDNA constructed in the present invention can construct gene expression patterns of various chemicals including environmental hormones, and the genes are expressed in various chemical exposure environments using a visualization network diagram. By determining whether or not you can predict the importance of a gene's chemical exposure. You can also assess the effects of chemicals on the effects of these genes. The present invention is characterized by a genetic chip that can be applied to the toxicological genome analysis of chemicals including environmental hormones through such an embodiment.

The important result of the gene chip of the gene chip is the value expressed in log2 value. This is a comparison of the expression level of the gene between the control group and the experimental group. When the log2 value is 1 or more, the expression of the gene in the experimental group is twice that of the control group. It is interpreted that the expression of the gene on the experimental group is 1/2 times or less than that of the control group when the expression is abnormal and the log2 value is -1 or less. In the case of E2, which is a marker of environmental hormones, the related genes are genes with a log2 ratio of 1 or more, and are the genes of

Here, the data in Table 4 and Table 5 are data derived from the same raw data, but the values are similar but not exactly matched by the data processing method and statistical correction. In this case, the data in Table 5 is corrected and represents a value subjected to normalization correction.

As described above, the method for developing a genetic chip for analyzing environmental stress after identifying sequence information from the random cDNA according to the present invention and screening for characteristic cDNA is not yet complete. This can be the basic process of developing a. In particular, the analytical method of the present invention is a method of selectively separating and producing only cDNA, so that it is possible to quantitatively analyze changes in gene expression of environmentally hazardous substances, which is useful for judging the toxic effects of environmentally harmful substances on aquatic organisms. Can be applied. The gene chip can be used to evaluate the toxicity by environmental hormones and to select genes that are sensitive to chemicals by forming a network diagram between environmental hormones and genes.

Attach sequence list electronic file  

Claims (5)

Gene chip for the evaluation of environmental hormone toxicity consisting of a fern cDNA having a nucleotide sequence of SEQ ID NO: 1 ~ 574. The method of claim 1, wherein the environmental hormone is selected from the group consisting of 17β- estradiol (E2), bisphenol A (BPA), 2-chlorophenol (2CP), phenol (Phenol), nonyl phenol (NP) Gene chip for the evaluation of environmental hormone toxicity. CDNA gene having any one nucleotide sequence selected from the group consisting of the following sequence numbers: SEQ ID NO: 120, SEQ ID NO: 123, SEQ ID NO: 126 to SEQ ID NO: 134, SEQ ID NO: 136 to SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147 to SEQ ID NO: 151, SEQ ID NO: 153 to SEQ ID NO: 154, SEQ ID NO: 156 to SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 163 to SEQ ID NO: 196, SEQ ID NO: 198 to SEQ ID NO: 202, SEQ ID NO: 204 to SEQ ID NO: 207, SEQ ID NO: 209 to SEQ ID NO: 211, SEQ ID NO: 213 to SEQ ID NO: 227, SEQ ID NO: 229 to SEQ ID NO: 231, SEQ ID NO: 234 to SEQ ID NO: 236, SEQ ID NO: 238 to SEQ ID NO: 253, SEQ ID NO: 255 to SEQ ID NO: 266, SEQ ID NO: 268 to SEQ ID NO: 269, SEQ ID NO: 271 to SEQ ID NO: 275, SEQ ID NO: 277 to SEQ ID NO: 279, SEQ ID NO: 281 to SEQ ID NO: 284, SEQ ID NO: 286, SEQ ID NO: 288, SEQ ID NO: 290 to SEQ ID NO: 291, SEQ ID NO: 293 to SEQ ID NO: 295 , SEQ ID NO: 298 to SEQ ID NO: 311, SEQ ID NO: 313, SEQ ID NO: 319 to SEQ ID NO: 330, SEQ ID NO: 332 to SEQ ID NO: 337, SEQ ID NO: 340 to SEQ ID NO: 352, SEQ ID NO: 357, SEQ ID NO: 359 to SEQ ID NO: 365, sequence SEQ ID NO: 367 to SEQ ID NO: 368, SEQ ID NO: 370 to SEQ ID NO: 374, SEQ ID NO: 376 to SEQ ID NO: 382, SEQ ID NO: 384 to SEQ ID NO: 397, SEQ ID NO: 399 to SEQ ID NO: 404, SEQ ID NO: 406 to SEQ ID NO: 494, SEQ ID NO: 496 To SEQ ID NO: 500, SEQ ID NO: 502 to SEQ ID NO: 514, SEQ ID NO: 516 to SEQ ID NO: 521, and SEQ ID NO: 523 to SEQ ID NO: 574. 1 step of synthesizing cDNA from mRNA extracted from liver tissue of the fern; Inserting the cDNA into a plasmid to construct a cDNA library; Sequencing the cDNA library to construct a local database containing genetic information; Separating the non-overlapping cDNA groups into the local database by using a local BLAST function in a BIOEDIT (NCBI) program; And a step 5 of selecting only representative cDNAs for each of the classified cDNA groups and spattering them on a chip. The method of claim 4, wherein the construction of the cDNA library in step 2 is a method of making a cDNA-binding plasmid by adding DNA ligase III, total cDNA, and plasmid to the synthesized cDNA, and cutting the synthesized cDNA by electrophoresis. A method for producing a lyrosa gene chip, comprising inserting a fragment of plasmid into a plasmid to make a cDNA-binding plasmid.

Images