KR100662660B1 - 사이토메가로바이러스 ｉｅ 인헨서/프로모터의 활성을촉진하는 올리고뉴크레오타이드 - Google Patents

사이토메가로바이러스 ｉｅ 인헨서/프로모터의 활성을촉진하는 올리고뉴크레오타이드 Download PDF

Info

Publication number
KR100662660B1
KR100662660B1 KR1020030056227A KR20030056227A KR100662660B1 KR 100662660 B1 KR100662660 B1 KR 100662660B1 KR 1020030056227 A KR1020030056227 A KR 1020030056227A KR 20030056227 A KR20030056227 A KR 20030056227A KR 100662660 B1 KR100662660 B1 KR 100662660B1
Authority
KR
South Korea
Prior art keywords
cmv
cpg
oligonucleotide
enhancer
promoter
Prior art date
Application number
KR1020030056227A
Other languages
English (en)
Other versions
KR20050018720A (ko
Inventor
권형주
이영희
이근욱
손원주
김두식
Original Assignee
학교법인 한림대학교
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 학교법인 한림대학교 filed Critical 학교법인 한림대학교
Priority to KR1020030056227A priority Critical patent/KR100662660B1/ko
Publication of KR20050018720A publication Critical patent/KR20050018720A/ko
Application granted granted Critical
Publication of KR100662660B1 publication Critical patent/KR100662660B1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 CMV IE 유전자 프로모터의 활성을 촉진하는 물질에 대한 발명으로, 더욱 상세하게는 CMV IE 유전자 프로모터의 활성을 촉진하는 CpG-올리고뉴크레오타이드에 대한 발명이다. 본 발명의 올리고뉴크레오타이드는 CMV 유전자 프로모터의 조절 하에 타겟 유전자의 최적발현의 촉진제로 유전자 치료 등에 적용할 수 있고 또한 동물세포에서 단백질 발현의 양을 크게 증대시키는 데 응용할 수 있다.

Description

사이토메가로바이러스 ＩＥ 인헨서/프로모터의 활성을 촉진하는 올리고뉴크레오타이드{Oligonucleotide for activating Cytomegalovirus IE enhancer/promoter activity}
도 1은 CpG-올리고뉴크레오타이드가 RAW 264.7 세포에서 CMV IE 인헨서/프로모터의 활성화를 촉진하는 것을 보여 주는 그림. RAW 264.7 세포를 CMV IE 인헨서/프로모터-루시퍼레이즈 컨스트럭스(pCMV-Luc)로 24시간 동안 트랜스팩션시키고, 6시간 동안 CpG-올리고뉴크레오타이드의 농도를 증가시키면서 세포를 자극하였고(도 1a), 도 1b는 3uM CpG-올리고뉴크레오타이드의 농도로 다른 시간동안 처리한 결과를 보여 준다.
도1c는 RAW 264.7 세포를 pCMV-Luc로 트랜스팩션시키고, 3uM 여러 CpG-올리고뉴크레오타이드로 6시간 처리한 후 루시퍼레이즈를 측정한 것을 보여준다.
도 2는 RAW 264.7 세포에서 CpG-ODN 1826 유도된 CMV IE 인헨서/프로모터의 활성이 IkBaSR 및 도미넌트 네가티브 돌연변이인 MyD88에 의해 저해되는 것을 보여주는 그림. RAW 264.7 세포를 CMV IE 인헨서/프로모터 컨스트럭트(pCMV-Luc)와 컨트롤 벡터, IkBaSR, 또는 도미넌트 네가티브 돌연변이인 MyD88로 24시간 동안 코트랜스팩션시켰다. 세포를 루시퍼레이즈 활성측정 전에 6시간 동안 3uM의 CpG-ODN 1826로 처리하였다. 결과는 컨트롤 벡터만 처리한 것과 비교한 활성화배수로 나타 내었다.
본 발명은 사이토메가로바이러스 IE 유전자 프로모터의 활성을 촉진하는 올리고뉴크레오타이드에 관한 발명으로, 더욱 상세하게는 CMV IE 유전자 프로모터의 활성을 촉진하는 CpG-올리고뉴크레오타이드에 대한 발명이다.
일반적으로 발현벡터(expression vector)는 대개 발현하고자 하는 유전자를 CMV promoter나 SV40 promoter 등, 강력한 viral promoter에 의해 발현이 유도되도록 고안하고 이 과정에서 CMV 프로모터가 많이 사용된다.
인간 사이토메가로바이러스(cytomegalovirus 이하, CMV라 함)는 이 바이러스가 재활성화된 면역타협환자에 있어서 중병을 일으키는 베타-헤르페스바이러스로 CMV immediate-early (IE) 인헨서/프로모터는 CMV 복제의 시작과 유전자 산물의 발현을 조절한다(Meier, J. L., and Pruessner, J. A. (2000) J. Virol. 74, 1602-1613.; Meier, J. L., Keller, M. J., and McCoy, J. J. (2002) J. Virol. 76, 313-326. 6).
CMV IE 유전자의 인헨서/프로모터 지역은 인헨서 지역에서 3-5번 반복되어 있는 네가지 타입인 17, 18, 19 및 and 21 bp 리피트의 반복서열 요소의 복잡한 일련의 조절요소를 갖는다. 이 요소에는 NF-kB/Rel, ATF/CREB, YY1, 및 NF1와 같은 전사인자에 대한 결합자리를 포함한다. (Thomsen, D. R., Stenberg, R. M., Goins, W. F., and Stinski, M. F. (1984) Proc. Natl. Acad. Sci. USA 81, 659-663; Jeang, K. T., Rawlins, D. R., Rosenfeld, P. J., Shero, J. H., Kelly, T. J., and Hayward, G.. S. (1987) J. Virol. 61, 1559-1570; Nelson, J. A., Reynolds-Kohler, C., and Smith, B. A. (1987) Mol. Cell. Biol. 7, 4125-4129; Sambucetti, L. C., Cherrington, J. M., Wilkinson, G. W., and Mocarski, E. S. (1989) EMBO J. 8, 4251-4258; Stamminger, T., Fickenscher, H., and Fleckenstein, B. (1990) J. Gen. Virol. 71, 105-113; Meier, J. L., and Stinski, M. F. (1996) Intervirology 39, 331-342; Sun, B., Harrowe, G., Reinhard, C., Yoshihara, C., Chu, K., and Zhou, S. (2001) J. Cell. Biochem. 83, 563-573.7-13).
더욱 더 Sp1, serum response element (SRE), ELK-1, CCAAT/enhancer binding protein (C/EBP), retinoic acid receptor RAR-RXR 계열 멤버 및 AP-1을 포함하는 많은 전사인자에 대한 결합자리도 밝혀졌다(Chan, Y.-J., Chiou, C.-J., Huang, Q., and Hayward, G. S. (1996) J. Virol. 70, 8590-8605; Angulo, A., Suto, C., Heymen, R. A., and Ghazal, P. (1996) Mol. Endocrinol. 10, 781-793: Prosch, S., Heine, A.-K., Volk, H.-D., and Kruger, D. H. (2001) J. Biol. Chem. 276, 40712-40720).
그동안 CMV 프로모터의 조절에 대한 연구들이 있었다.
예를들어 인터페론-알파는 쥐 CMV IE 유전자 발현을 저해한다는 보고가 있었고(Gribaudo, G., Ravaglia, S., Gaboli, M., Gariglio, M., Cavallo, R., and Landolfo S. (1995) Virology 211, 251-260), TNF-알파와 LPS는 CMV IE 인헨서/프로모터 활성을 촉진한다는 연구도 있었다(Laegreid, A., Thommesen, L., Jahr, T. G., Sundan, A., and Espevik, T. (1995) J. Biol. Chem. 270, 25418-25425; Prosch, S., Staak, K., Stein, J., Liebenthal, C., Stamminger, T., Volk, H.-D., and Kruger, D. H. (1995) Virology 208, 197-206).
유전자 치료용 벡터에서 CMV 유전자 프로모터가 많이 이용되고 있는데, CMV 유전자 프로모터는 in vivo에서 활성화에 문제점이 많음이 밝혀졌다(Gribaudo, G., Ravaglia, S., Gaboli, M., Gariglio, M., Cavallo, R., and Landolfo S. (1995) Virology 211, 251-260)또한 인터페론등에 의해 CMV 유전자 프로모터가 불활성화 됨이 밝혀졌다(Gribaudo, G., Ravaglia, S., Gaboli, M., Gariglio, M., Cavallo, R., and Landolfo S. (1995) Virology 211, 251-260). 따라서 본 발명은 CMV 유전자 프로모터의 유전자 치료에 적용했을 때 발생되는 단점을 극복할 수 있는 대안으로 이용될 수 있다.
본 발명은 상기의 필요성에 의하여 안출된 것으로서, 본 발명의 목적은 CMV 인헨서/프로모터를 활성화시키는 물질을 제공하는 것이다.
본 발명의 다른 목적은 CMV 인헨서/프로모터를 활성화시키는 방법을 제공하는 것이다.
상기의 목적을 달성하기 위하여, 본 발명은 사이토메가로바이러스(CMV) 이미 디어트 얼리 유전자 인헨서/프로모터 활성을 촉진시키는 CpG 서열을 포함하는 올리고뉴크레오타이드를 제공한다.
본 발명의 올리고뉴클레오타이드는 CpG 서열을 포함하는 올리고뉴크레오타이드가 바람직하고, 서열목록 1, 서열목록 2, 및 서열목록3으로 구성된 군으로부터 선택된 하나의 올리고뉴크레오타이드가 더욱 바람직하며, 서열목록 1의 올리고뉴크레오타이드가 가장 바람직하다.
또 본 발명은 본 발명에서 언급하고 있는 올리고뉴크레오타이드를 이용하여 사이토메가로바이러스(CMV) 이미디어트 얼리 유전자 프로모터 활성을 촉진하는 방법을 제공한다.
상기 프로모터 활성을 촉진시키는 올리고뉴크레오타이드의 유효농도는 0.1∼ 10uM인 것이 바람직하며, 상기 프로모터 활성을 촉진시키는 올리고뉴크레오타이드의 처리시간은 2∼24시간인 것이 바람직하다.
본 발명에 사용된 RAW 264.7 세포주는 American Type Culture Collection (ATCC, Manassas, VA, USA)에서 구입하여 사용하였고, 세포들은 10% fetal 보바인 시럼, 100 U/ml penicillin 및 100 mg/ml streptomycin을 갖는 Dulbeccos modified Eagles medium (DMEM)배지에서 배양시켰다. 생존도는 트립판 불루 다이를 사용하여 측정하였고, 95%이상이었다. IkBaSR을 코딩하는 발현벡터는 Harikrishna Nakshatri 박사(미국 인디아나대학, 의대)에게서 제공받았고, dominant negative 버전의 MyD88 (DMyD88)을 코딩하는 발현벡터는 Jurg Tschopp 박사(스위스의 Lausanne 대학)에게서 제공받았다.
이하 비한정적인 실시예를 통하여 본 발명을 상세하게 설명한다.
실시예: 올리고뉴크레오타이드의 합성 및 트랜스펙션 및 루시퍼레이즈 분석
본 발명에 사용된 포스포로싸이오에이트 골격의 올리고뉴크레오타이드는 대한민국 대전의 지노텍에서 구입하였다. 본 발명에서 사용된 CpG-ODN 1826는 두 CpG 모티프(TCCATG CG TTCCTGA CG TT; 서열목록 1)를 갖는 20베이스로 구성되었다. 하나 또는 두 개의 CG 서열이 GC로 역전(볼드체와 밑줄로 표시)된 CpG-ODN 1826 유도체는 CpG-ODN 1826(S-1, TCCATGA GC TTCCTGACGTT; 서열목록 2) 1826(S-2, TCCATGACGTTCCTGA GC TT; 서열목록 3), 및 1826(S-3, TCCATGA GC TTCCTGA GC TT; 서열목록 4)이 있고, 비-CpG ODN 2041 (CTGGTCTTTCTGGTTTTTTTCTGG; 서열목록 5)를 음성 대조군으로 사용하였다.
루시퍼레이즈 표지자 프라즈미드는 다음과 같은 방법으로 설계하였다.
IE 전사자리에서 상대적으로 -740에서 +65 CMV IE 인헨서/프로모터 절편은 5 프라이머로 CMV IE (-740) 5AGGTACCCAATATTGGCCATTAGCC3(서열목록 6); 3 프라이머로 CMV IE (+65) 5AAGATCTGACTGCGTTAGCAATTTAAC3(서열목록 7); 프라이머 세트를 사용하여 템플레이트로 네이티브 CMV 인헨서/프로모터 서열을 사용하여 PCR 반응에 의해 증폭하였다. CMV IE 인헨서/프로모터 절편을 루시퍼레이즈 표지자 프라스미드 pGL3-basic 벡터(Promega, Madison, WI, USA)의 Kpn I 와 Bgl II 자리에 라이게이션하여 pCMV-Luc, 표지자 컨스트럭트를 제조하였다.
트랜스펙션 하루 전 RAW264.7 세포를 5 x 105 세포/웰의 농도로 식스-웰 플 레이트에 처리하고, 세포를 사용설명서에 따라 10% FBS를 갖는 DMEM에서 FuGene 6 Transfection Reagent (Roche, Indianapolis, IN, USA)를 사용하여 트랜스펙션에 사용하였다. 각 컨스트럭트간 비교하기 위하여, 본 발명자들은 Renilla 루시퍼레이즈 벡터를 코트랜스펙션하여 동등한 트랜스펜션 효율을 확인하였다. 트랜스펙션 후에 CpG-ODN(3 mM 또는 각 실험에 나타낸 것과 같이)을 6시간 또는 각 실험에 나타난 것과 같이 처리하기 전에 세포를 완전배지에서 24시간 처리하였다. 세포를 모아서, 세척하고, 3회의 동결-해동에 의하여 파괴하였고, 루시퍼레이즈 활성은 TD-20/20 luminometer (Turner Designs, Sunnyvale, CA, USA)로 사용설명서에 따라 Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA)을 사용하여 결정하였다. 각 어세이는 Renilla 루시퍼레이즈 활성으로 표준화하였고, 데이터는 빈 벡터 대조군에 대한 활성의 배수증가로 표시하였다. 데이터는 유사한 결과의 2, 3회의 실험을 통하여 얻었고, 표준편자를 나타내었다.
CMV IE 인헨서/프로모터 활성에 대한 CpG-올리고뉴크레타이드의 효과를 측정하기 위하여, 본 발명자들은 CMV IE 인헨서/프로모터-루시퍼레이즈 표지자(pCMV-Luc)를 사용하고, 두 CpG 모티프를 갖는 20베이스의 CpG-ODN 1826로 RAW 264.7세포를 자극 후 그것의 조절을 조사하였다.
CpG-ODN 1826는 CMV IE 인헨서/프로모터를 시간 및 용량의존적으로 활성화하였다(도 1a 및 b 참조). 프로모터 활성화는 3 uM의 CpG-올리고뉴크레오타이드에서 6 시간 처리시 최대를 나타냈다. CpG-ODN 1826는 두 CpG 모티프를 가지고 있으므로, 본 발명자들은 프로모터 활성화에 CpG 다이뉴크레오타이드 서열 각각의 작용를 알아보았다.
본 발명자들은 포스포로싸이오에이트 골격을 갖는 CpG-ODN 1826(S-1, TCCATGA GC TTCCTGACGTT) 1826(S-2, TCCATGACGTTCCTGA GC TT), 및 1826(S-3, TCCATGA GC TTCCTGA GC TT)를 합성하였고, 이들은 CpG-ODN 1826 서열에서 CpG가 GC로 역전된 차이만이 존재하는 형태이다.
도 1의 c에서 알 수 있는 바와 같이, 루시퍼레이즈 활성은 세포를 CpG-ODN 1826(S)보다 CpG-ODN 1826(S-2)로 처리 시에 약 15%정도 감소하였고, CpG-ODN 1826(S)와 비교하여, CpG ODN-1826 (S-1)로 처리 시에는 루시퍼레이즈 활성이 약 40%감소하였으며, CpG-ODN 1826(S)의 두CpG 다이뉴크레오타이드 모두를 GC로 바꾼 CpG-ODN 1826(S-3)에서는 CMV 프로모터 활성능력을 잃어버렸다. 기본 루시퍼레이즈 활성은 비-CpG-ODN 2041로 자극된 대조군 세포로 측정하였다.
이상의 결과로부터 CpG-ODN 1826 서열은 CpG 서열 의존적으로 CMV IE 인헨서/프로모터활성화를 유도한다는 것을 알 수 있었다.
또 CpG-DNA에 의한 CMV IE 인헨서/프로모터 활성화에 MyD88이 관여하는지를 확인하기 위하여, 본 발명자들은 돌연변이 MyD88 (DMyD88)를 코딩하는 발현 프라즈미드와 프로모터를 RAW 264.7 세포에 코트랜스펙션시켰다. TLR/IL-1R-의존적인 신호전달에서 도미넌트네가티브 분자로 작용함으로서, 돌연변이체는 CpG-ODN1826-매개되는 CMV IE CMV IE 인헨서/프로모터 활성화를 저해하였다(도 2a 및 2b 참조)
본 발명자들은 프로모터 활성화가 CpG-ODN 신호 의존적인 IkBa 분해에 의해 조절되는지를 확인하였다.
RAW 264.7 세포를 돌연변이 IkBa 단백질(IkBa Super Repressor, IkBaSR)로 트랜스팩션시켰을 때 CpG-ODN 1826 자극에 의한 프로모터의 활성화가 저해되었다.
이상의 결과로부터 CpG-ODN 1826에 의해 유도된 CMV IE CMV IE 인헨서/프로모터 활성화에는 IkBa 단백질이 필요한 것을 알 수 있었다(도 2b 참조)
본 발명은 본 발명의 올리고뉴크레오타이드는 CMV 유전자 프로모터의 조절 하에 타겟 유전자의 최적발현의 촉진제로 유전자 치료 등에 적용할 수 있다. 유전자 치료용 벡터에서 CMV 유전자 프로모터가 많이 이용되고 있는데, CMV 유전자 프로모터는 in vivo에서 활성화에 문제점이 많음이 밝혀졌다. 또한 인터페론등에 의해 CMV 유전자 프로모터가 불활성화 됨이 밝혀졌다. 따라서 본 발명은 CMV 유전자 프로모터의 유전자 치료에 적용했을 때 발생되는 단점을 극복할 수 있는 대안으로 이용될 수 있다. 또한 동물세포에서 단백질 발현을 위해 CMV 유전자 프로모터를 이용하는데 단백질 발현 양을 크게 증대시키는 데 응용할 수 있다.
<110> KWON, Hyung Joo <120> Oligonucleotide for activating Cytomegalovirus IE enhancer/promoter activity <160> 7 <170> KopatentIn 1.71 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CpG-ODN 1826 <400> 1 tccatgcgtt cctgacgtt 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CpG-ODN 1826(S-1) <400> 2 tccatgagct tcctgacgtt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CpG-ODN 1826(S-2) <400> 3 tccatgacgt tcctgagctt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CpG-ODN 1826(S-3) <400> 4 tccatgagct tcctgagctt 20 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Non-CpG ODN 2041 <400> 5 ctggtctttc tggttttttt ctgg 24 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5' Primer CMV IE(-740) <400> 6 aggtacccaa tattggccat tagcc 25 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 3' Primer CMV IE (+65) <400> 7 aagatctgac tgcgttagca atttaac 27

Claims (6)

  1. 사이토메가로바이러스(CMV) 이미디어트 얼리 인헨서/프로모터 활성을 촉진시키는 CpG 서열을 포함하는 올리고뉴크레오타이드.
  2. 제 1항에 있어서, 상기의 올리고뉴크레오타이드는 서열목록 1, 서열목록 2, 및 서열목록3으로 구성된 군으로부터 선택된 하나의 올리고뉴크레오타이드인 것을 특징으로 하는 올리고뉴크레오타이드.
  3. 제 2항에 있어서, 상기의 올리고뉴크레오타이드는 서열목록 1인 것을 특징으로 하는 올리고뉴크레오타이드.
  4. 제1항 내지 제 3항 중 임의의 한 항에서 선택된 올리고뉴크레오타이드를 이용하여 사이토메가로바이러스(CMV) 이미디어트 얼리 인헨서/프로모터 활성을 촉진시키는 방법.
  5. 제 4항에 있어서, 상기 올리고뉴크레오타이드의 유효농도는 0.1∼ 10uM인 것(농도 범위는 가능할 것으로 예상되는 범위를 기재하여 주기 바람)을 특징으로 하는 사이토메가로바이러스(CMV) 이미디어트 얼리 인헨서/프로모터 활성을 촉진시키는 방법.
  6. 제 4항에 있어서, 상기의 올리고뉴크레오타이드의 처리시간은 2∼24시간인 것을 특징으로 하는 사이토메가로바이러스(CMV) 이미디어트 얼리 인헨서/프로모터 활성을 촉진시키는 방법.
KR1020030056227A 2003-08-13 2003-08-13 사이토메가로바이러스 ｉｅ 인헨서/프로모터의 활성을촉진하는 올리고뉴크레오타이드 KR100662660B1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020030056227A KR100662660B1 (ko) 2003-08-13 2003-08-13 사이토메가로바이러스 ｉｅ 인헨서/프로모터의 활성을촉진하는 올리고뉴크레오타이드

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020030056227A KR100662660B1 (ko) 2003-08-13 2003-08-13 사이토메가로바이러스 ｉｅ 인헨서/프로모터의 활성을촉진하는 올리고뉴크레오타이드

Publications (2)

Publication Number Publication Date
KR20050018720A KR20050018720A (ko) 2005-02-24
KR100662660B1 true KR100662660B1 (ko) 2007-01-02

Family

ID=37228135

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020030056227A KR100662660B1 (ko) 2003-08-13 2003-08-13 사이토메가로바이러스 ｉｅ 인헨서/프로모터의 활성을촉진하는 올리고뉴크레오타이드

Country Status (1)

Country Link
KR (1) KR100662660B1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6339068B1 (en) 1997-05-20 2002-01-15 University Of Iowa Research Foundation Vectors and methods for immunization or therapeutic protocols

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6339068B1 (en) 1997-05-20 2002-01-15 University Of Iowa Research Foundation Vectors and methods for immunization or therapeutic protocols

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
논문

Also Published As

Publication number Publication date
KR20050018720A (ko) 2005-02-24

Similar Documents

Publication Publication Date Title
Kim et al. Promoter sequences of the human transforming growth factor-β1 gene responsive to transforming growth factor-β1 autoinduction
Gopalakrishnan et al. Differential regulation of respiratory chain subunits by a CREB-dependent signal transduction pathway. Role of cyclic AMP in cytochrome c and COXIV gene expression.
Vyhlidal et al. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site
Lenardo et al. Repression of the IgH enhancer in teratocarcinoma cells associated with a novel octamer factor
Atwood et al. Interaction of the human polyomavirus, JCV, with human B-lymphocytes
Singh et al. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes
Kim et al. Post-transcriptional regulation of the human transforming growth factor-beta 1 gene.
Iverson et al. Clustered point mutation analysis of the rat prolactin promoter
Carey et al. Transcriptional synergy by the Epstein-Barr virus transactivator ZEBRA
Richard et al. Identification of a retinoic acid response element in the human oxytocin promoter.
Mori et al. Identification of APOBEC3B promoter elements responsible for activation by human papillomavirus type 16 E6
Galvagni et al. Sp1 and Sp3 physically interact and co-operate with GABP for the activation of the utrophin promoter
Yamauchi et al. AP-1 regulation of the rat bone sialoprotein gene transcription is mediated through a TPA response element within a glucocorticoid response unit in the gene promoter
Burbach et al. Repression of estrogen-dependent stimulation of the oxytocin gene by chicken ovalbumin upstream promoter transcription factor I.
Lee et al. Activation of the human endogenous retrovirus W long terminal repeat by herpes simplex virus type 1 immediate early protein 1
CZ41897A3 (en) Structures of nucleic acids for controlled expression of genes, cells containing such structures and their use for preparing medicaments
Kitajima et al. Human T-cell leukemia virus type I tax transformation is associated with increased uptake of oligodeoxynucleotides in vitro and in vivo.
Rothofsky et al. CROC-1 encodes a protein which mediates transcriptional activation of the human FOS promoter
Clark et al. Interaction of enhancer-binding protein EBP1 (NF-kappa B) with the human immunodeficiency virus type 1 enhancer
Stein et al. Regulation of transcription‐factor activity during growth and differentiation: Involvement of the nuclear matrix in concentration and localization of promoter binding proteins
Ronai et al. Identification of ultraviolet-inducible proteins that bind to a TGACAACA sequence in the polyoma virus regulatory region
Ghosh et al. The dual role of helix–loop–helix-zipper protein USF in ribosomal RNA gene transcription in vivo
Vanacker et al. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element
KR100662660B1 (ko) 사이토메가로바이러스 ｉｅ 인헨서/프로모터의 활성을촉진하는 올리고뉴크레오타이드
Ben-Or et al. Involvement of a C/EBP-like protein in the acquisition of responsiveness to glucocorticoid hormones during chick neural retina development

Legal Events

Date Code Title Description
A201 Request for examination
N231 Notification of change of applicant
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20121115

Year of fee payment: 7

FPAY Annual fee payment

Payment date: 20131014

Year of fee payment: 8

FPAY Annual fee payment

Payment date: 20140925

Year of fee payment: 9

FPAY Annual fee payment

Payment date: 20151023

Year of fee payment: 10

FPAY Annual fee payment

Payment date: 20161007

Year of fee payment: 11

FPAY Annual fee payment

Payment date: 20170925

Year of fee payment: 12

FPAY Annual fee payment

Payment date: 20181017

Year of fee payment: 13