KR100758727B1 - Composition for diagnosing the progress of liver disease in hbv infected patient and kit containing the same - Google Patents
Composition for diagnosing the progress of liver disease in hbv infected patient and kit containing the same Download PDFInfo
- Publication number
- KR100758727B1 KR100758727B1 KR1020060030113A KR20060030113A KR100758727B1 KR 100758727 B1 KR100758727 B1 KR 100758727B1 KR 1020060030113 A KR1020060030113 A KR 1020060030113A KR 20060030113 A KR20060030113 A KR 20060030113A KR 100758727 B1 KR100758727 B1 KR 100758727B1
- Authority
- KR
- South Korea
- Prior art keywords
- seq
- base
- hbv
- polynucleotide
- pres1
- Prior art date
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01B—MEASURING LENGTH, THICKNESS OR SIMILAR LINEAR DIMENSIONS; MEASURING ANGLES; MEASURING AREAS; MEASURING IRREGULARITIES OF SURFACES OR CONTOURS
- G01B3/00—Measuring instruments characterised by the use of mechanical techniques
- G01B3/10—Measuring tapes
- G01B3/1056—Tape end arrangements, e.g. end-hooks
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01B—MEASURING LENGTH, THICKNESS OR SIMILAR LINEAR DIMENSIONS; MEASURING ANGLES; MEASURING AREAS; MEASURING IRREGULARITIES OF SURFACES OR CONTOURS
- G01B3/00—Measuring instruments characterised by the use of mechanical techniques
- G01B3/10—Measuring tapes
- G01B3/1071—Separate means for supporting or affixing measuring tapes
- G01B2003/1076—Separate means for supporting or affixing measuring tapes associated with the end-hooks
Abstract
Description
도 1은 본 발명에서 nested PCR 방법을 사용하여 preS1 유전자의 코딩 개시 부위의 유전자 결손 변이주를 검출하는 방법을 보여주는 개락도이다.1 is a schematic diagram showing a method for detecting a gene deletion mutant of the coding start site of the preS1 gene using the nested PCR method in the present invention.
도 2는 본 발명의 구체예에서의 preS1 유전자의 결실 부위를 보여주는 것이다.Figure 2 shows the deletion site of the preS1 gene in an embodiment of the invention.
도 3a 및 3b는 preS1 유전자의 코딩 개시 부위 결손을 검출하기 위한 nest PCR 산물의 전기영동 결과를 보여주는 것으로, 3a는 2.5% 아가로스 젤 상에서의 전기영동 결과이고, 3b는 7.5% 폴리아크릴아마이드 젤 상에서의 전기 영동 결과이다.Figures 3a and 3b show the results of electrophoresis of nest PCR products to detect coding initiation site deletion of the preS1 gene, 3a is the result of electrophoresis on 2.5% agarose gel, 3b is on 7.5% polyacrylamide gel Electrophoresis results.
도 4는 본 발명의 제 I형 폴리뉴클레오타이드의 염기서열을 보여주는 것이다.Figure 4 shows the nucleotide sequence of the type I polynucleotide of the present invention.
도 5는 본 발명의 제 II형 폴리뉴클레오타이드의 염기서열을 보여주는 것이다.Figure 5 shows the nucleotide sequence of the type II polynucleotide of the present invention.
도 6은 본 발명의 제 III형 폴리뉴클레오타이드의 염기서열을 보여주는 것이다.Figure 6 shows the nucleotide sequence of the type III polynucleotide of the present invention.
도 7은 본 발명의 제 IV형 폴리뉴클레오타이드의 염기서열을 보여주는 것이 다. Figure 7 shows the nucleotide sequence of the type IV polynucleotide of the present invention.
본 발명은 국내 HBV 감염 환자로부터 채취한 시료에서 HBV의 유전자형 C의 preS1 유전자의 코딩 개시부위에서의 15 또는 21개의 염기 결실 여부를 확인하여, 상기 국내 HBV 감염 환자의 간질환의 악화 가능성을 진단하는 기술에 관한 것이다.The present invention is to determine whether 15 or 21 base deletions in the coding start region of the preS1 gene of HBV genotype C in a sample taken from a domestic HBV infection patient, to diagnose the possibility of exacerbation of liver disease in the domestic HBV infection patients It's about technology.
B형 간염 바이러스는 (Hepatitis B Virus; 이하 'HBV')는 전 세계적으로 약 3억 명 이상이 감염되어 있는 것으로 알려져 있으며, 궁극적으로 급성 및 만성 감염, 간경변증, 간세포암 등을 일으켜, 만성 질환 이환율 및 사망률을 증가시키는 질환이다. Hepatitis B virus (HBV) is known to have infected more than 300 million people worldwide, ultimately causing acute and chronic infections, cirrhosis and hepatocellular carcinoma. And mortality.
B 형 간염 바이러스 표면 항원 (HBsAg) 양성률은 지역마다 큰 차이가 있어서, 미국의 경우 0 내지 3%에 불과한 것으로 조사되었으나, 예방 접종이 본격적으로 시행되기 전 중국 대만과 일본을 포함한 동북아시아에서는 8 내지 10 %에 달했던 것으로 알려져 있다 (Zeng G, Wang Z, Wen S, Jiang J, Wang L, Cheng J, Tan D, Xiao F, Ma S, Li W, Luo K, Naoumov NV, Hou J. Geographic distribution, virologic and clinical characteristics of hepatitis B virus genotypes in China. J Viral Hepat. 2005). Hepatitis B virus surface antigen (HBsAg) positive rates vary widely from region to region, with only 0 to 3% in the United States, but before the vaccination began, 8 to 8 in Northeast Asia, including China, Taiwan, and Japan. 10% (Zeng G, Wang Z, Wen S, Jiang J, Wang L, Cheng J, Tan D, Xiao F, Ma S, Li W, Luo K, Naoumov NV, Hou J. Geographic distribution, virologic and clinical characteristics of hepatitis B virus genotypes in China.J Viral Hepat. 2005).
국내의 만성 HBV 감염 환자는 1983년부터 적극적인 예방접종 사업이 시작된 이래로 점차 줄어들고 있는 실정이며, 1990년대 이후에 발표된 여러 문헌을 종합해 볼 때, 대략적으로 5.1 내지 7.5 % 정도의 HBsAg 양성률을 보이는 것으로 나타났다 (Lee DH, Kim JH, Nam JJ, Kim HR, Shin HR. Epidemiological findings of hepatitis B infection based on 1998 National Health and Nutrition Survey in Korea. J Korean Med Sci. 2002;17(4):457-62). Patients with chronic HBV infection in Korea have been decreasing gradually since the start of active vaccination business since 1983. According to various literatures published since the 1990s, HBsAg positive rate was about 5.1 to 7.5%. Lee DH, Kim JH, Nam JJ, Kim HR, Shin HR.Epidemiological findings of hepatitis B infection based on 1998 National Health and Nutrition Survey in Korea.J Korean Med Sci. 2002; 17 (4): 457-62) .
그러나, 아직까지 우리나라는 HBV 만연지역으로서, 미국 및 유럽 선진국에 비해 10 배 이상의 높은 유병율을 보이고 있다. 또한 대부분의 감염시기가 성인 시기에 비해 임상경과가 불량한 것으로 알려진 5세 미만에 집중되어 있다. 현재 우리나라에서 바이러스성 간염, 간경변증 및 간암 등의 만성 간질환에 의한 사망률은 전체 사망의 8.5% (남자 12.0%, 여자 4.0%)를 차지하고 있는 실정이다. 따라서 우리나라에서 만성 간질환의 주된 원인인 B 형 간염은 양적, 질적으로 모든 감염 질환 중에서 국민건강에 가장 큰 위해를 주는 질병이라 할 수 있다.However, Korea is still a HBV rampant region, showing a 10 times higher prevalence than the United States and European advanced countries. Most infections are concentrated in children under 5 years of age, which are known to have poorer clinical course than adults. Currently, the mortality rate from chronic liver disease such as viral hepatitis, cirrhosis and liver cancer accounts for 8.5% of all deaths (12.0% male and 4.0% female). Therefore, hepatitis B, the main cause of chronic liver disease in Korea, can be said to be the most damaging to national health among all infectious diseases both quantitatively and qualitatively.
HBV는 간암의 주된 원인체로서, 미국의 경우는 전체 원발성 간암의 약 50% 정도가 HBV에 의해 발생된다고 알려져 있다. 우리나라의 경우에는, 각 지역마다 약간의 차이는 보이나, 전반적으로 원발성 간암의 약 75 내지 78% 가 HBV에 의해 유발된다고 알려져 있으며, 이는 미국 등의 선진국과 비교하여 매우 높은 비율이다 (Cheon JH, Park JW, Park KW, Kim YI, Kim SH, LeeWJ, Park HS, Park SJ, Hong EK, Kim CM. The clinical report of 1,078 cases of hepatocellular carcinomas: National Cancer Center experience. Korean J Hepatol. 2004 ;10(4):288-97.). HBV is a major cause of liver cancer. In the United States, about 50% of all primary liver cancers are caused by HBV. In Korea, there is a slight difference in each region, but overall, about 75 to 78% of primary liver cancers are known to be caused by HBV, which is very high compared to developed countries such as the US (Cheon JH, Park). JW, Park KW, Kim YI, Kim SH, LeeWJ, Park HS, Park SJ, Hong EK, Kim CM.The clinical report of 1,078 cases of hepatocellular carcinomas: National Cancer Center experience.Korean J Hepatol. 2004; 10 (4) : 288-97.).
HBV의 감염은 통상적으로 무증상 감염, 만성 간염, 간경변, 간세포암으로 이행하는 다양한 임상경과를 보인다. 이러한 임상 경과의 다양성에 숙주 인자, 바이 러스 인자 및 환경 인자 등의 다양한 인자가 관련될 것으로 생각된다. 숙주인자로는 감염 시 연령, HLA 등이 보고되어 있으며, 바이러스 인자로 추정되는 인자들로는 HBV 염기서열 변이와 HBV 유전자형 (genotype)이 HBV 감염의 임상 경과에 중요한 역할을 한다고 보고되어 있다. Infections of HBV typically have a variety of clinical paths leading to asymptomatic infection, chronic hepatitis, cirrhosis, and hepatocellular carcinoma. It is thought that various factors, such as host factors, virus factors, and environmental factors, may be involved in the diversity of clinical course. As host factors, age, HLA, etc., are reported, and viral factors, such as HBV sequence variation and HBV genotype, are reported to play an important role in the clinical course of HBV infection.
이러한 점을 고려할 때, 임상경과 및 치료효과와 국내 HBV와의 상관관계를 연구하기 위해서는, 임상결과에 영향을 미친다고 알려져 있는 바이러스 인자인 HBV 유전형의 분포 및 유전자 변이 양상에 초점을 두어 연구를 수행하여야 하는 것이 바람직할 것으로 생각된다. In light of this, in order to study the correlation between clinical progress and treatment effect and HBV in Korea, research should focus on the distribution and genetic variation of HBV genotype, a viral factor known to affect clinical outcomes. It is thought to be desirable.
본 발명자들의 연구를 포함한 최근의 연구결과들에 의하면, 다른 대부분의 국가에서 유전자형 A, B, D 등이 우세한 외국의 경우와는 달리, 국내 HBV 감염 환자에서 분리된 HBV의 대부분이 유전자형 C라고 보고되어 있다 (Kim BJ, Song BC. Distribution of hepatitis B virus genotypes according to the clinical outcomes in patients with chronic hepatitis B virus infection in Jeju island. Korean J Gastroenterol. 2003;42(6): 496-501.). HBV의 유전자형 C는 유전자형 B와 비교하여 상대적으로 병원성이 높은 것으로 알려져 있기 때문에, HBV의 유전자형 B와 C가 공존하는 것으로 알려진 다른 지역과 달리, 국내에 특이적으로 유전자형 C이 우세하게 배타적으로 분포한다는 사실은 HBV의 치료에 있어서 생물학적 및 임상적으로 지대한 영향을 미칠 수가 있다. 국내와 같이 유전자형 B에 비해 상대적으로 병원성이 높은 것으로 알려진 유전형 C만이 배타적으로 존재하는 경우에는, 유전자 재조합이 유전적인 다양성이 부족한 유전형 C 사이에서만 일어나기 때문에 병원성 또는 감염성이 높은 국내 특이적인 독자적인 변이주를 생산하는 방향으로 진행될 가능성을 배제할 수 없다는 문제가 있다. Recent studies, including our study, show that most of the HBVs isolated from domestic HBV-infected patients are genotype C, unlike in most other countries, where genotypes A, B, and D dominate. (Kim BJ, Song BC. Distribution of hepatitis B virus genotypes according to the clinical outcomes in patients with chronic hepatitis B virus infection in Jeju island.Korean J Gastroenterol. 2003; 42 (6): 496-501.). Since genotype C of HBV is known to be relatively pathogenic compared to genotype B, unlike other regions in which genotypes B and C of HBV are known to coexist, genotype C is predominantly exclusively distributed in Korea. The fact is that it can have a significant biological and clinical impact in the treatment of HBV. When only genotype C, which is known to be relatively pathogenic compared to genotype B, exists exclusively in Korea, since genetic recombination occurs only between genotype C, which lacks genetic diversity, it produces a domestically unique mutagenic strain that is highly pathogenic or infectious. There is a problem that can not exclude the possibility to proceed in the direction.
HBV의 preS 부위는 preS1 부위와 preS2 부위로 구성되어 있다. 이들 preS1 및 preS2는 S 항원과 함께 1개의 ORF로 구성되어 있으며, 각 각 S 항원과 같은 C 말단을 공유하는 Large S 항원 과 Middle S 항원을 코딩한다. 이 들 중에서 preS1 단백질은 preS2 단백질에 비하여 비리온의 형성 및 분비 등과 같은 HBV의 생활환 (life cycle)에 있어서 더 필수적인 것으로 알려져 있다. 한편, preS 부위의 유전자 변이, 특히 결손 (deletion) 유전자 변이가 간질환의 악화, 특히 간세포암과 관련이 있다고 알려져 있다. 이 preS 부위의 염기서열 변이가 간질환의 악화에 영향을 미치는 기전은 아직까지 확실하지는 않지만, 아마도 유전자 변이가 Large S 항원, Middle S 항원, 및 S 항원 세 단백의 발현 비율에 영향을 미쳐서, 이들 단백질들이 세포 밖으로 분비되지 않고 세포 내에 축적되기 때문에 세포독성이 유발되는 것으로 생각된다 (Locarnini S, McMillan J, Bartholomeusz A. The hepatitis B virus and common mutants. Semin Liver Dis. 2003;23(1):5-20. Review). The preS site of HBV consists of the preS1 site and the preS2 site. These preS1 and preS2 are composed of one ORF together with S antigens, and each encodes a Large S antigen and a Middle S antigen that share the same C terminus as each S antigen. Among these, preS1 protein is known to be more essential than the preS2 protein in the life cycle of HBV such as virion formation and secretion. On the other hand, gene mutations in the preS region, particularly deletion gene mutations, are known to be associated with exacerbation of liver disease, in particular hepatocellular carcinoma. The mechanism by which this sequence of the preS region affects the exacerbation of liver disease is not yet clear, but perhaps the genetic variation affects the expression rate of Large S antigen, Middle S antigen, and S protein triprotein. Cytotoxicity is thought to be induced because proteins accumulate in cells rather than secreted out of cells (Locarnini S, McMillan J, Bartholomeusz A. The hepatitis B virus and common mutants. Semin Liver Dis. 2003; 23 (1): 5 -20.Review).
그러나, 상기의 preS 부위의 유전자 결손이 간질환의 악화와 관련이 있다는 보고는 대부분 국내 이외의 지역의 HBV에 관련된 것이어서, 다른 지역과 달리 HBV의 유전자형 C가 압도적으로 우세한 국내 HBV 환자에 적용하기에 적절하지 못하였다. 또한, 상기 pre-S의 결손 유전자 변이 양상이 특정 부위에 한정되어 있지 않고 preS1 및/또는 preS2 부위의 전 부분에 걸쳐 산재되어 있는 것으로 되어 있기 때문에, 이들 preS1 결손 유전자의 표적화가 곤란하고, 이들 preS1 결손 유전자를 표적으로 하여 간질환의 악화와 연관되어 있는 preS1 결손 유전자를 갖는 HBV 변이주를 검출하는 진단 방법의 개발에 한계가 있어 왔다. However, most of the reports that the gene defects in the preS region are related to exacerbation of liver disease are mostly related to HBV outside of Korea, and unlike other regions, HBV genotype C is applied to domestic HBV patients who are predominantly superior. It was not appropriate. In addition, since the pattern of mutation of the pre-S deletion gene is not limited to a specific site and is interspersed over all of the preS1 and / or preS2 sites, targeting of these preS1 deletion genes is difficult, and these preS1 are difficult to target. There have been limitations in the development of diagnostic methods to target HBV mutants with preS1 deletion genes that are linked to exacerbation of liver disease by targeting the missing genes.
상기의 문제점를 극복하기 위하여, 본 발명은 국내 HBV 감염 환자로부터 채취한 시료에서 HBV의 유전자형 C의 preS1 유전자의 코딩 개시부위에서의 15 또는 21개의 염기 결실 여부를 확인하여, 상기 국내 HBV 감염 환자의 간질환 증상 악화 가능성을 예측하고 진단하는 기술을 제공하는 것을 주된 목적으로 한다.In order to overcome the above problems, the present invention is to determine whether 15 or 21 base deletions in the coding start region of the preS1 gene of genotype C of HBV in a sample taken from a domestic HBV infected patient, the liver of the domestic HBV infected patients Its primary purpose is to provide techniques for predicting and diagnosing the likelihood of disease symptoms worsening.
보다 구체적으로, 본 발명의 목적은 HBV 유전자형 C의 preS1 유전자의 코딩 개시 부위에 15 또는 21개의 염기 결실을 갖는 폴리뉴클레오타이드 및 상기 폴리뉴클레오타이드에 의하여 코딩되며, HBV 유전자형 C의 preS1 단백질의 N 말단 부위에서 5 내지 11개의 아미노산 결실을 갖는 단백질로 이루어진 군 중에서 선택된 한 가지 이상을 포함하는 국내 HBV 감염 환자의 간질환 악화 가능성 진단용 조성물을 제공하는 것이다.More specifically, an object of the present invention is a polynucleotide having 15 or 21 base deletions in the coding initiation site of the preS1 gene of HBV genotype C and encoded by the polynucleotide, and in the N terminal region of the preS1 protein of HBV genotype C. It is to provide a composition for diagnosing the possibility of liver disease worsening in a domestic HBV-infected patient comprising at least one selected from the group consisting of a protein having a 5 to 11 amino acid deletion.
본 발명의 또 다른 목적은 상기의 HBV 유전자형 C의 preS1 유전자의 코딩 개시 부위에 15 또는 21개의 염기 결실을 갖는 폴리뉴클레오타이드의 검출을 위한 프로브와 이를 포함하는 DNA 칩을 제공하는 것이다. Still another object of the present invention is to provide a probe for detecting a polynucleotide having 15 or 21 base deletions in the coding start site of the preS1 gene of HBV genotype C and a DNA chip comprising the same.
본 발명의 또 다른 목적은 국내 HBV 감염 환자로부터 채취한 시료 및 상기 폴리뉴클레오타이드 또는 단백질을 표적으로 하는 검출 수단을 한 가지 이상 포함하는 국내 HBV 감염 환자의 간질환 악화 가능성 진단용 키트를 제공하는 것이다. It is still another object of the present invention to provide a kit for diagnosing the possibility of liver disease exacerbation in a domestic HBV infected patient comprising at least one sample collected from a domestic HBV infected patient and a detection means targeting the polynucleotide or protein.
본 발명의 또 다른 목적은 국내 HBV 감염 환자로부터 채취한 시료에 대하여 두 쌍의 프라이머를 사용하는 nested PCR을 수행하고, 얻어진 PCR 산물을 전기영동하는 단계를 포함하는, 상기 폴리뉴클레오타이드의 검출 방법을 제공하는 것이다. Still another object of the present invention is to provide a method for detecting polynucleotide, comprising performing nested PCR using two pairs of primers on a sample collected from a domestic HBV infected patient, and electrophoresis of the obtained PCR product. It is.
본 발명은 국내 HBV 감염 환자로부터 채취한 시료에서 HBV 유전자형 C의 preS1 유전자의 코딩 개시 부위에서의 특정 패턴의 염기 결실 여부를 확인하여 간질환의 악화 가능성을 예측 및/또는 진단하는 기술과 관련된 것이다. The present invention relates to a technique for predicting and / or diagnosing the possibility of exacerbation of liver disease by confirming whether or not a specific pattern of bases are deleted at a coding start site of the preS1 gene of HBV genotype C in a sample collected from a domestic HBV infected patient.
본 발명자들은 여러 가지 임상증상을 보이는 국내 HBV 환자들의 HBV preS1 부위의 염기서열을 분석하여, 국내 HBV 간염환자의 간질환의 악화와 관계되는 국내 특이적인 preS1 부위의 유전자 변이 양상을 발견하고, 이러한 유전자 변이양상을 보이는 변형 HBV 유전자를 검출하는 분자생물학적인 진단 방법을 개발하고자 연구를 거듭한 결과, 본 발명을 완성하였다.The present inventors analyzed the sequencing of the HBV preS1 region of Korean HBV patients showing various clinical symptoms, and found a genetic variation pattern of the domestic specific preS1 region related to the exacerbation of liver disease in HBV hepatitis patients in Korea. As a result of repeated studies to develop a molecular biological diagnostic method for detecting a modified HBV gene exhibiting a variation, the present invention has been completed.
본 발명에서는 국내 간암 환자들의 B형 간염 바이러스(HBV)를 대상으로 preS1 부위의 염기서열을 분석한 결과 HBV의 preS1 유전자가 특정 패턴의 유전자 결손을 갖는다는 것을 밝혔다. 이러한 특정 패턴의 결손 유전자 변이체는 국내에서 HBV의 대부분을 차치하는 HBV 유전자형 C 의 preS1 유전자의 코딩 개시부위 (5' 말단쪽)에 15 또는 21 bp의 유전자 결손을 야기하는 패턴을 보임으로써, 궁극적으로 HBV 유전자형 C의 야생형 preS1 단백질과 비교하여 N 말단부위에 5 내지 11 개의 아미노산이 결손된 변이 preS1 단백질을 생산하게 된다. In the present invention, the analysis of the nucleotide sequence of the preS1 site in hepatitis B virus (HBV) of patients with liver cancer in Korea revealed that the preS1 gene of HBV has a specific pattern of gene deletion. This specific pattern of defective gene variants ultimately results in a pattern that causes 15 or 21 bp of gene deletion in the coding start of the preS1 gene of HBV ′ genotype C, which accounts for the majority of HBV in Korea, ultimately. Compared with the wild type preS1 protein of HBV genotype C, it will produce a mutant preS1 protein which lacks 5 to 11 amino acids in the N-terminal region.
따라서, 본 발명에 따르면, 국내 HBV 환자로부터 채취한 시료에서 상기와 같은 특정 패턴의 유전자 결손을 갖는 변이 preS1 유전자를 중합효소 연쇄반응(PCR) 시켜 얻어진 PCR 산물 또는 상기 변이 preS1 유전자로부터 코딩된 단백질의 N 말단부위에 5 내지 11개의 아미노산 결손을 갖는 변이 preS1 단백질을 아가로스 젤 또는 폴리아크릴 아마이드 젤 상에서 전기영동함으로써, 시간과 비용이 많이 소요되는 염기 서열 분석 또는 아미노산 서열 분석이 필요없이, 간단하고 정확하게 HBV preS1 유전자의 코딩 개시 부위의 특정 유전자 결손을 갖는 변이체를 검출하여, 보다 용이하게 PBV 환자의 간질환 악화 여부를 예측 및/또는 진단할 수 있다.Therefore, according to the present invention, a PCR product obtained by PCR polymerase chain reaction (PCR) of a mutant preS1 gene having a specific pattern of gene deletion as described above in a sample taken from a domestic HBV patient or a protein encoded from the mutant preS1 gene. By electrophoresis of a mutant preS1 protein having 5 to 11 amino acid deletions at the N terminus on agarose gels or polyacrylamide gels, HBV is simple and accurate without the need for time and costly sequencing or amino acid sequencing. Variants with specific gene deletions at the coding initiation site of the preS1 gene can be detected to more easily predict and / or diagnose liver disease aggravation in PBV patients.
또한, 본 발명에서는 이러한 HBV preS1의 염기 결손이 HBV 감염환자의 임상증상의 악화와의 연관성을 분석하기 위하여, 다양한 임상증상을 보이는 국내 만성 HBV 감염 환자들로부터 채취된 시료를 대상으로 본 발명의 진단방법을 이용하여 preS1 유전자의 코딩 개시부위 결손 유전자를 갖는 변이주의 상대적인 검출빈도를 분석한 결과, 상기와 같은 패턴의 preS1 유전자의 코딩 개시부위에서의 유전자 결손이 국내 만성 HBV 감염 환자에 있어서의 간경변 및/또는 간세포암으로의 간질환 증상 악화와 밀접한 관계가 있음을 입증하였다. 이는 본 발명에서 발견된 preS1 유전자 코딩 개시부위에서의 특정 패턴의 염기 결손을 갖는 유전자를 표적으로 하는 진단 기술이 국내 HBV 감염 환자의 임상증상 예후를 판단하고, 추후 간경변 및/또는 간세포암으로의 증상 악화를 예측하고, 이를 예방하는데 도움을 주는 매우 유용한 기술임을 시사하는 것이다. In addition, in the present invention, in order to analyze the association between the base defect of HBV preS1 and the deterioration of clinical symptoms of HBV infected patients, the diagnosis of the present invention was carried out on samples collected from domestic chronic HBV infected patients with various clinical symptoms. As a result of analyzing the relative detection frequency of the mutant strains having the coding initiation defect of the preS1 gene using the method, the gene deletion in the coding initiation region of the preS1 gene of the above pattern was found to be cirrhosis and And / or have been closely associated with exacerbation of liver disease symptoms to hepatocellular carcinoma. This is because the diagnostic technology that targets genes having a specific pattern of base defects in the preS1 gene coding initiation site found in the present invention determines the clinical symptoms and prognosis of HBV-infected patients in Korea, and the symptoms of liver cirrhosis and / or hepatocellular carcinoma later. It is a very useful technique that can help predict and deteriorate.
본 발명에 있어서, 'preS1 유전자의 코딩 개시부위'는 preS1 유전자의 개시 코돈 주변 부위를 의미하는 것으로, 보다 구체적으로는, 개시코돈의 첫 번째 염기 [HBV 유전자형 C의 전체 게놈 유전자(AY641558, SEQ ID NO: 19) 기준으로 2848번째 염기 (도 1)]에서부터 다음에 위치하는 또 다른 메티오닌 코딩 코돈 이전의 33번째 염기까지의 부위를 의미한다. 또한, 본 발명에 있어서, 'preS1 단백질의 N 말단부위'는 preS1 유전자의 개시코돈에 의하여 코딩된 메티오닌 주변 부위를 의미하는 것으로, 보다 구체적으로는, 1번째 아미노산인 메티오닌으로부터 11번째 아미노산까지의 부위를 의미한다. In the present invention, the 'coding initiation site of the preS1 gene' refers to a site around the start codon of the preS1 gene. More specifically, the first base of the initiation codon [the entire genome gene of HBV genotype C (AY641558, SEQ ID) NO: 19) on the basis of the 2848th base (FIG. 1)] to the 33rd base before another methionine coding codon located next. In addition, in the present invention, the 'N-terminal region of the preS1 protein' refers to a site around methionine encoded by the start codon of the preS1 gene, and more specifically, a site from the first amino acid methionine to the eleventh amino acid. Means.
보다 상세하게, 본 발명은 HBV 유전자형 C (SEQ ID NO:19)의 preS1 유전자의 코딩 개시부위의 1번 염기(전체 게놈 유전자 기준으로 2848번째 염기)부터 33번 염기까지의 부위에서 15 또는 21 bp의 염기 결실을 갖는 것을 특징으로 하는 간질환 증상 악화 가능성 진단을 위한 표적으로서의 폴리뉴클레오타이드를 제공한다. 상기 폴리뉴클레오타이드는 상기와 같은 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 또는 21 bp의 염기 결실을 포함하는 한 그 염기서열 길이에 있어서 제한이 없으며, 상기 염기 결실 부위의 양쪽 인접부위를 포함하여 약 10 bp 내지 전장 유전자일 수 있다. 진단의 정확성과 용이성을 모두 고려할 때, 본 발명의 표적 폴리뉴클레오타이드의 길이는 15bp 내지 400 bp인 것이 바람직하고, 50 bp 내지 250 bp인 것이 더욱 바람직하다. More specifically, the present invention provides 15 or 21 bp at sites from base 1 (
본 발명에 있어서, 국내 HBV 감염 환자와 HBV 감염에서 진행된 간경변 또는 간세포암 환자들로부터 채취한 시료로부터 HBV 유전자형 C의 preS1 유전자의 변이 패턴을 조사한 결과, HBV 유전자형 C의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 bp 또는 21 bp의 염기 결실을 갖는 특정 패턴의 유전자 변이가 상기 HBV 감염 환자와 간경변 또는 간세포암 환자들에 공통적으로 존재하면서 그 증상이 악화될수록 (즉, HBV 감염 -> 간경변 -> 간세포암으로 진행될수록) 그 빈도가 높아지는 것으로 나타났다 (표 3 참조). 따라서, 상기와 같이 HBV 유전자형 C의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 bp 또는 21 bp의 염기 결실을 갖는 폴리뉴클레오타이드는 HBV 감염 증상의 간경변 및/또는 간세포암 등으로의 악화 가능성을 예측 또는 진단할 수 있는 표적 폴리뉴클레오타이드로 사용할 수 있다. 또한, 상기 폴리뉴클레오타이드는 HBV 감염 환자의 간질환 증상 악화를 방지하기 위한 치료제 개발을 위한 표적 폴리뉴클레오타이드로서도 유용하다.In the present invention, the mutation pattern of the preS1 gene of HBV genotype C was examined from samples collected from patients with HBV infection and liver cirrhosis or hepatocellular carcinoma developed in HBV infection. Specific patterns of genetic variation with base deletions of 15 bp or 21 bp at bases 33 to 33 are common to the HBV-infected patients and liver cirrhosis or hepatocellular carcinoma patients, and as symptoms worsen (ie, The frequency of HBV infection-> cirrhosis-> hepatocellular carcinoma) increased (see Table 3). Thus, polynucleotides having a base deletion of 15 bp or 21 bp at
본 발명의 구체예에 있어서, 상기한 바와 같은 특정 패턴의 유전자 변이는 preS1 유전자의 코딩 개시부위의 1번 염기(전체 게놈 유전자 기준으로 2848번째 염기)부터 33번 염기까지의 부위에서의 15 bp 또는 21 bp 염기 결손일 수 있으며, 보다 구체적으로, 다음의 4 가지 형태를 가질 수 있다 (도 2 참조):In an embodiment of the present invention, the genetic variation of the specific pattern as described above is 15 bp at a site from base 1 (
제 I형: HBV 유전자형 C의 preS1 유전자의 시작 코돈의 두 번째 염기부터 6 번 코돈의 첫 번째 염기(16번째 염기)까지의 15-bp 염기 결손 형태 (예컨대, SEQ ID NO: 1);Type I: 15-bp base deletion form (eg SEQ ID NO: 1) from the second base of the start codon of the preS1 gene of HBV genotype C to the first base (16th base) of codon 6;
제 II형: HBV 유전자형 C의 preS1 유전자의 시작 코돈의 세 번째 염기부터 6 번 코돈의 두 번째 염기(17번째 염기)까지의 15-bp 염기 결손 형태 (예컨대, SEQ ID NO: 3); Type II: 15-bp base deletion form (eg SEQ ID NO: 3) from the third base of the start codon of the preS1 gene of HBV genotype C to the second base of the codon 6 (17th base);
제 III형: HBV 유전자형 C의 preS1 유전자의 시작 코돈의 두 번째 염기부터 8 번째 코돈의 첫 번째 염기(22번째 염기)까지의 21-bp 염기 결손 형태 (예컨대, SEQ ID NO: 5); 또는Type III: 21-bp base deletion form (eg SEQ ID NO: 5) from the second base of the start codon of the preS1 gene of HBV genotype C to the first base of the eighth codon (22nd base); or
제 IV형: HBV 유전자형 C의 preS1 유전자의 3 번째 코돈의 첫 번째 염기(7번째 염기)부터 9 번째 코돈의 세 번째 염기(27번째 염기)까지의 21 bp 염기 결손 형태 (예컨대, SEQ ID NO: 7).Type IV: 21 bp base deletion form from the first base (7th base) of the third codon of the preS1 gene of HBV genotype C to the third base (27th base) of the ninth codon (eg, SEQ ID NO: 7).
본 발명의 폴리뉴클레오타이드는 상기의 SEQ ID NO: 1, 3, 5, 및 7로 이루어진 군 중에서 선택된 염기서열을 갖는 것이거나, 상기 염기서열을 포함하는 15bp 내지 400 bp 폴리뉴클레오타이드, 보다 바람직하게는, 50 bp 내지 250 bp 폴리뉴클레오타이드일 수 있다. 본 발명의 구체예에 있어서, 상기 폴리뉴클레오타이드는 상기 제 I형 내지 제 IV형의 염기 서열 결손을 갖는 HBV 유전자형 C (SEQ ID NO: 19)의 전체 게놈 유전자 기준으로 2827번째 염기부터 3034번째 염기까지의 187 내지 193 bp 길이의 폴리뉴클레오타이드일 수 있다 (도 1 참조).Polynucleotide of the present invention has a base sequence selected from the group consisting of SEQ ID NO: 1, 3, 5, and 7, or 15bp to 400 bp polynucleotide comprising the base sequence, more preferably, 50 bp to 250 bp polynucleotides. In an embodiment of the invention, the polynucleotide is 2827 bases to 3034 bases based on the entire genome of HBV genotype C (SEQ ID NO: 19) having base sequence deletions of the type I to IV. It may be a polynucleotide of 187 to 193 bp long (see FIG. 1).
또 다른 측면에 있어서, 본 발명은 상기 폴리뉴클레오타이드에 의하여 코딩되고, HBV 유전자형 C의 preS1 단백질 중 1번 아미노산(메티오닌)에서 11번 아미노산까지의 부위에서 5 내지 11개의 아미노산 결손을 갖는 것을 특징으로 하는 간질환 증상 악화 가능성 진단을 위한 표적으로서의 단백질을 제공한다. 바람직하게는, 본 발명의 단백질은 상기와 같은 제 I형 내지 제IV형의 염기 서열 결손을 갖는 폴리뉴클레오타이드에 의하여 코딩되는 아미노산 서열을 포함하는 단백질일 수 있으며, 예컨대, SEQ ID NO: 1, 3, 5 및 7로 이루어진 군 중에서 선택된 염기서열에 의하여 코딩되는 아미노산을 포함하는 단백질일 수 있다. 본 발명의 한 구체예에 있어서, 상기 표적 단백질은 상기 제 I형 내지 제 IV형의 염기서열 결실을 갖는 HBV 유전자형 C (SEQ ID NO: 19)의 전체 게놈 유전자 기준으로 2827번째 염기부터 3034번째 염기까지의 187 내지 193 bp 길이의 폴리뉴클레오타이드에 의하여 코딩되는 것일 수 있다. 상기 제 I형 내지 제 III형 염기 서열 결손을 갖는 폴리뉴클레오타이드에 의하여 코딩되는 단백질은, 상기 폴리뉴클레오타이드의 시작 코돈이 절단되어(interrupted), 그 다음에 위치하는 메티오닌 코딩 코돈인 12번째 코돈부터 단백질 합성이 시작되기 때문에, 야생형 pre-S1 단백질과 비교하여, 1번 아미노산 (메티오닌)부터 11번째 아미노산까지의 11개의 아미노산이 결손된 형태를 갖는다. 상기 제 IV형 염기서열 결손을 갖는 폴리뉴클레오타이드에 의하여 코딩되는 단백질은 야생형 preS1 단백질의 3번 아미노산부터 9번 아미노산까지의 7개 아미노산이 결손된 형태를 갖는다 (도 2 참조). 본 발명의 구체예에 있어서, 상기 단백질은 SEQ ID NOs: 2, 4, 6 및 8로 이루어진 군 중에서 선택된 아미노산 서열을 갖는 단백질일 수 있다. In another aspect, the invention is characterized in that the polynucleotide is encoded by the polynucleotide, and has 5 to 11 amino acid deletions at sites from amino acids 1 (methionine) to amino acids 11 of the preS1 protein of HBV genotype C It provides a protein as a target for diagnosing the possibility of worsening liver disease symptoms. Preferably, the protein of the present invention may be a protein comprising an amino acid sequence encoded by a polynucleotide having a base sequence deletion of the above type I to IV, for example SEQ ID NO: 1, 3 , 5 and 7 may be a protein comprising an amino acid encoded by the base sequence selected from the group consisting of. In one embodiment of the invention, the target protein is based on the whole genome genome of HBV genotype C (SEQ ID NO: 19) having the nucleotide sequence of the type I to
본 발명의 단백질은, 상기 폴리뉴클레오타이드와 관련하여 설명한 바와 같이, HBV 감염 증상의 간경변 및/또는 간세포암 등으로의 악화 가능성을 예측 또는 진단할 수 있는 표적 단백질로서 유용하게 사용될 수 있다. 또한, 상기 단백질은 HBV 감염 환자의 간질환 증상 악화를 방지하기 위한 치료제 개발을 위한 표적 단백질로서도 유용하다.The protein of the present invention can be usefully used as a target protein capable of predicting or diagnosing the possibility of exacerbation of HBV infection symptoms to cirrhosis and / or hepatocellular carcinoma and the like, as described in connection with the polynucleotide. In addition, the protein is also useful as a target protein for the development of therapeutic agents to prevent the worsening of liver disease symptoms in patients with HBV infection.
또 다른 측면에 있어서, 본 발명은 상기 HBV 유전자형 C(SEQ ID NO: 19)의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 또는 21 bp의 염기 결실을 갖는 폴리뉴클레오타이드 검출용 프로브(probe)를 제공한다. 상기 프로브는 본 발명의 HBV 유전자형 C의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 또는 21 bp의 염기 결실을 갖는 폴리뉴클레오타이드와 혼성화 반응에 의하여 특이적 결합이 가능한 것을 의미한다. 따라서, 상기 폴리뉴클레오타이드 검출용 프로브는 상기 HBV 유전자형 C의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 또는 21 bp의 염기 결실을 갖는 폴리뉴클레오타이드와 상보적 염기서열을 갖는 것일 수 있다. 또한, 본 발명의 프로브는 다음의 서열로 이루어진 군 중에서 선택된 서열을 갖는 것일 수 있다. In another aspect, the present invention provides a polynucleotide having a base deletion of 15 or 21 bp at
제 I형 염기서열 결손을 갖는 폴리뉴클레오타이드에 특이적인 프로브: Probes specific for polynucleotides having a type I sequence deletion:
AGCTACAGCACCAAACCTCG (SEQ ID NO: 9);AGCTACAGCACCAAACCTCG (SEQ ID NO: 9);
제 II형 염기서열 결손을 갖는 폴리뉴클레오타이드에 특이적인 프로브:Probes specific for polynucleotides having a type II sequence deletion:
GCTACAGCATCAAACCTCGA (SEQ ID NO: 10);GCTACAGCATCAAACCTCGA (SEQ ID NO: 10);
제 III형 염기서열 결손을 갖는 폴리뉴클레오타이드에 특이적인 프로브:Probes specific for polynucleotides having a type III sequence deletion:
AGCTACAGCACTCGACAAGG (SEQ ID NO: 11); 및 AGCTACAGCACTCGACAAGG (SEQ ID NO: 11); And
제 IV형 염기서열 결손을 갖는 폴리뉴클레오타이드에 특이적인 프로브:Probes specific for polynucleotides having a type IV sequence deletion:
CAGCATGGGACAAGGCATGGG (SEQ ID NO: 12).CAGCATGGGACAAGGCATGGG (SEQ ID NO: 12).
본 발명의 구체예에 있어서, 상기 프로브는 SEQ ID NOs: 1, 3, 5 및 7로 이루어진 군 중에서 선택된 염기서열과 상보적인 염기서열을 갖는 것일 수 있다. In an embodiment of the present invention, the probe may have a base sequence complementary to a base sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, and 7.
또 다른 측면에 있어서, 본 발명은 In another aspect, the invention
상기와 같은 HBV 유전자형 C(SEQ ID NO: 19)의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 또는 21 bp의 염기 결실을 갖는 폴리뉴클레오타이드 검출용 프로브를 이상을 포함하는 국내 HBV 감염 환자의 간질환 증상 악화 진단용 조성물을 제공한다. The above-described polynucleotide detection probe having a base deletion of 15 or 21 bp at the
또 다른 측면에 있어서, 본 발명은 상기와 같은 HBV 유전자형 C(SEQ ID NO: 19)의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 또는 21 bp의 염기 결실을 갖는 폴리뉴클레오타이드 및 상기 폴리뉴클레오타이드에 의하여 코딩되고 HBV 유전자형 C의 preS1 단백질 중 1번 아미노산(메티오닌)에서 11번 아미노산까지의 부위에서 5 내지 11개의 아미노산 결실을 갖는 단백질로 이루어진 군 중에서 선택된 한 가지 이상을 포함하는 국내 HBV 감염 환자의 간질환 증상 악화 방지를 위한 치료제 개발을 위한 표적용 조성물을 제공한다. 바람직한 구체예에 있어서, 본 발명은 상기 폴리뉴클레오타이드는 제I형 내지 제 IV형의 염기서열 결손을 포함하는 것일 수 있으며, 예컨대, SEQ ID NOs: 1, 3, 5 및 7로 이루어진 군 중에서 선택된 염기서열을 갖는 것일 수 있다. In another aspect, the present invention has a base deletion of 15 or 21 bp at
또 다른 측면에 있어서, 본 발명은 상기의 HBV 유전자형 C(SEQ ID NO: 19)의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 또는 21 bp의 염기 결실을 갖는 폴리뉴클레오타이드 검출용 프로브를 포함하는 DNA 칩을 제공한다. In another aspect, the present invention provides a poly-containing polynucleotide having a base deletion of 15 or 21 bp at
본 발명의 DNA 칩은 상기한 바와 같은 본 발명의 폴리뉴클레오타이드 검출용 프로브를 한 가지 이상 포함한다. 또한, 본 발명의 DNA 칩은 프로브 위치를 알려주는 기준 마커(marker)를 추가로 포함할 수 있으며, 이러한 마커로서 β-글로빈, 액틴, GAPDH(glyceraldehyde-3-phosphate dehydrogenase) 유전자 등을 사용할 수 있다. 상기 DNA 칩의 민감도를 향상시키기 위하여, 상기 프로브는 5' 또는 3' 말단이 아민화된 것일 수 있다. 상기 프로브는 DNA 칩 표면에 고정화되며, 이 때, 프로브가 고정되는 표면은 알데히드기가 결합된 고체 표면으로서, 유리가 바람직하나 이에 한정되지 않는다. 이러한 프로브의 DNA 칩 표면상의 고정은 통상적인 방법에 의할 수 있다. The DNA chip of the present invention includes one or more probes for detecting polynucleotides of the present invention as described above. In addition, the DNA chip of the present invention may further include a reference marker indicating the probe position, and as such markers, β-globin, actin, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene, etc. may be used. . In order to improve the sensitivity of the DNA chip, the probe may be aminated 5 'or 3' terminal. The probe is immobilized on the surface of the DNA chip, wherein the surface on which the probe is immobilized is a solid surface to which an aldehyde group is bound, and glass is preferably, but not limited thereto. Immobilization of such probes on the surface of DNA chips can be by conventional methods.
또 다른 측면에 있어서, 본 발명은, In another aspect, the present invention,
국내 HBV 감염 환자로부터 채취한 시료; 및 Samples collected from domestic patients with HBV infection; And
HBV 유전자형 C(SEQ ID NO: 19)의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 또는 21개의 염기 결실을 갖는 폴리뉴클레오타이드 및 상기 폴리뉴클레오타이드에 의하여 코딩되고 HBV 유전자형 C의 preS1 단백질 중 1번 아미노산에서 11번 아미노산까지의 부위에서 5 내지 11개의 아미노산 결실을 갖는 단백질로 이루어진 군 중에서 선택된 한 가지 이상을 표적으로 하는 검출 수단을 한 가지 이상 포함하는 국내 HBV 감염 환자의 간질환 증상 악화 가능성 진단용 키트를 제공한다. HBV genotype C (SEQ ID NO: 19) polynucleotides having 15 or 21 base deletions at
상기 환자는 모든 포유류일 수 있으며, 바람직하게는 인간이다. 상기 국내 HBV 감염 환자로부터 채취한 시료는 HBV 감염 환자로부터 분리된 유전자 검사가 가능한 모든 체액, 조직 또는 세포일 수 있으며, 바람직하게는 혈액 또는 혈청일 수 있다. The patient can be any mammal and is preferably a human. Samples taken from the domestic HBV infected patients may be any body fluid, tissue or cell capable of genetic testing isolated from HBV infected patients, preferably may be blood or serum.
바람직한 구체예에 있어서, 상기 폴리뉴클레오타이드는 상기한 바와 같으며, 예컨대, 제I형 내지 제IV형 염기서열 결손을 포함하는 폴리뉴클레오타이드로 이루 어진 군 중에서 선택된 한 가지 이상일 수 있으며, 보다 구체적으로, SEQ ID NOs: 1, 3, 5 및 7로 이루어진 군 중에서 선택된 염기서열을 갖는 한 가지 이상의 폴리뉴클레오타이드일 수 있다. 상기 단백질은 상기 제I형 내지 제IV형 폴리뉴클레오타이드로 이루어진 군 중에서 선택된 폴리뉴클레오타이드에 의하여 코딩된 단백질일 수 있다.In a preferred embodiment, the polynucleotide is as described above, for example, may be at least one selected from the group consisting of polynucleotides including type I to IV nucleotide deletions, more specifically, SEQ ID NOs: may be one or more polynucleotides having a nucleotide sequence selected from the group consisting of 1, 3, 5, and 7. The protein may be a protein encoded by a polynucleotide selected from the group consisting of the type I to type IV polynucleotides.
상기 검출 수단은 폴리뉴클레오타이드의 염기서열 또는 단백질의 아미노산 서열을 분석할 수 있는 모든 수단을 포함한다. 예컨대, 상기 폴리뉴클레오타이드의 검출 수단은 상기한 바와 같은 폴리뉴클레오타이드 검출용 프로브일 수 있으며, 추가로 적절한 형광물질 등의 표지물질을 포함할 수 있다.The detecting means includes all means capable of analyzing the nucleotide sequence of the polynucleotide or the amino acid sequence of the protein. For example, the means for detecting the polynucleotide may be a probe for detecting a polynucleotide as described above, and may further include a label such as an appropriate fluorescent material.
또한, 바람직한 구체예에 있어서, 상기 검출 수단은, 폴리뉴클레오타이드의 경우, 상기 폴리뉴클레오타이드에 적합한 PCR용 프라이머와 통상의 PCR 장치 및 전기영동 장치를 포함하는 것일 수 있으며, 단백질의 경우에는 통상의 전기영동 장치를 포함하는 것일 수 있다. 상기 전기영동은 예컨대, 아가로스 젤 또는 폴리아크릴 아마이드 젤 상에서 수행되는 것일 수 있다. 또한, 상기 폴리뉴클레오타이드의 보다 정확한 고감도의 검출을 위하여, 두 쌍의 프라이머 [외부(outer) 프라이머와 내부(inner) 프라이머]를 사용하는 nested PCR을 수행할 수 있으며, 이러한 경우에는, 본 발명의 키트는 검출하고자 하는 폴리뉴클레오타이드에 적합한 두 쌍의 프라이머를 포함하는 것일 수 있다. In addition, in a preferred embodiment, the detection means, in the case of polynucleotides may include a primer for PCR suitable for the polynucleotides, a conventional PCR device and an electrophoresis device, in the case of a protein, the usual electrophoresis It may be to include a device. The electrophoresis may be performed on, for example, agarose gel or polyacrylamide gel. In addition, for more accurate high sensitivity detection of the polynucleotide, nested PCR using two pairs of primers (outer primer and inner primer) may be performed, in which case, the kit of the present invention. May comprise two pairs of primers suitable for the polynucleotide to be detected.
본 발명에 따르면, 상기 폴리뉴클레오타이드 또는 단백질의 검출은 시간과 비용이 많이 소요되는 뉴클레오타이드 서열 또는 아미노산 서열의 분석이 필요 없 이, 간단한 전기영동 또는 PCR과 전기영동을 수행함으로써, 간편하고 신속하게 수행될 수 있다는 장점을 갖는다. According to the present invention, the detection of the polynucleotide or protein does not require time and costly analysis of nucleotide sequences or amino acid sequences, and can be performed simply and quickly by performing simple electrophoresis or PCR and electrophoresis. Has the advantage that it can.
시료에 본 발명의 특정 유전자 결손을 갖는 폴리뉴클레오타이드가 존재하는 경우, 전기영동 시 정상 길이보다 15 또는 21 bp가 짧은 폴리뉴클레오타이드에 해당하는 밴드가 형성되므로, 전기영동 결과 형성된 밴드를 조사하여 상기 폴리뉴클레오타이드의 존재 여부를 확인할 수 있으며, 밴드의 두께와 진하기를 조사하면 상기 폴리뉴클레오타이드의 상대적 존재량도 측정할 수 있다. When a polynucleotide having a specific gene defect of the present invention is present in a sample, a band corresponding to a polynucleotide having a short length of 15 or 21 bp shorter than a normal length is formed during electrophoresis, and thus the polynucleotide is examined by examining a band formed as a result of electrophoresis. The presence of the can be confirmed, and the relative abundance of the polynucleotide can be measured by examining the thickness and the depth of the band.
본 발명의 한 구체예에 있어서, 외부 프라이머쌍으로서 DelF2 (SEQ ID NO: 13)와 PreS-R1 (SEQ ID NO: 14), 내부 프라이머쌍으로서 Del-PRA-F1 (SEQ ID NO: 15)와 Del-PreS1-R (SEQ ID NO: 16)을 사용하는 nested PCR을 수행하여 본 발명의 폴리뉴클레오타이드를 검출할 수 있다. In one embodiment of the invention, DelF2 (SEQ ID NO: 13) and PreS-R1 (SEQ ID NO: 14) as an external primer pair, Del-PRA-F1 (SEQ ID NO: 15) and Polynucleotides of the invention can be detected by nested PCR using Del-PreS1-R (SEQ ID NO: 16).
또 다른 측면에 있어서, 본 발명은 국내 HBV 환자로부터 분리된 시료에 HBV 유전자형 C(SEQ ID NO: 19)의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 또는 21개의 염기 결실을 갖는 폴리뉴클레오타이드 또는 상기 폴리뉴클레오타이드에 의하여 코딩되는 단백질이 존재하는지 여부를 측정하는 것을 특징으로 하는 HBV 감염 환자의 간질환 악화 관련 인자 검출 방법을 제공한다. In another aspect, the present invention provides a sample isolated from
본 발명의 구체예에 있어서, 상기 검출 방법은 상기한 바와 같은 HBV 유전자형 C(SEQ ID NO: 19)의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 또는 21개의 염기 결실을 갖는 폴리뉴클레오타이드 검출용 프라이머를 사용하는 것일 수 있다. 본 발명의 또 다른 구체예에 있어서, 상기 검출 방법은 HBV 유전자형 C(SEQ ID NO: 19)의 preS1 유전자의 코딩 개시부위의 1번 염기부터 33번 염기까지의 부위에서 15 또는 21개의 염기 결실을 갖는 폴리뉴클레오타이드의 검출을 위한 한 쌍의 외부 프라이머와 한 쌍의 내부 프라이머를 순차적으로 사용하는 유전자중합효소법 (nested PCR)을 수행하고, 얻어진 PCR 산물을 전기영동하는 단계를 포함하는 것일 수 있다. 상기 외부 프라이머쌍으로서 DelF2 (SEQ ID NO: 13)와 PreS-R1 (SEQ ID NO: 14) 및 내부 프라이머쌍으로서 Del-PRA-F1 (SEQ ID NO: 15)와 Del-PreS1-R (SEQ ID NO: 16)로 구성된 것이 바람직하다. In an embodiment of the present invention, the detection method comprises 15 or 21 bases at
본 발명에서 사용된 유전자 검출 방법은 기존의 서열 분석 방법을 대체할 수 있는 정확하면서도 간편하고 저렴한 방법이다.The gene detection method used in the present invention is an accurate, simple and inexpensive method that can replace the existing sequencing method.
이하, 본 발명을 실시예를 들어 보다 상세히 설명하고자 한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것에 불과하며, 본 발명이 이들 실시예에 의하여 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are only for illustrating the present invention, the present invention is not limited by these examples.
[실시예]EXAMPLE
I. 재료 및 방법I. Materials and Methods
1) 대상 환자1) Target patient
2002년 3월부터 2002년 11월까지 제주대학병원 및 2005년 1년간 서울대학병원에서 HBsAg (hepatitis B surface antigen) 양성인 환자를 대상으로 하였으며, HBV 감염 환자에 특이적인 간질환 증상 악화 여부를 보다 정확하게 조사하기 위하여, 항바이러스 치료의 병력의 있거나, 알코올성 간질환이 합병된 경우, C형 간질환을 동반하는 환자는 배제하였다. 염기서열 분석을 위하여 15 명의 서로 다른 간 암 환자의 검체를 사용하였고, 유전자 변이와 간질환의 악화와의 상관관계 분석을 위한 preS1 시작 부위 결손 유전자 검출방법의 시료로서 158명의 환자 유래 검체를 사용하였다 [간세포암 (HCC): 67명, 간경변 (LC): 57명, 만성간염 (CH): 34명]. Patients who were positive for hepatitis B surface antigen (HBsAg) at Cheju National University Hospital from March 2002 to November 2002 and Seoul National University Hospital for 1 year were diagnosed. To investigate, patients with a history of antiviral treatment or with alcoholic liver disease were excluded. Specimens from 15 different liver cancer patients were used for sequencing, and 158 patient-derived samples were used as samples of the preS1 start-up defect gene detection method for correlation between genetic mutation and exacerbation of liver disease. Hepatocellular carcinoma (HCC): 67, cirrhosis (LC): 57, chronic hepatitis (CH): 34].
2) 혈청 수집2) serum collection
상기 환자들에 대하여 내원 시에 혈액을 채취하여 기본적인 혈청 생화학적 검사를 시행하였다. 첫 내원 시 HBsAg에 대하여 양성인 경우, 항-HBs, e항원 (HBeAg), 항-HBe, HBV-DNA, 알파-태아단백질 (alpha-fetoprotein, AFP) 검사하고, 남은 혈액을 -80℃에서 냉동 보관하였다. HBsAg와 항-HBs는 방사면역측정 키트 (Abbott laboratory, North Chicago, IL)를 이용하여 검사하였고, HBeAg/항-HBe는 효소 면역법(enzyme immunoassay)을 이용하였다. 혈청 HBV DNA의 정량은 Hybrid capture HBV DNA assay kit (Digene, Gaithersburg, MD, USA)를 이용하였으며, 이 검사의 HBV DNA 검출한계는 0.5 pg/mL이다. Blood was collected at the time of the visit and the patients underwent basic serum biochemical tests. If positive for HBsAg at first visit, anti-HBs, eantigens (HBeAg), anti-HBe, HBV-DNA, alpha-fetoprotein (AFP) are tested and the remaining blood frozen at -80 ° C It was. HBsAg and anti-HBs were examined using radioimmunoassay kits (Abbott laboratory, North Chicago, IL), and HBeAg / anti-HBe was subjected to enzyme immunoassay. Serum HBV DNA was quantified using a Hybrid capture HBV DNA assay kit (Digene, Gaithersburg, MD, USA). The detection limit of HBV DNA was 0.5 pg / mL.
3) 간질환의 임상적 정의 및 진단3) Clinical definition and diagnosis of liver disease
본 명세서에 있어서의 간질환의 정의 및 진단은 임상적, 생화학적, 방사선학적 검사 소견들을 종합하여 판단하였다. 임상적으로 HBsAg에 대하여 양성인 환자 중에서 HBeAg 양성, anti-HBe 음성, HBV DNA 양성이고, 혈청 트랜스아미나아제 (transaminase)가 정상이고, 방사선학적으로 만성 간질환의 증거가 없는 경우를 e항원 양성 건강 보균자로 정의하였다. HBeAg 혈청전환은 HBeAg음성, anti-HBe 양성, HBV DNA 음성이면서 혈청 transaminase가 정상인 경우이고, 만성 B형 간염은 HBsAg이 6개월 이상 양성이면서 HBeAg 여부에 관계없이 HBV DNA가 양성이고 혈청 AST/ALT가 지속적으로 상승되면서 내시경 소견상 위식도 정맥류가 없고 초음파 소견상 견경변증의 증거가 없는 경우로 정의하였다(Lok AS, Heathcote EJ, Hoofnagle JH. Management of hepatitis B: 2000-summary of workshop. Gastroenterology2001;120: 1828-1853.). The definition and diagnosis of liver disease in the present specification were judged by combining clinical, biochemical and radiological findings. Patients who are clinically positive for HBsAg are those who have HBeAg positive, anti-HBe negative, HBV DNA positive, serum transaminase is normal, and there is no radiological evidence of chronic liver disease. Defined as. HBeAg seroconversion is HBeAg negative, anti-HBe positive, HBV DNA negative and serum transaminase is normal. Chronic hepatitis B is HBsAg positive for at least 6 months and HBV DNA positive and serum AST / ALT regardless of HBeAg. It was defined as continually elevated gastroesophageal varices without endoscopic findings and no evidence of symptomatology with ultrasound findings (Lok AS, Heathcote EJ, Hoofnagle JH.Management of hepatitis B: 2000-summary of workshop.Gastroenterology 2001; 120: 1828-1853.).
간경변증은 임상적으로 문맥압 항진증 (예, 식도정맥류, 비장 종대, 혈소판 <100,000/m3) 소견이 있거나, 복부 초음파상 간경변증으로 의심되는 소견 등을 종합하여 진단하였으며 (Di Lelio, A., Cestari, C, Lomazzi, A, Beretta, L. Cirrhosis: diagnosis with sonographic study of the liver surface. Radiology 1989;172: 389-392), 간세포암은 혈청 AFP치가 400pg/mL이상이면서 전형적인 과혈관상의 CT 소견을 보인 경우 (Bruix J, Sherman M, Llovet JM, Beaugrand M, Lencioni R, Burroughs AK, Christensen E, Pagliaro L, Colombo M, Rodes J for the EASL panel of expert on HCC. Clinical management of hepatocellular carcinoma: conclusions of the Barcelona-2000 EASL conference. J Hepatol 2001;35:421-430), 또는 그렇지 않은 경우는 간생검을 통하여 진단하였다. Liver cirrhosis was diagnosed clinically by combining portal hypertension (eg esophageal varices, splenomegaly, platelet <100,000 / m3) or suspected liver cirrhosis with abdominal ultrasonography (Di Lelio, A., Cestari, C). , Lomazzi, A, Beretta, L. Cirrhosis: diagnosis with sonographic study of the liver surface.Radiology 1989; 172: 389-392), hepatocellular carcinoma with serum AFP levels above 400 pg / mL and typical hypervascular CT findings (Bruix J, Sherman M, Llovet JM, Beaugrand M, Lencioni R, Burroughs AK, Christensen E, Pagliaro L, Colombo M, Rodes J for the EASL panel of expert on HCC.Clinical management of hepatocellular carcinoma: conclusions of the Barcelona- 2000 EASL conference.J Hepatol 2001; 35: 421-430), or else, liver biopsy.
4) 혈청 DNA의 추출4) Extraction of Serum DNA
173명의 환자에서 유래된 혈청으로부터 DNA를 추출하였다. 이를 요약하면, 상기 환자들로부터 채취한 혈청 100 uL에 DNAzol (Molecular Research Center, Inc, Ohio, USA) 500 uL를 첨가한 후, 1분간 볼텍스를 수행하고, 페놀/클로로포름/이소아밀알코올(50:49:1) 500 uL를 첨가하였다. 이를 실온에서 10분간 12,000 rpm으로 원심분리한 후, 상층액 400 uL를 취하여 새로운 튜브에 옮긴 후, 여기에 이소 프로판올 260 uL를 첨가하고, 4℃에서 10분간 15,000 rpm으로 원심분리하였다. 침전물을 70% 에탄올로 세척한 후, TBE buffer 30uL를 첨가하여 DNA를 회수하였다. DNA was extracted from serum derived from 173 patients. In summary, 500 uL of DNAzol (Molecular Research Center, Inc, Ohio, USA) was added to 100 uL of serum collected from the patients, followed by vortexing for 1 minute, and phenol / chloroform / isoamyl alcohol (50: 49: 1) 500 uL was added. It was centrifuged at 12,000 rpm for 10 minutes at room temperature, 400 uL of supernatant was taken and transferred to a new tube, after which 260 uL of isopropanol was added and centrifuged at 15,000 rpm for 10 minutes at 4 ° C. After washing the precipitate with 70% ethanol, 30uL of TBE buffer was added to recover the DNA.
5) HBV preS1 유전자 염기서열 분석5) HBV preS1 gene sequence analysis
PreS1 결손 유전자 변이양상을 분석하기 위하여, 15명의 간암환자 유래 HBV를 대상으로 하여 preS1 부위의 염기서열을 분석하였다. HBV의 유전자 영역 중에서 preS1 와 preS2 부위를 전부 포함하고 S 부위의 일부를 포함하는 부위 (672-bp, 즉 HBV의 염기서열 중에서 2814 번째 염기에서 )를 표적으로 하여 PCR로 증폭한 후, 염기 서열을 분석하였다. 염기서열 위치의 기준은 야생형 유전형 C형의 HBV의 전체 게놈 3215-bp (SEQ ID NO: 19) 중에서 preS2 부위에 존재하는 EcoRI 인지 위치를 첫 번째 염기 서열로 하였다 (도 1 참조). PCR을 위한 프라이머 쌍으로는 정방향 프라이머로서 DelF2 (5'- GGG TCA CCA TAT TCT TGG G-3' 센스 뉴클레오타이드, SEQ ID NO: 13, 2814번째 염기부터 2833 번째 염기까지에 해당)와 역방향 프라이머로 PreS-R1 (5'-ATT GAG AGA AGT CCA CCA CGA-3' 안티센스 뉴클레오타이드,SEQ ID NO: 14, 274번째 염기부터 254번째 염기까지에 해당)을 이용하였다 (도 1 참조). In order to analyze the patterns of mutations in the PreS1 deletion gene, the nucleotide sequence of the preS1 region was analyzed in HBV derived from 15 liver cancer patients. PCR amplification was carried out by targeting a region (672-bp in the base sequence of HBV) that contains all of the preS1 and preS2 regions and part of the S region of the HBV gene region, and then amplifies the nucleotide sequence. Analyzed. The base sequence was based on the EcoRI recognition position present at the preS2 site in the entire genome 3215-bp (SEQ ID NO: 19) of HBV of wild-type genotype C (see FIG. 1). Primer pairs for PCR include DelF2 (5'- GGG TCA CCA TAT TCT TGG G-3 'sense nucleotide, SEQ ID NO: 13,
PCR은 Bioneer(Chungbuk, Korea)의 AccuPower PCR PreMix (2 U of Taq polymerase, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2)를 이용하여 수행하였다. 튜브에 DNA 3 ul (50 ng) 를 첨가 한 후 상기 한 쌍의 프라이머를 각각 20 pmol 씩 첨가하여 PCR을 수행하였다. PCR 조건으로서, 최초 변성(denature) 95℃에서 10분, 40 cycle로 95℃에서 45 초, 60℃에서 60초, 72에서 90 초로 수행하고, 최종 신장(final extension)은 72℃에서 5분의 조건으로 수행하였다 (Model 9600 thermocycler, Perkin-Elmer Cetus, Norwalk, USA). 증폭된 PCR 산물은 젤 절편과 QIAEX II SYSTEM (Qiagen, Hilden, Germany)을 이용하여 672 bp의 PCR 산물을 회수하였다. 그리고 나서, 상기 672 bp 산물을 TOPO SYSTEM (In vitrogen, USA)을 이용하여 TOPO TA vector (TOPO SYSTEM)에 클로닝한 후, Top 10 대장균(TOPO SYSTEM) 에 형질전환 시켰다. 상기 대장균을 24 시간동안 진탕 배양한 후, 통상적인 방법으로 plasmid DNA를 회수하였다. 회수된 plasmid DNA를 벡터 안의 프라이머인 M13 정방향 프라이머 (5'-GTA AAA CGA CGG CCA G-3', SEQ ID NO: 17) 및 M13 역방향 프라이머 (5'-CAG GAA ACA GCT ATG AC-3', SEQ ID NO: 18)를 이용하여 양쪽으로 염기서열을 분석하였다. PCR was performed using AccuPower PCR PreMix (2 U of Taq polymerase, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl 2) of Bioneer (Chungbuk, Korea). PCR was performed by adding 3 ul (50 ng) of DNA to the tube and adding 20 pmol of the pair of primers, respectively. As PCR conditions, initial denature was performed at 95 ° C for 10 minutes, 40 cycles at 95 ° C for 45 seconds, at 60 ° C for 60 seconds, and for 72 to 90 seconds, and the final extension of 5 minutes at 72 ° C. Condition was performed (Model 9600 thermocycler, Perkin-Elmer Cetus, Norwalk, USA). The amplified PCR product was recovered by gel fragment and 672 bp PCR product using QIAEX II SYSTEM (Qiagen, Hilden, Germany). Then, the 672 bp product was cloned into the TOPO TA vector (TOPO SYSTEM) using the TOPO SYSTEM (In vitrogen, USA), and transformed into Top 10 E. coli (TOPO SYSTEM). The E. coli was shaken for 24 hours, and then plasmid DNA was recovered by a conventional method. The recovered plasmid DNA was subjected to M13 forward primer (5'-GTA AAA CGA CGG CCA G-3 ', SEQ ID NO: 17) and M13 reverse primer (5'-CAG GAA ACA GCT ATG AC-3') The sequence was analyzed on both sides using SEQ ID NO: 18).
모두 각 검체 당 5개의 클론들의 염기서열을 분석하여 preS1 유전자 코딩 개시부위에서의 염기 결손 여부를 판단하였다. 염기서열 분석은 자동염기서열 장치인 Applied Biosystems model 377 DNA automatic sequencer (Perkin-Elmer Applied Biosystems, Warrington, UK)로 수행하였고, 반응은 Big Dye Terminator Cycle Sequencing kit (Perkin-Elmer Applied Biosystems)을 이용하여 수행하였다. 주형 DNA로는 500 ng 의 회수된 plasmid DNA를 사용하였고, 시발체는 M13 양쪽 시발체 중에 한쪽 방향으로만 5 pmol을 Big Dye Terminator v2.0 100 RR mix (Perkin-Elmer Applied Biosystems) 4 uL 에 멸균증류수를 첨가하여 최종 부피 10 uL가 되도록 하여 반응을 수행하였다. 조건은 30 cycles로 96℃에서 10초, 60℃에서 5초, 60℃에서 4분으로 수행하였다. 분석된 염기서열은 후에 DNASTAR의 Megalign 프로그램을 (Window Version 3.12e; Madison, USA)이용하여 본 연구에서 분석된 염기서 열을 다정렬(multiplealignment) 한 후, Genbank에 등록된 유전형 C형 및 D형에 해당되는 표준 염기서열과 비교분석 하였다.In all, the base sequences of five clones of each sample were analyzed to determine whether there was a base deletion at the start of the preS1 gene coding. Sequencing was performed with an Applied Biosystems model 377 DNA automatic sequencer (Perkin-Elmer Applied Biosystems, Warrington, UK), an automatic nucleotide sequencer, and the reaction was performed using a Big Dye Terminator Cycle Sequencing kit (Perkin-Elmer Applied Biosystems). It was. For template DNA, 500 ng of recovered plasmid DNA was used. For primers, 5 pmol of one side of M13 primer was added to one side of Big Dye Terminator v2.0 100 RR mix (Perkin-Elmer Applied Biosystems). The reaction was carried out to a final volume of 10 uL. Conditions were carried out in 30 cycles for 10 seconds at 96 ℃, 5 seconds at 60 ℃, 4 minutes at 60 ℃. The analyzed sequences were later subjected to multiple alignment of the sequences analyzed in this study using DNASTAR's Megalign program (Window Version 3.12e; Madison, USA), followed by genotypes C and D of Genbank. Comparison was made with standard sequences corresponding to
6) preS1 유전자의 코딩 개시부위 결손 유전자 변이주 검출용 nested PCR6) nested PCR for detecting the coding mutation of the preS1 gene
본 발명에서 제시되는 두 쌍의 프라이머를 사용하는 nested PCR 방법은 번거로운 염기서열 분석 없이 PCR 반응산물의 전기영동만으로 preS1 유전자의 코딩 개시부위 결손 유전자 변이를 검출할 수 있다. 본 발명의 nested PCR의 개략적인 과정을 도 1에 나타내었다.Nested PCR method using two pairs of primers presented in the present invention can detect the gene mutation of the coding start region of preS1 gene only by electrophoresis of the PCR reaction product without cumbersome sequencing. A schematic process of the nested PCR of the present invention is shown in FIG.
본 발명의 nested PCR의 첫 번째 PCR은 상기 염기서열 분석에 사용하였던 프라이머쌍 DelF2 (SEQ ID NO: 13)와 PreS-R1(SEQ ID NO: 14)을 외부 프라이머(outer primer)로 사용하여 HBV의 전체 외피 단백 중에서 preS1 와 preS2 부위를 전부 포함하고 S 부위의 일부를 포함하는 부위 (672-bp)를 증폭하였다. PCR 은 Bioneer (Chungbuk, Korea)의 AccuPower PCR PreMix (2 U of Taq polymerase, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2)를 이용하여 수행하였다. 튜브에 DNA 3 ul (50 ng) 를 첨가 한 후상기 프라이머를 각각 3 pmol 씩 첨가하여 PCR을 수행하였다. 본 발명의 nested PCR의 첫 번째 PCR 조건은 최초 변성 95℃에서 10분, 30 cycle로 95℃에서 45 초, 52℃에서 60초, 72℃에서 90 초, 최종 신장 72℃에서 5분의 조건으로 수행하였다 (Model 9600 thermocycler, Perkin-Elmer Cetus, Norwalk, USA). In the first PCR of the nested PCR of the present invention, the primer pair DelF2 (SEQ ID NO: 13) and PreS-R1 (SEQ ID NO: 14), which were used for the sequencing, were used as the outer primers. Of the whole envelope protein, a region (672-bp) containing all of the preS1 and preS2 sites and a part of the S site was amplified. PCR was performed using AccuPower PCR PreMix (2 U of Taq polymerase, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl 2) of Bioneer (Chungbuk, Korea). PCR was performed by adding 3 ul (50 ng) of DNA to the tube and then adding 3 pmol of each of the primers. The first PCR conditions of the nested PCR of the present invention is the first denaturation at 95 ℃ 10 minutes, 30 cycles at 95 ℃ 45 seconds, 52 ℃ 60 seconds, 72 ℃ 90 seconds, final elongation at 72
본 발명의 nested PCR의 두 번째 PCR은 결손이 없는 야생형인 경우 HBV 전체 염기서열 중에서 2827에서 3034 까지의 preS1의 일부를 포함하는 208-bp를 표적으로 하였다. 두 번째 PCR을 위한 내부 프라이머 쌍 중에서, 정방향 프라이머로서 Del-PRA-F1 (5'- CTT GGG AAC AAG AGC TAC AGC-3' 센스 뉴클레오타이드, SEQ ID NO: 15, 2827번째 염기부터 2847번째 염기까지에 해당), 역방향 프라이머로서 Del-PreS1-R (5'- ATG CTC CCR CTC CTA CCK GAT-3' 안티센스 뉴클레오타이드, SEQ ID NO: 16, 3034번째 염기부터 3013번째 염기까지에 해당)을 사용하였다. 두 번째 PCR은 첫 번째 PCR의 증폭산물인 672-bp 3ul을 주형 DNA로 사용하였고, 상기 프라이머를 각각 20 pmol씩 첨가하여 수행하였다. Nested PCR의 두 번째 PCR 조건은 최초 변성 95℃에서 10분, 40 cycle로 95℃에서 45 초, 60℃에서 60초, 72℃에서 90 초, 최종 신장 72℃에서 5 분의 조건으로 수행하였다. The second PCR of the nested PCR of the present invention targeted 208-bp including a part of preS1 from 2827 to 3034 in the entire sequence of HBV in the wild type without a deletion. Among the inner primer pairs for the second PCR, Del-PRA-F1 (5′-CTT GGG AAC AAG AGC TAC AGC-3 ′ sense nucleotide, SEQ ID NO: 15,
상기와 같이 두 번의 PCR을 거친 PCR 산물은 2.5% 아가로스 젤과 7.5% 폴리아크릴 아마이드 젤 상에서 각각 전기영동 한 후, EtBr로 염색하고, PCR 증폭산물의 이동양상을 판단하여, preS1 유전자의 코딩 개시부위 결손 유전자 변이를 검출하여, 그 결과를 도 3a 및 3b에 나타내었다. DNA 마커로는 50-bp DNA ladder를 사용하였다 (M). PCR products that have undergone two PCR as described above were electrophoresed on 2.5% agarose gel and 7.5% polyacrylamide gel, respectively, stained with EtBr, and the transfer patterns of PCR amplification products were determined to start coding of the preS1 gene. Site deletion gene mutations were detected and the results are shown in FIGS. 3A and 3B. As a DNA marker, a 50-bp DNA ladder was used (M).
II. 결과 및 분석II. Results and analysis
1) 간암환자의 HBV preS1 시작부위 결손 유전자 변이 양상 분석1) Analysis of gene mutation patterns in HBV preS1 initiation region of liver cancer patients
국내의 간질환의 악화와 연관된 preS1 유전자의 유전자 결손 변이 양상을 분석하기 위하여, 총 22명의 간암환자 유래 HBV의 preS1 유전자 염기서열을 분석하였다. 각 환자 당 5 개의 클론을 제작하여 이들의 염기서열을 분석하였다. 그 결과, 22 명의 환자 중 1개 이상의 클론에서 preS1 유전자 변이를 보유하고 있는 환자는 총 6명 이었다 (27.3). 이와 같은 결과를 아래의 표 1에 나타내었다. In order to analyze the gene mutation patterns of preS1 gene associated with the worsening of liver disease in Korea, we analyzed preS1 gene sequence of HBV derived from 22 liver cancer patients. Five clones were prepared for each patient and their sequences were analyzed. As a result, six of the 22 patients had preS1 gene mutations in at least one clone (27.3). These results are shown in Table 1 below.
[표 1]TABLE 1
상기 preS1 유전자 코딩 개시부위에서 유전자 결손이 검출된 6 명의 간세포암 환자의 preS1 유전자의 변이 양상을 아래의 표 2에 나타내었다.The variation of the preS1 gene of six hepatocellular carcinoma patients whose gene deletion was detected at the preS1 gene coding initiation region is shown in Table 2 below.
[표 2]TABLE 2
표 2에서 알 수 있는 바와 같이, 상기 6명 중에서 3명 (각각 XCM-30, NOR-30, JH15이라 칭함)은 5개 클론 모두에서 제1형 또는 제3형 염기 서열 결손을 가지고 있었고, 나머지 3명 (각각 Seldi-4, JH32, JH31라 칭함)은 야생형과 결손 변이주가 서로 혼재하고 있는 것으로 나타났다. As can be seen from Table 2, three of the six (referred to as XCM-30, NOR-30, JH15, respectively) had
상기 6명의 간세포암 환자 유래의 HBV 유전자형 C의 preS1 결손 유전자 변이 양상을 분석해 본 결과, preS1 유전자에서의 결손 유전자 변이 부위 위치 및 결손 유전자 염기수 등에 따라 4가지 유형으로 분류할 수 있었다. 상기 4 가지 유형을 도 2에 나타내었다. 상기 표 2와 도 2에서 알 수 있는 바와 같이, 6명의 간세포암 환자 중 2 명의 간세포암 환자 (SCM-30, NOR-30)에서 발견된 제 I형 (Type I)은 preS1 전체 유전자 중에서 2 번째 염기부터 16 번째 염기까지 총 15-bp의 염기서열 결손을 보였다. 1 명 (Seldi-4)의 간세포암 환자에서 발견된 제 II형 (Type II)은 preS1 전체 유전자 중에서 3 번째 염기부터 17 번째 염기까지 총 15-bp의 염기서열 결손을 보였다. 또한, 1명 (JH15)의 간세포암 환자에서 발견된 제 III형(Type III)은 preS1 전체 유전자 중에서 2 번째 염기부터 22 번째 염기까지 총 21-bp의 염기서열 결손을 보였다. As a result of analyzing the preS1 deletion gene mutation pattern of HBV genotype C from the six hepatocellular carcinoma patients, it was classified into four types according to the location of the deletion gene mutation region and the number of the missing gene base in the preS1 gene. The four types are shown in FIG. 2. As can be seen in Table 2 and FIG. 2, Type I found in two hepatocellular carcinoma patients (SCM-30 and NOR-30) among six hepatocellular carcinoma patients was the second of all preS1 genes. A total of 15-bp sequence was deleted from base to 16th base. Type II (SII) was found in one patient (Seldi-4) with a total 15-bp deletion from
이 들 3가지 형 (Type I, II, III)은 모두 도 2에서 보여주는 것처럼 HBV의 large 외피 단백질의 번역 개시 부위에 영향을 주기 때문에, 원래 개시코돈 위치보다 11개 아미노산 뒤의 다음 메티오닌 코딩 코돈이 나타나는 부위에서 단백질 발현이 시작되게 된다. 따라서, 결손이 없는 HBV 유전자형 C의 preS1 단백질 부위는 119개의 아미노산을 보유하는 반면에, 본 발명의 상기 3 가지 유형의 preS1 유전자의 코딩 개시부위 결손 유전자 변이주는, HBV 유전자형 C임에도 불구하고, HBV 유전자형 D와 같이 108 개의 아미노산으로 구성된 preS1 단백질을 보유하게 된다. Since these three types (Type I, II, III) all influence the translation initiation site of the large envelope protein of HBV, as shown in Figure 2, the next methionine coding codon 11 amino acids after the original initiation codon position Protein expression begins at the site of appearance. Thus, while the preS1 protein portion of HBV genotype C without deletion contains 119 amino acids, the HBV genotype C, despite the HBV ′ genotype C, is present in the coding initiation deletion gene variant of the three types of preS1 genes of the present invention. It has a preS1 protein consisting of 108 amino acids like D.
마지막으로 제 IV형은 2 명 (JH31, JH32)의 간세포암 환자에서 발견된 것으로서, preS1 전체 유전자 중에서 7 번째 염기부터 27 번째 염기까지 총 21-bp의 염기서열 결손을 보였다. 제 4형은 상기 3 가지 형과는 다르게, large 외피 단백의 시작 부위에 영향을 주지 않기 때문에, 시작 부위는 야생형의 시작 부위와 동일하 나, 3번째 코돈에서 9번째 코돈까지의 모두 7개의 아미노산이 결손된 총 112 개의 아미노산으로 구성된 preS1 단백질을 보유하게 된다. Finally, type IV was found in 2 patients with hepatocellular carcinoma (JH31, JH32), showing a 21-bp total sequence deletion from the 7th to 27th base of preS1 gene. Because
기존에 preS 결손 변이주는 많은 논문에서 보고되었지만, 이들은 대부분 국내에 우세하게 존재하는 HBV 유전자형 C이 아닌, 유전자형 A, B, D 등에서 보고되어 있다. 그리고, 보고된 결손 유전자 변이가 주로 preS2 유전자에 집중되어 있으며, 결손 유전자의 위치가 집중되지 않고 여러부위에 산재되어 있기 때문에 결손 유전자 변이주를 검출하는 분자생물학적인 방법을 개발하는 것이 매우 곤란하였다. 기존의 논문에서 발견된 preS 유전자 변이와 비교하여 볼 때, 본 발명에서 발견된 preS1 결손 유전자 변이주는 결손이 일정한 부위, 즉 preS1 유전자의 코딩 개시 부위에 집중되어 있고, 15-21 bp의 충분한 길이의 결손이 관찰되므로, 이러한 유전자 변이체를 표적으로 한 분자생물학적인 방법의 개발이 용이하다는 장점이 있다. Previously, the preS deletion mutations have been reported in many papers, but most of them have been reported in genotypes A, B, D, etc., rather than HBV genotype C, which predominantly exists in Korea. In addition, it is very difficult to develop a molecular biological method for detecting a defective gene strain because the reported deletion gene mutation is mainly concentrated in the preS2 gene, and the position of the defective gene is not concentrated and is scattered in various parts. Compared with the preS gene mutations found in the previous papers, the preS1 deletion gene mutations found in the present invention are concentrated at a constant site, that is, the coding start site of the preS1 gene, and have a sufficient length of 15-21 bp. Since deficiencies are observed, there is an advantage in that it is easy to develop molecular biological methods targeting these gene variants.
2) preS1 시작 부위 결손 유전자 변이주 검출을 위한 nested-PCR 산물의 전기영동 결과 분석2) Analysis of electrophoretic results of nested-PCR products for detection of preS1 start site deletion gene mutants
상기한 바와 같이, 본 발명에서 발견된 preS1 결손 유전자 변이는 분자생물학적 방법의 표적으로서 적절하다는 장점이 있으므로, 본 발명에서는 염기서열 분석 없이, 한 번의 PCR 반응만으로 상기 preS1 유전자의 코딩 개시부위 결손 유전자 변이주를 검출할 수 있는 nested PCR 방법을 고안하였다 (도 1 참조). 즉, 본 발명의 전략은 결손 변이주와 야생형주가 서로 다른 크기의 preS1 PCR 증폭산물을 생산함으로써, 환자 검체에서 변이주의 존재를 검출할 수 있게 하는 것이다. As described above, the preS1 deletion gene mutation found in the present invention has the advantage that it is suitable as a target of the molecular biological method, in the present invention, without a sequencing analysis, the coding start region deletion gene mutation strain of the preS1 gene with only one PCR reaction. A nested PCR method was devised to detect (see FIG. 1). In other words, the strategy of the present invention is to allow the deletion mutant and wild-type strains to produce preS1 PCR amplification products of different sizes, thereby detecting the presence of mutant strains in patient samples.
상기의 nested PCR을 거친 PCR 산물을 2.5% 아가로스 젤과 7.5% 폴리아크릴 아마이드 젤 상에서 각각 전기영동 한 결과를 도 3a 및 3b에 나타내었다. 도 3a는 2.5% 아가로스 젤 상에서의 전기영동 결과를 보여주는 것이고, 도 3b는 7.5% 폴리아크릴 아마이드 젤 상에서의 전기영동 결과를 보여주는 것이다. 환자의 시료가 야생형 HBV preS1 유전자만을 포함하고 있을 경우에는 208-bp의 PCR 산물을 생산하고 (①), preS1 유전자 코딩 개시부위에 결손이 있는 변이주 만을 포함하고 있을 때에는 결손 크기에 따라 183-194bp 범위의 PCR 산물을 생산하며 (②), 상기 야생형과 결손 변이주가 혼합되어 있을 경우에는 두 가지 PCR 산물을 모두 생산하였다 (③). 3A and 3B show the results of the electrophoresis of the PCR products subjected to the nested PCR on 2.5% agarose gel and 7.5% polyacrylamide gel, respectively. Figure 3a shows the results of electrophoresis on 2.5% agarose gel, Figure 3b shows the results of electrophoresis on 7.5% polyacrylamide gel. If the patient's sample contains only the wild-type HBV preS1 gene, it produces a 208-bp PCR product (①), and if it contains only the mutant strain that has a defective deletion at the preS1 gene coding region, the range is 183-194bp. Produced a PCR product of (②), when the wild type and the deletion mutant is mixed, both PCR products were produced (③).
본 발명의 nested PCR 방법과 전기영동 방법을 염기서열이 분석된 22 명의 간세포암 환자 검체에 적용하여 상기 표 1에 나타낸 염기서열 결과와 비교하였다. 그 결과, 표 1에 나타낸 염기서열 분석 결과와 동일하게, nested PCR과 전기영동을 수행한 경우에도, 22명의 환자 중에서 6명의 환자에서 변이주가 검출되었고, 16 명의 환자에서는 야생형만이 존재함을 확인할 수 있었다. 도 3a 및 3b에서 확인할 수 있는 바와 같이, preS1 유전자 결손 변이주가 확인된 6명의 환자 중 3명은 변이주와 야생형이 혼재되어 있는 정도까지도 확인할 수 있었다. 본 방법의 장점은 도 3a의 레인 4와 7에서 보여주는 것처럼 환자 시료에 야생형과 변이주가 혼재되어 있을 경우에도, 두 크기의 증폭 산물의 젤 상에서의 EtBr 염색상의 강도를 서로 비교함으로써, 환자 시료 안에서 두 그룹간 (야생형 및 변이주)의 상대적인 분포비율까지도 알 수 있다는 것이다. The nested PCR method and the electrophoresis method of the present invention were applied to 22 hepatocellular carcinoma patients whose base sequences were analyzed and compared with the base sequence results shown in Table 1 above. As a result of the sequencing analysis shown in Table 1, even when nested PCR and electrophoresis were performed, mutants were detected in 6 of 22 patients and only wild type was present in 16 patients. Could. As can be seen in Figures 3a and 3b, three of the six patients with preS1 gene deletion mutant was confirmed to the extent that the mutant and wild type is mixed. The advantage of the method is that even when the patient sample is mixed with wild-type and mutant strains, as shown in
3) preS1 유전자의 코딩 개시부위 결손 유전자 변이주 검출용 nested-PCR 방 법의 환자 시료에의 적용3) Application of the nested-PCR method for detecting the gene mutation of the coding start region of preS1 gene to patient samples
본 발명의 preS1 유전자의 코딩 개시 부위 결손 유전자 변이가 국내 환자에 있어서 간질환의 악화와 연관성이 있는지 여부를 분석하기 위하여, 본 발명에서 개발된 preS1 시작 부위 결손 변이주 검출용 nested PCR 방법을 다양한 임상증상을 보이는 158명의 HBV 간질환 환자[간세포암 (HCC): 67명, 간경변 (LC): 57명, 만성간염 (CH): 34명]의 검체에 적용하였다. 그 결과를 아래의 표 3에 나타내었다. In order to analyze whether the coding start site deletion gene mutation of the preS1 gene of the present invention is related to the exacerbation of liver disease in domestic patients, the nested PCR method for detecting the preS1 start site deletion mutation strain developed in the present invention has various clinical symptoms. 158 patients with HBV hepatic disease (hepatocellular carcinoma (HCC): 67, cirrhosis (LC): 57, chronic hepatitis (CH): 34) were enrolled. The results are shown in Table 3 below.
[표 3]TABLE 3
상기 표 3에서 알 수 있는 바와 같이, 본 발명의 preS1 유전자 코딩 개시부위 결손 변이주의 빈도는, 임상 증상의 악화 정도에 따라서 preS1 시작 부위 결손 변이주 빈도가 높아짐을 알 수 있었다 [간염 (3.0%) → 간경변 (12.3%) → 간암 (20.9%)]. 따라서, 본 발명의 preS1 유전자 코딩 개시부위 결손 변이는 HBV 감염 환자의 간질환 증상 악화와 밀접한 관계가 있음을 알 수 있다.As can be seen in Table 3, the frequency of the preS1 gene coding start-up mutant strain of the present invention, it can be seen that the frequency of the preS1 start-up mutant strain increases according to the exacerbation of clinical symptoms [hepatitis (3.0%) → Cirrhosis (12.3%) → liver cancer (20.9%)]. Therefore, it can be seen that the mutation of the preS1 gene coding initiation region of the present invention is closely related to worsening of liver disease symptoms in HBV-infected patients.
상기한 바와 같이, 국내의 B 형 간염 바이러스 환자의 경우, HBV의 유전형 A, B, 및 D 형이 만연되는 다른 나라와 달리 대부분이 유전형 C에 감염되어 있으며, 이러한 유전형 C는 일반적으로 보균자, 간염, 간경변, 간(세포)암으로 연속적 인 임상경과를 보이는 것으로 알려져 있기 때문에, 본 발명에서 발견한 preS1 시작 부위 결손 유전자 변이는 환자의 다음 간질환 단계로의 전이를 촉진시키는 요인인 것으로 입증되어, 간질환 증상의 악화 가능성의 예측 및 진단과, 이러한 악화를 방지하기 위한 치료제 개발을 위한 표적으로서 매우 유용하다. As described above, in the case of hepatitis B virus patients in Korea, most of the other countries where genotypes A, B, and D of HBV are prevalent, most are infected with genotype C, and genotype C is generally carriers, hepatitis Because it is known to have a continuous clinical course of liver, cirrhosis, and liver (cell) cancer, the preS1 start site deletion gene mutation found in the present invention has been proven to be a factor that promotes metastasis to the next stage of liver disease. It is very useful as a target for predicting and diagnosing the possibility of exacerbation of liver disease symptoms and for developing therapeutics to prevent such exacerbations.
서열목록 전자파일 첨부 Attach sequence list electronic file
Claims (21)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020060030113A KR100758727B1 (en) | 2006-04-03 | 2006-04-03 | Composition for diagnosing the progress of liver disease in hbv infected patient and kit containing the same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020060030113A KR100758727B1 (en) | 2006-04-03 | 2006-04-03 | Composition for diagnosing the progress of liver disease in hbv infected patient and kit containing the same |
Publications (1)
Publication Number | Publication Date |
---|---|
KR100758727B1 true KR100758727B1 (en) | 2007-09-14 |
Family
ID=38737809
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020060030113A KR100758727B1 (en) | 2006-04-03 | 2006-04-03 | Composition for diagnosing the progress of liver disease in hbv infected patient and kit containing the same |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR100758727B1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20140044924A (en) * | 2011-11-25 | 2014-04-15 | 서울대학교산학협력단 | Hepatitis b virus-derived cis-regulatory element and use thereof |
CN106957851A (en) * | 2016-01-12 | 2017-07-18 | 香港中文大学深圳研究院 | A kind of endoplasmic reticulum spike and the method for triggering er stress |
-
2006
- 2006-04-03 KR KR1020060030113A patent/KR100758727B1/en active IP Right Grant
Non-Patent Citations (1)
Title |
---|
염기서열 |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20140044924A (en) * | 2011-11-25 | 2014-04-15 | 서울대학교산학협력단 | Hepatitis b virus-derived cis-regulatory element and use thereof |
EP2784159A4 (en) * | 2011-11-25 | 2015-08-05 | Snu R&Db Foundation | Hepatitis b virus-derived cis-regulatory element and use thereof |
KR101662917B1 (en) * | 2011-11-25 | 2016-10-06 | 서울대학교산학협력단 | Hepatitis b virus-derived cis-regulatory element and use thereof |
CN106957851A (en) * | 2016-01-12 | 2017-07-18 | 香港中文大学深圳研究院 | A kind of endoplasmic reticulum spike and the method for triggering er stress |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Chan et al. | Viral genotype and hepatitis B virus DNA levels are correlated with histological liver damage in HBeAg-negative chronic hepatitis B virus infection | |
Yeh et al. | Quantification and genotyping of hepatitis B virus in a single reaction by real-time PCR and melting curve analysis | |
Chen et al. | Pre-S deletion and complex mutations of hepatitis B virus related to advanced liver disease in HBeAg-negative patients | |
Bayliss et al. | Hepatitis B virus splicing is enhanced prior to development of hepatocellular carcinoma | |
Tanaka et al. | Two subtypes (subgenotypes) of hepatitis B virus genotype C: A novel subtyping assay based on restriction fragment length polymorphism | |
KR101209312B1 (en) | A method for detecting hbv using real time pcr | |
Kato et al. | High prevalance of TT virus infection in Japanese patients with liver diseases and in blood donors | |
Tangkijvanich et al. | A case–control study on sequence variations in the enhancer II/core promoter/precore and X genes of hepatitis B virus in patients with hepatocellular carcinoma | |
Raimondo et al. | Non-sequencing molecular approaches to identify preS2-defective hepatitis B virus variants proved to be associated with severe liver diseases | |
JP2005058234A (en) | Pcr primer set for detecting hepatitis b, and method for detecting hepatitis b and using the primer set | |
KR100758727B1 (en) | Composition for diagnosing the progress of liver disease in hbv infected patient and kit containing the same | |
KR20140022971A (en) | Diagnostic primer for the heatitis b virus, probe, kit including same, and method for diagnosing the hepatitis b virus using the kit | |
KR101162088B1 (en) | A Kit for Diagnosing Hepatitis B-Associated Hepatic Disorder Using Real-Time PCR | |
Angounda et al. | Molecular characterization of hepatitis B virus among chronic hepatitis B patients from Pointe Noire, Republic of Congo | |
Lee et al. | Correlation of HBV DNA levels in serum and liver of chronic hepatitis B patients with cirrhosis | |
KR101418836B1 (en) | Markers for diagnosing liver disease and its use | |
AU3141501A (en) | An assay for detecting variant hapatitis b viruses (hbvs) which exhibit altered sensitivity to agents | |
KR101503039B1 (en) | Diagnostic primer for the heatitis c virus, probe, kit including same, and method for diagnosing the hepatitis c virus using the kit | |
US9879330B2 (en) | Hepatitis B variants with reduced sensitivity to therapeutic compounds, their detection and uses thereof | |
Bubonja-Šonje et al. | Prevalence of occult hepatitis B virus infection and characterisation of hepatitis B surface antigen mutants among adults in western Croatia | |
Osiowy et al. | Discordant diagnostic results due to a hepatitis B virus T123A HBsAg mutant | |
JP4330833B2 (en) | Nucleic acid molecule possessed by novel hepatitis B virus and detection method thereof | |
KR101394973B1 (en) | Method for predicting the risk of hepato celullar carcinoma occurred in chronic hepatitis B infected patients | |
KR100764850B1 (en) | A diagnostic kit for hepatitis b employing hbv s antigen | |
CN114182013A (en) | Kit for diagnosing susceptibility of hepatocellular carcinoma and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20120907 Year of fee payment: 6 |
|
FPAY | Annual fee payment |
Payment date: 20130826 Year of fee payment: 7 |
|
FPAY | Annual fee payment |
Payment date: 20140822 Year of fee payment: 8 |
|
FPAY | Annual fee payment |
Payment date: 20151224 Year of fee payment: 9 |
|
FPAY | Annual fee payment |
Payment date: 20170824 Year of fee payment: 11 |
|
FPAY | Annual fee payment |
Payment date: 20180820 Year of fee payment: 12 |
|
FPAY | Annual fee payment |
Payment date: 20190917 Year of fee payment: 13 |