KR100777082B1 - A cosmetic composition comprising antisense oligonucletide for inhibiting secretion of sebum - Google Patents

Abstract

The present invention relates to a cosmetic composition for inhibiting sebum secretion containing oligonucleotide, and more particularly to a cosmetic composition for inhibiting sebum secretion containing antisense oligonucleotide for 5-alpha reductase or androgen receptor. .

The cosmetic composition comprising an antisense oligonucleotide of the present invention has the advantage of inhibiting sebum secretion and improving acne by inhibiting the expression of mRNA of 5-alpha reductase or mRNA gene of androgen receptor.

Antisense oligomer, sebum secretion, 5-alpha reductase, androgen receptor, acne.

Description

Cosmetic composition for sebum secretion containing oligonucleotide {A COSMETIC COMPOSITION COMPRISING ANTISENSE OLIGONUCLETIDE FOR INHIBITING SECRETION OF SEBUM}

[Industrial use]

The present invention relates to a cosmetic composition for inhibiting sebum secretion comprising an oligonucleotide, and more particularly to inhibit sebum secretion and improve acne by inhibiting expression of mRNA of 5-alpha reductase or mRNA gene of androgen receptor. It relates to a cosmetic composition.

[Private Technology]

Acne is an acronym for vulgar acne, which refers to the inflammation of many hair follicles on the face of men and women, especially on the cheeks and forehead. Some may develop on the chest or back, and some may develop at age 40. The initial symptoms of acne are the formation of yellowish white lumps due to the filling of the cortex and keratin to the hair follicles, sometimes with blackened peaks. When you squeeze the cheese-like secretion will come out. Subsequently, inflammation develops around this and rises red. When a bacterium is infected, it becomes purplish and yellow, and after it is better, a crater-like trace remains.

Acne is often caused by bacterial infections in sebum that is secreted excessively by the action of innate hormones, especially male hormones. Women 22 years and older often worsen just before menstruation. The cause of acne has not yet been precisely identified, but in general, sebum secretion, skin keratinization and lipid peroxidation are known to be closely related to androgen, a male hormone.

For the treatment of acne, wash the soap in the morning and evening, the cosmetics use a lotion lotion, varnishing cream, do not use twin cakes or cold cream. If you have a forehead, do not hang the bangs, and if you have gastrointestinal disorders or constipation, the basic treatment for it. Also avoid mental stress and eat beef, fish and vegetables.

In addition, antimicrobial agents have been added or raw materials for promoting exfoliation have been used. As a raw material for promoting exfoliation, acidic raw materials such as AHA and retinoid (vitamin A) have been used, but only a very limited amount is used because the effect is insignificant or excessive skin irritation occurs. As an antimicrobial agent, antibiotics such as tetracycline are used. However, these antimicrobial substances are known to have a high possibility of causing side effects such as the appearance of bacteria resistance or photosensitization. You can also use these antimicrobials to delay acne deterioration, but you can't expect to prevent or cure the underlying acne.

In addition, as an external medicine used for the treatment of acne has been used cummerfeld solution for a long time, in addition to sulfa antibiotics, vitamins A, B2, B6, etc. and hormones are used. However, these preparations have side effects such as skin rash, dry skin, and allergies may occur depending on the individual. Salicylic acid, in particular, is low in effect, and may worsen acne due to side effects such as skin rash. Hormonal agents have the disadvantage of increasing capillaries and widening pores.

The present invention is to solve the above problems, it is an object of the present invention to provide a cosmetic composition for inhibiting sebum secretion comprising an antisense oligonucleotide.

In order to achieve the above object, the present invention provides a cosmetic composition for inhibiting sebum secretion comprising an oligonucleotide.

The present invention also provides a cosmetic composition for improving acne containing antisense oligonucleotides for 5-alpha reductase or androgen receptor.

Hereinafter, the present invention will be described in more detail.

Regardless of the substance that shows the action of androgenic hormones, all are called androgens (androgens), a steroid having 19 carbon atoms, and is a derivative of androstane. Male hormone increases its secretion from puberty and promotes and maintains the expression of secondary sexuality in men. These male hormones include testosterone, androstenedin, dihydroepiandrosterone and the like.

Testosterone, one of the male hormones, is converted to the active male hormone dihydrotestosterone (DHT) by 5-alpha reductase, and an abnormal excess of this hormone produces a major causative agent that causes sebum cells to produce excessive sebum. to provide.

Thus, when excess sebum is stagnated in the hair follicles, such as clogging of the dorsum of the discharge tube from which sebum is secreted due to the excessive production of sebum, scleroderma is generated. When they are not discharged to the outside, and accumulated in the hair follicles, the sebum is prevented from entering the outside air, the interior of the hair follicles propionibacterium acnes (propionibacterium acnes) is an environment that can be proliferated smoothly. Propionibacterium acnes secrete lipolytic enzymes and chemical factors to produce free fatty acids, trigger the immune response of leukocytes, and destroy the hair follicle wall, causing the contents to drain into the dermis, resulting in inflammatory reactions. .

Therefore, by inhibiting the overproduction of dihydrotestosterone by inhibiting the activity or expression of androgen receptor or 5-alpha reductase can prevent and treat the above diseases fundamentally and effectively.

As a method for inhibiting the activity or expression of such proteins, antisense oligomers that bind to mRNA and inhibit protein synthesis may be used. Antisense oligomers are analogs of DNA or RNA and have a sequence complementary to some sequences of mRNA, which selectively bind to the mRNA of the gene and interfere with protein synthesis. Since the mRNA sequence contains protein synthesis information, it can be considered as a sense sequence, and thus, a complementary sequence that binds to the sense sequence is called an antisense or complementary sequence.

In the present invention, antisense oligomer nucleotides for inhibiting the expression of 5-alpha reductase or androgen receptor, which are causes of sebum secretion, were prepared as described above.

The antisense oligonucleotide is an oligonucleotide including a nucleotide sequence complementary to mRNA, the length thereof may be 15 to 25 bp, but is not limited thereto. If the length of the antisense oligonucleotide is less than 15bp may not effectively inhibit mRNA translation, if it exceeds 25bp may be difficult to penetrate the cell.

In one embodiment, the antisense oligonucleotide for mRNA of the 5-alpha reductase gene is GeneBank accession no. It may be 15 to 25 bp nucleotides complementary to the mRNA for the sequence described in M32313, preferably may be selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs: 1-9. The antisense oligonucleotide for mRNA of the androgen receptor gene may be 15-25 bp of nucleotides complementary to the mRNA for the sequence described in GeneBank accession no M34233, preferably the group consisting of the nucleotide sequences set forth in SEQ ID NOs: 10-18 It may be selected from.

The antisense oligonucleotides of the present invention may be chemically synthesized, or may be synthesized in phosphorothioate form to further enhance stability in vivo.

Sebum secretion inhibition or acne improvement cosmetic composition according to the present invention is an antisense oligonucleotide selected from the group consisting of antisense oligonucleotides for mRNA of the 5-alpha reductase gene and antisense oligonucleotides for mRNA of the androgen receptor gene as an active ingredient Nucleotide may be included as an active ingredient.

The content of the active ingredient is preferably contained by 0.00001 to 10% by weight based on the total cosmetic composition in dry weight. If the amount is less than 0.00001%, the sebum inhibiting effect is hardly exhibited. If the amount exceeds 10% by weight, the effect on the amount of use may be insignificant. Preferably the content of the active ingredient may be 0.001 to 1.0% by weight.

The cosmetic composition, in addition to the active ingredient, may include all kinds of ingredients usable in ordinary cosmetics, such as excipients, diluents and the like. Commonly usable components include oils, purified water, surfactants, moisturizers, lower alcohols, thickeners, chelating agents, pigments, preservatives, sunscreens, antioxidants, dyes, fragrances and the like.

In addition, the cosmetic composition is used for the skin, it may be provided for the use of basic cosmetics, makeup cosmetics, body cosmetics, hair cosmetics, scalp cosmetics, shaving cosmetics or oral cosmetics. Examples of the basic cosmetics include creams, lotions, packs, massage creams, emulsions, etc. Examples of the makeup cosmetics include creams, lotions, packs, massage creams, latexes, and the like. Lipstick, eye shadow, eyeliner, mascara, eyebrow pencil, etc. Body cosmetics include soap, liquid cleanser, bath, sunscreen cream and sun oil, and hair cosmetics include shampoo, conditioner and hair treatment. Hair care, hair mousse, hair liquid, pomade, hair color, hair bleach, and color rinse. Hair tonic and scalp treatments are available for shaving, and aftershave and shaving cream are for shaving. There are, oral cosmetics include toothpaste, mouse washer and the like. The preparation of such products may include various conventional carriers and additives suitable for each of these formulations and well known in the art.

Hereinafter, preferred embodiments of the present invention are described. However, the following examples are only preferred embodiments of the present invention, and the present invention is not limited to the following examples.

Example  1 to 18: Antisense Of oligonucleotides  Production-1

A total of 18 oligonucleotides of SEQ ID NOS: 1 to 18 were synthesized by Bioneer Co., Ltd., respectively, and synthesized with phosphorothioate DNA to increase stability in vivo. Each oligonucleotide prepared was as Examples 1-18. SEQ ID NOs: 1 to 9 are antisense oligonucleotides for mRNA of the 5-alpha reductase gene, and SEQ ID NOs: 10 to 18 are antisense oligonucleotides for mRNA of the androgen receptor gene.

SEQ ID NO: acactgcacaatggctcaag

SEQ ID NO: 2 actcgctggcgtactggtag

SEQ ID NO: 3 gccattgtacatgccaacag

SEQ ID NO: 4 ccaacagtggcataggcttt

SEQ ID NO: 5 ggggatctgttacccagtca

SEQ ID NO: 6 gcctccccttggtattttgt

SEQ ID NO: tttccggaggtaccactcat

SEQ ID NO: 8 atagagaagcgccattggaa

SEQ ID NO: 9 gggggctatagaagggattg

SEQ ID NO: 10: ctggggctagtctcttgctg

SEQ ID NO: 11: ttctggaaagctcctcggta

SEQ ID NO: 12: ggacgctctggaacagattc

SEQ ID NO: 13: ctgcagcagcagcaaactg

SEQ ID NO: 14: gcagctgagtcatcctcgtc

SEQ ID NO: 15: ctttaaggtcagcggagcag

SEQ ID NO: 16: gacaccgacactgccttaca

SEQ ID NO: 17: cgctgtcgtctagcagagaa

SEQ ID NO: 18: cctcccttgaaaggggaata

Production Example  1: Preparation of skin external ointment prescription

Skin ointment formulations containing antisense oligonucleotides were prepared as shown in Table 1 below.

Composition weight% Example 1 0.05 Example 10 0.05 Diethyl sebacate 8 Prepayment 5 Polyoxyethylene Oleyl Ether Phosphate 6 Sodium benzoate Quantity vaseline To 100

Production Example  2: Preparation of Cream

Cream comprising an antisense oligonucleotide was prepared in a composition ratio as shown in Table 2.

Composition weight% Example 2 0.2 Example 13 0.2 Stearic acid 1.0 Cetanol 2.0 Fiji-20 sorbitan monostearate 1.0 Sorbitan monostearate 1.0 Mineral oil 10.0 Trioctanoate 5.0 Triethanolamine 0.5 Carbomer 0.2 glycerin 5.0 Propylene glycol 3.0 antiseptic Quantity incense Quantity Purified water To 100

Production Example  3: manufacture of flexible cosmetic water

Softening water containing an antisense oligonucleotide was prepared in a composition ratio as shown in Table 3.

Composition weight% Example 5 0.1 Example 15 0.1 ethanol 10.0 Polyoxyethylene Cured Castor Oil 1.0 Paraoxybenzoic Acid Methyl 0.2 glycerin 5.0 1,3-butylene glycol 6.0 incense Quantity Pigment Quantity Purified water To 100

Production Example  4 : Essence  Produce

An essence comprising an antisense oligonucleotide was prepared in a composition ratio as shown in Table 4 below.

Composition weight% Example 1 0.5 Example 11 0.5 Propylene glycol 10.0 glycerin 10.0 Sodium hyaluronate aqueous solution (1%) 5.0 ethanol 5.0 Polyoxyethylene Cured Castor Oil 1.0 Paraoxybenzoic Acid Methyl 0.1 Carbomer 0.3 Triethanolamine 0.4 incense Quantity Purified water To 100

Production Example  5: manufacture of the pack

A pack containing an antisense oligonucleotide was prepared in a composition ratio as shown in Table 5 below.

Composition weight% Example 6 0.01 Example 16 0.01 glycerin 5.0 Propylene glycol 4.0 Polyvinyl alcohol 15.0 ethanol 8.0 Polyoxyethylene Cured Castor Oil 1.0 Polyoxyethylene Oleethyl 1.0 Paraoxybenzoic Acid Methyl 0.2 incense Quantity Pigment Quantity Purified water To 100

Production Example  6: Preparation of Nutrients

Nutrients containing antisense oligonucleotides were prepared in a composition ratio as shown in Table 6 below.

Composition weight% Example 7 0.05 Example 10 0.05 Polyoxyethylene Cured Castor Oil 1.0 Paraoxybenzoic Acid Methyl Quantity glycerin 6.0 1,3-butylene glycol 5.0 Carbomer 0.2 Triethanolamine 0.3 Propylene glycol 5.0 ethanol 3.2 Carboxy Vinyl Polymer 0.1 Pigment Quantity incense Quantity Purified water To 100

Comparative example  1 to 6

To the composition (unit: wt%) of Tables 7 to 12, skin external ointments, creams, soft cosmetics, essences, packs, and nutrient cosmetics were prepared, respectively.

Composition weight% Diethyl sebacate 8 Prepayment 5 Polyoxyethylene Oleyl Ether Phosphate 6 Sodium benzoate Quantity vaseline To 100

Composition weight% Stearic acid 1.0 Cetanol 2.0 Fiji-20 sorbitan monostearate 1.0 Sorbitan monostearate 1.0 Mineral oil 10.0 Trioctanoate 5.0 Triethanolamine 0.5 Carbomer 0.2 glycerin 5.0 Propylene glycol 3.0 antiseptic Quantity incense Quantity Purified water To 100

Composition weight% ethanol 10.0 Polyoxyethylene Cured Castor Oil 1.0 Paraoxybenzoic Acid Methyl 0.2 glycerin 5.0 1,3-butylene glycol 6.0 incense Quantity Pigment Quantity Purified water To 100

Composition weight% Propylene glycol 10.0 glycerin 10.0 Sodium hyaluronate aqueous solution (1%) 15.0 ethanol 5.0 Polyoxyethylene Cured Castor Oil 1.0 Paraoxybenzoic Acid Methyl 0.1 Carbomer 0.3 Triethanolamine 0.4 incense Quantity Purified water To 100

Composition weight% glycerin 5.0 Propylene glycol 4.0 Polyvinyl alcohol 15.0 ethanol 8.0 Polyoxyethylene Cured Castor Oil 1.0 Polyoxyethylene Oleethyl 1.0 Paraoxybenzoic Acid Methyl 0.2 incense Quantity Pigment Quantity Purified water To 100

Composition weight% Polyoxyethylene Cured Castor Oil 1.0 Paraoxybenzoic Acid Methyl Quantity glycerin 6.0 1,3-butylene glycol 5.0 Carbomer 0.2 Triethanolamine 0.3 Propylene glycol 5.0 ethanol 3.2 Carboxy Vinyl Polymer 0.1 Pigment Quantity incense Quantity Purified water To 100

Experimental Example  1: Androgen Of receptor  Expression inhibitory effect measurement

Experimental Example  1-1: Cell Culture

LN Cap-FGC purchased through Korea Cell Line Bank (KTCC) was used for the experiment. Unlike normal skin cells, the prostate cell line expresses the male sex hormone (Androgen Receptor) and related enzymes (5-α-Reductase), which show secondary sexual characteristics, so that hormone-related diseases (acne, excess sebum secretion, Hair loss, enlarged prostate gland) is widely used. The LN Cap cells were subcultured at 10 times / week intervals in 10% FBS / DMEM medium, and prepared by incubating with 10% FBS / DMEM (phenol w / o) media treated with Charcoal / Dextran at the time of experiment.

Experimental Example  1-2: Experiment Inhibitory Effect

The antisense oligonucleotides of Examples 1 to 18 were added to a culture solution of LN Cap cells, which are human-derived prostate cancer cells at a concentration of 2 μM, and cultured for 48 hours, after which RNA was isolated and 5-alpha reductase or RT-PCR was used. The inhibitory effect of androgen receptor expression was tested.

Their quantitation was corrected by obtaining band intensities with a fluoro-S multi-imager (biorad, usa) and correcting them with glycerolaldehyde phosphate dehydrogenase (GPDH), an internal control.

Inhibition Rate = (Control-Experimental) / Control X 100

The inhibition rate (%) was calculated by the above formula and is shown in Table 13 below.

Example Band Intensity Expression inhibition rate (%) Control (5a reductase) 9348 - Example 1 4702 50.3 Example 2 4786 51.2 Example 3 4609 49.3 Example 4 4263 45.6 Example 5 3898 41.7 Example 6 4655 49.8 Example 7 3842 41.1 Example 8 4281 45.8 Example 9 4076 43.6 Android receptor 9358 - Example 10 5055 56.4 Example 11 4759 53.1 Example 12 4553 50.8 Example 13 4939 55.1 Example 14 4383 48.9 Example 15 4499 50.2 Example 16 4006 44.7 Example 17 4150 46.3 Example 18 4231 47.2

As shown in Table 13, the antisense oligonucleotides of Examples 1-18 compared to the control inhibited the expression of 41-57% 5-alpha reductase or androgen receptor at a concentration of 2 μM. In addition, it can be seen that the difference according to the nucleotide sequence of the oligonucleotide selected in each example is not large.

Experimental Example  2: flexible cosmetics or Essence Sebaceous glands  Inhibitory effect experiment

Forehead 20 men of average age 34,5 years old are gently wiped with 70% ethanol and dried, and the sebu tape is applied to the left, middle, and right sides of the forehead for 30 minutes. After 30 minutes, remove the sebu tape and attach it to the area where the new sebu tape has been removed for 30 minutes and then remove it. Thereafter, the softening paste or essence of Preparation Examples 3 and 4 and Comparative Examples 3 and 4 was applied to the forehead twice a day for 4 weeks, and the sample was not applied on the morning of the measurement day. Attach the new sebu tape in the same way as 4 weeks before the experiment and remove it.

This four-week sebum measurement was measured after adapting the subject under constant temperature and humidity (22 ℃, 50% humidity) conditions to reduce the effect on the external environment before measurement. The sebu tapes thus obtained were compared to their values through image analysis and are shown in Table 14 below.

sample No improvement / worsening (<10%) Slight improvement (10% to 30%) Significant improvement (> 30%) Comparative Example 3 16 4 - Preparation Example 3 One 6 13 Comparative Example 4 17 3 - Preparation Example 4 2 4 14

As shown in Table 14, 33 of 40 subjects in Comparative Example 3 and Comparative Example 4 that do not contain an antisense oligonucleotide did not show sebum secretion inhibitory effect, while applying cosmetics according to Preparation Example 3 and Preparation Example 4 37 of 40 subjects experienced sebum secretion inhibitory effect. In addition, no adverse effects appeared in the test subjects using the cosmetics of Preparation Examples 3 and 4. Therefore, it can be seen that the cosmetic containing antisense oligonucleotide has a safe and excellent sebum secretion effect.

As described above, the antisense oligonucleotide and the cosmetic composition comprising the mRNA of the 5-alpha reductase or the mRNA of the androgen receptor of the present invention to suppress sebum secretion and at the same time improve acne by inhibiting their expression Has an effect.

Attach sequence list electronic file

Claims (7)

Antisense oligonucleotides for mRNA of at least one 5-alpha reductase gene selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs: 1-9; And antisense oligonucleotides for mRNA of at least one androgen receptor gene selected from the group consisting of the nucleotide sequences set forth in SEQ ID NOs: 10-18. A cosmetic composition for inhibiting sebum secretion or acne that contains at least one oligonucleotide selected from the group consisting of. delete delete delete The cosmetic composition for inhibiting sebum secretion or acne according to claim 1, wherein the antisense oligonucleotide is contained in an amount of 0.00001 to 10.0 wt% based on the total composition. The cosmetic composition for inhibiting sebum secretion or acne according to claim 1, wherein the cosmetic composition is formulated as an external skin ointment, cream, softening lotion, nourishing lotion, pack or essence. The cosmetic composition of claim 1, wherein the oligonucleotide is a phosphorothioate oligonucleotide.