KR100657011B1 - Expression Vector Systems for Preparing Active ??90/??45 Complex in E. coli - Google Patents

Expression Vector Systems for Preparing Active ??90/??45 Complex in E. coli Download PDF

Info

Publication number
KR100657011B1
KR100657011B1 KR1020050035510A KR20050035510A KR100657011B1 KR 100657011 B1 KR100657011 B1 KR 100657011B1 KR 1020050035510 A KR1020050035510 A KR 1020050035510A KR 20050035510 A KR20050035510 A KR 20050035510A KR 100657011 B1 KR100657011 B1 KR 100657011B1
Authority
KR
South Korea
Prior art keywords
promoter
gene
expression vector
coli
escherichia coli
Prior art date
Application number
KR1020050035510A
Other languages
Korean (ko)
Other versions
KR20060112843A (en
Inventor
심재경
Original Assignee
세종대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 세종대학교산학협력단 filed Critical 세종대학교산학협력단
Priority to KR1020050035510A priority Critical patent/KR100657011B1/en
Publication of KR20060112843A publication Critical patent/KR20060112843A/en
Application granted granted Critical
Publication of KR100657011B1 publication Critical patent/KR100657011B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C12N15/72—Expression systems using regulatory sequences derived from the lac-operon
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 NF(nuclear factor)90/NF(nuclear factor)45 복합체를 활성화 형태로 대장균(Escherichia. coli)에서 제조하기 위한 두 가지 발현벡터를 포함하는 발현벡터 시스템; 그리고 NF(nuclear factor)90/NF(nuclear factor)45 복합체를 활성화 형태로 대장균(Escherichia. coli)에서 제조하기 위한 활성 NF90/NF45 복합체의 제조방법에 관한 것으로서, 보다 상세하게는 (a) 대장균에서 작동하는 복제원점, 대장균에서 작동하는 프로모터, 상기 프로모터에 작동적으로(operatively) 연결된 NF90 유전자 및 항생제-내성 유전자를 포함하는 NF90 발현용 벡터; 그리고, (b) 대장균에서 작동하며 상기 (a)의 복제원점과 다른 복제원점, 대장균에서 작동하는 프로모터, 상기 프로모터에 작동적으로 연결된 NF45 유전자 및 상기 (a)의 항생제-내성 유전자와 다른 항생제-내성 유전자를 포함하는 NF45 발현용 벡터를 포함하는 발현벡터 시스템; 그리고 상기 발현벡터 시스템을 이용한 활성 NF90/NF45 복합체의 제조방법에 관한 것이다.The present invention provides an expression vector system comprising two expression vectors for producing an NF (nuclear factor) 90 / NF (nuclear factor) 45 complex in an activated form in Escherichia coli ; And a method for preparing an active NF90 / NF45 complex for producing an NF (nuclear factor) 90 / NF (nuclear factor) 45 complex in an activated form in Escherichia coli , more specifically, in (a) E. coli An NF90 expression vector comprising an origin of replication, a promoter operating in E. coli, an NF90 gene operatively linked to the promoter and an antibiotic-resistant gene; And (b) a replication origin that is different from the origin of replication of (a), a promoter that operates in Escherichia coli, an NF45 gene operably linked to the promoter, and an antibiotic-resistant gene and other antibiotics of (a)- An expression vector system comprising an NF45 expression vector comprising a resistance gene; And it relates to a method for producing an active NF90 / NF45 complex using the expression vector system.

NF90, NF45, 공동발현, 대장균, 발현벡터 NF90, NF45, co-expression, Escherichia coli, expression vector

Description

활성 ＮＦ90/ＮＦ45 복합체를 대장균에서 제조하기 위한 발현벡터 시스템{Expression Vector Systems for Preparing Active ＮＦ90/ＮＦ45 Complex in E. coli}Expression Vector Systems for Preparing Active NF90 / NF45 Complex in E. coli

도 1a는 본 발명에서 이용된 pGST-NF45의 구축 과정을 보여주는 모식도이다. 인간 간 cDNA 라이브러리를 주형으로 하고 프라이머를 이용하여 NF45 유전자를 PCR 증폭하였다. NF45 유전자의 PCR 산물을 BamHI 및 SalI으로 절단하였다. NF45 유전자를 포함하는 단편을 BamHI-SalI-선형화 pGEX-4T-1에 라이게이션하여 플라스미드 pGST-NF45를 제작하였다. pGST-NF45 유전자 지도에서, GST 및 NF45는 각각 글루타티온 S-트랜스퍼라아제 및 NF45를 코딩하는 유전자이고, Ampr는 암피실린 내성 유전자, pBR322 ori는 플라스미드 pBR322에서 유래한 복제원점, lac Iq는 lac 오페론의 억제자(repressor)를 코딩하는 유전자를 나타낸다. Ptac는 tac 프로모터를 나타내며, 이 프로모터는 trp 프로모터의 -35 부위 및 lacUV5 프로모터의 -10 부위로 이루어진 하이브리드 프로모터이다. Ptac에 의한 발현은 Lac Iq 단백질에 의해 억제된다.Figure 1a is a schematic diagram showing the construction of pGST-NF45 used in the present invention. The human liver cDNA library was used as a template and the NF45 gene was PCR amplified using a primer. PCR products of the NF45 gene were digested with Bam HI and Sal I. The fragment containing the NF45 gene was ligated to Bam HI- Sal I-linearized pGEX-4T-1 to prepare plasmid pGST-NF45. In the pGST-NF45 gene map, GST and NF45 are the genes encoding glutathione S-transferase and NF45, respectively, Amp r is the ampicillin resistance gene, pBR322 ori is the origin of replication from plasmid pBR322, and lac I q is the lac operon The gene encoding the suppressor of is shown. P tac represents the tac promoter, which is a hybrid promoter consisting of the -35 site of the trp promoter and the -10 site of the lac UV5 promoter. Expression by P tac is inhibited by Lac I q protein.

도 1b는 본 발명에 이용된 pMBP-NF90의 구축 과정을 보여주는 모식도이다. HepG2 세포로부터 총 RNA를 분리한 다음, 조류 근원세포 바이러스(avian myeloblastosis virus)의 역전사효소 이용하여 제1쇄 cDNA를 얻었다. 이어, 반응산물을 주형으로 하여 PCR 증폭하였다. NF90 PCR 산물을 EcoRI 및 BamHI으로 절단하였다. NF90 유전자를 포함하는 단편을 EcoRI-BamHI-선형화 pMAL-c2에 라이게이션하였다. 이어, 벡터를 BglII 및 BamHI으로 절단한 다음 p15A-유래 ori를 갖는 pMBPc에 삽입하였다. HincII-EcoRV-선형화 pLysE를 MscI-DraI-선형화 pMAL-c2에 라이게이션하여 구축된 BglII-BamHI-선형화 pMBPc에 NF90 유전자를 포함하는 단편을 라이게이션하여 플라스미드 pMBP-NF90를 제조하였다. E. coli에서의 융합 단백질 발현을 위한 상기 박테리아 벡터는 IPTG(isopropyl-β-D-thiogalactopyranoside) 유도의 조절 하에 있다. pMBP-NF90 유전자 지도에서, MBP 및 NF90은 각각 말토스 결합 단백질 및 NF90 단백질을 코딩하는 유전자를 나타내고, p15A ori는 플라스미드 p15A로부터 유래된 복제원점을 나타내며, Cmr은 클로람페니콜 내성 유전자를 나타낸다.Figure 1b is a schematic diagram showing the construction of pMBP-NF90 used in the present invention. Total RNA was isolated from HepG2 cells, and the first-chain cDNA was obtained using reverse transcriptase of avian myeloblastosis virus. Then, the reaction product was PCR amplified using the template. NF90 PCR products were digested with Eco RI and Bam HI. Fragments containing the NF90 gene were ligated to Eco RI- Bam HI-linearized pMAL-c2. The vector was then digested with Bgl II and Bam HI and inserted into pMBPc with p15A-derived ori . A plasmid pMBP-NF90 was prepared by ligating a fragment comprising the NF90 gene in Bgl II- Bam HI-linearized pMBPc constructed by ligating Hin cII- Eco RV-linearized pLysE to Msc I- Dra I-linearized pMAL-c2. It was. The bacterial vector for fusion protein expression in E. coli is under the control of isopropyl-β-D-thiogalactopyranoside (IPTG) induction. In the pMBP-NF90 gene map, MBP and NF90 represent genes encoding maltose binding protein and NF90 protein, respectively, p15A ori represents the origin of replication derived from plasmid p15A, and Cm r represents the chloramphenicol resistance gene.

도 2a는 GST-NF45, MBP-NF90 및 MBP-NF90/GST-NF45의 SDS-PAGE 결과를 보여주는 젤 사진이다. 친화성 컬럼으로 정제된 GST-NF45(레인 1), MBP-NF90(레인 2) 및 공동발현된 MBP-NF90/GST-NF45를 8% SDS-PAGE 하고 쿠마시 브릴런트 블루로 염색하였다. 공동발현된 단백질을 GST 컬럼(MBP-NF90/GST-NF45(G), 레인 3)에 적용한 다음, MBP 컬럼(MBP-NF90/GST-NF45(M), 레인 4)에 로딩하였다. 각각의 단백질 의 위치를 화살표로 표시하였다. 2A is a gel photograph showing the SDS-PAGE results of GST-NF45, MBP-NF90 and MBP-NF90 / GST-NF45. GST-NF45 (lane 1), MBP-NF90 (lane 2) and coexpressed MBP-NF90 / GST-NF45 purified by affinity column were 8% SDS-PAGE and stained with Coomassie Brilliant Blue. The coexpressed protein was applied to a GST column (MBP-NF90 / GST-NF45 (G), lane 3) and then loaded onto an MBP column (MBP-NF90 / GST-NF45 (M), lane 4). The location of each protein is indicated by an arrow.

도 2b는 GST-NF45, MBP-NF90 및 MBP-NF90/GST-NF45의 웨스턴 블롯팅 결과를 보여주는 사진이다. GST-NF45(레인 1), MBP-NF90(레인 2), 공동발현 MBP-NF90/GST-NF45(G), 및 (M) (레인 3과 4)를 8% SDS-PAGE 하고, 니트로셀룰로스 막에 옮겼다. 막의 단백질을 항-NF45 항체(아래 패널) 및 항-NF90 항체(위 패널)로 염색하였다.Figure 2b is a photograph showing the Western blotting results of GST-NF45, MBP-NF90 and MBP-NF90 / GST-NF45. 8% SDS-PAGE of GST-NF45 (lane 1), MBP-NF90 (lane 2), coexpression MBP-NF90 / GST-NF45 (G), and (M) (lanes 3 and 4) and nitrocellulose membrane Transferred to. Proteins in the membrane were stained with anti-NF45 antibody (bottom panel) and anti-NF90 antibody (top panel).

도 3a-3c는 GST-NF45, MBP-NF90 및 MBP-NF90/GST-NF45의 RNA 결합 분석 결과를 보여준다. 도 3a는 프로브로서 32P-표지 HBV ε RNA를 사용하여 각각의 단백질에 대한 UV 교호결합 분석 결과이다. 레인 1, GST; 레인 2, MBP; 레인 3, GST-NF45; 레인 4, MBP-NF90; 레인 5, MBP-NF90/GST-NF45. 각각의 단백질의 위치는 화살표로 표시되어 있다. 도 3b는 HBV ε RNA 결합 활성을 분석한 EMSA 결과이다. 레인 1, GST; 레인 2, MBP; 레인 3, GST-NF45; 레인 4, MBP-NF90; 레인 5, MBP-NF90/GST-NF45. 도 3c는 항-NF45 항체의 존재하에서 MBP-NF90/GST-NF45의 슈퍼전이(supershift)를 보여주는 실험 결과이다. EMSA를 실시한 다음 항-NF45 항체를 첨가하였다. 레인 1, MBP-NF90/GST-NF45; 레인 2, MBP-NF90/GST-NF45 + 항-NF45 항체.3A-3C show RNA binding assays of GST-NF45, MBP-NF90 and MBP-NF90 / GST-NF45. 3A shows the results of UV cross-linking analysis for each protein using 32 P-labeled HBV ε RNA as probe. Lane 1, GST; Lane 2, MBP; Lane 3, GST-NF45; Lane 4, MBP-NF90; Lane 5, MBP-NF90 / GST-NF45. The location of each protein is indicated by an arrow. 3b shows EMSA analysis of HBV ε RNA binding activity. Lane 1, GST; Lane 2, MBP; Lane 3, GST-NF45; Lane 4, MBP-NF90; Lane 5, MBP-NF90 / GST-NF45. FIG. 3C is an experimental result showing the supershift of MBP-NF90 / GST-NF45 in the presence of anti-NF45 antibody. EMSA was performed followed by addition of anti-NF45 antibody. Lane 1, MBP-NF90 / GST-NF45; Lane 2, MBP-NF90 / GST-NF45 + anti-NF45 antibody.

도 4는 GST-NF45, MBP-NF90 및 MBP-NF90/GST-NF45의 반응 특이성을 보여주는 EMSA 결과이다. MBP-NF90(레인 2) 및 MBP-NF90/GST-NF45(레인 6)를 32P-표지 HBV ε RNA와 반응시켰다. 저온 HBV ε RNA의 5배(레인 3 및 7) 또는 20배(레인 4 및 8), 또는 경쟁자로서 Poly(I)-Poly(C)(레인 5 및 9)를 이용하였다. 레인 1은 32P-표지 HBV ε RNA를 단독 반응시킨 경우이다.4 is an EMSA result showing the reaction specificity of GST-NF45, MBP-NF90 and MBP-NF90 / GST-NF45. MBP-NF90 (lane 2) and MBP-NF90 / GST-NF45 (lane 6) were reacted with 32 P-labeled HBV ε RNA. Five times (lanes 3 and 7) or 20 times (lanes 4 and 8) of cold HBV epsilon RNA, or Poly (I) -Poly (C) (lanes 5 and 9) as competitors were used. Lane 1 is the case where 32 P-labeled HBV ε RNA was reacted alone.

본 발명은 활성 NF(nuclear factor)90/NF(nuclear factor)45 복합체를 대장균에서 제조하기 위한 발현벡터 시스템에 관한 것으로서, 보다 상세하게는 본 발명은 (a) NF(nuclear factor)90/NF(nuclear factor)45 복합체를 활성화 형태로 대장균(Escherichia. coli)에서 제조하기 위한 두 가지 발현벡터를 포함하는 발현벡터 시스템; 그리고 (b) NF(nuclear factor)90/NF(nuclear factor)45 복합체를 활성화 형태로 대장균(Escherichia. coli)에서 제조하기 위한 활성 NF90/NF45 복합체의 제조방법에 관한 것이다.The present invention relates to an expression vector system for preparing an active NF (nuclear factor) 90 / NF (nuclear factor) 45 complex in E. coli, and more particularly, the present invention (a) NF (nuclear factor) 90 / NF ( an expression vector system comprising two expression vectors for producing a nuclear factor) 45 complex in an Escherichia coli ( Esherichia coli ) in an activated form; And (b) a method for preparing an active NF90 / NF45 complex for preparing an NF (nuclear factor) 90 / NF (nuclear factor) 45 complex in an activated form in Escherichia coli .

활성 T-세포의 핵인자(Nuclear factor of activated T-cells: NF-AT)는 초기 T-세포 유전자의 활성화에 필수적이다(1-6). NF-AT는 항원 수용체 요소 2(antigen receptor response element 2: ARRE-2))로 알려진 인터루킨-2(IL-2) 인핸서 내의 한 서열에 결합함으로써, 인터루킨-2(IL-2)의 전사 활성에 관여를 하며(8), 상기 인터루킨-2는 T-세포 활성 이후에 처음으로 분비되는 림포카인이다(7). 또한, NF-AT는, 종양괴사인자-α, IL-4, IL-3 및 과립구-대식세포 콜로니 자극인자와 같은 다른 사이토카인 유전자의 조절 위치에 결합한다(9-15). Nuclear factor of activated T-cells (NF-AT) is essential for the activation of early T-cell genes (1-6). NF-AT binds to a sequence in the interleukin-2 (IL-2) enhancer known as antigen receptor response element (ARRE-2), thereby affecting the transcriptional activity of interleukin-2 (IL-2). Interleukin-2 is lymphokine secreted for the first time after T-cell activity (7). NF-AT also binds to regulatory sites of other cytokine genes, such as tumor necrosis factor-α, IL-4, IL-3 and granulocyte-macrophage colony stimulating factors (9-15).

NF-AT-ARRE-2 DNA 결합 활성에 관여하는 단백질을 동정하기 위한 많은 시도가 있었다. 현재까지, NF-AT 단백질의 몇 종(NF-AT1, NF-ATC, NF-AT3 및 NF-AT4)은 면역반응 동안에 사이토카인 유전자와 다른 유전자의 전사에 중요한 역할을 하는 것으로 규명되었다(16-21). 이들 단백질들은 보존성 DNA-결합 도메인을 포함하는 전사인자의 신규 패밀리로 분류된다(16, 17, 19, 21). 상기 신규 패밀리뿐만 아니라, 단백질의 다른 클래스들도 ARRE-2 DNA 인핸서 요소에 결합하여 전사 활성에 관여를 한다. Corthesy와 Kao는 ARRE-2 결합 활성을 나타내는 헤테로다이머 단백질(NF90/NF45)을 정제하였다. 이 단백질 복합체는 NFAT 전사인자와 유사한 몇 가지 활성을 나타내었지만 또한 다른 특징들, 예컨대 보존성 DNA-결합 도메인의 결여, 인산화 효과 및 세포내 특정 부위 분포와 같은 다른 특징들도 나타내었다(22, 23).Many attempts have been made to identify proteins involved in NF-AT-ARRE-2 DNA binding activity. To date, several species of NF-AT proteins (NF-AT1, NF-AT C , NF-AT3, and NF-AT4) have been shown to play an important role in the transcription of cytokine and other genes during the immune response (16 -21). These proteins are classified as novel families of transcription factors that contain conservative DNA-binding domains (16, 17, 19, 21). In addition to the new family, other classes of proteins also participate in transcriptional activity by binding to the ARRE-2 DNA enhancer element. Corthesy and Kao purified heterodimer proteins (NF90 / NF45) that showed ARRE-2 binding activity. This protein complex showed some activity similar to NFAT transcription factor but also other features such as lack of conservative DNA-binding domains, phosphorylation effect and specific site distribution in cells (22, 23). .

상기 헤테로다이머의 큰 서브유니트인 NF90은 명확한 DNA-결합 도메인을 가지고 있지 않으나, 이중쇄 RNA 결합에 관여하는 것으로 알려진 모티프와 유사한 두 개의 부위를 가지고 있다(23). Liao 등은 인간 293세포로부터 NF90 단백질을 정제하였고, 이 단백질이 dsRNA에 대한 결합능을 갖고 또한 아데노바이러스 VA RNAs와 같은 고도로 구조화된 ssRNAsd 대하여도 결합능을 갖는다는 것을 노스웨스턴 블롯팅으로 분석하였으며, NF45는 이러한 결합능이 없다는 것도 규명하였다(24). 또한, Langland 등은, NF90의 dsRNA-결합 특성을 분석하였고 비면역 HeLa 세포에서 NF90을 동정하였으며 PKR에 의한 NF90의 인산화를 규명하였다(25). 최근에, NF90와 같이 이중쇄 RNA 결합 모티프(double strand RNA binding motif: dsRBM)를 가지는 많은 단백질들이 다양한 루트로 동정되었다(26-30). 이러한 단백질의 한 그룹으로서, NF90 단백질 패밀리는 유전자발현 조절과 같은 몇 가지의 생물학적 과정에 관여를 하는 것으로 보고 되었다(25, 26, 28-38). 그의 파트너로서, NF45은 다른 유전자좌로부터 유래되며, dsRBM을 갖지는 않지만 NF90 패밀리 멤버와 유사한 약 150 아미노산 잔기의 부위를 포함한다(39). NF90의 RNA 결합은 이미 규명되었고, 그의 기능도 많은 연구가 이루어졌으나, NF45의 RNA 결합 특성과 그의 역할은 아직 알려진 바 없다. 보다 최근에, Shin 등은 HepG2 세포에서의 HBV ε RNA 결합 단백질로서 NF90/NF45 헤테로다이머 복합체를 정제하고 그 특성을 연구하였으며, 이 연구결과는 HBV 중합효소의 단백질 프라이밍에 상기 헤테로다이머 인자가 중요한 역할을 한다는 것을 보여준다(40).NF90, a large subunit of the heterodimer, does not have a clear DNA-binding domain, but has two sites similar to a motif known to be involved in double-stranded RNA binding (23). Liao et al. Purified NF90 protein from human 293 cells and analyzed by northwest blotting that the protein has binding capacity to dsRNA and also to high structured ssRNAsd such as adenovirus VA RNAs. The absence of such binding capacity was also demonstrated (24). Langland et al. Also analyzed the dsRNA-binding properties of NF90, identified NF90 in non-immune HeLa cells, and identified phosphorylation of NF90 by PKR (25). Recently, many proteins with a double stranded RNA binding motif (dsRBM), such as NF90, have been identified with various routes (26-30). As a group of these proteins, the NF90 protein family has been reported to be involved in several biological processes such as gene expression regulation (25, 26, 28-38). As its partner, NF45 is derived from another locus and contains sites of about 150 amino acid residues that do not have dsRBM but are similar to the NF90 family member (39). RNA binding of NF90 has already been identified and its function has been studied a lot, but the RNA binding properties of NF45 and its role are still unknown. More recently, Shin et al. Purified and characterized the NF90 / NF45 heterodimer complex as an HBV ε RNA binding protein in HepG2 cells, and the results show that the heterodimer factor plays an important role in protein priming of HBV polymerase. (40).

본 발명자는 활성 상태의 NF(nuclear factor)90/NF(nuclear factor)45 복합체를 대장균(E. coli)에서 효율적으로 제조할 수 있는 방법을 개발하고자 예의 연구 노력한 결과, E. coli에서 양립하는 두 가지 발현벡터를 구축하고 이를 이용하여 E. coli에서 NF90와 NF45를 공동발현하는 경우에는 활성 상태의 NF90/NF45 복합체를 효율적으로 제조할 수 있음을 확인함으로써, 본 발명을 완성하게 되었다.The present inventors that the two incompatible active in NF (nuclear factor) 90 / NF (nuclear factor) of E. coli for 45 complex (E. coli) study cases to develop a method that can be efficiently produced in the results sought, E. coli When constructing a branched expression vector and co-expressing NF90 and NF45 in E. coli using the same, the present invention was completed by confirming that the NF90 / NF45 complex in an active state can be efficiently produced.

따라서, 본 발명의 목적은 NF(nuclear factor)90/NF(nuclear factor)45 복합체를 활성화 형태로 대장균(Escherichia. coli)에서 제조하기 위한 두 가지 발현벡터를 포함하는 발현벡터 시스템을 제공하는 데 있다.Accordingly, an object of the present invention is to provide an expression vector system comprising two expression vectors for the production of NF (nuclear factor) 90 / NF (nuclear factor) 45 complex in the form of E. coli ( Escherichia. Coli) .

본 발명의 다른 목적은 NF(nuclear factor)90/NF(nuclear factor)45 복합체를 활성화 형태로 대장균(Escherichia. coli)에서 제조하기 위한 활성 NF90/NF45 복합체의 제조방법을 제공하는 데 있다.It is another object of the present invention to provide a method for preparing an active NF90 / NF45 complex for preparing an NF (nuclear factor) 90 / NF (nuclear factor) 45 complex in an activated form in Escherichia coli .

본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

본 발명의 일 양태에 따르면, 본 발명은 NF(nuclear factor)90/NF(nuclear factor)45 복합체를 활성화 형태로 대장균(Escherichia. coli)에서 제조하기 위한 다음의 두 가지 발현벡터를 포함하는 발현벡터 시스템을 제공한다: According to an aspect of the present invention, the present invention provides an expression vector comprising the following two expression vectors for the preparation of NF (nuclear factor) 90 / NF (nuclear factor) 45 complex in E. coli ( Escherichia. Coli) Provide the system:

(a) 대장균에서 작동하는 복제원점, 대장균에서 작동하는 프로모터, 상기 프로모터에 작동적으로(operatively) 연결된 NF90 유전자 및 항생제-내성 유전자를 포함하는 NF90 발현용 벡터; 그리고, (a) an NF90 expression vector comprising an origin of replication in E. coli, a promoter in E. coli, an NF90 gene and an antibiotic-resistant gene operatively linked to the promoter; And,

(b) 대장균에서 작동하며 상기 (a)의 복제원점과 다른 복제원점, 대장균에서 작동하는 프로모터, 상기 프로모터에 작동적으로 연결된 NF45 유전자 및 상기 (a)의 항생제-내성 유전자와 다른 항생제-내성 유전자를 포함하는 NF45 발현용 벡터.(b) a replication origin that is different from the replication origin of (a), a promoter that operates in Escherichia coli, an NF45 gene operably linked to the promoter, and an antibiotic-resistant gene that is different from the antibiotic-resistant gene of (a) NF45 expression vector comprising a.

본 발명자들은 활성 상태의 NF(nuclear factor)90/NF(nuclear factor)45 복합체(complex)를 대장균(E. coli)에서 효율적으로 제조할 수 있는 방법을 개발하고자 심도 있는 연구를 하였고, 그 결과 E. coli에서 양립하는(compatible) 두 가지 발현벡터를 구축하고 이를 이용하여 E. coli에서 NF90와 NF45를 공동발현하는 경우에는 활성 상태의 NF90/NF45 복합체를 효율적으로 제조할 수 있음을 확인하였다.The present inventors have in-depth research to develop a method capable of producing the NF (nuclear factor) 90 / NF (nuclear factor) 45 conjugate (complex) of active efficiently in Escherichia coli (E. coli), the result E When constructing two expression vectors compatible with coli and co-expressing NF90 and NF45 in E. coli , it was confirmed that the NF90 / NF45 complex in active state can be efficiently prepared.

본 명세서에서, 용어 “활성 상태의 NF90/NF45 복합체”는 HBV ε RNA에 대하여 결합 활성을 갖는 HBV NF90/NF45 복합체를 의미한다.As used herein, the term “active NF90 / NF45 complex” means an HBV NF90 / NF45 complex having binding activity against HBV ε RNA.

본 발명의 특징 중 하나는 하나의 E. coli 세포에서 양립하는 두 종의 발현벡터를 이용하는 것이다. 본 명세서에서 발현벡터를 언급하면서 사용되는 용어 “양립하는”은 하나의 세포에 있는 두 종의 벡터가 여러 세대(passage)를 거치는 동안에도 계속적으로 유지되는 특성을 의미한다. 이러한 양립성을 부여하기 위하여, 본 발명에서 두 종의 벡터는 서로 다른 복제원점을 갖는다.One of the features of the present invention is to use two expression vectors compatible with one E. coli cell. As used herein, the term "compatible" as used to refer to an expression vector refers to a property that two species of vector in one cell are continuously maintained over several generations. In order to impart this compatibility, two vectors of the present invention have different origins of replication.

본 발명의 바람직한 구현예에서, 상기 대장균에서 작동하는 복제원점은 pBR322-유래 ori, p15A-유래 ori, pMB1-유래 ori, ColE1-유래 ori, Rldrd19-유래 ori, CloDF13-유래 ori 및 M13-유래 ori로 구성된 군으로부터 선택되며, 보다 바람직하게는, pBR322-유래 ori, p15A-유래 ori 또는 pMB1-유래 ori이며, 가장 바람직하게는 pBR322-유래 ori 또는 p15A-유래 ori이다. 본 발명의 구체적인 일 실시예에 따르면, NF90 발현용 벡터는 p15A-유래 ori를 포함하고, NF45 발현용 벡터는 pBR322-유래 ori를 포함한다. 이러한 서로 다른 복제원점에 의해 NF90 발현용 벡 터 및 NF45 발현용 벡터는 여러 세대를 거치는 동안에도 분리(segregation)되지 않고, E. coli 세포에서 계속적으로 양립하게 된다.In a preferred embodiment of the invention, the origin of replication in E. coli is pBR322-derived ori, p15A-derived ori, pMB1-derived ori, ColE1-derived ori, Rl drd 19-derived ori, CloDF13-derived ori and M13- Selected from the group consisting of derived ori, more preferably, pBR322-derived ori, p15A-derived ori or pMB1-derived ori, most preferably pBR322-derived ori or p15A-derived ori. According to a specific embodiment of the present invention, the NF90 expression vector comprises p15A-derived ori, and the NF45 expression vector comprises pBR322-derived ori. Due to these different origins of replication, NF90 expression vectors and NF45 expression vectors are not segregated over several generations and are consistently compatible in E. coli cells.

본 발명의 바람직한 구현예에 따르면, 상기 대장균에서 작동하는 프로모터는 tac 프로모터, lac 프로모터, lacUV5 프로모터, lpp 프로모터, pL λ프로모터, pR λ프로모터, rac5 프로모터, amp 프로모터, recA 프로모터, SP6 프로머터, trp 프로모터 및 T7 프로모터로 구성된 군으로부터 선택된다. 보다 바람직하게는, 상기 프로모터는 tac 프로모터, lac 프로모터 및 lacUV5 프로모터이며, 가장 바람직하게는 tac 프로모터이다. 상기 tac 프로모터는 trp 프로모터의 -35 부위 및 lacUV5 프로모터의 -10 부위로 이루어진 하이브리드 프로모터이다. tac 프로모터에 의해 조절되는 발현은 Lac Iq 단백질(Lac 오페론의 억제자(repressor))에 의해 억제되며, IPTG(isopropyl-β-D-thiogalactopyranoside)에 의해 유도(induction)된다.According to a preferred embodiment of the present invention, the promoter operating in E. coli is a tac promoter, lac promoter, lac UV5 promoter, lpp promoter, p L λ promoter, p R λ promoter, rac 5 promoter, amp promoter, recA promoter, SP6 Promoter, trp promoter and T7 promoter. More preferably, the promoter is a tac promoter, a lac promoter and a lac UV5 promoter, most preferably the tac promoter. The tac promoter is a hybrid promoter consisting of the -35 site of the trp promoter and the -10 site of the lac UV5 promoter. Expression regulated by the tac promoter is inhibited by the Lac I q protein (repressor of Lac operon) and induced by isopropyl-β-D-thiogalactopyranoside (IPTG).

NF90 및 NF45 유전자는 프로모터에 작동적(operatively)으로 연결되어 있다. 본 명세서에서 용어 “작동적으로 결합된”은 핵산 발현 조절 서열인 프로모터와 NF90 또는 NF45 유전자 사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절 서열은 상기 NF90 또는 NF45 유전자의 전사를 조절하게 된다.NF90 and NF45 genes are operatively linked to a promoter. As used herein, the term “operably linked” means a functional binding between a promoter, which is a nucleic acid expression control sequence, and an NF90 or NF45 gene, whereby the regulatory sequence regulates transcription of the NF90 or NF45 gene.

본 발명의 또 다른 특징은 NF90 발현용 벡터 및 NF45 발현용 벡터가 서로 다른 항생제-내성 유전자를 갖는다는 것이다. 이와 같은 특징을 통하여, 벡터에 의해 형질전환된 세포의 선별(selection)을 용이하게 하고 NF90 발현용 벡터 및 NF45 발현용 벡터에 의해 발현되는 NF90 및 NF45 단백질을 개별적으로 분리하고 동정할 수 있게 한다.Another feature of the invention is that the NF90 expression vector and the NF45 expression vector have different antibiotic-resistant genes. This feature facilitates the selection of cells transformed with the vector and allows for the separate isolation and identification of NF90 and NF45 proteins expressed by the NF90 expression vector and the NF45 expression vector.

본 발명의 바람직한 구현예에서, 상기 항생제-내성 유전자는 암피실린, 겐타마이신, 카베니실린, 클로람페니콜, 스트렙토마이신 또는 테트라사이클린에 대하여 저항성을 부여하는 유전자이며, 보다 바람직하게는 암피실린 또는 클로람페니콜에 대하여 저항성을 부여하는 유전자이다. 본 발명의 구체적인 일 실시예에 따르면, NF90 발현용 벡터는 클로람페니콜-내성 유전자를 가지고, NF45 발현용 벡터는 암피실린 내성 유전자를 갖는다.In a preferred embodiment of the invention, the antibiotic-resistant gene is a gene that confers resistance to ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin or tetracycline, and more preferably resistance to ampicillin or chloramphenicol. It is a gene to be given. According to one specific embodiment of the present invention, the NF90 expression vector has a chloramphenicol-resistant gene, and the NF45 expression vector has an ampicillin resistance gene.

본 발명의 바람직한 구현예에 따르면, 상기 NF90 발현용 벡터 및 NF45 발현용 벡터는 tac 프로모터, lac 프로모터 또는 lacUV5 프로모터를 포함하고, lac Iq 유전자(즉, Lac 오페론의 억제자(repressor)를 코딩하는 유전자)를 추가적으로 포함하며, 보다 바람직하게는 상기 NF90 발현용 벡터 및 NF45 발현용 벡터는 tac 프로모터를 포함하고, lac Iq 유전자를 추가적으로 포함한다. 이와 같이 프로모터로서 tac 프로모터, lac 프로모터 또는 lacUV5 프로모터를 가지고 추가적으로 lac Iq 유전자를 갖게 되면, IPTG에 의한 유도를 통해 NF90 및 NF45 유전자의 발현을 인위적으로 조절할 수 있게 된다.According to a preferred embodiment of the present invention, the NF90 expression vector and NF45 expression vector comprises a tac promoter, lac promoter or lac UV5 promoter, and encodes a lac I q gene (ie, a repressor of Lac operon). Gene), and more preferably, the NF90 expression vector and NF45 expression vector include a tac promoter and further include a lac I q gene. As such, when the promoter has a lac I q gene with a tac promoter, a lac promoter or a lac UV5 promoter, the expression of NF90 and NF45 genes can be artificially controlled through induction by IPTG.

본 발명의 바람직한 구현예에 따르면, 상기 NF90 발현용 벡터 및 NF45 발현용 벡터는 발현된 NF90 및 NF45의 정제를 용이하게 하기 위한 융합 파트너를 코딩하는 유전자를 포함한다. 이러한 융합 파트너는 NF90 및 NF45 유전자의 업스트림에 위치하여, 발현시 각각의 N-말단에 융합되어 발현된다. 정제를 용이하게 하기 위한 융합 서열은 글루타티온 S-트랜스퍼라아제(GST), 말토스 결합 단백질(MBP), FLAG 및 6x His 등이 있으며, 바람직하게는 GST 및 MBP이다. GST가 융합된 경우에는 이 효소의 기질인 글루타티온-결합 레진 컬럼, MBP가 융합된 경우에는 아밀로스-결합 레진 컬럼, 6x His이 이용된 경우에는 Ni-NTA His-결합 레진 컬럼을 이용하여 소망하는 NF90 및 NF45단백질을 신속하고 용이하게 정제할 수 있다. 본 발명의 구체적인 일 실시예에 따르면, NF90 발현용 벡터는 MBP를 NF90 유전자의 업스트림쪽에 가지며, NF45 발현용 벡터는 GST를 NF45 유전자의 업스트림쪽에 갖는다. According to a preferred embodiment of the invention, the NF90 expression vector and NF45 expression vector comprises a gene encoding a fusion partner to facilitate purification of the expressed NF90 and NF45. These fusion partners are located upstream of the NF90 and NF45 genes and are expressed at the N-terminus, fused at the time of expression. Fusion sequences to facilitate purification include glutathione S-transferase (GST), maltose binding protein (MBP), FLAG and 6x His and the like, preferably GST and MBP. Desired NF90 using a glutathione-binding resin column, a substrate of this enzyme when GST was fused, an amylose-binding resin column when MBP was fused, and a Ni-NTA His-binding resin column when 6x His was used. And NF45 protein can be purified quickly and easily. According to a specific embodiment of the present invention, the NF90 expression vector has MBP upstream of the NF90 gene, and the NF45 expression vector has GST upstream of the NF45 gene.

본 발명의 가장 바람직한 구현예에 따르면, 상기 NF90 발현용 벡터는 도 1b에 기재된 유전자 지도를 가지는 벡터이다. 본 발명의 가장 바람직한 구현예에 따르면, 상기 NF45 발현용 벡터는 도 1a에 기재된 유전자 지도를 가지는 벡터이다.According to the most preferred embodiment of the present invention, the NF90 expression vector is a vector having a gene map described in Figure 1b. According to the most preferred embodiment of the present invention, the NF45 expression vector is a vector having a gene map described in Figure 1a.

NF90 발현용 벡터 및 NF45 발현용 벡터를 포함하는 본 발명의 발현벡터 시스템은 하나의 대장균 세포에 공동형질전환(cotransformation)되어 대장균 세포의 여러 세대 동안 안정되게 유지되며, NF90 및 NF45를 발현하여 효율적으로 활성 NF90/NF45 복합체를 제조케 한다.The expression vector system of the present invention comprising an NF90 expression vector and an NF45 expression vector is cotransformed into one E. coli cell to remain stable for several generations of E. coli cells, and efficiently expresses NF90 and NF45. Active NF90 / NF45 complexes are prepared.

본 발명의 다른 양태에 따르면, 본 발명은 NF(nuclear factor)90/NF(nuclear factor)45 복합체를 활성화 형태로 대장균(Escherichia. coli)에서 제조하기 위한 다음의 단계를 포함하는 활성 NF90/NF45 복합체의 제조방법을 제공한다:According to another aspect of the present invention, the present invention provides an active NF90 / NF45 complex comprising the following steps for preparing a NF (nuclear factor) 90 / NF (nuclear factor) 45 complex in an activated form in Escherichia coli Provides a method for preparing:

(a) 다음의 두 가지 벡터로 대장균을 형질전환하는 단계; (a) transforming Escherichia coli with the following two vectors;

(ⅰ) 대장균에서 작동하는 복제원점, 대장균에서 작동하는 프로모터, 상기 프로모터에 작동적으로(operatively) 연결된 NF90 유전자 및 항생제-내성 유전자를 포함하는 NF90 발현용 벡터; 그리고, (ⅱ) 대장균에서 작동하며 상기 (ⅱ)의 복제원점과 다른 복제원점, 대장균에서 작동하는 프로모터, 상기 프로모터에 작동적으로 연결된 NF45 유전자 및 상기 (ⅱ)의 항생제-내성 유전자와 다른 항생제-내성 유전자를 포함하는 NF45 발현용 벡터; (Iii) an NF90 expression vector comprising an origin of replication in E. coli, a promoter in E. coli, an NF90 gene and an antibiotic-resistant gene operatively linked to said promoter; And (ii) a replication origin that is different from the replication origin of (ii), a promoter that operates in E. coli, an NF45 gene operably linked to the promoter, and an antibiotic-resistant gene and other antibiotics of (ii)- NF45 expression vector comprising a resistance gene;

(b) 상기 항생제-내성 유전자에 의해 저항성이 발생된 항생제를 상기 대장균에 처리하여 항생제-내성 특성을 나타내는 대장균을 선별하는 단계; 및 (b) treating Escherichia coli with an antibiotic generated by the antibiotic-resistant gene, thereby selecting Escherichia coli which exhibits antibiotic-resistant properties; And

(c) 상기 형질전환된 대장균을 배양하는 단계.(c) culturing the transformed Escherichia coli.

본 발명의 방법은 상기 발현벡터 시스템을 이용하기 때문에, 이 둘 사이에 공통된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여, 그 기재를 생략한다.Since the method of the present invention uses the expression vector system, the contents common between the two are omitted in order to avoid excessive complexity of the present specification.

본 발명의 방법에 있어서 형질전환 단계는 CaCl2 방법(Cohen, S.N. et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)), 하나한 방법(Cohen, S.N. et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973); 및 Hanahan, D., J. Mol. Biol., 166:557-580(1983)) 및 전기 천공 방법(Dower, W.J. et al., Nucleic. Acids Res., 16:6127-6145(1988)) 등에 의해 실시될 수 있다.Transformation step in the method of the present invention is a CaCl 2 method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA , 9: 2110-2114 (1973)), one method (Cohen, SN et al , Proc. Natl. Acac. Sci. USA , 9: 2110-2114 (1973); and Hanahan, D., J. Mol. Biol. , 166: 557-580 (1983)) and electroporation methods (Dower, WJ et al., Nucleic.Acids Res. , 16: 6127-6145 (1988)) and the like.

본 발명의 바람직한 구현예에 따르면, 상기 NF90 발현용 벡터 및 NF45 발현용 벡터는 tac 프로모터, lac 프로모터 또는 lacUV5 프로모터를 포함하고, lac Iq 유전자를 추가적으로 포함하며, 상기 배양된 대장균에 IPTG를 처리하여 NF90 및 NF45 유전자의 발현을 유도하는 단계 (d)를 추가적으로 포함한다. tac 프로모터, lac 프로모터 또는 lacUV5 프로모터에 의해 조절되는 발현은 Lac Iq 단백질에 의해 억제되며, IPTG에 의해 효과적으로 유도된다.According to a preferred embodiment of the present invention, the NF90 expression vector and NF45 expression vector comprises a tac promoter, lac promoter or lac UV5 promoter, additionally contains a lac I q gene, and treated IPTG to the cultured E. coli To further induce the expression of the NF90 and NF45 genes. Expression regulated by the tac promoter, lac promoter or lac UV5 promoter is inhibited by the Lac I q protein and is effectively induced by IPTG.

본 발명에 이용되는 벡터가 NF90 및 NF45의 정제를 용이하게 하기 위한 융합 파트너를 코딩하는 유전자를 포함하는 경우, 상기 융합 파트너에 대하여 친화성(affinity)를 나타내는 물질이 결합된 레진을 이용하여 대장균에서 발현된 NF90 및 NF45를 효과적으로 정제할 수 있다.When the vector used in the present invention contains a gene encoding a fusion partner to facilitate the purification of NF90 and NF45, in E. coli using a resin bound to affinity to the fusion partner The expressed NF90 and NF45 can be purified effectively.

본 발명의 바람직한 구현예 따르면, 본 발명의 방법은 다음의 단계를 포함한다: According to a preferred embodiment of the present invention, the method of the present invention comprises the following steps:

(a) 도 1b의 유전자 지도를 갖는 NF90 발현용 벡터 및 도 1a의 유전자 지도를 갖는 NF45 발현용 벡터로 대장균을 형질전환하는 단계; (a) transforming Escherichia coli with an NF90 expression vector having a genetic map of FIG. 1B and an NF45 expression vector having a genetic map of FIG. 1A;

(b) 상기 암피실린 또는 클로람페니콜을 상기 대장균에 처리하여 항생제-내성 특성을 나타내는 대장균을 선별하는 단계;(b) treating said Escherichia coli with said ampicillin or chloramphenicol to screen for Escherichia coli that exhibits antibiotic-resistant properties;

(c) 상기 형질전환된 대장균을 배양하는 단계; (c) culturing the transformed Escherichia coli;

(d) 상기 배양된 대장균에 IPTG를 처리하여 NF90 및 NF45 유전자의 발현을 유도하는 단계; (d) treating the cultured Escherichia coli with IPTG to induce expression of NF90 and NF45 genes;

(e) 상기 대장균을 파쇄하는 단계; 및 (e) crushing the E. coli; And

(f) 상기 대장균 파쇄물을 글루타티온-결합 레진 컬럼 또는 아밀로스-결합 레진 컬럼에 적용하여 활성 상태의 NF90/NF45 복합체를 수득하는 단계.(f) subjecting the E. coli lysate to a glutathione-bound resin column or an amylose-bound resin column to obtain an NF90 / NF45 complex in an active state.

본 발명의 방법에 따르면, 활성 상태의 NF90/NF45 복합체를 높은 수율로 효과적으로 얻을 수 있다.According to the method of the present invention, the NF90 / NF45 complex in the active state can be effectively obtained in high yield.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

실시예Example

실험재료 및 실험방법Experimental Materials and Methods

실험재료Experimental material

글루타티온 S-트랜스퍼라아제(glutathione S-transferase: GST)-융합 발현 벡터(pGEX-4T-1) 및 글루타티온-세파로스 4B는 Pharmacia Biotech으로부터 구입하였다. 말토스-결합 단백질(maltose-binding protein: MBP)-융합 발현 벡터(pMAL-c2), 아밀로스, 제한효소 및 DNA-변형 효소들은 New England Biolabs로부터 구입하였다. HBV ε 부위의 DNA 단편(nt 1-68)을 pGEM2(Promega)의 T7 RNA 중합효소-특이 프로모터에 융합함으로써, 야생형을 포함하는 벡터를 구축하였다(40). RNA 합성, 표지화 및 정제는 Promega 사의 프로토콜 및 응용 안내(2판)에 기초하여 실시하였다. 32P-방사능 뉴클레오타이드는 Amersham으로부터 구입하였고 다른 모든 시 약은 Promega 또는 Sigma로부터 구입하였다.Glutathione S-transferase (GST) -fusion expression vector (pGEX-4T-1) and glutathione-Sepharose 4B were purchased from Pharmacia Biotech. Maltose-binding protein (MBP) -fusion expression vectors (pMAL-c2), amylose, restriction enzymes and DNA-modifying enzymes were purchased from New England Biolabs. The DNA fragment (nt 1-68) of the HBV ε site was fused to the T7 RNA polymerase-specific promoter of pGEM2 (Promega) to construct a vector containing a wild type (40). RNA synthesis, labeling and purification were performed based on Promega's protocol and application guide (2nd edition). 32 P-radioactive nucleotides were purchased from Amersham and all other reagents were from Promega or Sigma.

PCR 및 벡터 구축PCR and vector construction

PCR 용 올리고뉴클레오타이드 프라이머는 각각의 단백질의 cDNA 서열에 기초하여 제작하였다. NF45의 경우, 프라이머 40(+)(CGCGGATCCATGAGGGGTGACAGAGGCCGTGGT) 및 1221(-)(ACGCGTCGACTTAGGCTCCAGTCTTTCCCTTGGG)와 인간 간 cDNA 라이브러리 주형을 이용하여, 1.2 kb의 PCR 산물을 생성시켰다(PCR 조건: 94℃ for 30 sec, 60℃ for 45 sec, 72℃ for 2 min, 30 사이클). NF45의 PCR 산물을 BamHI 및 SalI으로 절단하였다. NF45 유전자를 포함하는 단편을 BamHI-SalI-선형화 pGEX-4T-1에 라이게이션하여 플라스미드 pGST-NF45를 얻었다. NF90의 경우, 총 RNA를 HepG2 세포로부터 분리하였다. 조류 근원세포 바이러스(avian myeloblastosis virus)의 역전사효소(Promega) 10 유니트를 이용하여 총 RNA 1 ㎍을 역전사함으로써 제1쇄 cDNA를 얻었다(42℃ for 30 min, 99℃ for 5 min, 5℃ for 5 min). 이 반응사물을 주형으로 이였고, 프라이머 265(+)(CCGGAATTCATGCGTCCAATGCGAATTTTTGTG) 및 2280(-)(CGCGGATCCTCAT GTAGCCTCCATGGTTGGCGC)를 이용하여 PCR 하여 2.0 kb의 산물을 얻었다(PCR 조건: 94℃for 30 sec, 60℃ for 20 sec 및 68℃ for 2 min 20 sec, 28 사이클). NF90의 PCR 산물을 EcoRI 및 BamHI으로 절단하였다. NF90 유전자를 포함하는 단편을 EcoRI-BamHI-선형화 pMAL-c2에 라이게이션하였다. 이어, 벡터를 BglII 및 BamHI으로 절단한 다음 p15A-유래 ori를 갖는 pMBPc에 삽입하였다. HincII-EcoRV-선형화 pLysE를 MscI-DraI-선형화 pMAL-c2에 라이게이션하여 구축된 BglII-BamHI-선형화 pMBPc에 NF90 유전자를 포함하는 단편을 라이게이션하여 플라스미드 pMBP-NF90를 제조하였다. E. coli에서의 융합 단백질 발현을 위한 상기 박테리아 벡터는 IPTG(isopropyl-β-D-thiogalactopyranoside) 유도의 조절 하에 있다. Oligonucleotide primers for PCR were prepared based on the cDNA sequence of each protein. For NF45, a 1.2 kb PCR product was generated using primers 40 (+) (CGCGGATCCATGAGGGGTGACAGAGGCCGTGGT) and 1221 (-) (ACGCGTCGACTTAGGCTCCAGTCTTTCCCTTGGG) with human cDNA library template (PCR condition: 94 ° C for 30 sec, 60 ° C). for 45 sec, 72 ° C. for 2 min, 30 cycles). PCR products of NF45 were digested with Bam HI and Sal I. A fragment containing the NF45 gene was ligated to Bam HI- Sal I-linearized pGEX-4T-1 to obtain plasmid pGST-NF45. For NF90, total RNA was isolated from HepG2 cells. First-chain cDNA was obtained by reverse transcription of 1 μg of total RNA using 10 units of reverse transcriptase (Promega) of avian myeloblastosis virus (42 ° C. for 30 min, 99 ° C. for 5 min, 5 ° C. for 5). min). The reaction product was used as a template, and PCR was obtained using primers 265 (+) (CCGGAATTCATGCGTCCAATGCGAATTTTTGTG) and 2280 (-) (CGCGGATCCTCAT GTAGCCTCCATGGTTGGCGC) to obtain a product of 2.0 kb (PCR condition: 94 ° C for 30 sec, 60 ° C for 60 ° C). 20 sec and 68 ° C. for 2 min 20 sec, 28 cycles). PCR products of NF90 were digested with Eco RI and Bam HI. Fragments containing the NF90 gene were ligated to Eco RI- Bam HI-linearized pMAL-c2. The vector was then digested with Bgl II and Bam HI and inserted into pMBPc with p15A-derived ori . A plasmid pMBP-NF90 was prepared by ligating a fragment comprising the NF90 gene in Bgl II- Bam HI-linearized pMBPc constructed by ligating Hin cII- Eco RV-linearized pLysE to Msc I- Dra I-linearized pMAL-c2. It was. The bacterial vector for fusion protein expression in E. coli is under the control of isopropyl-β-D-thiogalactopyranoside (IPTG) induction.

웨스턴 블롯팅 분석Western blotting analysis

BSA 표준방법으로 그 양이 결정된 융합 단백질 약 1 ㎍을 5% 스태킹, 8% 분리 SDS-PAGE에서 분리한 다음, 폴리비닐리덴 디플루오라이드 막에 전이시켰다. 상기 막을 5% 비지방 건유로 블록킹한 다음, 제1항 항체와 1:2000 희석 비율로 25℃에서 1시간 동안 반응시킨 후, PBS(phosphate-buffered saline)로 세척하고 호스래디쉬 퍼옥시다아제-결합 제2차 항체(Sigma)와 1:8000 희석비로 25℃에서 1시간 동안 반응시킨 후, 최종적으로 ECL 시스템(Amersham)으로 가시화하였다.About 1 μg of the fusion protein, determined by BSA standard method, was separated on 5% stacking, 8% isolated SDS-PAGE, and then transferred to a polyvinylidene difluoride membrane. The membrane was blocked with 5% non-fat dry milk, then reacted with the antibody of claim 1 at 25 ° C. for 1 hour at a ratio of 1: 2000, washed with phosphate-buffered saline (PBS), and horseradish peroxidase-binding. After reacting with a secondary antibody (Sigma) 1:25 dilution at 25 ℃ for 1 hour, finally visualized by ECL system (Amersham).

E. coli에서In E. coli 융합 단백질의 발현 Expression of Fusion Proteins

플라스미드 pGST-NF45 또는 pMBP-NF90으로 형질전환된 E. coli BL21(DE3)을 하룻밤 동안 배양하고, 이 배양물을 신선한 YT 배지(암피실린 100 ㎍/㎖ 또는 클로람페니콜 68 ㎍/㎖ 포함)에 1:100 희석비로 접종하였다. 세포를 29℃ O.D.600 1.0까지 성장시킨 다음, 최종 농도 0.5 mM까지 IPTG를 첨가하여 융합 컨스트럭트를 유 도한 후, 격렬하게 쉐이킹하면서 29℃에서 5시간 동안 배양하였다. 유도된 세포를 2,500 rpm에서 20분 동안 원심분리하여 수집하였다. 수집된 세포를 완충액 A (20 mM Tris-HCl, pH 7.9, 100 mM KCl, 0.2 mM EDTA, 1 mM PMSF, 1 mM DTT, 20% 글라이세롤)의 원래 부피에 1/20 비율로 현탁한 다음, 5분 동안 음파파쇄를 실시하였다. 현탁액을 20,000 rpm에서 30분 동안 원심분리한 다음 상등액을 수거하였다. E. coli BL21 (DE3) transformed with plasmid pGST-NF45 or pMBP-NF90 was incubated overnight and the culture was 1: 100 in fresh YT medium (including 100 μg / ml of ampicillin or 68 μg / ml of chloramphenicol). Inoculation was carried out at a dilution ratio. Cells were grown to 29 ° C. OD 600 1.0, followed by induction of the fusion construct by addition of IPTG to a final concentration of 0.5 mM, followed by incubation at 29 ° C. for 5 hours with vigorous shaking. Induced cells were collected by centrifugation at 2,500 rpm for 20 minutes. The collected cells are suspended at a ratio of 1/20 in the original volume of Buffer A (20 mM Tris-HCl, pH 7.9, 100 mM KCl, 0.2 mM EDTA, 1 mM PMSF, 1 mM DTT, 20% glycerol) , Sonication was performed for 5 minutes. The suspension was centrifuged at 20,000 rpm for 30 minutes and then the supernatant was collected.

융합 단백질의 정제Purification of Fusion Proteins

글루타티온 S-트랜스퍼라아제-표지된 NF45(GST-NF45)를 선택적으로 정제하기 위한 글루타티온-세파로스 컬럼 크로마토그래피를 실시하였다. 완충액 A로 평형화된 글루타티온 세파로스 4B(Pharmacia) 50% 슬러리를 E.coli 분쇄물에 첨가한 다음, 4℃에서 1시간 30분 동안 부드럽게 교반하였다. 흡착된 융합 단백질을 갖는 매트릭스를 컬럼에 팩킹한 다음, 완충액 A의 100 베드 부피로 세척하였다. 컬럼을 20 mM 환원 글루타티온을 포함하는 완충액 B(100 mM Tris-HCl, pH 8.5, 100 mM KCl, 0.2 mM EDTA, 1 mM PMSF, 1 mM DTT, 20% 글라이세롤)로 용출하였다. 말토스-결합 단백질-표지된 NF90(MBP-NF90)을 선택적으로 정제하기 위한 아밀로스 컬럼 크로마토그래피를 실시하였다(50). 세포 분쇄물을 아밀로스 컬럼에 로딩하였다. 컬럼을 완충액 A로 세척하고 10 mM 말토스를 포함하는 완충액 A로 용출하였다.Glutathione-Sepharose column chromatography was performed to selectively purify glutathione S-transferase-labeled NF45 (GST-NF45). Glutathione Sepharose 4B (Pharmacia) 50% slurry equilibrated with Buffer A was added to the E. coli pulverization and then gently stirred at 4 ° C. for 1 h 30 min. The matrix with the adsorbed fusion protein was packed into a column and then washed with 100 bed volumes of Buffer A. The column was eluted with Buffer B (100 mM Tris-HCl, pH 8.5, 100 mM KCl, 0.2 mM EDTA, 1 mM PMSF, 1 mM DTT, 20% glycerol) containing 20 mM reduced glutathione. Amylose column chromatography was performed to selectively purify maltose-binding protein-labeled NF90 (MBP-NF90) (50). Cell crushes were loaded on amylose column. The column was washed with Buffer A and eluted with Buffer A with 10 mM maltose.

공동발현 및 정제Co-expression and Purification

MBP-NF90과 GST-NF45를 공동발현시키기 위하여, 플라스미드 pMBP-NF90를 E. coli 균주 BL21(DE3)에 CaCl2 방법으로 형질전환시킨 다음, 68 ㎍/㎖ 클로람페니콜을 함유하는 2 x YT 플레이트에서 클로람페니콜-내성 클론을 선별하였다. 이어, pMBP-NF90를 갖는 E. coli BL21(DE3)를 pGST-NF45로 CaCl2 방법으로 형질전환시켰다. 68 ㎍/㎖ 클로람페니콜과 100 ㎍/㎖ 암피실린을 함유하는 2 x YT 배지에서 암피실린과 클로람페니콜 모두에 내성을 나타내는 클론을 선별하였고, 이를 종균 배양에 이용하였다. 하룻밤 배양한 배양물을 68 ㎍/㎖ 클로람페니콜과 100 ㎍/㎖ 암피실린을 함유하는 2 x YT 배지에서 1:100 비율로 희석하였다. 세포를 O.D.600 1.0까지 성장시킨 다음, IPTG를 최종농도 0.5 mM까지 첨가하고 29℃에서 5시간 동안 쉐이킹 하면서 배양하였다. 유도된 세포를 2,500 rpm에서 20분 동안 원심분리하여 수집하였다. 수집된 세포를 완충액 A (20 mM Tris-HCl, pH 7.9, 100 mM KCl, 0.2 mM EDTA, 1 mM PMSF, 1 mM DTT, 20% 글라이세롤)에 1/20 비율로 현탁한 다음, 5분 동안 음파파쇄를 실시하였다. 현탁액을 20,000 rpm에서 30분 동안 원심분리한 다음 상등액을 4℃에서 2시간 동안 글루타티온-세파로스 4B 비드와 혼합시켰다. 혼합물을 컬럼에 패킹하고 완충액 A의 10 베드 부피로 5회 세척하였다. 결합된 단백질을 20 mM 환원 글루타티온을 포함하는 완충액 B(100 mM Tris-HCl, pH 8.5, 100 mM KCl, 0.2 mM EDTA, 1 mM PMSF, 1 mM DTT, 20% 글라이세롤)로 용출하였다. 그리고 나서, 용출액을 아밀로스 컬럼에 로딩하였다. 컬럼을 완충액 A로 세척한 후, 10 mM 말토스를 포함하는 완충액 A로 용출하였다.To co-express MBP-NF90 and GST-NF45, plasmid pMBP-NF90 was transformed into E. coli strain BL21 (DE3) by the CaCl 2 method, followed by chloramphenicol in 2 x YT plates containing 68 μg / ml chloramphenicol. Tolerant clones were selected. E. coli BL21 (DE3) with pMBP-NF90 was then transformed with pGST-NF45 by CaCl 2 method. Clones that were resistant to both ampicillin and chloramphenicol in 2 × YT medium containing 68 μg / ml chloramphenicol and 100 μg / ml ampicillin were selected and used for seed culture. Overnight cultures were diluted 1: 100 in 2 × YT medium containing 68 μg / ml chloramphenicol and 100 μg / ml ampicillin. Cells were grown to OD 600 1.0, then IPTG was added to a final concentration of 0.5 mM and incubated with shaking at 29 ° C. for 5 hours. Induced cells were collected by centrifugation at 2,500 rpm for 20 minutes. The collected cells were suspended in Buffer A (20 mM Tris-HCl, pH 7.9, 100 mM KCl, 0.2 mM EDTA, 1 mM PMSF, 1 mM DTT, 20% glycerol) at a rate of 1/20 and then 5 minutes. Sonication was carried out. The suspension was centrifuged at 20,000 rpm for 30 minutes and then the supernatant was mixed with glutathione-sepharose 4B beads at 4 ° C. for 2 hours. The mixture was packed into a column and washed five times with a 10 bed volume of Buffer A. The bound protein was eluted with Buffer B (100 mM Tris-HCl, pH 8.5, 100 mM KCl, 0.2 mM EDTA, 1 mM PMSF, 1 mM DTT, 20% glycerol) containing 20 mM reduced glutathione. The eluate was then loaded onto an amylose column. The column was washed with Buffer A and then eluted with Buffer A with 10 mM maltose.

RNA-단백질 상호작용의 UV 교호결합 분석UV Interaction Analysis of RNA-protein Interactions

결합 완충액[10 mM Tris (pH 7.9), 5% 글라이세롤, 2 mM MgCl2, 50 mM KCl, 0.1 mM EDTA]에서 과량의 tRNA(3 ㎍)의 존재 하에서 균일하게 레이블링된 RNA 4 ng과 E. coli 발현 단백질 2 ㎕를 반응시켰다(50). 실온에서 10분 동안 반응시킨 다음, 반응 혼합물을 96-웰 플레이트에 옮긴 다음, CL-1000 Ultraviolet Crosslinker (Hoefer)를 이용하여 약 10 cm의 UV 램프 이격거리로 20분 동안 UV 교호 결합시켰다. RNase A 및 RNase T1 (Sigma) 혼합물을 각각 최종 농도 0.5 ㎍/㎕ 및 0.5 U/㎕가 되도록 첨가한 후, 각각의 반응 혼합물을 30℃에서 20분 동안 반응시켰다. 최종적으로, 단백질 시료 완충액[50 mM Tris (pH 6.8), 10% 글라이세롤, 2% SDS, 100 mM DTT, 0.01% 브로모페놀 블루]을 첨가하고, 복합체를 8% SDS-PAGE에서 분석하였다(40).4 ng and E homogeneously labeled RNA in binding buffer [10 mM Tris (pH 7.9), 5% glycerol, 2 mM MgCl 2 , 50 mM KCl, 0.1 mM EDTA] in the presence of excess tRNA (3 μg) 2 μl of coli expressing protein was reacted (50). After reacting for 10 minutes at room temperature, the reaction mixture was transferred to a 96-well plate, and then UV-coupled for 20 minutes using a CL-1000 Ultraviolet Crosslinker (Hoefer) at a UV lamp spacing of about 10 cm. After the RNase A and RNase T1 (Sigma) mixtures were added to the final concentrations of 0.5 μg / μl and 0.5 U / μl respectively, each reaction mixture was reacted at 30 ° C. for 20 minutes. Finally, protein sample buffer [50 mM Tris (pH 6.8), 10% glycerol, 2% SDS, 100 mM DTT, 0.01% bromophenol blue] was added and the complex was analyzed on 8% SDS-PAGE. 40.

전기영동 이동성 전이(Electrophoretic mobility shift) 분석Electrophoretic Mobility Shift Analysis

RNA 결합 반응을 결합 완충액에서 4 ng의 [α-32P]UTP-표지된 HBV ε RNA (2-3 x 103 cps)로 15 ㎕ 부피에서 실시하였고, 이 때 E. coli 발현 단백질에서 RNA 결합 단백질에 대한 비특이적 경쟁자로서 tRNA (3 ㎍)을 이용하였다. 이어, 단백질을 최종적으로 첨가하였다. 실온에서 20분 동안 반응시킨 다음, 0.5 x TBE (pH 8.5) 내의 1 x Tris-보레이트-EDTA, TBE (pH 8.5)에서 중합된 5% 비변성 폴리아크릴아미드 젤(29:1의 아크릴아미드-비스아크릴아미드 중량비)에서 상기 반응 시료를 분석하였다. 전기영동을 150 V/16-18 mA에서 2시간 동안 실온에서 실시하였다. 그런 다음, 젤을 Whatman No. 3MM 페이퍼에 옮기고, 건조시킨 후, -70℃에서 인텐시파잉 스크린을 가지고 오토래디오그래피를 하였다. 경쟁 실험으로서, E.coli 발현 단백질을 비표지된 HBV ε RNA의 증가량 또는 과량의 폴리(I)-폴리(C)와 반응시켰다. 항체를 이용한 슈퍼전이(supershift) 분석을 위하여, 단백질 A(단백질 A-세파로스)에 대한 흡착성을 이용하여 항-NF45-항체를 토끼 면역혈청으로부터 정제하였다.RNA binding reactions were performed in 15 μl volume with 4 ng of [α- 32 P] UTP-labeled HBV ε RNA (2-3 × 10 3 cps) in binding buffer, with RNA binding in E. coli expressing protein. TRNA (3 μg) was used as a nonspecific competitor to the protein. Then, the protein was finally added. 5% unmodified polyacrylamide gel (29: 1 acrylamide-bis polymerized in 1 x Tris-borate-EDTA, TBE (pH 8.5) in 0.5 x TBE (pH 8.5) after reaction at room temperature for 20 minutes The reaction sample was analyzed in acrylamide weight ratio). Electrophoresis was performed at 150 V / 16-18 mA for 2 hours at room temperature. Then, apply the gel Whatman No. Transferred to 3MM paper, dried and autoradiography with an intensifying screen at -70 ° C. As a competition experiment, E. coli expressing proteins were reacted with increased or excess poly (I) -poly (C) of unlabeled HBV ε RNA. For supershift analysis using antibodies, anti-NF45-antibodies were purified from rabbit immune serum using adsorption to protein A (protein A-sepharose).

실험 결과Experiment result

공동발현 시스템의 구축Construction of co-expression system

RNA 결합 단백질, NF45와 NF90 헤테로다이머에 대한 정밀한 분석을 위하여, 각각의 유전자를 PCR 증폭하였다. 이어, NF45 및 NF90를 발현시키기 위하여 각각 pGEX 및 pMAL-c 발현 벡터를 이용하였다. 친환성 크로마토그래피로 정제된 NF45 및 NF90를 이용하여, 각각의 단백질의 RNA 결합 특성을 분석하였다. 실험 결과, MBP-NF 90은 RNA에 결합하였으나, GST-NF45는 결합하지 않았다. 사실 헤테로다이머 단백질들은 바이너리 단백질 복합체 상태에서만 활성을 나타내는 것이 일반적이다(51). 이러한 문제점을 해결하기 위하여, 본 발명자들은 공동발현 시스템을 응용하여, 서로 다른 두 종류의 발현 벡터를 이용하여 E. coli에서 단백질을 공동발현시켰다. 두 종류의 서로 다른 발현 벡터는 다른 ori를 요구하는 데, 이는 플라스미드의 분리(segregation)를 억제함으로써 세포에서 하나의 플라스미드가 손실되 는 것을 막기 위한 것이며, 또한 상기 벡터 시스템은 서로 다른 항생물질에 대한 내성을 요구하는 데, 이는 선별을 용이하게 하고 서로 다른 융합시스템이 개별적으로 분리되고 동정될 수 있도록 하기 위한 것이다. 우선, 본 발명자들은 pBR322로부터 유래된 복제원점, 암피실린 내성 유전자 및 pGEX-4T-1 유래 GST 및 NF45 유전자를 갖는 tac-계열의 발현 플라스미드 pGST-NF45를 구축하였다(도 1a). 이어, 상기 구축된 플라스미드와 양립되는 tac-계열의 발현벡터 pMBP-NF90를 구축하였는 데, 이는 p15A-유래 ori, pLysE로부터 유래된 클로람페니콜 내성 유전자, pMAL-c2 유래 MBP 및 NF90 유전자를 포함한다(도 1b).For precise analysis of RNA binding proteins, NF45 and NF90 heterodimers, each gene was PCR amplified. Then, pGEX and pMAL-c expression vectors were used to express NF45 and NF90, respectively. RNA binding properties of each protein were analyzed using NF45 and NF90 purified by affinity chromatography. As a result, MBP-NF 90 binds to RNA, but GST-NF45 does not. In fact, heterodimer proteins are generally active only in the binary protein complex state (51). In order to solve this problem, the present inventors applied a coexpression system, co-expressed the protein in E. coli using two different expression vectors. Two different expression vectors require different ori to prevent the loss of one plasmid in the cell by inhibiting the segregation of the plasmid, and the vector system for different antibiotics. Resistance is required to facilitate selection and to allow different fusion systems to be individually isolated and identified. First, we constructed a tac-family expression plasmid pGST-NF45 with a replication origin derived from pBR322, an ampicillin resistance gene and pGEX-4T-1 derived GST and NF45 genes (FIG. 1A). Then, a tac-family expression vector pMBP-NF90 compatible with the constructed plasmid was constructed, including p15A-derived ori , chloramphenicol resistance gene derived from pLysE, pMAL-c2 derived MBP and NF90 genes (FIG. 1b).

GST-NF45 및 MBP-NF90의 공동발현 및 정제Coexpression and Purification of GST-NF45 and MBP-NF90

단백질의 공동발현을 위하여, E.coli BL21(DE3) 세포를 pMBPc-NF90 컨스트럭트로 형질전환하고 클로람페니콜 내성 세포를 선별한 다음, pGST-NF45로 다시 형질전환하고 클로람페니콜 내성 세포를 선별하였다. 선별된 세포를 37℃에서 배양한 다음, IPTG로 유도하여 GST-NF45 및 MBP-NF90를 공동발현시켰다. 이어, 단백질의 안정성 및 용해성을 위하여 배양물을 29℃로 온도를 하강시켰다. 글루타티온 S-트랜스퍼라아제-표지 NF45(GST-NF45)의 정제를 위한 글루타티온-세파로스 컬럼 크로마토그래피, 그리고 말토스-결합 단백질-표지 NF90(MBP-NF90)의 정제를 위한 아밀로스 컬럼 크로마토그래피를 실시하였다. 그런 다음, 정제된 GST-표지 NF45 및 MBP-표지 NF90을 8% SDS-PAGE하고 쿠마시 브릴런트 블루로 염색하였다(도 2a). GST-NF45 및 MBP-NF90은 각각 66 kDa 및 126 kDa의 어페런트 분자량을 나타내었다( 도 2a, 레인 1과 2). 공동발현 MBP-NF90 및 GST-NF45를 GST-표지 NF45 정제용 글루타티온-세파로스 컬럼에 적용시켰다. 그 결과, GST-NF45 뿐만 아니라 MBP-NF90도 용출되었다(도 2a, 레인 3). 또한, GST 용출된 단백질을 아밀로스 컬럼에 적용한 경우, MBP-NF90 뿐만 아니라 GST-NF45도 용출되었다(도 2a, 레인 4). 상기 결과를 항-NF45 항체(도 2b)와 항-NF90 항체(도 2c)를 이용하여 웨스턴 블롯팅 분석으로 재확인하였다. 또한, 100 kDa의 다른 단백질이 항-NF90 항체와 반응하였는 데, 이 단백질은 MBP-NF90의 파쇄물 또는 불완전 산물로 판단된다. 공동발현된 MBP-NF90과 GST-NF45을 젤 여과 크로마토그래피에 적용한 경우, 상기 두 단백질은 동시에 용출되었다. 이 결과를 통하여, NF90과 NF45가 후-변형 없이 단백질-단백질 상호작용을 통하여 헤테로다이머를 형성한다는 것을 알 수 있다.For coexpression of the protein, E. coli BL21 (DE3) cells were transformed with pMBPc-NF90 construct, chloramphenicol resistant cells were selected, then transformed back with pGST-NF45 and chloramphenicol resistant cells were selected. Selected cells were incubated at 37 ° C. and then induced by IPTG to co-express GST-NF45 and MBP-NF90. The culture was then lowered to 29 ° C. for stability and solubility of the protein. Glutathione-sepharose column chromatography for purification of glutathione S-transferase-labeled NF45 (GST-NF45), and amylose column chromatography for purification of maltose-binding protein-labeled NF90 (MBP-NF90) It was. Then, purified GST-labeled NF45 and MBP-labeled NF90 were 8% SDS-PAGE and stained with Coomassie Brilliant Blue (FIG. 2A). GST-NF45 and MBP-NF90 exhibited parent molecular weights of 66 kDa and 126 kDa, respectively (FIG. 2A, lanes 1 and 2). Co-expression MBP-NF90 and GST-NF45 were applied to GST-labeled NF45 preparative glutathione-sepharose columns. As a result, not only GST-NF45 but also MBP-NF90 were eluted (FIG. 2A, lane 3). In addition, when the GST eluted protein was applied to an amylose column, not only MBP-NF90 but also GST-NF45 eluted (FIG. 2A, lane 4). The results were reconfirmed by Western blotting analysis using anti-NF45 antibody (FIG. 2B) and anti-NF90 antibody (FIG. 2C). In addition, another 100 kDa protein was reacted with the anti-NF90 antibody, which is believed to be a fragment or incomplete product of MBP-NF90. When coexpressed MBP-NF90 and GST-NF45 were subjected to gel filtration chromatography, both proteins were eluted at the same time. These results show that NF90 and NF45 form heterodimers through protein-protein interactions without post-modification.

공동발현 GST-NF45와 MBP-NF90의 RNA 결합능 분석RNA binding capacity analysis of coexpression GST-NF45 and MBP-NF90

HepG2 세포에서 정제된 공지의 헤테로다이머 NF90/NF43와 같이, E. coli에서 공동발현된 본 발명의 단백질이 HBV ε RNA에 결합하는 지 여부를 결정하기 위하여, UV-교호결합 분석 및 EMSA를 실시하였다(40). 이용된 프로브는 68-nt 인 비트로 전사체(HE1-68)인데, 이는 HBV ε 스템-루프 구조를 갖는다. 각각의 단백질을 균일하게 표지된 HE1-68 RNA와 30℃에서 반응시켰고, 이 때 과량의 이스트 tRNA를 이용하여 비특이적 상호작용에 의한 백그라운드를 최소화하였다. 단백질-RNA 복합체를 UV-교호결합시키고 RNase 절단을 과도하게 한 다음, SDS-PAGE 분석을 실시하였다. 그 결과, MBP-NF90(도 3a, 레인 4) 및 MBP-NF90/GST-NF45(도 3a, 레인 5)은 검출되었으나, 네가티브 대조군으로서의 GST(도 3a, 레인 1)와 MBP(도 3a, 레인 2), 그리고 GST-NF45 (도 3a, 레인 3)은 검출되지 않았다. MBP-NF90은 SDS-PAGE 결과와 동일한 크기의 126 kDa 밴드를 나타내었다. MBP-NF90/GST-NF45은 두 개의 주요 밴드를 나타내었다. 빠르게 이동하는 밴드는 66 kDa의 추정 분자량을 나타내었는데, 이는 GST-NF45의 분자량에 해당된다. 느리게 이동하는 밴드는 MBP-NF90에 해당된다. 상기 결과와 일치되게, HE1-68로 프로빙된 EMSA는 GST-NF45(도 3b, 레인 3)는 프로브에 결합되지 않았으나, MBP-NF90(도 3b, 레인 4) 및 공동발현 MBP-NF90/GST-NF45(도 3a, 레인 5)는 결합하였다. 공동발현 MBP-NF90/GST-NF45 헤테로다이머는, MBP-NF90 보다 크게 전이(shift)된 밴드를 나타내었다. 전이된 모든 밴드들은 프로테아제 K 절단에 민감하였고, 이 결과는 상기 밴드들이 폴리펩타이드에 해당된다는 것을 확인시켜 준다. Like known heterodimers NF90 / NF43 purified in HepG2 cells, UV-crosslinking assays and EMSA were performed to determine whether the proteins of the invention co-expressed in E. coli bind to HBV ε RNA. 40. The probe used was a 68-nt in vitro transcript (HE1-68), which has an HBV ε stem-loop structure. Each protein was reacted with homogeneously labeled HE1-68 RNA at 30 ° C., with excess yeast tRNA used to minimize background due to nonspecific interactions. Protein-RNA complexes were UV-crosslinked and RNase cleaved excessively, followed by SDS-PAGE analysis. As a result, MBP-NF90 (FIG. 3A, lane 4) and MBP-NF90 / GST-NF45 (FIG. 3A, lane 5) were detected, but GST (FIG. 3A, lane 1) and MBP (FIG. 3A, lane) as negative controls. 2), and GST-NF45 (FIG. 3A, lane 3) was not detected. MBP-NF90 showed a 126 kDa band of the same size as the SDS-PAGE results. MBP-NF90 / GST-NF45 showed two major bands. The fast moving band showed an estimated molecular weight of 66 kDa, which corresponds to the molecular weight of GST-NF45. The slow moving band corresponds to MBP-NF90. Consistent with the above results, EMSA probed with HE1-68 did not bind GST-NF45 (FIG. 3B, lane 3) to the probe, but MBP-NF90 (FIG. 3B, lane 4) and coexpression MBP-NF90 / GST- NF45 (FIG. 3A, lane 5) bound. The coexpressed MBP-NF90 / GST-NF45 heterodimer exhibited a band shifted larger than MBP-NF90. All bands that were transfected were sensitive to protease K cleavage and the results confirm that the bands correspond to polypeptides.

상술한 데이터를 통하여, NF45의 HBV ε RNA에 대한 결합능에 헤테로다이머의 형성이 중요한 역할을 한다는 것을 알 수 있다(추측컨대, 단백질 폴딩의 효과를 통하여). NF45의 HBV ε RNA 결합을 확인하기 위하여, 항-NF45 항체를 이용하여 슈퍼전이 분석을 실시하였다. 반응 후 항체를 첨가하였다. 도 3c에서 볼 수 있듯이, 항-NF45 항체를 첨가한 경우, MBP-NF90/GST-NF45 헤테로다이머 밴드 뿐만 아니라 슈퍼전이 밴드도 나타났다. 이 밴드는 헤테로다이머와 항체의 복합체이다. 이러한 데이터를 기초로 하여, 본 발명자들은 GST-NF45가 MBP-NF90/GST-NF45를 형성할 때 HBV ε RNA에 결합한다는 결론을 얻었다.From the above data, it can be seen that heterodimer formation plays an important role in NF45 binding ability to HBV ε RNA (presumably through the effect of protein folding). In order to confirm the HBV ε RNA binding of NF45, super-transfer assay was performed using anti-NF45 antibody. The antibody was added after the reaction. As can be seen in Figure 3c, when the anti-NF45 antibody was added, not only the MBP-NF90 / GST-NF45 heterodimer band but also the super-transition band appeared. This band is a complex of heterodimer and antibody. Based on these data, we conclude that GST-NF45 binds to HBV ε RNA when forming MBP-NF90 / GST-NF45.

공동발현 MBP-NF90 및 GST-NF45의 RNA 결합 특이성RNA binding specificity of coexpression MBP-NF90 and GST-NF45

NF90은 dsRNA 및 고도로 구조화된 ssRNAs에 결합할 수 있다고 알려져 있다(24, 25). 최근에, NF45는 고도로 구조화된 ssRNA에 결합할 수 있다고 보고되었다(40). 그러나, RNA와 상기 단백질의 상호작용에 있어서 특이성은 연구가 거의 없다. E. coli 발현 RNA 결합 단백질의 특이성을 결정하기 위하여, 각각의 단백질을 표지된 HBV ε RNA와 반응시켰고 또한 비표지된 HBV ε RNA 또는 비표지된 dsRNA, poly(I)-poly(C)의 증가량과 반응시켰다. 실험 결과, MBP-NF90(도 4, 레인 2-5) 및 MBP-NF90/GST-NF45 헤테로다이머(도 4, 레인 6-9)는 유사한 패턴을 나타내었다. 비표지된 HBV ε RNA의 양을 증가시키면, 표지된 RNA-단백질 복합체의 양이 감소하였다. 또한, 비표지된 dsRNA, poly(I)-poly(C)의 20배 몰 양을 반응 전에 첨가한 경우, 전이밴드가 없어졌다. 이러한 결과를 통하여, E. coli 발현 NF90 및 NF45는 고도로 구조화된 HBV ε RNA에 선호적으로 결합하며 이러한 결합은 dsRNA에 의해 경쟁된다는 것을 알 수 있다.NF90 is known to bind to dsRNAs and highly structured ssRNAs (24, 25). Recently, NF45 has been reported to be capable of binding highly structured ssRNAs (40). However, the specificity in the interaction of RNA with these proteins is little studied. To determine the specificity of an E. coli expressing RNA binding protein, each protein was reacted with labeled HBV epsilon RNA and also increased the amount of unlabeled HBV epsilon RNA or unlabeled dsRNA, poly (I) -poly (C). Reacted with As a result, MBP-NF90 (FIG. 4, lanes 2-5) and MBP-NF90 / GST-NF45 heterodimer (FIG. 4, lanes 6-9) showed similar patterns. Increasing the amount of unlabeled HBV ε RNA decreased the amount of labeled RNA-protein complex. Also, when a 20-fold molar amount of unlabeled dsRNA, poly (I) -poly (C), was added before the reaction, the transition band disappeared. These results indicate that E. coli expressing NF90 and NF45 preferentially binds to highly structured HBV ε RNA and this binding is competitive by dsRNA.

상술한 바와 같이, 본 발명은 NF(nuclear factor)90/NF(nuclear factor)45 복합체를 활성화 형태로 대장균(Escherichia. coli)에서 제조하기 위한 두 가지 발현벡터를 포함하는 발현벡터 시스템을 제공한다. 또한, 본 발명은 NF90/NF45 복합체를 활성화 형태로 대장균에서 제조하기 위한 활성 NF90/NF45 복합체의 제조방법을 제공한다. 본 발명에 따르면, NF90 발현용 벡터 및 NF45 발현용 벡터가 하 나의 대장균 세포에 공동형질전환 되어 대장균 세포의 여러 세대 동안 안정되게 유지되며, NF90 및 NF45를 발현하여 효율적으로 활성 NF90/NF45 복합체를 제조케 한다.As described above, the present invention provides an expression vector system including two expression vectors for preparing an NF (nuclear factor) 90 / NF (nuclear factor) 45 complex in an activated form in Escherichia coli . The present invention also provides a method for preparing an active NF90 / NF45 complex for producing an NF90 / NF45 complex in E. coli in an activated form. According to the present invention, the NF90 expression vector and the NF45 expression vector are co-transformed into one E. coli cell to remain stable for several generations of E. coli cells, expressing NF90 and NF45 to efficiently produce an active NF90 / NF45 complex. Make it.

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

참조문헌Reference

1. A. Rao, NF-ATp: a transcription factor required for the co-ordinate induction of several cytokine genes, Immunol. Today 15 (1994) 274-281.A. Rao, NF-ATp: a transcription factor required for the co-ordinate induction of several cytokine genes, Immunol. Today 15 (1994) 274-281.

2. G. R. Crabtree, N. A. Clipstone, Signal transmission between the plasma membrane and nucleus of T lymphocytes, Annu. Rev. Biochem. 63 (1994) 1045-1083.G. R. Crabtree, N. A. Clipstone, Signal transmission between the plasma membrane and nucleus of T lymphocytes, Annu. Rev. Biochem. 63 (1994) 1045-1083.

3. J. Jain, C. Loh, A. Rao, Transcriptional regulation of the IL-2 gene, Curr. Opin. Immunol. 7 (1995) 333-342.3. J. Jain, C. Loh, A. Rao, Transcriptional regulation of the IL-2 gene, Curr. Opin. Immunol. 7 (1995) 333-342.

4. C. Luo, E. Burgeon, A. Rao, Mechanisms of transactivation by nuclear factor of activated T cells-1, J. Exp. Med. 184 (1996) 141-147.4. C. Luo, E. Burgeon, A. Rao, Mechanisms of transactivation by nuclear factor of activated T cells-1, J. Exp. Med. 184 (1996) 141-147.

5. S. L. Schreiber, G. R. Crabtree, The mechanism of action of cyclosporin A and FK506, Immunol. Today 13 (1992) 136-142.5. S. L. Schreiber, G. R. Crabtree, The mechanism of action of cyclosporin A and FK506, Immunol. Today 13 (1992) 136-142.

6. E. Serfling, A. Avois, M. Neumann, The architecture of the interleukin-2 promoter: a reflection of T lymphocyte activation, Biochim. Biophys. Acta. 1263 (1995) 181-200.6.E. Serfling, A. Avois, M. Neumann, The architecture of the interleukin-2 promoter: a reflection of T lymphocyte activation, Biochim. Biophys. Acta. 1263 (1995) 181-200.

7. G. R. Crabtree, Contingent genetic regulatory events in T lymphocyte activation, Science 243 (1989) 355-361.G. R. Crabtree, Contingent genetic regulatory events in T lymphocyte activation, Science 243 (1989) 355-361.

8. J. P. Shaw, P. J. Utz, D. B. Durand, J. J. Toole, E. A. Emmel, G. R. Crabtree, Identification of a putative regulator of early T cell activation genes, Science 241 (1988) 202-205.8. J. P. Shaw, P. J. Utz, D. B. Durand, J. J. Toole, E. A. Emmel, G. R. Crabtree, Identification of a putative regulator of early T cell activation genes, Science 241 (1988) 202-205.

9. P. N. Cockerill, F. Shannon, A. G. Bert, G. R. Ryan, M. A. Vadas, The granulocyte-macrophage colony-stimulating factor/interleukin 3 locus is regulated by an inducible cyclosporin A-sensitive enhancer, Proc. Natl. Acad. Sci. U. S. A. 90 (1993) 2466-2470.9.P. N. Cockerill, F. Shannon, A. G. Bert, G. R. Ryan, M. A. Vadas, The granulocyte-macrophage colony-stimulating factor / interleukin 3 locus is regulated by an inducible cyclosporin A-sensitive enhancer, Proc. Natl. Acad. Sci. U. S. A. 90 (1993) 2466-2470.

10. E. S. Masuda, H. Tokumitsu, A. Tsuboi, J. Shlomai, P. Hung, K. I. Arai, N. Arai, The granulocyte-macrophage colony-stimulating factor promoter cis-acting element CLE0 mediates induction signals in T cells and is recognized by factors related to AP1 and NFAT, Mol. Cell. Biol. 13 (1993) 7399-7407.10.ES Masuda, H. Tokumitsu, A. Tsuboi, J. Shlomai, P. Hung, KI Arai, N. Arai, The granulocyte-macrophage colony-stimulating factor promoter cis-acting element CLE0 mediates induction signals in T cells and is recognized by factors related to AP1 and NFAT, Mol. Cell. Biol. 13 (1993) 7399-7407.

11. S. Chuvpilo, C. Schomberg, R. Gerwig, A. Heinfling, R. Reeves, F. Grummt, E. Serfling, Multiple closely-linked NFAT/octamer and HMG I(Y) binding sites are part of the interleukin-4 promoter, Nucl. Acids Res. 21 (1993) 5694-5704.11.S. Chuvpilo, C. Schomberg, R. Gerwig, A. Heinfling, R. Reeves, F. Grummt, E. Serfling, Multiple closely-linked NFAT / octamer and HMG I (Y) binding sites are part of the interleukin -4 promoter, Nucl. Acids Res. 21 (1993) 5694-5704.

12. S. J. Szabo, J. S. Gold, T. L. Murphy, K. M. Murphy, Identification of cis-acting regulatory elements controlling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc, Mol. Cell. Biol. 13 (1993) 4793-4805. 12.S. J. Szabo, J. S. Gold, T. L. Murphy, K. M. Murphy, Identification of cis-acting regulatory elements controlling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc, Mol. Cell. Biol. 13 (1993) 4793-4805.

13. J. W. Rooney, M. R. Hodge, P. G. McCaffrey, A. Rao, L. H. Glimcher, A common factor regulates both Th1- and Th2-specific cytokine gene expression, EMBO J. 13 (1994) 625-633.13. J. W. Rooney, M. R. Hodge, P. G. McCaffrey, A. Rao, L. H. Glimcher, A common factor regulates both Th1- and Th2-specific cytokine gene expression, EMBO J. 13 (1994) 625-633.

14. H. J. Lee, E. S. Masuda, N. Arai, K. Arai, T. Yokota, Definition of cis-regulatory elements of the mouse interleukin-5 gene promoter. Involvement of nuclear factor of activated T cell-related factors in interleukin-5 expression, J. Biol. Chem. 270 (1995) 17541-17550.14.H. J. Lee, E. S. Masuda, N. Arai, K. Arai, T. Yokota, Definition of cis-regulatory elements of the mouse interleukin-5 gene promoter. Involvement of nuclear factor of activated T cell-related factors in interleukin-5 expression, J. Biol. Chem. 270 (1995) 17541-17550.

15. A. E. Goldfield, P. G. McCaffrey, J. L. Strominger, A. Rao, Identification of a novel cyclosporin-sensitive element in the human tumor necrosis factor alpha gene promoter, J. Exp. Med. 178 (1993) 1365-1379.15. A. E. Goldfield, P. G. McCaffrey, J. L. Strominger, A. Rao, Identification of a novel cyclosporin-sensitive element in the human tumor necrosis factor alpha gene promoter, J. Exp. Med. 178 (1993) 1365-1379.

16. S. Ho, D. J. Thomas, L. A. Timmerman, X. Li, U. Franke, G. R. Crabtree, NFATc3, a lymphoid-specific NFATc family member that is calcium-regulated and exhibits distinct DNA binding specificity, J. Biol. Chem. 270 (1995) 19898-19907.16. S. Ho, D. J. Thomas, L. A. Timmerman, X. Li, U. Franke, G. R. Crabtree, NFATc3, a lymphoid-specific NFATc family member that is calcium-regulated and exhibits distinct DNA binding specificity, J. Biol. Chem. 270 (1995) 19898-19907.

17. T. Hoey, Y. L. Sun, K. Williamson, X. Xu, Isolation of two new members of the NF-AT gene family and functional characterization of the NF-AT proteins, Immunity 2 (1995) 461-472.17.T. Hoey, Y. L. Sun, K. Williamson, X. Xu, Isolation of two new members of the NF-AT gene family and functional characterization of the NF-AT proteins, Immunity 2 (1995) 461-472.

18. C. Luo, E. Burgeon, J. A. Carew, P. G. McCaffrey, T. M. Badalian, W. S. Lane, P. G. Hogan, A. Rao, Recombinant NFAT1 (NFATp) is regulated by calcineurin in T cells and mediates transcription of several cytokine genes, Mol. Cell. Biol. 16 (1996) 3955-3966.18.C. Luo, E. Burgeon, JA Carew, PG McCaffrey, TM Badalian, WS Lane, PG Hogan, A. Rao, Recombinant NFAT1 (NFATp) is regulated by calcineurin in T cells and mediates transcription of several cytokine genes, Mol . Cell. Biol. 16 (1996) 3955-3966.

19. E. S. Masuda, Y. Naito, H. Tokumitsu, D. Campbell, F. Saito, C. Hannum, K. I. Arai, N. Arai, NFATx, a novel member of the nuclear factor of activated T cells family that is expressed predominantly in the thymus, Mol. Cell. Biol. 15 (1995) 2697-2706.19.ES Masuda, Y. Naito, H. Tokumitsu, D. Campbell, F. Saito, C. Hannum, KI Arai, N. Arai, NFATx, a novel member of the nuclear factor of activated T cells family that is expressed predominantly in the thymus, Mol. Cell. Biol. 15 (1995) 2697-2706.

20. P. G. McCaffrey, C. Luo, T. K. Kerppola, S. Jain, T. M. Badalian, A. H. Ho, E. B. Burgeon, W. S. Lane, J. N. Lambert, T. Curran, G. L. Verdine, A. Rao, P. G. Hogan, Isolation of the cyclosporin-sensitive T cell transcription factor NFATp, Science 262 (1993) 750-754.20.PG McCaffrey, C. Luo, TK Kerppola, S. Jain, TM Badalian, AH Ho, EB Burgeon, WS Lane, JN Lambert, T. Curran, GL Verdine, A. Rao, PG Hogan, Isolation of the cyclosporin- sensitive T cell transcription factor NFATp, Science 262 (1993) 750-754.

21. J. P. Northrop, S. N. Ho, L. Chen, D. J. Thomas, L. A. Timmerman, G. P. Nolan, A. Admon, G. R. Crabtree, NF-AT components define a family of transcription factors targeted in T-cell activation, Nature 369 (1994) 497-502.JP Northrop, SN Ho, L. Chen, DJ Thomas, LA Timmerman, GP Nolan, A. Admon, GR Crabtree, NF-AT components define a family of transcription factors targeted in T-cell activation, Nature 369 (1994) 497-502.

22. B. Corthesy, P. N. Kao, Purification by DNA affinity chromatography of two polypeptides that contact the NF-AT DNA binding site in the interleukin 2 promoter, J. Biol. Chem. 269 (1994) 20682-20690.22.B. Corthesy, P. N. Kao, Purification by DNA affinity chromatography of two polypeptides that contact the NF-AT DNA binding site in the interleukin 2 promoter, J. Biol. Chem. 269 (1994) 20682-20690.

23. P. N. Kao, L. Chen, G. Brock, J. Ng, J. Kenny, A. J. Smith, B. Corthesy, Cloning and expression of cyclosporin A- and FK506-sensitive nuclear factor of activated T-cells: NF45 and NF90, J. Biol. Chem. 269 (1994) 20691-20699.23.PN Kao, L. Chen, G. Brock, J. Ng, J. Kenny, AJ Smith, B. Corthesy, Cloning and expression of cyclosporin A- and FK506-sensitive nuclear factor of activated T-cells: NF45 and NF90 , J. Biol. Chem. 269 (1994) 20691-20699.

24. H. J. Liao, R. Kobayashi, M. B. Mathews, Activities of adenovirus virus-associated RNAs: purification and characterization of RNA binding proteins, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 8514-8519.24. H. J. Liao, R. Kobayashi, M. B. Mathews, Activities of adenovirus virus-associated RNAs: purification and characterization of RNA binding proteins, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 8514-8519.

25. J. O. Langland, P. N. Kao, B. L. Jacobs, Nuclear factor-90 of activated T-cells: A double-stranded RNA-binding protein and substrate for the double-stranded RNA-dependent protein kinase, PKR, Biochemistry 38 (1999) 6361-6368.JO Langland, PN Kao, BL Jacobs, Nuclear factor-90 of activated T-cells: A double-stranded RNA-binding protein and substrate for the double-stranded RNA-dependent protein kinase, PKR, Biochemistry 38 (1999) 6361 -6368.

26. L. R. Saunders, D. J. Perkins, S. Balachandran, R. Michaels, R. Ford, A. Mayeda, G. N. Barber, Characterization of two evolutionarily conserved, alternatively spliced nuclear phosphoproteins, NFAR-1 and -2, that function in mRNA processing and interact with the double-stranded RNA-dependent protein kinase, PKR, J. Biol. Chem. 276 (2001) 32300-32312.26.LR Saunders, DJ Perkins, S. Balachandran, R. Michaels, R. Ford, A. Mayeda, GN Barber, Characterization of two evolutionarily conserved, alternatively spliced nuclear phosphoproteins, NFAR-1 and -2, that function in mRNA processing and interact with the double-stranded RNA-dependent protein kinase, PKR, J. Biol. Chem. 276 (2001) 32300-32312.

27. F. W. Buaas, K. Lee, S. Edelhoff, C. Disteche, R. E. Braun, Cloning and characterization of the mouse interleukin enhancer binding factor 3 (Ilf3) homolog in a screen for RNA binding proteins, Mamm. Genome 10 (1999) 451-456.27.F. W. Buaas, K. Lee, S. Edelhoff, C. Disteche, R. E. Braun, Cloning and characterization of the mouse interleukin enhancer binding factor 3 (Ilf3) homolog in a screen for RNA binding proteins, Mamm. Genome 10 (1999) 451-456.

28. R. C. Patel, D. J. Vestal, Z. Xu, S. Bandyopadhyay, W. Guo, S. M. Erme, B. R. Williams, G. C. Sen, DRBP76, a double-stranded RNA-binding nuclear protein, is phosphorylated by the interferon-induced protein kinase, PKR, J. Biol. Chem. 274 (1999) 20432-20437.28.RC Patel, DJ Vestal, Z. Xu, S. Bandyopadhyay, W. Guo, SM Erme, BR Williams, GC Sen, DRBP76, a double-stranded RNA-binding nuclear protein, is phosphorylated by the interferon-induced protein kinase , PKR, J. Biol. Chem. 274 (1999) 20432-20437.

29. Y. H. Xu, G. A. Grabowski, Molecular cloning and characterization of a translational inhibitory protein that binds to coding sequences of human acid beta-glucosidase and other mRNAs, Mol. Genet. Metab. 68 (1999) 441-454.29.Y. H. Xu, G. A. Grabowski, Molecular cloning and characterization of a translational inhibitory protein that binds to coding sequences of human acid beta-glucosidase and other mRNAs, Mol. Genet. Metab. 68 (1999) 441-454.

30. N. Matsumoto-Taniura, F. Pirollet, R. Monroe, L. Gerace, J. M. Westendorf, Identification of novel M phase phosphoproteins by expression cloning, Mol. Biol. Cell. 7 (1996) 1455-1469.30. N. Matsumoto-Taniura, F. Pirollet, R. Monroe, L. Gerace, J. M. Westendorf, Identification of novel M phase phosphoproteins by expression cloning, Mol. Biol. Cell. 7 (1996) 1455-1469.

31. L. M. Parker, I. Fierro-Monti, T. W. Reichman, S. Gunnery, M. B. Mathews, Double-stranded RNA-binding proteins and the control of protein synthesis and cell growth, Cold Spring Harb. Symp. Quant. Biol. 66 (2001) 485-497.31.L. M. Parker, I. Fierro-Monti, T. W. Reichman, S. Gunnery, M. B. Mathews, Double-stranded RNA-binding proteins and the control of protein synthesis and cell growth, Cold Spring Harb. Symp. Quant. Biol. 66 (2001) 485-497.

32. L. M. Parker, I. Fierro-Monti, M. B. Mathews, Nuclear factor 90 is a substrate and regulator of the eukaryotic initiation factor 2 kinase double-stranded RNA-activated protein kinase, J. Biol. Chem. 276 (2001) 32522-32530.32. L. M. Parker, I. Fierro-Monti, M. B. Mathews, Nuclear factor 90 is a substrate and regulator of the eukaryotic initiation factor 2 kinase double-stranded RNA-activated protein kinase, J. Biol. Chem. 276 (2001) 32522-32530.

33. C. J. Coolidge, J. G. Patton, A new double-stranded RNA-binding protein that interacts with PKR, Nucleic Acids Res. 28 (2000) 1407-1417.33. C. J. Coolidge, J. G. Patton, A new double-stranded RNA-binding protein that interacts with PKR, Nucleic Acids Res. 28 (2000) 1407-1417.

34. N. S. Ting, P. N. Kao, D. W. Chan, L. G. Lintott, S. P. Lees-Miller, DNA-dependent protein kinase interacts with antigen receptor response element binding proteins NF90 and NF45, J. Biol. Chem. 273 (1998) 2136-2145.34. N. S. Ting, P. N. Kao, D. W. Chan, L. G. Lintott, S. P. Lees-Miller, DNA-dependent protein kinase interacts with antigen receptor response element binding proteins NF90 and NF45, J. Biol. Chem. 273 (1998) 2136-2145.

35. L. F. Fung, A. K. Lo, P. W. Yuen, Y. Liu, X. H. Wang, S. W. Tsao, Differential gene expression in nasopharyngeal carcinoma cells, Life Sci. 67 (2000) 923-936.35. L. F. Fung, A. K. Lo, P. W. Yuen, Y. Liu, X. H. Wang, S. W. Tsao, Differential gene expression in nasopharyngeal carcinoma cells, Life Sci. 67 (2000) 923-936.

36. T. W. Reichman, L. C. Muniz, M. B. Mathews, The RNA binding protein nuclear factor 90 functions as both a positive and negative regulator of gene expression in mammalian cells, Mol. Cell. Biol. 22 (2002) 343-356.36. T. W. Reichman, L. C. Muniz, M. B. Mathews, The RNA binding protein nuclear factor 90 functions as both a positive and negative regulator of gene expression in mammalian cells, Mol. Cell. Biol. 22 (2002) 343-356.

37. I. Kranoselskaya-Riz, A. Spruill, Y. W. Chen, D. Schuster, T. Teslovich, C. Baker, Nuclear factor 90 mediates activation of the cellular antiviral expression cascade, AIDS Res. Hum. Retroviruses 18 (2002) 591-604.37. I. Kranoselskaya-Riz, A. Spruill, Y. W. Chen, D. Schuster, T. Teslovich, C. Baker, Nuclear factor 90 mediates activation of the cellular antiviral expression cascade, AIDS Res. Hum. Retroviruses 18 (2002) 591-604.

38. J. Shim, H. Lim, J. R. Yates, M. Karin, Nuclear export of NF90 is required for interleukin-2 mRNA stabilization, Mol. Cell. 10 (2002) 1331-1344.38. J. Shim, H. Lim, J. R. Yates, M. Karin, Nuclear export of NF90 is required for interleukin-2 mRNA stabilization, Mol. Cell. 10 (2002) 1331-1344.

39. T. W. Reichman, A. M. Parrott, I. Fierro-Monti, D. J. Caron, P. N. Kao, C. G. Lee, H. Li, M. B. Mathews, Selective regulation of gene expression by nuclear factor 110, a member of the NF90 family of double-stranded RNA-binding proteins, J. Mol. Biol. 332 (2003) 85-98.39.TW Reichman, AM Parrott, I. Fierro-Monti, DJ Caron, PN Kao, CG Lee, H. Li, MB Mathews, Selective regulation of gene expression by nuclear factor 110, a member of the NF90 family of double-stranded RNA-binding proteins, J. Mol. Biol. 332 (2003) 85-98.

40. H. J. Shin, S. S. Kim, Y. H. Cho, S. G. Lee, H. M. Rho, Host cell proteins binding to the encapsidation signal epsilon in hepatitis B virus RNA, Arch. Virol. 147 (2002) 471-491.40.H. J. Shin, S. S. Kim, Y. H. Cho, S. G. Lee, H. M. Rho, Host cell proteins binding to the encapsidation signal epsilon in hepatitis B virus RNA, Arch. Virol. 147 (2002) 471-491.

41. D. O. Morgan, Principles of CDK regulation, Nature 374 (1995) 131-134.41.D. O. Morgan, Principles of CDK regulation, Nature 374 (1995) 131-134.

42. P. E. Shaws, Ternary complex formation over the c-fos serum response element: p62TCF exhibits dual component specificity with contacts to DNA and an extended structure in the DNA-binding domain of p67SRF, EMBO J. 11 (1992) 3011-3019.42. P. E. Shaws, Ternary complex formation over the c-fos serum response element: p62TCF exhibits dual component specificity with contacts to DNA and an extended structure in the DNA-binding domain of p67SRF, EMBO J. 11 (1992) 3011-3019.

43. R. Treisman, G. Ammerer, The SRF and MCM1 transcription factors, Curr. Opin. Genet. Dev. 2 (1992) 221-226.43. R. Treisman, G. Ammerer, The SRF and MCM1 transcription factors, Curr. Opin. Genet. Dev. 2 (1992) 221-226.

44. T. Hsu, M. J. Betenbaugh, Coexpression of molecular chaperone BiP improves immunoglobulin solubility and IgG secretion from Trichoplusia ni insect cells, Biotechnol. Prog. 13 (1997) 96-104.44. T. Hsu, M. J. Betenbaugh, Coexpression of molecular chaperone BiP improves immunoglobulin solubility and IgG secretion from Trichoplusia ni insect cells, Biotechnol. Prog. 13 (1997) 96-104.

45. L. Chen, J. T. M. Buters, J. P. Hardwick, S. Tamura, B. W. Penman, F. J. Gonzalez, C. L. Crespi, Coexpression of cytochrome P4502A6 and human NADPH-P450 oxidoreductase in the baculovirus system, Drug Metab. Dispos. 25 (1997) 399-405.45.L. Chen, J. T. M. Buters, J. P. Hardwick, S. Tamura, B. W. Penman, F. J. Gonzalez, C. L. Crespi, Coexpression of cytochrome P4502A6 and human NADPH-P450 oxidoreductase in the baculovirus system, Drug Metab. Dispos. 25 (1997) 399-405.

46. T. French, P. Roy, Synthesis of bluetongue virus (BTV) corelike particles by a recombinant baculovirus expressing the two major structural core proteins of BTV, J. Virol. 64 (1990) 1530-1536.46. T. French, P. Roy, Synthesis of bluetongue virus (BTV) corelike particles by a recombinant baculovirus expressing the two major structural core proteins of BTV, J. Virol. 64 (1990) 1530-1536.

47. C. Li, J. W. R. Schwabe, E. Banayo, R. M. Evans, Coexpression of nuclear receptor partners increases their solubility and biological activities, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 2278-2283.47. C. Li, J. W. R. Schwabe, E. Banayo, R. M. Evans, Coexpression of nuclear receptor partners increases their solubility and biological activities, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 2278-2283.

48. W. B. R. Pollock, F. I. Rosell, M. B. Twitchett, M. E. Dumont, A. G. Mauk, Bacterial expression of a mitochondrial cytochrome c. Trimethylation of lys72 in yeast iso-1-cytochrome c and the alkaline conformational transition, Biochemistry 37 (1998) 6124-6131.48. W. B. R. Pollock, F. I. Rosell, M. B. Twitchett, M. E. Dumont, A. G. Mauk, Bacterial expression of a mitochondrial cytochrome c. Trimethylation of lys72 in yeast iso-1-cytochrome c and the alkaline conformational transition, Biochemistry 37 (1998) 6124-6131.

49. M. Munson, P. F. Predki, L. Regan, ColE1-compatible vectors for high-level expression of cloned DNAs from the T7 promoter, Gene 144 (1994) 59-62.49.M. Munson, P. F. Predki, L. Regan, ColE1-compatible vectors for high-level expression of cloned DNAs from the T7 promoter, Gene 144 (1994) 59-62.

50. S. S. Kim, H. J. Shin, Y. H. Cho, H. M. Rho, Expression of stable hepatitis B viral polymerase associated with GRP94 in E. coli, Arch. Virol. 145 (2000) 1305-1320.50. S. S. Kim, H. J. Shin, Y. H. Cho, H. M. Rho, Expression of stable hepatitis B viral polymerase associated with GRP94 in E. coli, Arch. Virol. 145 (2000) 1305-1320.

51. K. Johnston, A. Clements, R. N. Venkataramani, R. C. Trievel, R. Marmorstein, Coexpression of proteins in bacteria using T7-based expression plasmids: expression of heteromeric cell-cycle and transcriptional regulatory complexes, Protein Expr. Purif. 20 (2000) 435-43.51.K. Johnston, A. Clements, R. N. Venkataramani, R. C. Trievel, R. Marmorstein, Coexpression of proteins in bacteria using T7-based expression plasmids: expression of heteromeric cell-cycle and transcriptional regulatory complexes, Protein Expr. Purif. 20 (2000) 435-43.

Claims (15)

NF(nuclear factor)90/NF(nuclear factor)45 복합체를 활성화 형태로 대장균(Escherichia. coli)에서 제조하기 위한 다음의 두 가지 발현벡터를 포함하는 조성물:Composition comprising the following two expression vectors for the preparation of NF (nuclear factor) 90 / NF (nuclear factor) 45 complex in an activated form in Escherichia coli : (a) 대장균에서 작동하는 복제원점으로서 pBR322-유래 ori 또는 p15A-유래 ori, 대장균에서 작동하는 프로모터로서 tac 프로모터, 상기 프로모터에 작동적으로(operatively) 연결된 NF90 유전자 및 항생제-내성 유전자를 포함하는 NF90 발현용 벡터; 그리고, (a) PBR322-derived ori or p15A-derived ori as origin of replication in E. coli, NF90 gene comprising a tac promoter as a promoter in Escherichia coli, an NF90 gene operatively linked to the promoter and an antibiotic-resistant gene Expression vector; And, (b) 대장균에서 작동하며 상기 (a)의 복제원점과 다른 복제원점으로서 pBR322-유래 ori 또는 p15A-유래 ori, 대장균에서 작동하는 프로모터로서 tac 프로모터, 상기 프로모터에 작동적으로 연결된 NF45 유전자 및 상기 (a)의 항생제-내성 유전자와 다른 항생제-내성 유전자를 포함하는 NF45 발현용 벡터.(b) pBR322-derived ori or p15A-derived ori as origin of replication in E. coli and other origins of replication in (a), a tac promoter as a promoter in Escherichia coli, an NF45 gene operably linked to said promoter, and An NF45 expression vector comprising an antibiotic-resistant gene of a) and another antibiotic-resistant gene. 삭제delete 삭제delete 제 1 항에 있어서, 상기 항생제-내성 유전자는 암피실린, 겐타마이신, 카베니실린, 클로람페니콜, 스트렙토마이신 또는 테트라사이클린에 대하여 저항성을 부여하는 유전자인 것을 특징으로 하는 조성물.The composition of claim 1, wherein the antibiotic-resistant gene is a gene that confers resistance to ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin or tetracycline. 제 1 항에 있어서, 상기 NF90 발현용 벡터 및 NF45 발현용 벡터는 tac 프로모터, lac 프로모터 또는 lacUV5 프로모터를 포함하고, lac Iq 유전자를 추가적으로 포함하는 것을 특징으로 하는 조성물.The composition of claim 1, wherein the NF90 expression vector and the NF45 expression vector comprise a tac promoter, a lac promoter or a lac UV5 promoter, and further include a lac I q gene. 제 1 항에 있어서, 상기 NF90 발현용 벡터는 도 1b에 기재된 유전자 지도를 가지는 것을 특징으로 하는 조성물.The composition of claim 1, wherein the NF90 expression vector has a genetic map as described in FIG. 1B. 제 1 항에 있어서, 상기 NF45 발현용 벡터는 도 1a에 기재된 유전자 지도를 가지는 것을 특징으로 하는 조성물.The composition of claim 1, wherein the NF45 expression vector has a genetic map as shown in FIG. 1A. NF(nuclear factor)90/NF(nuclear factor)45 복합체를 활성화 형태로 대장균(Escherichia. coli)에서 제조하기 위한 다음의 단계를 포함하는 활성 NF90/NF45 복합체의 제조방법:A method for preparing an active NF90 / NF45 complex comprising the following steps for preparing a NF (nuclear factor) 90 / NF (nuclear factor) 45 complex in an activated form in Escherichia coli : (a) 다음의 두 가지 벡터로 대장균을 형질전환하는 단계; (a) transforming Escherichia coli with the following two vectors; (i) 대장균에서 작동하는 복제원점으로서 pBR322-유래 ori 또는 p15A-유래 ori, 대장균에서 작동하는 프로모터로서 tac 프로모터, 상기 프로모터에 작동적으로(operatively) 연결된 NF90 유전자 및 항생제-내성 유전자를 포함하는 NF90 발현용 벡터; 그리고, (ii) 대장균에서 작동하며 상기 (i)의 복제원점과 다른 복제원점으로서 pBR322-유래 ori 또는 p15A-유래 ori, 대장균에서 작동하는 프로모터로서 tac 프로모터, 상기 프로모터에 작동적으로 연결된 NF45 유전자 및 상기 (i)의 항생제-내성 유전자와 다른 항생제-내성 유전자를 포함하는 NF45 발현용 벡터; (i) pBR322-derived ori or p15A-derived ori as origin of replication in E. coli, NF90 gene comprising a tac promoter as a promoter in Escherichia coli, an NF90 gene operatively linked to the promoter and an antibiotic-resistant gene Expression vector; And (ii) pBR322-derived ori or p15A-derived ori as the origin of replication different from the origin of replication of (i) in Escherichia coli, a tac promoter as a promoter operating in Escherichia coli, an NF45 gene operably linked to the promoter and An NF45 expression vector comprising the antibiotic-resistant gene of (i) and another antibiotic-resistant gene; (b) 상기 항생제-내성 유전자에 의해 저항성이 발생된 항생제를 상기 대장균에 처리하여 항생제-내성 특성을 나타내는 대장균을 선별하는 단계; 및 (b) treating Escherichia coli with an antibiotic generated by the antibiotic-resistant gene, thereby selecting Escherichia coli which exhibits antibiotic-resistant properties; And (c) 상기 형질전환된 대장균을 배양하는 단계. (c) culturing the transformed Escherichia coli. 삭제delete 삭제delete 제 8 항에 있어서, 상기 항생제-내성 유전자는 암피실린, 겐타마이신, 카베니실린, 클로람페니콜, 스트렙토마이신 또는 테트라사이클린에 대하여 저항성을 부여하는 유전자인 것을 특징으로 하는 활성 NF90/NF45 복합체의 제조방법.The method of claim 8, wherein the antibiotic-resistant gene is a gene that imparts resistance to ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, or tetracycline. 제 8 항에 있어서, 상기 NF90 발현용 벡터 및 NF45 발현용 벡터는 tac 프로모터, lac 프로모터 또는 lacUV5 프로모터를 포함하고, lac Iq 유전자를 추가적으로 포함하는 것을 특징으로 하는 활성 NF90/NF45 복합체의 제조방법.The method of claim 8, wherein the NF90 expression vector and the NF45 expression vector include a tac promoter, a lac promoter or a lac UV5 promoter, and further include a lac I q gene. . 제 8 항에 있어서, 상기 NF90 발현용 벡터는 도 1b에 기재된 유전자 지도를 가지는 것을 특징으로 하는 활성 NF90/NF45 복합체의 제조방법.9. The method for producing an active NF90 / NF45 complex according to claim 8, wherein the NF90 expression vector has a gene map as shown in FIG. 제 8 항에 있어서, 상기 NF45 발현용 벡터는 도 1a에 기재된 유전자 지도를 가지는 것을 특징으로 하는 활성 NF90/NF45 복합체의 제조방법.9. The method for producing an active NF90 / NF45 complex according to claim 8, wherein the NF45 expression vector has a gene map as shown in Fig. 1A. 제 12 항에 있어서, 상기 방법은 상기 배양된 대장균에 IPTG(isopropyl-β-D-thiogalactopyranoside)를 처리하여 NF90 및 NF45의 발현을 유도하는 단계 (d)를 추가적으로 포함하는 것을 특징으로 하는 활성 NF90/NF45 복합체의 제조방법.The method according to claim 12, wherein the method further comprises the step of inducing the expression of NF90 and NF45 by treating the cultured E. coli IPTG (isopropyl-β-D-thiogalactopyranoside) active NF90 / Method for preparing NF45 complex.
KR1020050035510A 2005-04-28 2005-04-28 Expression Vector Systems for Preparing Active ??90/??45 Complex in E. coli KR100657011B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020050035510A KR100657011B1 (en) 2005-04-28 2005-04-28 Expression Vector Systems for Preparing Active ??90/??45 Complex in E. coli

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020050035510A KR100657011B1 (en) 2005-04-28 2005-04-28 Expression Vector Systems for Preparing Active ??90/??45 Complex in E. coli

Publications (2)

Publication Number Publication Date
KR20060112843A KR20060112843A (en) 2006-11-02
KR100657011B1 true KR100657011B1 (en) 2006-12-20

Family

ID=37651294

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020050035510A KR100657011B1 (en) 2005-04-28 2005-04-28 Expression Vector Systems for Preparing Active ??90/??45 Complex in E. coli

Country Status (1)

Country Link
KR (1) KR100657011B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008030905A (en) * 2006-07-28 2008-02-14 Ishikawajima Transport Machinery Co Ltd Climbing crane

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2008030905A (en) * 2006-07-28 2008-02-14 Ishikawajima Transport Machinery Co Ltd Climbing crane

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
논문1994.08
논문1994.08.12
논문1999.05.11
논문2002.03
논문2003.09.05

Also Published As

Publication number Publication date
KR20060112843A (en) 2006-11-02

Similar Documents

Publication Publication Date Title
Park et al. A plant viral “reinitiation” factor interacts with the host translational machinery
Liu et al. Role of SCF ubiquitin-ligase and the COP9 signalosome in the N gene–mediated resistance response to Tobacco mosaic virus
Brennan et al. HuR and mRNA stability
Stargell et al. The TBP-TFIIA interaction in the response to acidic activators in vivo
CA2400772C (en) Zinc finger domains and methods of identifying same
Lee et al. Regulation of gene expression by TBP-associated proteins
Vicente-Carbajosa et al. A maize zinc-finger protein binds the prolamin box in zein gene promoters and interacts with the basic leucine zipper transcriptional activator Opaque2
Kosugi et al. E2F sites that can interact with E2F proteins cloned from rice are required for meristematic tissue‐specific expression of rice and tobacco proliferating cell nuclear antigen promoters
Diray-Arce et al. The Arabidopsis At1g30680 gene encodes a homologue to the phage T7 gp4 protein that has both DNA primase and DNA helicase activities
Jiang et al. The Arabidopsis RNA binding protein with K homology motifs, SHINY1, interacts with the C-terminal domain phosphatase-like 1 (CPL1) to repress stress-inducible gene expression
KR20040065235A (en) Phenotypic screen of chimeric proteins
US10221422B2 (en) Blue light-inducible system for gene expression
US20190390205A1 (en) Incorporation of internal polya-encoded poly-lysine sequence tags and their variations for the tunable control of protein synthesis in bacterial and eukaryotic cells
Peska et al. Using the telobox to search for plant telomere binding proteins
Willison et al. Structure and function of chaperonins in archaebacteria and eukaryotic cytosol
Xiang et al. Myb transcription factors in the oomycete Phytophthora with novel diversified DNA-binding domains and developmental stage-specific expression
EP2190989B1 (en) Method for manufacturing a modified peptide
KR100657011B1 (en) Expression Vector Systems for Preparing Active ??90/??45 Complex in E. coli
Crasser et al. The Recombinant Product of the Chryptomonasφ Plastid Gene hlpA is an Architectural Hu‐Like Protein that Promotes the Assembly of Complex Nucleoprotein Structures
MacFerrin et al. [7] Overproduction of proteins using expression-cassette polymerase chain reaction
Hwang et al. Assembly of FAP93 at the proximal axoneme in Chlamydomonas cilia
KR100648842B1 (en) Methods of identifying pharmacologically active substances and DNA templates for use in such methods
Lin et al. Two enzymes, TilS and HprT, can form a complex to function as a transcriptional activator for the cell division protease gene ftsH in Bacillus subtilis
US7052843B2 (en) Transcription-based assay for identification of post-translational modification and its application in proteomics
Yeon et al. TIR Domains in Arabidopsis thaliana suppressor of npr1-1, constitutive 1 and its closely related disease resistance proteins form intricate interaction networks

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20101206

Year of fee payment: 5

LAPS Lapse due to unpaid annual fee