KR100758727B1 - Composition for diagnosing the progress of liver disease in hbv infected patient and kit containing the same - Google Patents

Abstract

A composition for diagnosis of the progress of liver disease of a HBV(Hepatitis B Virus) infected patient and a kit containing the same composition are provided to anticipate, diagnose and prevent the progress of liver disease of the HBV infected patient by confirming nucleotide deletion of a preS1 initiation site. A polynucleotide which has base deletions of 15-21 bp(2848th to 2880th bases) in the coding initiation site of preS1 gene of HBV genotype C genome genes having the nucleotide sequence of SEQ ID NO:19, and total 15-400 continuous bases located at both ends of the deletion site is provided, wherein the base deletion is 15bp base deletion from 2849th-2863th bases in the nucleotide sequence of SEQ ID NO:19, 15bp base deletion from 2850th-2864th bases in the nucleotide sequence of SEQ ID NO:19, 21bp base deletion from 2849th-2869th bases in the nucleotide sequence of SEQ ID NO:19, or 21bp base deletion from 2854th-2874th bases in the nucleotide sequence of SEQ ID NO:19. The composition for diagnosis of the progress of liver disease of a HBV infected patient comprises the probe having a nucleotide sequence complementary with the polynucleotide sequence, selected from SEQ ID NOs:9, 10, 11 and 12 to detect the polynucleotide.

Description

COMPOSITION FOR DIAGNOSING THE PROGRESS OF LIVER DISEASE IN HBV INFECTED PATIENT AND KIT CONTAINING THE SAME}

1 is a schematic diagram showing a method for detecting a gene deletion mutant of the coding start site of the preS1 gene using the nested PCR method in the present invention.

Figure 2 shows the deletion site of the preS1 gene in an embodiment of the invention.

Figures 3a and 3b show the results of electrophoresis of nest PCR products to detect coding initiation site deletion of the preS1 gene, 3a is the result of electrophoresis on 2.5% agarose gel, 3b is on 7.5% polyacrylamide gel Electrophoresis results.

Figure 4 shows the nucleotide sequence of the type I polynucleotide of the present invention.

Figure 5 shows the nucleotide sequence of the type II polynucleotide of the present invention.

Figure 6 shows the nucleotide sequence of the type III polynucleotide of the present invention.

Figure 7 shows the nucleotide sequence of the type IV polynucleotide of the present invention.

The present invention is to determine whether 15 or 21 base deletions in the coding start region of the preS1 gene of HBV genotype C in a sample taken from a domestic HBV infection patient, to diagnose the possibility of exacerbation of liver disease in the domestic HBV infection patients It's about technology.

Hepatitis B virus (HBV) is known to have infected more than 300 million people worldwide, ultimately causing acute and chronic infections, cirrhosis and hepatocellular carcinoma. And mortality.

Hepatitis B virus surface antigen (HBsAg) positive rates vary widely from region to region, with only 0 to 3% in the United States, but before the vaccination began, 8 to 8 in Northeast Asia, including China, Taiwan, and Japan. 10% (Zeng G, Wang Z, Wen S, Jiang J, Wang L, Cheng J, Tan D, Xiao F, Ma S, Li W, Luo K, Naoumov NV, Hou J. Geographic distribution, virologic and clinical characteristics of hepatitis B virus genotypes in China.J Viral Hepat. 2005).

Patients with chronic HBV infection in Korea have been decreasing gradually since the start of active vaccination business since 1983. According to various literatures published since the 1990s, HBsAg positive rate was about 5.1 to 7.5%. Lee DH, Kim JH, Nam JJ, Kim HR, Shin HR.Epidemiological findings of hepatitis B infection based on 1998 National Health and Nutrition Survey in Korea.J Korean Med Sci. 2002; 17 (4): 457-62) .

However, Korea is still a HBV rampant region, showing a 10 times higher prevalence than the United States and European advanced countries. Most infections are concentrated in children under 5 years of age, which are known to have poorer clinical course than adults. Currently, the mortality rate from chronic liver disease such as viral hepatitis, cirrhosis and liver cancer accounts for 8.5% of all deaths (12.0% male and 4.0% female). Therefore, hepatitis B, the main cause of chronic liver disease in Korea, can be said to be the most damaging to national health among all infectious diseases both quantitatively and qualitatively.

HBV is a major cause of liver cancer. In the United States, about 50% of all primary liver cancers are caused by HBV. In Korea, there is a slight difference in each region, but overall, about 75 to 78% of primary liver cancers are known to be caused by HBV, which is very high compared to developed countries such as the US (Cheon JH, Park). JW, Park KW, Kim YI, Kim SH, LeeWJ, Park HS, Park SJ, Hong EK, Kim CM.The clinical report of 1,078 cases of hepatocellular carcinomas: National Cancer Center experience.Korean J Hepatol. 2004; 10 (4) : 288-97.).

Infections of HBV typically have a variety of clinical paths leading to asymptomatic infection, chronic hepatitis, cirrhosis, and hepatocellular carcinoma. It is thought that various factors, such as host factors, virus factors, and environmental factors, may be involved in the diversity of clinical course. As host factors, age, HLA, etc., are reported, and viral factors, such as HBV sequence variation and HBV genotype, are reported to play an important role in the clinical course of HBV infection.

In light of this, in order to study the correlation between clinical progress and treatment effect and HBV in Korea, research should focus on the distribution and genetic variation of HBV genotype, a viral factor known to affect clinical outcomes. It is thought to be desirable.

Recent studies, including our study, show that most of the HBVs isolated from domestic HBV-infected patients are genotype C, unlike in most other countries, where genotypes A, B, and D dominate. (Kim BJ, Song BC. Distribution of hepatitis B virus genotypes according to the clinical outcomes in patients with chronic hepatitis B virus infection in Jeju island.Korean J Gastroenterol. 2003; 42 (6): 496-501.). Since genotype C of HBV is known to be relatively pathogenic compared to genotype B, unlike other regions in which genotypes B and C of HBV are known to coexist, genotype C is predominantly exclusively distributed in Korea. The fact is that it can have a significant biological and clinical impact in the treatment of HBV. When only genotype C, which is known to be relatively pathogenic compared to genotype B, exists exclusively in Korea, since genetic recombination occurs only between genotype C, which lacks genetic diversity, it produces a domestically unique mutagenic strain that is highly pathogenic or infectious. There is a problem that can not exclude the possibility to proceed in the direction.

The preS site of HBV consists of the preS1 site and the preS2 site. These preS1 and preS2 are composed of one ORF together with S antigens, and each encodes a Large S antigen and a Middle S antigen that share the same C terminus as each S antigen. Among these, preS1 protein is known to be more essential than the preS2 protein in the life cycle of HBV such as virion formation and secretion. On the other hand, gene mutations in the preS region, particularly deletion gene mutations, are known to be associated with exacerbation of liver disease, in particular hepatocellular carcinoma. The mechanism by which this sequence of the preS region affects the exacerbation of liver disease is not yet clear, but perhaps the genetic variation affects the expression rate of Large S antigen, Middle S antigen, and S protein triprotein. Cytotoxicity is thought to be induced because proteins accumulate in cells rather than secreted out of cells (Locarnini S, McMillan J, Bartholomeusz A. The hepatitis B virus and common mutants. Semin Liver Dis. 2003; 23 (1): 5 -20.Review).

However, most of the reports that the gene defects in the preS region are related to exacerbation of liver disease are mostly related to HBV outside of Korea, and unlike other regions, HBV genotype C is applied to domestic HBV patients who are predominantly superior. It was not appropriate. In addition, since the pattern of mutation of the pre-S deletion gene is not limited to a specific site and is interspersed over all of the preS1 and / or preS2 sites, targeting of these preS1 deletion genes is difficult, and these preS1 are difficult to target. There have been limitations in the development of diagnostic methods to target HBV mutants with preS1 deletion genes that are linked to exacerbation of liver disease by targeting the missing genes.

In order to overcome the above problems, the present invention is to determine whether 15 or 21 base deletions in the coding start region of the preS1 gene of genotype C of HBV in a sample taken from a domestic HBV infected patient, the liver of the domestic HBV infected patients Its primary purpose is to provide techniques for predicting and diagnosing the likelihood of disease symptoms worsening.

More specifically, an object of the present invention is a polynucleotide having 15 or 21 base deletions in the coding initiation site of the preS1 gene of HBV genotype C and encoded by the polynucleotide, and in the N terminal region of the preS1 protein of HBV genotype C. It is to provide a composition for diagnosing the possibility of liver disease worsening in a domestic HBV-infected patient comprising at least one selected from the group consisting of a protein having a 5 to 11 amino acid deletion.

Still another object of the present invention is to provide a probe for detecting a polynucleotide having 15 or 21 base deletions in the coding start site of the preS1 gene of HBV genotype C and a DNA chip comprising the same.

It is still another object of the present invention to provide a kit for diagnosing the possibility of liver disease exacerbation in a domestic HBV infected patient comprising at least one sample collected from a domestic HBV infected patient and a detection means targeting the polynucleotide or protein.

Still another object of the present invention is to provide a method for detecting polynucleotide, comprising performing nested PCR using two pairs of primers on a sample collected from a domestic HBV infected patient, and electrophoresis of the obtained PCR product. It is.

The present invention relates to a technique for predicting and / or diagnosing the possibility of exacerbation of liver disease by confirming whether or not a specific pattern of bases are deleted at a coding start site of the preS1 gene of HBV genotype C in a sample collected from a domestic HBV infected patient.

The present inventors analyzed the sequencing of the HBV preS1 region of Korean HBV patients showing various clinical symptoms, and found a genetic variation pattern of the domestic specific preS1 region related to the exacerbation of liver disease in HBV hepatitis patients in Korea. As a result of repeated studies to develop a molecular biological diagnostic method for detecting a modified HBV gene exhibiting a variation, the present invention has been completed.

In the present invention, the analysis of the nucleotide sequence of the preS1 site in hepatitis B virus (HBV) of patients with liver cancer in Korea revealed that the preS1 gene of HBV has a specific pattern of gene deletion. This specific pattern of defective gene variants ultimately results in a pattern that causes 15 or 21 bp of gene deletion in the coding start of the preS1 gene of HBV ′ genotype C, which accounts for the majority of HBV in Korea, ultimately. Compared with the wild type preS1 protein of HBV genotype C, it will produce a mutant preS1 protein which lacks 5 to 11 amino acids in the N-terminal region.

Therefore, according to the present invention, a PCR product obtained by PCR polymerase chain reaction (PCR) of a mutant preS1 gene having a specific pattern of gene deletion as described above in a sample taken from a domestic HBV patient or a protein encoded from the mutant preS1 gene. By electrophoresis of a mutant preS1 protein having 5 to 11 amino acid deletions at the N terminus on agarose gels or polyacrylamide gels, HBV is simple and accurate without the need for time and costly sequencing or amino acid sequencing. Variants with specific gene deletions at the coding initiation site of the preS1 gene can be detected to more easily predict and / or diagnose liver disease aggravation in PBV patients.

In addition, in the present invention, in order to analyze the association between the base defect of HBV preS1 and the deterioration of clinical symptoms of HBV infected patients, the diagnosis of the present invention was carried out on samples collected from domestic chronic HBV infected patients with various clinical symptoms. As a result of analyzing the relative detection frequency of the mutant strains having the coding initiation defect of the preS1 gene using the method, the gene deletion in the coding initiation region of the preS1 gene of the above pattern was found to be cirrhosis and And / or have been closely associated with exacerbation of liver disease symptoms to hepatocellular carcinoma. This is because the diagnostic technology that targets genes having a specific pattern of base defects in the preS1 gene coding initiation site found in the present invention determines the clinical symptoms and prognosis of HBV-infected patients in Korea, and the symptoms of liver cirrhosis and / or hepatocellular carcinoma later. It is a very useful technique that can help predict and deteriorate.

In the present invention, the 'coding initiation site of the preS1 gene' refers to a site around the start codon of the preS1 gene. More specifically, the first base of the initiation codon [the entire genome gene of HBV genotype C (AY641558, SEQ ID) NO: 19) on the basis of the 2848th base (FIG. 1)] to the 33rd base before another methionine coding codon located next. In addition, in the present invention, the 'N-terminal region of the preS1 protein' refers to a site around methionine encoded by the start codon of the preS1 gene, and more specifically, a site from the first amino acid methionine to the eleventh amino acid. Means.

More specifically, the present invention provides 15 or 21 bp at sites from base 1 (base line 2848 to base 33) to base 33 of the coding start of the preS1 gene of HBV genotype C (SEQ ID NO: 19). Provided are polynucleotides as targets for diagnosing the possibility of exacerbation of liver disease symptoms characterized by having a base deletion of. The polynucleotide is not limited in the length of the nucleotide sequence so long as it includes a base deletion of 15 or 21 bp at the base 1 to 33 base coding region of the preS1 gene as described above, the base deletion site It may be from about 10 bp to full-length gene, including both adjacent portions of. In consideration of both the accuracy and ease of diagnosis, the length of the target polynucleotide of the present invention is preferably 15 bp to 400 bp, more preferably 50 bp to 250 bp.

In the present invention, the mutation pattern of the preS1 gene of HBV genotype C was examined from samples collected from patients with HBV infection and liver cirrhosis or hepatocellular carcinoma developed in HBV infection. Specific patterns of genetic variation with base deletions of 15 bp or 21 bp at bases 33 to 33 are common to the HBV-infected patients and liver cirrhosis or hepatocellular carcinoma patients, and as symptoms worsen (ie, The frequency of HBV infection-> cirrhosis-> hepatocellular carcinoma) increased (see Table 3). Thus, polynucleotides having a base deletion of 15 bp or 21 bp at sites 1 to 33 of the coding initiation region of the preS1 gene of HBV genotype C as described above may be used for cirrhosis and / or hepatocellular carcinoma of HBV infection. It can be used as a target polynucleotide capable of predicting or diagnosing the possibility of worsening such as. In addition, the polynucleotides are also useful as target polynucleotides for the development of therapeutic agents for preventing the worsening of liver disease symptoms in patients with HBV infection.

In an embodiment of the present invention, the genetic variation of the specific pattern as described above is 15 bp at a site from base 1 (base station 2848 to base 33) to base 33 of the coding start of the preS1 gene or 21 bp base deletion, and more specifically, may have the following four forms (see FIG. 2):

Type I: 15-bp base deletion form (eg SEQ ID NO: 1) from the second base of the start codon of the preS1 gene of HBV genotype C to the first base (16th base) of codon 6;

Type II: 15-bp base deletion form (eg SEQ ID NO: 3) from the third base of the start codon of the preS1 gene of HBV genotype C to the second base of the codon 6 (17th base);

Type III: 21-bp base deletion form (eg SEQ ID NO: 5) from the second base of the start codon of the preS1 gene of HBV genotype C to the first base of the eighth codon (22nd base); or

Type IV: 21 bp base deletion form from the first base (7th base) of the third codon of the preS1 gene of HBV genotype C to the third base (27th base) of the ninth codon (eg, SEQ ID NO: 7).

Polynucleotide of the present invention has a base sequence selected from the group consisting of SEQ ID NO: 1, 3, 5, and 7, or 15bp to 400 bp polynucleotide comprising the base sequence, more preferably, 50 bp to 250 bp polynucleotides. In an embodiment of the invention, the polynucleotide is 2827 bases to 3034 bases based on the entire genome of HBV genotype C (SEQ ID NO: 19) having base sequence deletions of the type I to IV. It may be a polynucleotide of 187 to 193 bp long (see FIG. 1).

In another aspect, the invention is characterized in that the polynucleotide is encoded by the polynucleotide, and has 5 to 11 amino acid deletions at sites from amino acids 1 (methionine) to amino acids 11 of the preS1 protein of HBV genotype C It provides a protein as a target for diagnosing the possibility of worsening liver disease symptoms. Preferably, the protein of the present invention may be a protein comprising an amino acid sequence encoded by a polynucleotide having a base sequence deletion of the above type I to IV, for example SEQ ID NO: 1, 3 , 5 and 7 may be a protein comprising an amino acid encoded by the base sequence selected from the group consisting of. In one embodiment of the invention, the target protein is based on the whole genome genome of HBV genotype C (SEQ ID NO: 19) having the nucleotide sequence of the type I to IV base 2827 base to 3034 base Up to 187 to 193 bp in length may be encoded by a polynucleotide. The protein encoded by the polynucleotide having the type I to III nucleotide sequence deletion is protein synthesis starting from the 12th codon, which is the methionine coding codon located after the start codon of the polynucleotide is interrupted As this begins, compared to the wild type pre-S1 protein, 11 amino acids from amino acid 1 (methionine) to the 11th amino acid have a deleted form. The protein encoded by the polynucleotide having the type IV sequence deletion has a form in which 7 amino acids from amino acids 3 to 9 of the wild type preS1 protein are deleted (see FIG. 2). In an embodiment of the invention, the protein may be a protein having an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6 and 8.

The protein of the present invention can be usefully used as a target protein capable of predicting or diagnosing the possibility of exacerbation of HBV infection symptoms to cirrhosis and / or hepatocellular carcinoma and the like, as described in connection with the polynucleotide. In addition, the protein is also useful as a target protein for the development of therapeutic agents to prevent the worsening of liver disease symptoms in patients with HBV infection.

In another aspect, the present invention provides a polynucleotide having a base deletion of 15 or 21 bp at sites 1 to 33 of the coding start of the preS1 gene of HBV genotype C (SEQ ID NO: 19) Provided is a probe for detection. The probe is capable of specific binding by hybridization with a polynucleotide having a base deletion of 15 or 21 bp at the base 1 to 33 base coding region of the preS1 gene of HBV genotype C of the present invention. it means. Thus, the polynucleotide detection probe has a complementary base sequence with a polynucleotide having a base deletion of 15 or 21 bp at the base 1 to the base 33 coding region of the preS1 gene of the HBV genotype C. It may be. In addition, the probe of the present invention may have a sequence selected from the group consisting of the following sequences.

Probes specific for polynucleotides having a type I sequence deletion:

AGCTACAGCACCAAACCTCG (SEQ ID NO: 9);

Probes specific for polynucleotides having a type II sequence deletion:

GCTACAGCATCAAACCTCGA (SEQ ID NO: 10);

Probes specific for polynucleotides having a type III sequence deletion:

AGCTACAGCACTCGACAAGG (SEQ ID NO: 11); And

Probes specific for polynucleotides having a type IV sequence deletion:

CAGCATGGGACAAGGCATGGG (SEQ ID NO: 12).

In an embodiment of the present invention, the probe may have a base sequence complementary to a base sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, and 7.

In another aspect, the invention

The above-described polynucleotide detection probe having a base deletion of 15 or 21 bp at the base 1 to the base 33 coding region of the preS1 gene of HBV genotype C (SEQ ID NO: 19) as described above To provide a composition for diagnosing the worsening of liver disease symptoms in patients with domestic HBV infection.

In another aspect, the present invention has a base deletion of 15 or 21 bp at sites 1 to 33 of the coding start of the preS1 gene of HBV genotype C (SEQ ID NO: 19) as described above. At least one selected from the group consisting of polynucleotides and proteins encoded by said polynucleotides and having 5 to 11 amino acid deletions at sites from amino acids 1 (methionine) to amino acids 11 of the preS1 protein of HBV genotype C; To provide a target composition for the development of a therapeutic agent for preventing the worsening of liver disease symptoms in patients with domestic HBV infection. In a preferred embodiment, the present invention, the polynucleotide may include a base sequence deletion of type I to IV, for example, a base selected from the group consisting of SEQ ID NOs: 1, 3, 5 and 7 It may have a sequence.

In another aspect, the present invention provides a poly-containing polynucleotide having a base deletion of 15 or 21 bp at sites 1 to 33 of the coding start of the preS1 gene of HBV genotype C (SEQ ID NO: 19). Provided is a DNA chip comprising a probe for detecting a nucleotide.

The DNA chip of the present invention includes one or more probes for detecting polynucleotides of the present invention as described above. In addition, the DNA chip of the present invention may further include a reference marker indicating the probe position, and as such markers, β-globin, actin, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene, etc. may be used. . In order to improve the sensitivity of the DNA chip, the probe may be aminated 5 'or 3' terminal. The probe is immobilized on the surface of the DNA chip, wherein the surface on which the probe is immobilized is a solid surface to which an aldehyde group is bound, and glass is preferably, but not limited thereto. Immobilization of such probes on the surface of DNA chips can be by conventional methods.

In another aspect, the present invention,

Samples collected from domestic patients with HBV infection; And

HBV genotype C (SEQ ID NO: 19) polynucleotides having 15 or 21 base deletions at bases 1 to 33 of the coding start of the preS1 gene and encoded by the polynucleotides and encoded by HBV genotype C Liver of a Korean HBV-infected patient comprising at least one detection means targeting at least one selected from the group consisting of proteins having 5 to 11 amino acid deletions at sites 1 to 11 of preS1 protein of Provide a kit for diagnosing the possibility of disease symptoms worsening.

The patient can be any mammal and is preferably a human. Samples taken from the domestic HBV infected patients may be any body fluid, tissue or cell capable of genetic testing isolated from HBV infected patients, preferably may be blood or serum.

In a preferred embodiment, the polynucleotide is as described above, for example, may be at least one selected from the group consisting of polynucleotides including type I to IV nucleotide deletions, more specifically, SEQ ID NOs: may be one or more polynucleotides having a nucleotide sequence selected from the group consisting of 1, 3, 5, and 7. The protein may be a protein encoded by a polynucleotide selected from the group consisting of the type I to type IV polynucleotides.

The detecting means includes all means capable of analyzing the nucleotide sequence of the polynucleotide or the amino acid sequence of the protein. For example, the means for detecting the polynucleotide may be a probe for detecting a polynucleotide as described above, and may further include a label such as an appropriate fluorescent material.

In addition, in a preferred embodiment, the detection means, in the case of polynucleotides may include a primer for PCR suitable for the polynucleotides, a conventional PCR device and an electrophoresis device, in the case of a protein, the usual electrophoresis It may be to include a device. The electrophoresis may be performed on, for example, agarose gel or polyacrylamide gel. In addition, for more accurate high sensitivity detection of the polynucleotide, nested PCR using two pairs of primers (outer primer and inner primer) may be performed, in which case, the kit of the present invention. May comprise two pairs of primers suitable for the polynucleotide to be detected.

According to the present invention, the detection of the polynucleotide or protein does not require time and costly analysis of nucleotide sequences or amino acid sequences, and can be performed simply and quickly by performing simple electrophoresis or PCR and electrophoresis. Has the advantage that it can.

When a polynucleotide having a specific gene defect of the present invention is present in a sample, a band corresponding to a polynucleotide having a short length of 15 or 21 bp shorter than a normal length is formed during electrophoresis, and thus the polynucleotide is examined by examining a band formed as a result of electrophoresis. The presence of the can be confirmed, and the relative abundance of the polynucleotide can be measured by examining the thickness and the depth of the band.

In one embodiment of the invention, DelF2 (SEQ ID NO: 13) and PreS-R1 (SEQ ID NO: 14) as an external primer pair, Del-PRA-F1 (SEQ ID NO: 15) and Polynucleotides of the invention can be detected by nested PCR using Del-PreS1-R (SEQ ID NO: 16).

In another aspect, the present invention provides a sample isolated from domestic HBV patients 15 or 21 at the base 1 to 33 of the coding start of the preS1 gene of HBV genotype C (SEQ ID NO: 19) Provided is a method for detecting a factor related to exacerbation of liver disease in an HBV-infected patient, characterized by determining whether a polynucleotide having a base deletion or a protein encoded by the polynucleotide is present.

In an embodiment of the present invention, the detection method comprises 15 or 21 bases at sites 1 to 33 of the coding start of the preS1 gene of HBV genotype C (SEQ ID NO: 19) as described above. It may be to use a primer for detecting a polynucleotide having a deletion. In another embodiment of the present invention, the detection method comprises 15 or 21 base deletions at sites 1 to 33 of the coding initiation region of the preS1 gene of HBV genotype C (SEQ ID NO: 19). It may include the step of performing a nested PCR (nested PCR) using a pair of the outer primer and a pair of inner primer for the detection of the polynucleotide having, and electrophoresis of the obtained PCR product. DelF2 (SEQ ID NO: 13) and PreS-R1 (SEQ ID NO: 14) as the outer primer pair and Del-PRA-F1 (SEQ ID NO: 15) and Del-PreS1-R (SEQ ID as the inner primer pair NO: 16) is preferred.

The gene detection method used in the present invention is an accurate, simple and inexpensive method that can replace the existing sequencing method.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are only for illustrating the present invention, the present invention is not limited by these examples.

EXAMPLE

I. Materials and Methods

1) Target patient

Patients who were positive for hepatitis B surface antigen (HBsAg) at Cheju National University Hospital from March 2002 to November 2002 and Seoul National University Hospital for 1 year were diagnosed. To investigate, patients with a history of antiviral treatment or with alcoholic liver disease were excluded. Specimens from 15 different liver cancer patients were used for sequencing, and 158 patient-derived samples were used as samples of the preS1 start-up defect gene detection method for correlation between genetic mutation and exacerbation of liver disease. Hepatocellular carcinoma (HCC): 67, cirrhosis (LC): 57, chronic hepatitis (CH): 34].

2) serum collection

Blood was collected at the time of the visit and the patients underwent basic serum biochemical tests. If positive for HBsAg at first visit, anti-HBs, eantigens (HBeAg), anti-HBe, HBV-DNA, alpha-fetoprotein (AFP) are tested and the remaining blood frozen at -80 ° C It was. HBsAg and anti-HBs were examined using radioimmunoassay kits (Abbott laboratory, North Chicago, IL), and HBeAg / anti-HBe was subjected to enzyme immunoassay. Serum HBV DNA was quantified using a Hybrid capture HBV DNA assay kit (Digene, Gaithersburg, MD, USA). The detection limit of HBV DNA was 0.5 pg / mL.

3) Clinical definition and diagnosis of liver disease

The definition and diagnosis of liver disease in the present specification were judged by combining clinical, biochemical and radiological findings. Patients who are clinically positive for HBsAg are those who have HBeAg positive, anti-HBe negative, HBV DNA positive, serum transaminase is normal, and there is no radiological evidence of chronic liver disease. Defined as. HBeAg seroconversion is HBeAg negative, anti-HBe positive, HBV DNA negative and serum transaminase is normal. Chronic hepatitis B is HBsAg positive for at least 6 months and HBV DNA positive and serum AST / ALT regardless of HBeAg. It was defined as continually elevated gastroesophageal varices without endoscopic findings and no evidence of symptomatology with ultrasound findings (Lok AS, Heathcote EJ, Hoofnagle JH.Management of hepatitis B: 2000-summary of workshop.Gastroenterology 2001; 120: 1828-1853.).

Liver cirrhosis was diagnosed clinically by combining portal hypertension (eg esophageal varices, splenomegaly, platelet <100,000 / m3) or suspected liver cirrhosis with abdominal ultrasonography (Di Lelio, A., Cestari, C). , Lomazzi, A, Beretta, L. Cirrhosis: diagnosis with sonographic study of the liver surface.Radiology 1989; 172: 389-392), hepatocellular carcinoma with serum AFP levels above 400 pg / mL and typical hypervascular CT findings (Bruix J, Sherman M, Llovet JM, Beaugrand M, Lencioni R, Burroughs AK, Christensen E, Pagliaro L, Colombo M, Rodes J for the EASL panel of expert on HCC.Clinical management of hepatocellular carcinoma: conclusions of the Barcelona- 2000 EASL conference.J Hepatol 2001; 35: 421-430), or else, liver biopsy.

4) Extraction of Serum DNA

DNA was extracted from serum derived from 173 patients. In summary, 500 uL of DNAzol (Molecular Research Center, Inc, Ohio, USA) was added to 100 uL of serum collected from the patients, followed by vortexing for 1 minute, and phenol / chloroform / isoamyl alcohol (50: 49: 1) 500 uL was added. It was centrifuged at 12,000 rpm for 10 minutes at room temperature, 400 uL of supernatant was taken and transferred to a new tube, after which 260 uL of isopropanol was added and centrifuged at 15,000 rpm for 10 minutes at 4 ° C. After washing the precipitate with 70% ethanol, 30uL of TBE buffer was added to recover the DNA.

5) HBV preS1 gene sequence analysis

In order to analyze the patterns of mutations in the PreS1 deletion gene, the nucleotide sequence of the preS1 region was analyzed in HBV derived from 15 liver cancer patients. PCR amplification was carried out by targeting a region (672-bp in the base sequence of HBV) that contains all of the preS1 and preS2 regions and part of the S region of the HBV gene region, and then amplifies the nucleotide sequence. Analyzed. The base sequence was based on the EcoRI recognition position present at the preS2 site in the entire genome 3215-bp (SEQ ID NO: 19) of HBV of wild-type genotype C (see FIG. 1). Primer pairs for PCR include DelF2 (5'- GGG TCA CCA TAT TCT TGG G-3 'sense nucleotide, SEQ ID NO: 13, bases 2814 to 2833) as the forward primer and PreS as the reverse primer. -R1 (5'-ATT GAG AGA AGT CCA CCA CGA-3 'antisense nucleotide, SEQ ID NO: 14, corresponding to bases 274 to 254) was used (see Figure 1).

PCR was performed using AccuPower PCR PreMix (2 U of Taq polymerase, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl 2) of Bioneer (Chungbuk, Korea). PCR was performed by adding 3 ul (50 ng) of DNA to the tube and adding 20 pmol of the pair of primers, respectively. As PCR conditions, initial denature was performed at 95 ° C for 10 minutes, 40 cycles at 95 ° C for 45 seconds, at 60 ° C for 60 seconds, and for 72 to 90 seconds, and the final extension of 5 minutes at 72 ° C. Condition was performed (Model 9600 thermocycler, Perkin-Elmer Cetus, Norwalk, USA). The amplified PCR product was recovered by gel fragment and 672 bp PCR product using QIAEX II SYSTEM (Qiagen, Hilden, Germany). Then, the 672 bp product was cloned into the TOPO TA vector (TOPO SYSTEM) using the TOPO SYSTEM (In vitrogen, USA), and transformed into Top 10 E. coli (TOPO SYSTEM). The E. coli was shaken for 24 hours, and then plasmid DNA was recovered by a conventional method. The recovered plasmid DNA was subjected to M13 forward primer (5'-GTA AAA CGA CGG CCA G-3 ', SEQ ID NO: 17) and M13 reverse primer (5'-CAG GAA ACA GCT ATG AC-3') The sequence was analyzed on both sides using SEQ ID NO: 18).

In all, the base sequences of five clones of each sample were analyzed to determine whether there was a base deletion at the start of the preS1 gene coding. Sequencing was performed with an Applied Biosystems model 377 DNA automatic sequencer (Perkin-Elmer Applied Biosystems, Warrington, UK), an automatic nucleotide sequencer, and the reaction was performed using a Big Dye Terminator Cycle Sequencing kit (Perkin-Elmer Applied Biosystems). It was. For template DNA, 500 ng of recovered plasmid DNA was used. For primers, 5 pmol of one side of M13 primer was added to one side of Big Dye Terminator v2.0 100 RR mix (Perkin-Elmer Applied Biosystems). The reaction was carried out to a final volume of 10 uL. Conditions were carried out in 30 cycles for 10 seconds at 96 ℃, 5 seconds at 60 ℃, 4 minutes at 60 ℃. The analyzed sequences were later subjected to multiple alignment of the sequences analyzed in this study using DNASTAR's Megalign program (Window Version 3.12e; Madison, USA), followed by genotypes C and D of Genbank. Comparison was made with standard sequences corresponding to

6) nested PCR for detecting the coding mutation of the preS1 gene

Nested PCR method using two pairs of primers presented in the present invention can detect the gene mutation of the coding start region of preS1 gene only by electrophoresis of the PCR reaction product without cumbersome sequencing. A schematic process of the nested PCR of the present invention is shown in FIG.

In the first PCR of the nested PCR of the present invention, the primer pair DelF2 (SEQ ID NO: 13) and PreS-R1 (SEQ ID NO: 14), which were used for the sequencing, were used as the outer primers. Of the whole envelope protein, a region (672-bp) containing all of the preS1 and preS2 sites and a part of the S site was amplified. PCR was performed using AccuPower PCR PreMix (2 U of Taq polymerase, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl 2) of Bioneer (Chungbuk, Korea). PCR was performed by adding 3 ul (50 ng) of DNA to the tube and then adding 3 pmol of each of the primers. The first PCR conditions of the nested PCR of the present invention is the first denaturation at 95 ℃ 10 minutes, 30 cycles at 95 ℃ 45 seconds, 52 ℃ 60 seconds, 72 ℃ 90 seconds, final elongation at 72 ℃ 5 minutes (Model 9600 thermocycler, Perkin-Elmer Cetus, Norwalk, USA).

The second PCR of the nested PCR of the present invention targeted 208-bp including a part of preS1 from 2827 to 3034 in the entire sequence of HBV in the wild type without a deletion. Among the inner primer pairs for the second PCR, Del-PRA-F1 (5′-CTT GGG AAC AAG AGC TAC AGC-3 ′ sense nucleotide, SEQ ID NO: 15, bases 2827 to 2847, as forward primer Corresponding), Del-PreS1-R (5'- ATG CTC CCR CTC CTA CCK GAT-3 'antisense nucleotide, SEQ ID NO: 16, corresponding to bases 3034 to 3013) was used as the reverse primer. The second PCR was performed using 672-bp 3ul, which is an amplification product of the first PCR, as template DNA, and 20 pmol of each of the primers was added. The second PCR condition of the nested PCR was performed under conditions of 10 minutes at 95 ° C for the first denaturation, 45 seconds at 95 ° C, 60 seconds at 60 ° C, 90 seconds at 72 ° C, and 5 minutes at 72 ° C at the final elongation.

PCR products that have undergone two PCR as described above were electrophoresed on 2.5% agarose gel and 7.5% polyacrylamide gel, respectively, stained with EtBr, and the transfer patterns of PCR amplification products were determined to start coding of the preS1 gene. Site deletion gene mutations were detected and the results are shown in FIGS. 3A and 3B. As a DNA marker, a 50-bp DNA ladder was used (M).

II. Results and analysis

1) Analysis of gene mutation patterns in HBV preS1 initiation region of liver cancer patients

In order to analyze the gene mutation patterns of preS1 gene associated with the worsening of liver disease in Korea, we analyzed preS1 gene sequence of HBV derived from 22 liver cancer patients. Five clones were prepared for each patient and their sequences were analyzed. As a result, six of the 22 patients had preS1 gene mutations in at least one clone (27.3). These results are shown in Table 1 below.

TABLE 1

The variation of the preS1 gene of six hepatocellular carcinoma patients whose gene deletion was detected at the preS1 gene coding initiation region is shown in Table 2 below.

TABLE 2

As can be seen from Table 2, three of the six (referred to as XCM-30, NOR-30, JH15, respectively) had type 1 or type 3 base sequence deletions in all 5 clones, and the rest Three (named Seldi-4, JH32, and JH31, respectively) were found to have a mixture of wild-type and missing mutants.

As a result of analyzing the preS1 deletion gene mutation pattern of HBV genotype C from the six hepatocellular carcinoma patients, it was classified into four types according to the location of the deletion gene mutation region and the number of the missing gene base in the preS1 gene. The four types are shown in FIG. 2. As can be seen in Table 2 and FIG. 2, Type I found in two hepatocellular carcinoma patients (SCM-30 and NOR-30) among six hepatocellular carcinoma patients was the second of all preS1 genes. A total of 15-bp sequence was deleted from base to 16th base. Type II (SII) was found in one patient (Seldi-4) with a total 15-bp deletion from base 3 to base 17 of the preS1 gene. In addition, type III (III) found in one (JH15) hepatocellular carcinoma patient showed a 21-bp total sequence deletion from the 2nd base to the 22nd base of preS1 gene.

Since these three types (Type I, II, III) all influence the translation initiation site of the large envelope protein of HBV, as shown in Figure 2, the next methionine coding codon 11 amino acids after the original initiation codon position Protein expression begins at the site of appearance. Thus, while the preS1 protein portion of HBV genotype C without deletion contains 119 amino acids, the HBV genotype C, despite the HBV ′ genotype C, is present in the coding initiation deletion gene variant of the three types of preS1 genes of the present invention. It has a preS1 protein consisting of 108 amino acids like D.

Finally, type IV was found in 2 patients with hepatocellular carcinoma (JH31, JH32), showing a 21-bp total sequence deletion from the 7th to 27th base of preS1 gene. Because type 4 does not affect the starting site of large envelope proteins, unlike the above three types, the starting site is the same as that of the wild type, but all seven amino acids from the third codon to the ninth codon This deletion will have a preS1 protein consisting of a total of 112 amino acids.

Previously, the preS deletion mutations have been reported in many papers, but most of them have been reported in genotypes A, B, D, etc., rather than HBV genotype C, which predominantly exists in Korea. In addition, it is very difficult to develop a molecular biological method for detecting a defective gene strain because the reported deletion gene mutation is mainly concentrated in the preS2 gene, and the position of the defective gene is not concentrated and is scattered in various parts. Compared with the preS gene mutations found in the previous papers, the preS1 deletion gene mutations found in the present invention are concentrated at a constant site, that is, the coding start site of the preS1 gene, and have a sufficient length of 15-21 bp. Since deficiencies are observed, there is an advantage in that it is easy to develop molecular biological methods targeting these gene variants.

2) Analysis of electrophoretic results of nested-PCR products for detection of preS1 start site deletion gene mutants

As described above, the preS1 deletion gene mutation found in the present invention has the advantage that it is suitable as a target of the molecular biological method, in the present invention, without a sequencing analysis, the coding start region deletion gene mutation strain of the preS1 gene with only one PCR reaction. A nested PCR method was devised to detect (see FIG. 1). In other words, the strategy of the present invention is to allow the deletion mutant and wild-type strains to produce preS1 PCR amplification products of different sizes, thereby detecting the presence of mutant strains in patient samples.

3A and 3B show the results of the electrophoresis of the PCR products subjected to the nested PCR on 2.5% agarose gel and 7.5% polyacrylamide gel, respectively. Figure 3a shows the results of electrophoresis on 2.5% agarose gel, Figure 3b shows the results of electrophoresis on 7.5% polyacrylamide gel. If the patient's sample contains only the wild-type HBV preS1 gene, it produces a 208-bp PCR product (①), and if it contains only the mutant strain that has a defective deletion at the preS1 gene coding region, the range is 183-194bp. Produced a PCR product of (②), when the wild type and the deletion mutant is mixed, both PCR products were produced (③).

The nested PCR method and the electrophoresis method of the present invention were applied to 22 hepatocellular carcinoma patients whose base sequences were analyzed and compared with the base sequence results shown in Table 1 above. As a result of the sequencing analysis shown in Table 1, even when nested PCR and electrophoresis were performed, mutants were detected in 6 of 22 patients and only wild type was present in 16 patients. Could. As can be seen in Figures 3a and 3b, three of the six patients with preS1 gene deletion mutant was confirmed to the extent that the mutant and wild type is mixed. The advantage of the method is that even when the patient sample is mixed with wild-type and mutant strains, as shown in lanes 4 and 7 of FIG. 3A, the intensity of the EtBr stains on the gel of the two amplification products are compared to each other in the patient sample. The relative distribution ratios between groups (wild type and mutant strains) can be known.

3) Application of the nested-PCR method for detecting the gene mutation of the coding start region of preS1 gene to patient samples

In order to analyze whether the coding start site deletion gene mutation of the preS1 gene of the present invention is related to the exacerbation of liver disease in domestic patients, the nested PCR method for detecting the preS1 start site deletion mutation strain developed in the present invention has various clinical symptoms. 158 patients with HBV hepatic disease (hepatocellular carcinoma (HCC): 67, cirrhosis (LC): 57, chronic hepatitis (CH): 34) were enrolled. The results are shown in Table 3 below.

TABLE 3

As can be seen in Table 3, the frequency of the preS1 gene coding start-up mutant strain of the present invention, it can be seen that the frequency of the preS1 start-up mutant strain increases according to the exacerbation of clinical symptoms [hepatitis (3.0%) → Cirrhosis (12.3%) → liver cancer (20.9%)]. Therefore, it can be seen that the mutation of the preS1 gene coding initiation region of the present invention is closely related to worsening of liver disease symptoms in HBV-infected patients.

As described above, in the case of hepatitis B virus patients in Korea, most of the other countries where genotypes A, B, and D of HBV are prevalent, most are infected with genotype C, and genotype C is generally carriers, hepatitis Because it is known to have a continuous clinical course of liver, cirrhosis, and liver (cell) cancer, the preS1 start site deletion gene mutation found in the present invention has been proven to be a factor that promotes metastasis to the next stage of liver disease. It is very useful as a target for predicting and diagnosing the possibility of exacerbation of liver disease symptoms and for developing therapeutics to prevent such exacerbations.

Attach sequence list electronic file  

Claims (21)

Among the genomic genes of HBV genotype C having the nucleotide sequence of SEQ ID NO: 19, having a base deletion of 15 or 21 bp at sites from the bases 2848 to 2880, the coding initiation region of the preS1 gene, and on both sides of the base deletion site Characterized in that it has a total of 15 to 400 bases located in succession Targeted polynucleotides for the diagnosis of possible worsening of liver disease symptoms. The method of claim 1 wherein said polynucleotide is A 15 bp base deletion from the 2849 base to the 2863 base of SEQ ID NO: 19; A 15 bp base deletion from the 2850 base to the 2864 base of SEQ ID NO: 19; A 21 bp base deletion from the 2849 base to the 2869 base of SEQ ID NO: 19; or 21 bp base deletion from the 2854 base to the 2874 base of SEQ ID NO: 19 Having a polynucleotide. The polynucleotide of claim 2, wherein the polynucleotide has any one base selected from the group consisting of SEQ ID NOs: 1, 3, 5, and 7. Having a 7 or 11 amino acid deletion at a site from amino acids 1 to 11 of the preS1 protein encoded by the polynucleotide according to claim 1 and starting from the 2848th base in the nucleotide sequence of SEQ ID NO: 19; Targeted protein for diagnosing the possibility of worsening of liver disease symptoms. 5. The protein of claim 4, wherein the protein is deleted from the first to 11th amino acids in the preS1 protein starting from the 2848th base in SEQ ID NO: 19, or from the third to ninth amino acids. 7 amino acids of which are deleted. The protein of claim 5, having an amino acid sequence of any one selected from the group consisting of SEQ ID NOs: 2, 4, 6, and 8. 7. Probe for detecting the polynucleotide having a nucleotide sequence complementary to the polynucleotide according to claim 1. The probe according to claim 7, wherein the probe has a nucleotide sequence selected from the group consisting of SEQ ID NO: 9, 10, 11, and 12. The probe according to claim 7, wherein the probe has a nucleotide sequence complementary to any one nucleotide sequence selected from the group consisting of SEQ ID NO: 1, 3, 5, and 7. A composition for diagnosing liver disease symptom worsening in a domestic HBV infected patient comprising a probe according to any one of claims 7 to 9. 10. A DNA chip comprising one or more probes according to claim 7. Liver disease of a domestic HBV-infected patient comprising at least one target substance selected from the group consisting of a polynucleotide according to any one of claims 1 to 3 and a protein according to any one of claims 4 to 6. Target composition for the development of a therapeutic for preventing symptoms worsening. Samples isolated from domestic HBV infected patients; And At least one detection means for targeting at least one selected from the group consisting of a polynucleotide according to any one of claims 1 to 3 and a protein according to any one of claims 4 to 6. Kit for diagnosing the possibility of worsening of liver disease in patients with HBV infection in Korea. The diagnostic kit according to claim 13, wherein the detection means includes a probe having a nucleotide sequence complementary to the polynucleotide. The diagnostic kit of claim 14, wherein the probe has any one nucleotide sequence selected from the group consisting of SEQ ID NO: 9, 10, 11, and 12. 16. The method according to claim 13, wherein the detecting means comprises a pair of outer primers and a pair of inner primers, a PCR device and an electrophoresis device for detecting the polynucleotide, The pair of outer primers are DelF2 (SEQ ID NO: 13) and PreS-R1 (SEQ ID NO: 14), The pair of inner primers are Del-PRA-F1 (SEQ ID NO: 15) and Del-PreS1-R (SEQ ID NO: 16), Diagnostic kit. delete Reacting a probe having a complementary sequence with a polynucleotide according to any one of claims 1 to 3 to a sample isolated from a domestic HBV patient; DelF2 (SEQ ID NO: 13) and PreS-R1 (SEQ ID NO: 14) and Del-PRA-F1 (SEQ ID NO: 15) and Del-PreS1-R (external primer pair) Performing a nested PCR using SEQ ID NO: 16), and Electrophoresis of the PCR product obtained above A method for detecting liver disease exacerbation related factor in a HBV infected patient. The detection method according to claim 18, wherein a probe having any one nucleotide sequence selected from the group consisting of SEQ ID NO: 9, 10, 11, and 12 is used. delete delete

Images