KR100820095B1 - Cloning of the Melanin-concentrating hormone receptor from Olive flounder Paralichthys olivaceus - Google Patents

Cloning of the Melanin-concentrating hormone receptor from Olive flounder Paralichthys olivaceus Download PDF

Info

Publication number
KR100820095B1
KR100820095B1 KR1020060127595A KR20060127595A KR100820095B1 KR 100820095 B1 KR100820095 B1 KR 100820095B1 KR 1020060127595 A KR1020060127595 A KR 1020060127595A KR 20060127595 A KR20060127595 A KR 20060127595A KR 100820095 B1 KR100820095 B1 KR 100820095B1
Authority
KR
South Korea
Prior art keywords
thr
melanin
val
hormone receptor
ile
Prior art date
Application number
KR1020060127595A
Other languages
Korean (ko)
Inventor
송영환
전정민
정인영
Original Assignee
부경대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 부경대학교 산학협력단 filed Critical 부경대학교 산학협력단
Priority to KR1020060127595A priority Critical patent/KR100820095B1/en
Application granted granted Critical
Publication of KR100820095B1 publication Critical patent/KR100820095B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0684—Cells of the urinary tract or kidneys
    • C12N5/0686—Kidney cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C12N2510/02—Cells for production

Abstract

An expression vector is provided to induce expression of a melanin-concentrating hormone receptor 1(fMCHR1) gene and a melanin-concentrating hormone receptor 2(fMCHR2) gene isolated from brain of Paralichthys olivaccus, thereby the fMCHR1 gene involving with energy homeostasis being applicable for obesity related field and the fMCHR2 gene being applicable for finding out the function thereof. An expression vector is characterized in that a melanin-concentrating hormone receptor 1(fMCHR1) gene including a sequence of SEQ ID : NO. 1 is expressed by being recombined with pcDNA3.1(-)Hygro using a DNA ligase or a melanin-concentrating hormone receptor 2(fMCHR2) gene including a sequence of SEQ ID : NO. 3 is expressed by being recombined with the pcDNA3.1(-)Hygro using the DNA ligase.

Description

양식 넙치의 멜라닌 농축 호르몬 수용체{Cloning of the Melanin-concentrating hormone receptor from Olive flounder (Paralichthys olivaceus)}Cloning of the Melanin-concentrating hormone receptor from Olive flounder (Paralichthys olivaceus)

도 1은 본 발명의 멜라닌 농축 호르몬 수용체 1(fMCHR1) 유전자의 5'- and 3'-RACE PCR 수행 결과와 구성을 도시화 한 것이다.Figure 1 shows the results and configuration of the 5'- and 3'-RACE PCR of the melanin enriched hormone receptor 1 (fMCHR1) gene of the present invention.

도 2는 본 발명의 멜라닌 농축 호르몬 수용체 1(fMCHR1)의 세포막내 구성을 도시화 한 것이다.Figure 2 illustrates the intracellular composition of melanin enriched hormone receptor 1 (fMCHR1) of the present invention.

도 3은 본 발명의 멜라닌 농축 호르몬 수용체 2(MCHR2)유전자의 5'- and 3'-RACE PCR 수행 결과와 구성을 도식화 한 것이다.Figure 3 illustrates the results and configuration of 5'- and 3'-RACE PCR of the melanin enriched hormone receptor 2 (MCHR2) gene of the present invention.

도 4는 본 발명의 멜라닌 농축 호르몬 수용체 2(MCHR2)의 세포막내 구성을 도시화 한 것이다.Figure 4 illustrates the intracellular composition of melanin enriched hormone receptor 2 (MCHR2) of the present invention.

도 5는 본 발명의 pcNDA3.1(-)Hygro 발현벡터의 지도를 나타낸 것이다.Figure 5 shows a map of the pcNDA3.1 (-) Hygro expression vector of the present invention.

도 6은 본 발명의 pcDNA3.1(-)Hygro-fMCHR1 발현벡터의 지도를 나타낸 것이다.Figure 6 shows a map of the pcDNA3.1 (-) Hygro-fMCHR1 expression vector of the present invention.

도 7은 본 발명의 pcDNA3.1(-)-fMCHR2 발현벡터의 지도를 나타낸 것이다.Figure 7 shows a map of the pcDNA3.1 (-)-fMCHR2 expression vector of the present invention.

도 8은 두 종류의 발현벡터를 인간 배아 신장세포(HEK cell)에 일시적으로 감염시켜 두 종류의 멜라닌 농축호르몬 수용체에 넙치 멜라닌 농축호르몬의 결합을 통한 수용체의 특성을 나타낸 그래프이다.Figure 8 is a graph showing the characteristics of the receptor through the binding of two kinds of melanin enriched hormone receptor to flounder melanin enriched hormone by temporarily infecting two kinds of expression vectors human embryonic kidney cells (HEK cells).

본 발명은 경골어류인 양식넙치에서 멜라닌 농축 호르몬 수용체 1과 멜라닌 농축 호르몬 수용체 2를 생산할 수 있는 유전자와 발현벡터의 구성과 인간 배아 신장세포에 감염을 통해 넙치 멜라닌 농축호르몬과 결합능을 지닌 수용체의 특성에 대한 것이다.The present invention provides a composition of genes and expression vectors capable of producing melanin enriched hormone receptor 1 and melanin enriched hormone receptor 2 in cultured flounder, which are tibial fishes, and the characteristics of the receptor having the ability to bind to flounder melanin enriched hormone through infection of human embryonic kidney cells. It is about.

일반적으로 멜라닌 농축 호르몬은 연어에서 처음으로 펩티드가 분리되어 구조가 17개의 아미노산으로 구성 NH2-Asp-Thr-Met-Arg-Cys-Met-Val-Tyr-Arg-Pro-Cys-In general, melanin-rich hormone is the first peptide isolated from salmon and consists of 17 amino acids. NH 2 -Asp-Thr-Met-Arg-Cys-Met-Val-Tyr-Arg-Pro-Cys-

Trp-Glu-Val-COOH의 환형(cyclic)의 펩티드로 알려졌다 (Kawauchi et al., 1983). 또한 연어의 멜라닌 농축 호르몬 펩티드를 이용한 틸라피아 표피의 체외 생물학적 분석에서 틸라피아 멜라닌 보유세포의 멜라닌 과립이 농축되는 현상이 확인되었다. 이후 취의 시상하부에서 산 추출, 면역친화성 크로마토그래피와 아미노산 서열분석기를 이용하여 포유동물 처음으로 쥐에서 멜라닌 농축 호르몬이 분리 및 아미노산 서열이 분석되었으며 연어에서 밝혀진 멜라닌 농축 호르몬 펩티드 구조와 매우 유사한 19개 아미노산으로 된 구조를 보여주었다. It is known as a cyclic peptide of Trp-Glu-Val-COOH (Kawauchi et al ., 1983). In vitro biological analysis of the tilapia epidermis using melanin enriched hormone peptides from salmon confirmed the concentration of melanin granules in tilapia melanin-bearing cells. Subsequently, melanin enrichment hormone was isolated and analyzed for amino acid sequence in mice for the first time in mammals using acid extraction, immunoaffinity chromatography and amino acid sequencing in the hypothalamus of the anesthetic. It showed a structure of dog amino acids.

NH2-Asp-Phe-Asp-Met-Leu-Arg-Cys-Met-Leu-Gly-Arg-Val-Tyr-Arg-Pro -Cys-Trp-Gln-Val-COOH (Vaughan et al., 1989). NH 2 -Asp-Phe-Asp-Met-Leu-Arg-Cys-Met-Leu-Gly-Arg-Val-Tyr-Arg-Pro -Cys-Trp-Gln-Val-COOH (Vaughan et al ., 1989) .

포유동물에서 분리된 쥐의 멜라닌 농축 호르몬은 다양한 멜라닌 농축 호르몬 연구 를 가능하게 하였으며, 어류의 멜라닌 농축 호르몬에서 나타난 피부색의 변화와는 별개의 기능, 즉 신경전달물질 및 신경조절물질로서 기능성이 제시되었다.Melanin enriched hormones in rats isolated from mammals have allowed for the study of various melanin enriched hormones, and have been shown to function as neurotransmitters and neuromodulators independently of changes in skin color in fish melanin enriched hormones. .

최근의 멜라닌 농축 호르몬 연구는 포유동물에 적용되어 쥐의 경우 멜라닌 농축 호르몬이 시상하부 후엽에서 주로 발현되고 특히 비만 유전자의구성이 ob / ob인 쥐의 경우 시상하부에서 대량 발현되는 것이 알려졌다 (Qu et al., 1996). 또한 정상의 쥐와 비만의 쥐를 대상으로 금식을 시킨 경우 멜라닌 농축 호르몬의 발현이 증가되는 현상이 관찰되었고, 특히 뇌실로 멜라닌 농축 호르몬을 주사하였을 경우 음식물의 섭취가 증가되었음이 확인되어 멜라닌 농축 호르몬이 포유동물에서는 에너지 항상성과 섭식 행동에 영향을 미친다는 것이 밝혀졌다. 그러나 이러한 연구 동향은 멜라닌 농축 호르몬 수용체에 대한 인식이 이루어지지 않은 상태에서 이루어 졌으나, 이후 멜라닌 농축 호르몬 수용체를 유전자를 확인함으로서 연계를 통한 연구가 이루어졌다.Recent melanin concentrating hormone study is applied to a mammal for the rat melanin concentrating hormone is mainly expressed in the hypothalamus posterior in particular the configuration of the obese gene was known to be mass-expressed in the case of ob / ob mouse hypothalamus (Qu et al ., 1996). In addition, the expression of melanin concentration hormone was increased when fasting in normal rats and obese rats. Especially, when melanin concentration hormone was injected into the ventricle, food intake was increased. It has been found that this mammal affects energy homeostasis and feeding behavior. However, this research trend was carried out in the state that the recognition of melanin-enriched hormone receptor was not achieved, but afterwards, research was conducted by linking the melanin-enriched hormone receptor by identifying the gene.

멜라닌 농축 호르몬 수용체는 처음 SLC-1이라는 알려지지 않은 G 단백질 쌍을 이루는 수용체의 한 종류로 5개의 성장호르몬분비 억제 호르몬 수용체와 40% 이상의 유사성을 나타내었고 인간의 게놈에서 유전자 증폭기술을 이용하여 SLC-1 수용체의 유전자를 확보하였다 (Kolakowski, Jr. et al., 1983). Melanin-enriched hormone receptors are the first known group of G protein paired SLC-1 receptors, which show more than 40% similarity to five growth hormone secretion hormone receptors. 1 receptor gene was obtained (Kolakowski, Jr. et al ., 1983).

SLC-1 수용체의 리간드를 천연물질에서 찾는 과정에서 해당 리간드로서 멜라닌 농축 호르몬이라는 것을 확인하게 되었고 이후에 멜라닌 농축 호르몬 수용체로 명명되었다 (Bachner et al., 1999). 2001년에는 인간 게놈과 cDNA로부터 멜라닌 농축 호르몬을 리간드로 하는 두 번째 멜라닌 농축 호르몬 수용체를 확보하였다 (Rodriguez et al., 2001; Sailer et al., 2001; Hill et al., 2001).In the process of locating ligands of SLC-1 receptors in natural materials, they were identified as melanin enrichment hormones as ligands and later named melanin enrichment hormone receptors (Bachner et. al ., 1999). In 2001, a second melanin-enriched hormone receptor was obtained from the human genome and cDNA as a ligand for melanin-enriched hormone (Rodriguez et. al ., 2001; Sailer et al ., 2001; Hill et al ., 2001).

멜라닌 농축 호르몬 수용체는 현재까지 두 종류가 보고되어 있다. 그 중에서 멜라닌 농축 호르몬 수용체 1은 인간, 침팬지, 원숭이, 쥐, 소, 개, 복어, 제브라피쉬, 등에서 유전자 염기 서열이 밝혀져 있고, 쥐에서 멜라닌 농축 호르몬 수용체 기능에 대한 연구가 이루어지고 있다. 주로 연구되고 있는 것은 비만에 대한 연구가 주를 이루고 있으며 멜라닌 농축 호르몬과 멜라닌 농축 호르몬 수용체 1의 구조-활성 관계 연구를 통하여 아고니스트와 길항제 펩티드가 발견되었다 (Bednarek et al., 2002; Bednarek et al., 2001).Two types of melanin enriched hormone receptors have been reported to date. Among them, the melanin enriched hormone receptor 1 has been found to have gene sequences in humans, chimpanzees, monkeys, mice, cows, dogs, puffer fish, zebrafish, and the like, and studies on melanin enriched hormone receptor function in mice have been made. The main research subjects are obesity, and agonist and antagonist peptides have been found through the study of the structure-activity relationship between melanin and melanin receptor 1 (Bednarek et. al ., 2002; Bednarek et al ., 2001).

이 외에 뇌의 뉴런에서 폭넓게 발현되는 것으로 나타나고 있는데, 이것은 습성과 후각 작용, 기억 등과 관련한 뇌 활성 조절에 대해서 멜라닌 농축 호르몬과 함께 뇌에서 다양한 기능적 역할을 할 것으로 추측되고 있다 (Monzon et al., 1999; Monzon and De, Sr., 1999; Varas et al., 2002). In addition, it has been shown to be widely expressed in brain neurons, which are thought to play various functional roles in the brain along with melanin enrichment hormones in the regulation of brain activity related to habits, olfactory activity, and memory (Monzon et. al ., 1999; Monzon and De, Sr., 1999; Varas et al ., 2002).

멜라닌 농축 호르몬 수용체 2의 경우는 그 기능에 대한 연구가 미비하다. 그것은 인간에 대한 대표적 실험동물인 쥐에서는 멜라닌 농축 호르몬 수용체 2가 존재하지 않기 때문이며 다른 실험동물에서도 아직 멜라닌 농축 호르몬 수용체 2의 기능에 대한 보고가 현재까지 없다.In the case of melanin enriched hormone receptor 2, its function is insufficient. This is because melanin-enriched hormone receptor 2 does not exist in rats, which is a representative animal animal, and there are no reports on the function of melanin-enriched hormone receptor 2 in other experimental animals.

본 발명은 상기 유전자를 포함하는 멜라닌 농축 호르몬 수용체 유전자를 제공하기 위한 것으로, 구체적으로는 서열번호 1로 기재되는 염기서열을 갖는 멜라닌 농축 호르몬 수용체 1 유전자와 서열번호 3으로 기재되는 염기서열을 갖는 멜라닌 농축 호르몬 수용체 2 유전자를 제공한다. The present invention is to provide a melanin enriched hormone receptor gene comprising the gene, specifically melanin enriched hormone receptor 1 gene having a nucleotide sequence described in SEQ ID NO: 1 and melanin having a nucleotide sequence described in SEQ ID NO: 3 Provides enriched hormone receptor 2 gene.

또한, 본 발명은 상기 멜라닌 농축 호르몬 수용체 1 유전자를 포함하는 재조합 벡터와 멜라닌 농축 호르몬 수용체 2 유전자를 포함하는 재조합 벡터를 제공하며, 발현벡터를 인간 배아신장세포에 일시적으로 감염시켜 넙치 멜라닌 농축호르몬과의 결합능을 확인하여 작용기가 결합하는 수용체로서의 특성을 제공한다. 일반적으로 넙치의 멜라닌 농축호르몬은 멜라닌 농축호르몬 수용체에 결합하여 나타내는 효과반응이 EC50의 값으로 정의되며, 이 값이 10nM 이하의 값이 나오면 작용기-수용체 결합 이론에 의거 의미있는 작용기(멜라닌 농축호르몬)로서의 가능성을 지닌다. 또한 이때 수용체는 중요한 결합 특성을 지닌 수용체로서의 특성이 유지된다고 볼 수 있다.The present invention also provides a recombinant vector comprising the melanin enriched hormone receptor 1 gene and a recombinant vector comprising the melanin enriched hormone receptor 2 gene, and the expression vector is temporarily infected with human embryonic kidney cells and the flounder melanin enriched hormone. Checking the binding capacity of the compound provides the characteristics as a receptor to which the functional group binds. In general, the melanin-enriched hormone in flounder is defined as the EC50 value of the binding reaction to the melanin-enriched hormone receptor, and when this value is less than 10 nM, the functional group (melanin-enriched hormone) is meaningful according to the functional group-receptor binding theory. It has the potential as In addition, it can be said that the receptor is maintained as a receptor having important binding properties.

상기 목적을 달성하기 위하여, 본 발명은 멜라닌 농축 호르몬 수용체 1과 멜라닌 농축 호르몬 수용체 2 유전자를 제공한다. In order to achieve the above object, the present invention provides melanin enriched hormone receptor 1 and melanin enriched hormone receptor 2 genes.

또한 인간이나 쥐와 같은 포유동물의 세포에서 양식넙치의 멜라닌 농축 호르몬 수용체 유전자를 발현시키고, 세포에서 수용체로서 기능을 확인할 수 있도록 재조합 벡터를 제공한다.In addition, it provides a recombinant vector to express the melanin enrichment hormone receptor gene of cultured flounder in cells of mammals such as humans and mice, and to confirm the function as a receptor in the cell.

본 발명은 멜라닌 농축 호르몬을 기질로 삼는 수용체 단백질을 코딩하는 서열번호 1, 서열번호 3으로 구성된 군으로부터 선택되는 염기서열을 갖는 유전자를 제공한 다.The present invention provides a gene having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 encoding a receptor protein based on melanin enrichment hormone.

본 발명의 2개의 유전자 및 이로부터 코딩되는 단백질에 대하여 하기 [표 1]에 기재하였다. The two genes of the present invention and the proteins encoded therefrom are described in Table 1 below.

표 1. 유전자 및 이로부터 코딩되는 단백질Table 1. Genes and Proteins Encoded therefrom

유전자gene 유전자명Gene name 단백질protein 단백질의 Protein 아미노산 서열Amino acid sequence 서열번호 1SEQ ID NO: 1 fMCHR1fMCHR1 멜라닌 농축 호르몬 수용체 1Melanin Enriched Hormone Receptor 1 (Melanin-concentrating hormone receptor 1)(Melanin-concentrating hormone receptor 1) 서열번호 2SEQ ID NO: 2 서열번호 3SEQ ID NO: 3 fMCHR2fMCHR2 멜라닌 농축 호르몬 수용체 2Melanin Enriched Hormone Receptor 2 (Melanin-concentrating hormone receptor 2)(Melanin-concentrating hormone receptor 2) 서열번호 4SEQ ID NO: 4

본 발명에 따라 제공되는 유전자들은 다양한 숙주세포에 도입되어 멜라닌 농축 호르몬 수용체 1 및 2를 발현하는데 유용하게 사용될 수 있다.Genes provided according to the present invention can be introduced into a variety of host cells can be usefully used to express melanin enriched hormone receptors 1 and 2.

본 발명의 멜라닌 농축 호르몬 수용체 1 유전자는 서열번호 1에서 보는 바와 같이 1077 bp의 크기이며, 멜라닌 농축 호르몬 수용체 2 유전자는 서열번호 3에서 보는 바와 같이 1032 bp 크기이다.The melanin enriched hormone receptor 1 gene of the present invention is 1077 bp in size as shown in SEQ ID NO: 1, and the melanin enriched hormone receptor 2 gene is 1032 bp in size as shown in SEQ ID NO.

또한, 본 발명은 상기 멜라닌 농축 호르몬 수용체 1 및 2 유전자를 포함하는 재조합 벡터를 제공한다.The present invention also provides a recombinant vector comprising the melanin enriched hormone receptor 1 and 2 genes.

본 발명의 재조합 벡터는 멜라닌 농축 호르몬 수용체 1 및 2 각각을 기본 벡터에 삽입하여 제조한 것으로, 본 발명에서 사용될 수 있는 벡터는 유전자의 클로닝 또 는 포유동물 세포 주에 형질 도입하여 발현할 수 있는 벡터가 사용될 수 있다. The recombinant vector of the present invention was prepared by inserting each of the melanin enrichment hormone receptors 1 and 2 into a base vector. The vector which can be used in the present invention is a vector which can be expressed by cloning a gene or transducing a mammalian cell line. Can be used.

본 발명의 바람직한 실시 예에서는 pcDNA3.1(-)Hygro (Invitrogen, USA) 벡터를 사용하여 fMCHR1 및 fMCHR2 유전자를 포함하는 각각의 재조합 벡터를 제조하였으며, 이를 ‘pcDNA3.1(-)Hygro-fMCHR1’ 및 ‘pcDNA3.1(-)Hygro-fMCHR2'이라 명명하였다.In a preferred embodiment of the present invention, each recombinant vector including the fMCHR1 and fMCHR2 genes was prepared using the pcDNA3.1 (-) Hygro (Invitrogen, USA) vector, which was referred to as 'pcDNA3.1 (-) Hygro-fMCHR1'. And 'pcDNA3.1 (-) Hygro-fMCHR2'.

또한, 본 발명은 상기 멜라닌 농축 호르몬 수용체 1 및 2 유전자를 포함하는 재조합 벡터를 숙주세포에 형질 도입한 균주를 제공한다.The present invention also provides a strain transfected into a host cell with a recombinant vector comprising the melanin enriched hormone receptor 1 and 2 genes.

상기에서 숙주세포에 대장균을 사용할 수 있다. 본 발명의 바람직한 실시 예에서는 [서열번호 1]로 기재되는 fMCHR1 유전자를 포함하는 재조합 벡터 pcDNA3.1(-) Hygro-fMCHR1 및 [서열번호 3]로 기재되는 fMCHR2 유전자를 포함하는 재조합 pcDNA3.1(-)Hygro-fMCHR2를 대장균인 DH5α에 형질도입한 균주를 제조하였다.E. coli can be used in the host cell. In a preferred embodiment of the present invention, the recombinant vector pcDNA3.1 (-) comprising the fMCHR1 gene as described in [SEQ ID NO: 1), and the recombinant pcDNA3.1 (including Hygro-fMCHR1 and the fMCHR2 gene as described in [SEQ ID NO: 3]). -) A strain transduced with Hygro-fMCHR2 to E. coli DH5α was prepared.

이하, 본 발명의 구성에 대하여 아래 실시에를 통하여 더욱 상세히 설명하나, 본 발명의 권리범위가 아래 실시예에 만 한정되어지는 것은 아니며, 본 발명의 범주와 사상을 벗어나지 않는 범위 내에서 다양한 변형실시가 가능하다.Hereinafter, the configuration of the present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not limited only to the following examples, and various modifications can be made without departing from the scope and spirit of the present invention. Is possible.

[[ 실시예Example 1] 멜라닌 농축 호르몬 수용체 1 및 2 유전자의  1] melanin enrichment hormone receptor 1 and 2 genes 클로닝과Cloning and pcDNA3pcDNA3 .1(-) .One(-) HygroHygro 와의 재조합에 의한 포유동물 세포주에 발현 가능한 발현벡터 Expression vector expressible in mammalian cell line by recombination with 클로닝Cloning

양식 넙치의 뇌에서 분리된 전체 RNA로부터 5'- and 3'-RACE (Rapid amplification of cDNA ends)를 실시하여 확보한 멜라닌 농축 호르몬 수용체 1 (fMCHR1) 유전자 및 멜라닌 농축 호르몬 수용체 2 (fMCHR2) 유전자 중에서 ORF (open reading frame) 부분을 증폭하고 제한효소(Xho I, Hind III) 부위를 가지는 두 쌍의 프라이머(표 2 참조)를 제작하여 각각의 유전자 부위를 증폭시키고, 증폭된 각각의 ORF 바깥부분을 제거하고, pcDNA3.1(-)Hygro 벡터 DNA에도 제한효소(Xho I, Hind III) 처리하여 fMCHR1 유전자 및 fMCHR2 유전자 각각을 pcDNA3.1(-)Hygro에 DNA ligase로 재조합하여 pcDNA3.1(-)Hygro-fMCHR1 및 pcDNA3.1(-)Hygro-fMCHR2를 클로닝 하였다.Among the melanin-enriched hormone receptor 1 (fMCHR1) genes and the melanin-enriched hormone receptor 2 (fMCHR2) genes obtained from 5'- and 3'-RACE (Rapid amplification of cDNA ends) from total RNA isolated from cultured flounder brains Amplify the open reading frame (ORF) and construct two pairs of primers (see Table 2) with restriction enzymes (Xho I, Hind III) sites to amplify each of the gene sites Removed and treated with pcDNA3.1 (-) Hygro vector DNA by restriction enzymes (Xho I, Hind III) to recombine each of the fMCHR1 and fMCHR2 genes with a DNA ligase in pcDNA3.1 (-) Hygro and pcDNA3.1 (-) Hygro-fMCHR1 and pcDNA3.1 (−) Hygro-fMCHR2 were cloned.

표 2, fMCHR1 유전자 및 fMCHR2 유전자 프라이머Table 2, fMCHR1 Gene and fMCHR2 Gene Primers

염기 서열Base sequence 비 고Remarks 프라이머primer 1 One 5'-TT CTCGAG GGCACTTCTTAACTTGGATACACC-3'5'-TT CTCGAG GGCACTTCTTAACTTGGATACACC-3 ' fMCHR1 앞부분에 Xho I부위 첨가 Xho I site added in front of fMCHR1 프라이머primer 2 2 5'-AA AAGCTT GTGCAGATAAGATGGTGATGGAGT-3'5'-AA AAGCTT GTGCAGATAAGATGGTGATGGAGT-3 ' fMCHR1 뒷부분에 Hind Ⅲ부위 첨가 Hind III addition at the back of fMCHR1 프라이머primer 3 3 5'-TT CTCGAG CTGAGAAGAACTCCAGGAAGAAAG-3'5'-TT CTCGAG CTGAGAAGAACTCCAGGAAGAAAG-3 ' fMCHR2 앞부분에 Xho I 부위 첨가 Xho I site added in front of fMCHR2 프라이머primer 4 4 5'-AA AAGCTT CCCAGGTTCAATTGTACAGTATCC-3'5'-AA AAGCTT CCCAGGTTCAATTGTACAGTATCC-3 ' fMCHR2 뒷부분에 Hind Ⅲ 부위 첨가 Hind III site added at the back of fMCHR2

[서열 번호 1] [SEQ ID NO 1] floflo underunder MCHR1MCHR1 genegene

atggatttccatggatttcc ataacgattcataacgattc aaatttttctaaatttttct gtctcacacagtctcacaca ctaattcaacctaattcaac aacaacagctaacaacagct 60      60

gtatatgggggtatatgggg cccttcattccccttcattc cagtgccatccagtgccatc ctccctgtcactccctgtca tcttcggcattcttcggcat catctgttttcatctgtttt 120     120

cttggtatctcttggtatct tggggaactgtggggaactg catcgttatgcatcgttatg tacaccatcatacaccatca taaagaagactaaagaagac caagtgccgccaagtgccgc 180     180

gccaagcagagccaagcaga ctgttccggactgttccgga catctttatccatctttatc ttaaacgtgtttaaacgtgt cgattgttgacgattgttga cctcctctttcctcctcttt 240     240

ctccttgggactccttggga tgccgttccttgccgttcct catccaccagcatccaccag ttgctgggcattgctgggca atggcagttgatggcagttg gcactttggagcactttgga 300     300

gccacaatgtgccacaatgt gtacagtcatgtacagtcat cactgcgctccactgcgctc gactccaacagactccaaca gccagatagtgccagatagt cagtacttaccagtacttac 360     360

atcctcactgatcctcactg ctatgaccctctatgaccct tgaccgttactgaccgttac ttggctacggttggctacgg tccatcccattccatcccat ccgctttaacccgctttaac 420     420

tatgtccgcatatgtccgca caccctgtgtcaccctgtgt agcagcgctgagcagcgctg gtcatcgtcagtcatcgtca ttgtgtggggttgtgtgggg tctgtctttctctgtctttc 480     480

ctcaccattactcaccatta tccctgtgtgtccctgtgtg gatgtatgcggatgtatgcg ggcctgatgcggcctgatgc ctcttccagactcttccaga tggactggtttggactggtt 540     540

gcttgtgcgcgcttgtgcgc tcctcctgcctcctcctgcc tgacccaatttgacccaatt accgacacataccgacacat attggtttacattggtttac actttaccagactttaccag 600     600

ttctttttggttctttttgg ccttcgccatccttcgccat gcccttggttgcccttggtt ataatctgccataatctgcc tggtgttctttggtgttctt caagatgctccaagatgctc 660     660

caacacatgtcaacacatgt ccagcagtgtccagcagtgt ggcaccgctgggcaccgctg cctccacggacctccacgga gtctgagggtgtctgagggt gcgaaccagggcgaaccagg 720     720

aaggtgacccaaggtgaccc ggatggcggtggatggcggt ggccatctgcggccatctgc cttgcgttctcttgcgttct tcatctgctgtcatctgctg ggctccttacggctccttac 780     780

tacatccttctacatccttc agctgatccaagctgatcca ccttggggtgccttggggtg cagaagccaacagaagccaa cccttgcgttcccttgcgtt ctcctatgcgctcctatgcg 840     840

tacaacatagtacaacatag ccattagcatccattagcat gggctacgctgggctacgct aacagttgcaaacagttgca tcaacccatttcaacccatt tctctacatctctctacatc 900     900

atcctcagtgatcctcagtg agactttcaaagactttcaa gaggcagtttgaggcagttt ctcagagccgctcagagccg tacgtccggttacgtccggt caacagaaagcaacagaaag 960     960

ttccgcgtgattccgcgtga acccgagcacacccgagcac cacggatggtcacggatggt ggcagcgtgaggcagcgtga gcatgcgaatgcatgcgaat ggacctgaagggacctgaag 1020    1020

ggggctcggcggggctcggc aggagccggcaggagccggc ccctcgggagccctcgggag atgataccatatgataccat ccaatgtggcccaatgtggc gccacaagccacaa 1077       1077

[서열 번호 2] [SEQ ID NO 2] floflo underunder MCHR1MCHR1 aminoamino acidacid

MetMet AspAsp PhePhe HisHis AsnAsn AspAsp SerSer AsnAsn PhePhe SerSer ValVal SerSer HisHis ThrThr AsnAsn SerSer ThrThr ThrThr ThrThr AlaAla ValVal TyrTyr GlyGly AlaAla ThrThr HisHis SerSer SerSer AlaAla IleIle ThrThr ProPro ValVal IleIle PhePhe GlyGly IleIle IleIle CysCys PhePhe ThrThr GlyGly IleIle LeuLeu GlyGly AsnAsn CysCys IleIle ValVal MetMet TyrTyr ThrThr IleIle MetMet LysLys LysLys ThrThr LysLys CysCys ArgArg AlaAla LysLys GlnGln ThrThr ValVal ProPro AspAsp IleIle PhePhe IleIle LeuLeu AsnAsn ValVal SerSer IleIle ValVal AspAsp ThrThr ThrThr PhePhe ThrThr ThrThr GlyGly MetMet ProPro PhePhe ThrThr IleIle HisHis GlnGln LeuLeu ThrThr GlyGly AsnAsn GlyGly SerSer TrpTrp HisHis PhePhe GlyGly AlaAla ThrThr MetMet ArgArg ThrThr ValVal IleIle ThrThr AlaAla ThrThr AspAsp SerSer AsnAsn SerSer GlnGln MetMet ValVal SerSer ThrThr TyrTyr IleIle ThrThr ThrThr AlaAla MetMet ThrThr ThrThr AspAsp ArgArg TyrTyr LeuLeu AlaAla ThrThr ValVal HisHis ProPro IleIle ArgArg PhePhe AsnAsn TyrTyr ValVal ArgArg ThrThr ProPro CysCys ValVal AlaAla AlaAla ThrThr ValVal IleIle ValVal IleIle ValVal TrpTrp GlyGly ThrThr SerSer PhePhe ThrThr ThrThr IleIle IleIle ProPro ValVal TrpTrp MetMet TyrTyr AlaAla GlyGly ThrThr MetMet ProPro ThrThr ProPro AspAsp GlyGly ThrThr ValVal AlaAla CysCys AlaAla ThrThr ThrThr ThrThr ProPro AspAsp ProPro IleIle ThrThr AspAsp ThrThr TyrTyr TrpTrp PhePhe ThrThr ThrThr TyrTyr GlnGln PhePhe PhePhe LeuLeu AlaAla PhePhe AlaAla MetMet ProPro LeuLeu ValVal MetMet IleIle CysCys ThrThr ValVal PhePhe PhePhe LysLys MetMet ThrThr GlnGln HisHis MetMet SerSer SerSer SerSer ValVal AlaAla ProPro ThrThr ProPro ProPro ArgArg SerSer ThrThr ArgArg ValVal ArgArg ThrThr ArgArg LysLys ValVal ThrThr ArgArg MetMet AlaAla ValVal AlaAla IleIle CysCys ThrThr AlaAla PhePhe PhePhe IleIle CysCys TrpTrp AlaAla ProPro TyrTyr TyrTyr IleIle ThrThr GlnGln ThrThr IleIle HisHis ThrThr GlyGly ValVal GlnGln LysLys ProPro ThrThr ThrThr AlaAla PhePhe SerSer TyrTyr AlaAla TyrTyr AsnAsn MetMet AlaAla IleIle SerSer MetMet GlyGly TyrTyr AlaAla AsnAsn SerSer CysCys IleIle AsnAsn ProPro PhePhe ThrThr TyrTyr IleIle IleIle ThrThr SerSer GluGlu ThrThr PhePhe LysLys ArgArg GlnGln PhePhe ThrThr ArgArg AlaAla ValVal ArgArg ProPro ValVal AsnAsn ArgArg LysLys PhePhe ArgArg ValVal AsnAsn ProPro SerSer ThrThr ThrThr AspAsp GlyGly GlyGly SerSer ValVal SerSer MetMet ArgArg MetMet ValVal ProPro GluGlu GlyGly AlaAla ArgArg GlnGln GluGlu ProPro AlaAla ProPro ArgArg GluGlu MetMet MetMet ProPro SerSer AsnAsn ValVal AlaAla ProPro GlnGln TrpTrp 1717 3434 5151 6868 8585 102102 119119 136136 153153 170170 187187 204204 221221 238238 255255 272272 289289 306306 323323 340340 357357 360360

[서열 번호 3] [SEQ ID NO 3] floflo underunder MCHR2MCHR2 genegene

atgggcgacaatgggcgaca cgggcacattcgggcacatt ctgcaaccaactgcaaccaa acagccaaccacagccaacc tgacagaccctgacagaccc ggcgtgtctgggcgtgtctg aactcaacccaactcaaccc gcccgtcgtagcccgtcgta cagccacatacagccacata gacatcaccagacatcacca cgttcatgcacgttcatgca catattcccccatattcccc accatctacgaccatctacg gcatcctgtggcatcctgtg ctcggttggactcggttgga gttattgccagttattgcca acggactggtacggactggt catctacgcgcatctacgcg gtggcggcatgtggcggcat gcaaaaagaagcaaaaagaa aatggtctccaatggtctcc gacatctacggacatctacg tgctgaactttgctgaactt ggccatagcgggccatagcg gacatgctctgacatgctct tcctgctggttcctgctggt gatgcccttcgatgcccttc aacatccaccaacatccacc agctggtcagagctggtcag agacagacagagacagacag tgggtgttcgtgggtgttcg ggaactttatggaactttat gtgcaaagcggtgcaaagcg gtggtggtgggtggtggtgg acgtgagcaaacgtgagcaa ccagttcaccccagttcacc acagtagggaacagtaggga ttgttactgtttgttactgt gctgtgcattgctgtgcatt gaccggtacagaccggtaca tagccatagttagccatagt ccaccccaccccaccccacc tcggagaaaatcggagaaaa ggaccatccaggaccatcca ctggaccatcctggaccatc atgatcaacaatgatcaaca tactagtgtgtactagtgtg gttgggcagcgttgggcagc ttcctcctcattcctcctca ccgtccctgtccgtccctgt catgatgtaccatgatgtac gccaaggttggccaaggttg agcgcaggcaagcgcaggca gcgtttggaggcgtttggag gtctgcatgagtctgcatga tgaacctggatgaacctgga tgggcctgagtgggcctgag gacatgtactgacatgtact ggtacactttggtacacttt ctaccagtccctaccagtcc atccttggctatccttggct acatcatcccacatcatccc cttcatcatccttcatcatc atcagcacctatcagcacct tttactcgcttttactcgct caccctctaccaccctctac cacgtcttcacacgtcttca gctccatccggctccatccg ccgggtaaaaccgggtaaaa cgcaagcagtcgcaagcagt ccgtctgggcccgtctgggc taaaagagcctaaaagagcc accaagatggaccaagatgg tgctgatggttgctgatggt catcgcattgcatcgcattg ttcctgatctttcctgatct gctggtcaccgctggtcacc ctaccacgtcctaccacgtc atccaggtgaatccaggtga tcaacctgagtcaacctgag caacaacacgcaacaacacg ccgaccatcaccgaccatca ccttcgtctaccttcgtcta tgcctaccactgcctaccac atcagcatctatcagcatct gtctcagctagtctcagcta ctctcacagcctctcacagc tgcatcaacctgcatcaacc cactcatgctcactcatgct gctcatcttcgctcatcttc gcccagaactgcccagaact atcgcgaccgatcgcgaccg cctttgccgccctttgccgc agaaatatgcagaaatatgc tcaacagttctcaacagttc ccagcattcaccagcattca tccaagctcatccaagctca cagtcgtcaacagtcgtcaa aacagatggtaacagatggt tccagtataatccagtataa ccaataacccccaataaccc caactaccgccaactaccgc tgtactgtcgtgtactgtcg tata 6060 120120 180180 240240 300300 360360 420420 480480 540540 600600 660660 720720 780780 840840 900900 960960 10201020 10321032

[서열 번호 4] [SEQ ID NO 4] floflo underunder MCHR2MCHR2 aminoamino acidacid

MetMet GlyGly AspAsp ThrThr GlyGly ThrThr PhePhe CysCys AsnAsn GlnGln ThrThr AlaAla AsnAsn ThrThr ThrThr AspAsp ProPro AlaAla CysCys ThrThr AsnAsn SerSer ThrThr ArgArg ProPro SerSer TyrTyr SerSer HisHis MetMet AspAsp IleIle ThrThr ThrThr PhePhe MetMet HisHis MetMet PhePhe ProPro ThrThr IleIle TyrTyr GlyGly IleIle ThrThr CysCys SerSer ValVal GlyGly ValVal IleIle AlaAla AsnAsn GlyGly ThrThr ValVal IleIle TyrTyr AlaAla ValVal AlaAla AlaAla CysCys LysLys LysLys LysLys MetMet ValVal SerSer AspAsp IleIle TyrTyr ValVal ThrThr AsnAsn LeuLeu AlaAla MetMet AlaAla AspAsp MetMet ThrThr PhePhe ThrThr ThrThr ValVal MetMet ProPro PhePhe AsnAsn IleIle HisHis GlnGln ThrThr ValVal ArgArg AspAsp ArgArg GlnGln TrpTrp ValVal PhePhe GlyGly AsnAsn PhePhe MetMet CysCys LysLys AlaAla ValVal ValVal ValVal AspAsp ValVal SerSer AsnAsn GlnGln PhePhe ThrThr ThrThr ValVal GlyGly IleIle ValVal ThrThr ValVal ThrThr CysCys IleIle AspAsp ArgArg TyrTyr MetMet AlaAla MetMet ValVal HisHis ProPro ThrThr SerSer GluGlu LysLys ArgArg ThrThr IleIle HisHis TrpTrp ThrThr IleIle MetMet IleIle AsnAsn MetMet ThrThr ValVal TrpTrp LeuLeu GlyGly SerSer PhePhe ThrThr ThrThr ThrThr ValVal ProPro ValVal MetMet MetMet TyrTyr AlaAla LysLys ValVal GluGlu ArgArg ArgArg GlnGln ArgArg LeuLeu GluGlu ValVal CysCys MetMet MetMet AsnAsn ThrThr AspAsp GlyGly ProPro GluGlu AspAsp MetMet TyrTyr TrpTrp TyrTyr ThrThr PhePhe TyrTyr GlnGln SerSer IleIle ThrThr GlyGly TyrTyr IleIle IleIle ProPro PhePhe IleIle IleIle IleIle SerSer ThrThr PhePhe TyrTyr SerSer ThrThr ThrThr ThrThr TyrTyr HisHis ValVal PhePhe SerSer SerSer IleIle ArgArg ArgArg ValVal LysLys ArgArg LysLys GlnGln SerSer ValVal TrpTrp AlaAla LysLys ArgArg AlaAla ThrThr LysLys MetMet ValVal ThrThr MetMet ValVal IleIle AlaAla LeuLeu PhePhe ThrThr IleIle CysCys TrpTrp SerSer ProPro TyrTyr HisHis ValVal IleIle GlnGln ValVal IleIle AsnAsn ThrThr SerSer AsnAsn AsnAsn ThrThr ProPro ThrThr IleIle ThrThr PhePhe ValVal TyrTyr AlaAla TyrTyr HisHis IleIle SerSer IleIle CysCys ThrThr SerSer TyrTyr SerSer HisHis SerSer CysCys IleIle AsnAsn ProPro ThrThr MetMet ThrThr ThrThr IleIle PhePhe AlaAla GlnGln AsnAsn TyrTyr ArgArg AspAsp ArgArg ThrThr CysCys ArgArg ArgArg AsnAsn MetMet ThrThr AsnAsn SerSer SerSer GlnGln HisHis SerSer SerSer LysLys ThrThr ThrThr ValVal ValVal LysLys ThrThr AspAsp GlyGly SerSer SerSer MetMet ThrThr AsnAsn AsnAsn ProPro AsnAsn TyrTyr ArgArg CysCys ThrThr ValVal ValVal 1717 3434 5151 6868 8585 102102 119119 136136 153153 170170 187187 204204 221221 238238 255255 272272 289289 306306 323323 340340 344344

[실시예 2] 두 종류의 발현벡터의 세포주 일시감염과 형광 영상 프레이트 인식 장치(FLIPR)를 이용한 효과농도 (ECExample 2 Effect Concentration Using Cell Line Temporary Infection of Two Expression Vectors and Fluorescent Image Recognition Device (FLIPR) (EC 5050 )의 측정) Measurement

[실시예 1]에서 준비된 멜라닌 농축 호르몬 유전자의 프로모터 영역을 포함한 재조 합 DNA를 인간 배아 신장 세포주 (HEK cell)에 일시감염 시키기 위하여 감염용 시약으로 리포펙타민 (LipofectamineTM Reagent, Invitrogen, USA)을 사용하였다. Lipofectamine (Lipofectamine ™ Reagent, Invitrogen, USA) was used as an infectious agent to temporarily infect the recombinant DNA including the promoter region of the melanin enriched hormone gene prepared in Example 1 to human embryonic kidney cell lines (HEK cells). Used.

세포주의 일시감염을 시키기 위해 먼저 각 세포주를 24 웰 프레이트에 세포개수를 맞추었다. 인간 배아 신장 세포주는 하나의 웰 당 1.2× 105 세포 수로 맞추어 배양을 하였다. 배양조건은 37℃, 5% CO2를 유지하며 24 시간을 배양하였으며 각각 배양된 세포에 각각의 재조합 DNA를 24 웰 프레이트에 배양된 세포주에 일시감염을 실시하였다.To transiently infect cell lines, each cell line was first counted in 24 well plates. Human embryonic kidney cell lines were cultured at 1.2 × 10 5 cells per well. Culture conditions were maintained for 24 hours while maintaining 37 ℃, 5% CO 2 and each recombinant cell was transiently infected with cell lines cultured in 24 well plate of each recombinant DNA.

일시감염은 각 웰 당 OPTI-MEM I (Reduced Serum Medium Modification of MEM (Eagle's), GIBCO, USA) 배지 52 ㎕ 에 [실시예 1]에서 클로닝 된 재조합 DNA pGL2M-1487, pGL2M-865, pGL2M-500, pGL2M-115, pGL2M-95를 각각 1㎍, LipofectaminTM Reagent 1.26 ㎕ 를 혼합하여 45 분간 상온에서 반응시켰다.Transfection was performed on recombinant DNA pGL2M-1487, pGL2M-865, pGL2M-500 cloned in [Example 1] in 52 μl of OPTI-MEM I (Eagle's, GIBCO, USA) medium per well. , 1 g of pGL2M-115 and pGL2M-95, 1.26 μl of Lipofectamin ™ Reagent, respectively, were mixed and reacted at room temperature for 45 minutes.

인간 배아 신장 세포주에 일시감염을 위하여 24 웰의 배양액을 제거하고 각 웰에 혈청(FBS)이 없는 배양액 (DMEM, 1% Penicillin/Streptomycin, 0.8% G 418 sulfate) 236 ㎕을 첨가하고 앞에서 상온에서 45 분간 반응시킨 반응액에 OPTI-MEM I 184㎕를 첨가하여 이를 다시 각 웰에 첨가한다. 24 웰 프레이트를 37℃, 5% CO2 배양기에서 5 시간동안 배양한다. 5시간 배양 후 각 웰에 배양배지의 2배의 혈청이 포함된 배지(DMEM, 20% FBS, 1% Penicillin/Streptomycin, 0.8% G 418 sulfate) 472 ㎕를 첨가하여 48 시간동안 37℃, 5% 이산화탄소 배양기에서 배양 하였다.Remove 24 wells of culture for temporary infection in human embryonic kidney cell lines, add 236 μl of serum-free (FBS) (DMEM, 1% Penicillin / Streptomycin, 0.8% G 418 sulfate) to each well, and at 45 ° C at room temperature 184 [mu] l of OPTI-MEM I was added to the reaction solution which was reacted for a minute and added to each well again. 24 well plates are incubated at 37 ° C., 5% CO 2 incubator for 5 hours. After 5 hours of incubation, 472 μl of medium containing twice the serum of the culture medium (DMEM, 20% FBS, 1% Penicillin / Streptomycin, 0.8% G 418 sulfate) was added to each well for 37 hours, and 5% for 48 hours. Cultured in a carbon dioxide incubator.

배양된 각 세포주를 96 웰 프레이트에 인간 배아 신장세포(HEK cell)의 경우 웰당 90,000 개의 세포가 되도록 하여 100㎕ 씩 웰에 분주한다. 24시간 배양한 후 배양액을 완전히 제거한다. 배양액을 완전히 제거한 후, 50㎕의 완충용액 B를 첨가하고, 37℃에서 1시간 배양한다. 측정에 이용하는 넙치 멜라닌 농축호르몬은 10㎎/㎖의 싸이토크롬씨(cytochrome C) 용액 200㎕가 첨가된 각각의 20㎖의 완충용액 A에 2uM 0.02 nM까지의 농도로 희석되게 첨가하여, 인간 배아 신장세포(HEK cell)가 배양된 웰 프레이트의 웰에 농도별로 각각 웰 당 110 ㎕ 씩 분주하여 형광 영상 프레이트 인식 장치에서 분석한다. 효과농도(EC50)를 계산하기 위해서 형광영상 프레이트 인식장치에서 얻어진 결과를 프리즘(PRISM 4.0)(Graphpad, USA)를 이용하여 계산하였다. Each cultured cell line is inoculated into the well of 100 μl in a 96 well plate in the case of human embryonic kidney cells (HEK cells) to be 90,000 cells per well. After 24 hours of incubation, the culture solution is completely removed. After complete removal of the culture, 50 μl of buffer B is added and incubated at 37 ° C. for 1 hour. Flounder melanin-concentrated hormone used for the measurement is added to each 20 ml of buffer A to which 200 µl of 10 mg / ml cytochrome C solution is added, diluted to a concentration of up to 2 uM 0.02 nM, and human embryos. In the wells of the well plate in which the kidney cells (HEK cells) were cultured, 110 μl per well was dispensed for each well and analyzed by a fluorescence imaging plate recognition device. In order to calculate the effect concentration (EC 50 ), the result obtained by the fluorescence image plate recognition apparatus was calculated using a prism (PRISM 4.0) (Graphpad, USA).

상기 사용되는 완충용액의 조성은 다음과 같으며, 이를 자세히 설명하면,The composition of the buffer solution used is as follows.

먼저, 완충용액 A (FLIPR 완충용액)는 20㎖의 10X Hank’s BSS, 4㎖의 HEPES(pH 7.4), 142㎎의 Probenocid 를 1N NaOH 1㎖ 에 녹인 후, 증류수를 첨가하여 200㎖이 되게 하고 pH 7.4로 맞춘다.First, buffer A (FLIPR buffer) was dissolved in 20 ml of 10X Hank's BSS, 4 ml of HEPES (pH 7.4), and 142 mg of Probenocid in 1 ml of 1N NaOH, and then distilled water was added to 200 ml. Set to 7.4.

완충용액 B는 상기 완충용액 A 5.5 ㎖에, Pluronic acid 5.5 ㎕, Fluo-4 5.5 ㎕, FBS 55 ㎕를 첨가하여 완충용액 B가 만들어지게 된다.Buffer B is prepared by adding 5.5 μl of Pluronic acid, 5.5 μl of Fluo-4, and 55 μl of FBS to 5.5 mL of Buffer A.

이상에서와 같이 본 발명은 비록 상기의 실시예에 한하여 설명하였지만 반드시 여기에만 한정되는 것은 아니며 본 발명의 범주와 사상을 벗어나지 않는 범위 내에서 다양한 변형실시가 가능함은 물론이다.   As described above, although the present invention has been described with reference to the above embodiments, it is not necessarily limited thereto, and various modifications may be made without departing from the scope and spirit of the present invention.

상기에서 살펴본 바와 같이, 본 발명에서는 양식넙치의 뇌에서 분리된 멜라닌 농축 호르몬 수용체 1 및 2의 유전자를 포유동물 세포주에 형질전환 할 수 있는 발현벡터에 재조합하여 발현을 유도하였으며, 인간 배아 신장세포에 일시적인 감염을 통해 넙치 멜라닌 농축호르몬과 결합하는 효과능을 확인하였다. 멜라닌 농축 호르몬 수용체 1 유전자는 멜라닌 농축 호르몬과 더불어 생물종의 에너지 항상성에 관여하게 되는데 이는 비만과 연관하여 이용 가능할 것이고, 멜라닌 농축 호르몬 수용체 2 유전자는 아직 그 기능이 밝혀져 있지 않으므로 해당 유전자의 기능을 규명하는데 이용할 수 있을 것이다.As described above, in the present invention, the genes of melanin enriched hormone receptors 1 and 2 isolated from the brains of cultured flounder were recombined into expression vectors capable of transforming mammalian cell lines to induce expression in human embryonic kidney cells. Transient infection was confirmed by the effect of binding to the flounder melanin enriched hormone. Melanin enriched hormone receptor 1 gene, along with melanin enriched hormone, is involved in the energy homeostasis of the species, which will be available in association with obesity, and melanin enriched hormone receptor 2 gene is not yet known, so its function is identified. Will be available.

서열목록 전자파일 첨부 Attach sequence list electronic file  

Claims (3)

서열 1의 염기서열이 포함된 멜라닌 농축 호르몬 수용체 1(fMCHR1) 유전자 가 pcDNA3.1(-)Hygro에 DNA합성효소(ligase)로 재조합하여 발현 가능한 특징을 가진 발현벡터Expression vector with melanin-enriched hormone receptor 1 (fMCHR1) gene containing the nucleotide sequence of SEQ ID NO: 1 recombined with DNA synthase (ligase) in pcDNA3.1 (-) Hygro 서열 3의 염기서열이 포함된 멜라닌 농축 호르몬 수용체 2(fMCHR2) 유전자 가 pcDNA3.1(-)Hygro에 DNA합성효소(ligase)로 재조합하여 발현 가능한 특징을 가진 발현벡터Expression vector with melanin enriched hormone receptor 2 (fMCHR2) gene containing the nucleotide sequence of SEQ ID NO: 3 recombined with DNA synthase (ligase) in pcDNA3.1 (-) Hygro 제 1항 또는 제 2항의 발현벡터는 넙치 멜라닌 농축호르몬 수용체의 특징을 가진 발현벡터The expression vector of claim 1 or 2 is characterized by the expression vector of the flounder melanin enriched hormone receptor
KR1020060127595A 2006-12-14 2006-12-14 Cloning of the Melanin-concentrating hormone receptor from Olive flounder Paralichthys olivaceus KR100820095B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020060127595A KR100820095B1 (en) 2006-12-14 2006-12-14 Cloning of the Melanin-concentrating hormone receptor from Olive flounder Paralichthys olivaceus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020060127595A KR100820095B1 (en) 2006-12-14 2006-12-14 Cloning of the Melanin-concentrating hormone receptor from Olive flounder Paralichthys olivaceus

Publications (1)

Publication Number Publication Date
KR100820095B1 true KR100820095B1 (en) 2008-04-07

Family

ID=39534027

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020060127595A KR100820095B1 (en) 2006-12-14 2006-12-14 Cloning of the Melanin-concentrating hormone receptor from Olive flounder Paralichthys olivaceus

Country Status (1)

Country Link
KR (1) KR100820095B1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6593108B1 (en) 1999-11-16 2003-07-15 Merck & Co., Inc. Nucleic acid molecule encoding a melanin-concentrating hormone receptor 2 polypeptide
US6723552B2 (en) 1998-12-31 2004-04-20 Synaptic Pharmaceutical Corporation DNA encoding a human melanin concentrating hormone receptor (MCH1) and uses thereof
US20040132045A1 (en) 2001-05-31 2004-07-08 Carina Tan Rhesus monkey, dog and ferret melanin-concentrating hormone type 2 receptor
JP2005229804A (en) 2000-03-24 2005-09-02 Astellas Pharma Inc New melanin concentrating hormone receptor

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6723552B2 (en) 1998-12-31 2004-04-20 Synaptic Pharmaceutical Corporation DNA encoding a human melanin concentrating hormone receptor (MCH1) and uses thereof
US6593108B1 (en) 1999-11-16 2003-07-15 Merck & Co., Inc. Nucleic acid molecule encoding a melanin-concentrating hormone receptor 2 polypeptide
JP2005229804A (en) 2000-03-24 2005-09-02 Astellas Pharma Inc New melanin concentrating hormone receptor
US20040132045A1 (en) 2001-05-31 2004-07-08 Carina Tan Rhesus monkey, dog and ferret melanin-concentrating hormone type 2 receptor

Similar Documents

Publication Publication Date Title
DK2875043T3 (en) glucagon
Qian et al. Cloning and characterization of teneurin C-terminus associated peptide (TCAP)-3 from the hypothalamus of an adult rainbow trout (Oncorhynchus mykiss)
CN1191491A (en) Connective tissue growth factor
CN103298938B (en) Oxidative stress indicator is expressed with nucleic acid construct thing and application thereof
Kim et al. Molecular characterization of neuropeptide elevenin and two elevenin receptors, IsElevR1 and IsElevR2, from the blacklegged tick, Ixodes scapularis
Teichert et al. A uniquely selective inhibitor of the mammalian fetal neuromuscular nicotinic acetylcholine receptor
Wang et al. Venom resistance mechanisms in centipede show tissue specificity
Ma et al. The co-existence of two growth hormone receptors and their differential expression profiles between female and male tongue sole (Cynoglossus semilaevis)
Nachman et al. A C-terminal aldehyde insect kinin analog enhances inhibition of weight gain and induces significant mortality in Helicoverpa zea larvae
Hausken et al. Cloning and characterization of a second lamprey pituitary glycoprotein hormone, thyrostimulin (GpA2/GpB5)
Seon et al. Isolation, structure, synthesis, and activity of a new member of the calcitonin gene-related peptide family from frog skin and molecular cloning of its precursor
KR100820095B1 (en) Cloning of the Melanin-concentrating hormone receptor from Olive flounder Paralichthys olivaceus
Ito et al. Molecular cloning of bullfrog corticotropin-releasing factor (CRF): effect of homologous CRF on the release of TSH from pituitary cells in vitro
Katafuchi et al. Identification of second and third calcitonin receptor-stimulating peptides in porcine brain
Luo et al. Efficient oxidative folding and site‐specific labeling of human hepcidin to study its interaction with receptor ferroportin
CN104193826B (en) A kind of fused polypeptide and its application in antineoplastic is prepared
JPH03502880A (en) Methods for producing numerous peptide analogs and novel peptide analogs
Liu et al. Targeted top-down mass spectrometry for the characterization and tissue-specific functional discovery of crustacean hyperglycemic hormones (CHH) and CHH precursor-related peptides in response to low pH stress
Mori et al. Urotensin II-related peptide, the endogenous ligand for the urotensin II receptor in the rat brain
WO2006022343A1 (en) Gonadotropic hormone originating in invertebrate and method of producing the same
Wolf et al. The ring size of monocyclic ET‐1 controls selectivity and signaling efficiency at both endothelin receptor subtypes
JP3579711B2 (en) Cancer cell growth inhibitor
CN107840875B (en) Plutella xylostella cotesia ruber neuropeptide Cv-sNPF and receptor thereof and application of plutella xylostella cotesia ruber neuropeptide Cv-sNPF in increasing trehalose content in plutella xylostella
CN114096556A (en) Epidermal Growth Factor Receptor (EGFR) ligands
KR20160049874A (en) Composition or method for preventing or treating hair loss, and screening method for a material preventing, treating, or alleviating of hair loss

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20120229

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20130312

Year of fee payment: 6

LAPS Lapse due to unpaid annual fee