KR100655792B1 - Genetic construct for detection oxidative stress and biosensor using the same - Google Patents

Abstract

The invention -NADP ⁺ ferredoxin reductase ^{(Ferredoxin-NADP + reductase; fpr} ) of the model soil microorganism Pseudomonas footage is KT2440 (Pseudomonas putida KT2440) coupled to a promoter, and works on the promoter of the promoter, GFP (green fluorescent protein; A biosensor capable of detecting a oxidative stress-inducing contaminant including a transcriptional fusion construct comprising a GFP) gene and a Pseudomonas putida KT2440 reporter strain transformed with the gene construct. will be. According to the present invention of the above configuration, there is an advantage that can quickly, accurately and economically detect various oxidative stress-induced environmental pollutants such as paracoat, menadione, hydrogen peroxide.

Oxidative Stress, GFP Expression, Pseudomonas putida KT2440, Environmental Pollution, Biomonitoring

Description

Genetic construct for detection oxidative stress and biosensor using the same

1 is a diagram showing the results of northern analysis showing that the peredoxin-NADP ⁺ reductase gene ( fpr ) of Pseudomonas putida KT2440 ( Pseudomonas putida KT2440) according to the present invention is induced by paracoat.

Figure 2 is a diagram showing the promoter sequence of the peredoxin-NADP ⁺ reductase gene ( fpr ) of Pseudomonas putida KT2440 ( Pseudomonas putida KT2440) according to the present invention.

3A to 3D are GFP expression by paracoat (PQ) using the Pseudomonas putida KT2440 reporter strain according to the present invention prepared for oxidative stress-induced contaminant biomonitoring. The pictures showed.

Figure 3a: microbiological picture in LB medium (Luria-Burtani media) obtained using a phase contrast microscope, Figure 3b: microbial picture in LB medium obtained using a fluorescence microscope, Figure 3c: using a phase contrast microscope Microbe photograph in LB medium containing paracoat (0.2 mM) obtained by the use of FIG. 3D: Microbe photograph in LB medium containing paracoat (0.2 mM) obtained using a fluorescence microscope.

FIG. 3E is a graph showing relative fluorescence values measured using a fluorimeter victor ³ to measure the degree of GFP fluorescence of the microorganisms of FIGS. 3B and 3D.

Figure 4 is a graph showing the fluorescence value in the liquid culture of the reporter strain according to the present invention according to the paracoat injection concentration and incubation time after injection.

Figure 5 is a graph showing the fluorescence value in culture of the reporter strain according to the present invention according to the injection concentration for each environmental pollutant and incubation time after injection.

6 is a view showing the results of the northern analysis to confirm the expression of the reporter strain according to the present invention in the presence of environmental pollutants.

The present invention relates to a gene construct for oxidative stress detection, a biosensor comprising a reporter strain using the same, and a method for detecting oxidative stress-inducing pollutants using the biosensor, and more particularly, to inducing various oxidative stresses. The present invention relates to a gene structure for oxidative stress detection, a biosensor including a biomonitoring reporter strain using the same, and a method for detecting an oxidative stress-inducing pollutant using the biosensor.

Oxidative stress in the form of free radicals, free radicals, can cause serious damage to the microorganisms, plants, and animals that make up the ecosystem by modifying biopolymers such as cell membranes, proteins, and nucleic acids. And it is known to cause fatal diseases leading to aging and various types of cancer. Therefore, there is a need for an assessment of natural or artificial harmful pollutants causing such oxidative stress.

Whole-cell reporters using microorganisms in monitoring environmental pollutants are more economical and simpler than chemically identifying contaminants. Therefore, much research has been conducted on biological detection methods that can identify damage by metabolism of pollutants.

More specifically, the development of a genetic recombinant capable of easily detecting a gene damage material by combining a promoter and a group of related genes expressed during gene damage of a cell with a reporter gene.

In Korean Patent No. 473350, a recombinant plasmid pPQI5 is prepared by combining a pqi-5 promoter of Pqi-5 protein and a luminescent gene which are sensitive to oxidatively damaging substances such as hydrogen peroxide and paracoat. When introduced to detect a substance that induces oxidative damage of cells, the transformed bacteria are transformed to increase luminescence. Is disclosed.

Despite these studies, there is a continuing need for a way to quickly and accurately detect a wider variety of environmental pollutants that cause oxidative stress.

It is an object of the present invention to provide a genetic construct capable of detecting a variety of environmental pollutants causing oxidative stress quickly, accurately and at low cost.

Another object of the present invention is to provide a biosensor capable of detecting an oxidative stress-inducing contaminant including a reporter strain transformed by the gene construct.

Still another object of the present invention is to provide a method for detecting various environmental pollutants using the novel biosensor.

In order to achieve the above object, a gene construct comprising a promoter of peredoxin-NADP ⁺ reductase ( fpr ) gene of Pseudomonas putida KT2440 and a Green Fluorescent Protein (GFP) gene operably linked to the promoter. To provide.

The present invention also provides a recombinant vector prepared by introducing a promoter of the peredoxin-NADP ⁺ reductase ( fpr ) gene of Pseudomonas putida KT2440 into pRK415gfp including the GFP gene.

Furthermore, the present invention provides a biosensor for detecting an oxidative stress-inducing substance, including the Pseduomonas reporter strain transformed by introducing the gene construct or the recombinant vector.

In addition, the present invention provides a method for detecting an oxidative stress-inducing pollutant that detects the oxidative stress-inducing pollutant by exposing the biosensor to an oxidative stress-inducing pollutant and measuring the fluorescence value by GFP.

Pseudomonas is a rifampin resistant strain Pseudomonas putida KT2440-R ( P. putida KT2240-R) is characterized in that the strain.

The oxidative stress-inducing contaminants may be any one of paracoat, menadione, hydrogen peroxide, gasoline, diesel, toluene, paint thinner, stain remover, tobacco smoke, salicylate and benzoate.

Hereinafter, the present invention will be described in more detail.

The present inventors para coat; -NADP ⁺ ferredoxin reductase ^{(ferredoxin-NADP + reductase; fpr} ) of (paraquat herbicide) soil model microorganism Pseudomonas footage is KT2440 (Pseudomonas putida KT2440) strongly induced by the discovery of genes, The present invention was completed by constructing a transcriptional fusion construct comprising a promoter of the gene and a GFP gene that does not require stable and other substrates, and confirmed the detection ability of the reporter strain including the same.

More specifically, genomic DNA and primers Fpr-pro1 of the promoter portion of Pseudomonas footage is KT2440 (Pseudomonas putida KT2440) of the fpr gene (CGC GAATTC GCCGTTGAGCAGGTCTTC; SEQ ID NO: 1) and, Fpr-pro3 (CGC GGATCC ACGTTCGTGGTTCATGTTGCTCA ; SEQ ID NO: 2) Is amplified using.

The 417 bp fragment (SEQ ID NO: 3) thus obtained is introduced into a promoter probing vector containing GFP, and the strain of Pseudomonas is transformed using the vector to produce a reporter strain.

The promoter identification vector may be, for example, pRK415gfp (Yin et al ., Appl. Environ. Microbiol. 2003), and the Pseudomonas strain is Pseudomonas putida KT2440-R ( P. putida KT2240-R), which is a rifampin resistant strain. May be a strain.

The produced reporter strain can detect oxidative stress-causing contaminants quickly and economically by checking it because the fluorescence value by GFP increases when exposed to various oxidative stress-causing contaminants.

Hereinafter, the present invention configured as described above will be described in more detail with reference to the following examples. These examples are intended to illustrate the invention, it is apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

Example 1: Manufacture of reporter strain in response to paracoat, a superoxide-generating substance

Pseudomonas footage is -NADP ⁺ ferredoxin reductase ^{(Ferredoxin-NADP + reductase: fpr} ) of the KT2440 gene is strongly induced by parametric Court (PQ) Northern analysis confirmed the results. The results of northern analysis are shown in FIG. 1, in which MD represents menadione and NO represents nitric oxide.

The promoter portion of the fpr gene Fpr-pro1 using the genomic DNA of the primer and the footage Pseudomonas (P. putida KT2440) of: (SEQ ID NO: 2 CGC GGATCC ACGTTCGTGGTTCATGTTGCTCA) (CGC GAATTC GCCGTTGAGCAGGTCTTC SEQ ID NO: 1) and, Fpr-pro3 By amplification.

At this time, PCR conditions were as follows. The reaction mixture (50 μl) of each tube was prepared with each primer (0.5 μm), 1 × PCR buffer (Gibco BRL, Gaithersburg, MD), dNTP (0.2 mM), MgCl ₂ (1.5 mM), and 1.25 units of Taq DNA polymerase. Gibco BRL, Gaithersburg, MD). Cycles were 5 minutes at 94 ^o C (1 cycle), 1 minute at 94 ^o C, 1 minute at 60 ^o C and 1 minute at 72 ^o C (35 cycles); It took 5 minutes (1 cycle) at 72 ^o C. Amplicons were separated by electrophoresis on 2% agarose gel.

The 417 bp gene fragment thus obtained (FIG. 2, SEQ ID NO: 3) was ligated to the Eco RI / Bam HI site of pRK415gfp, a promoter identification vector containing GFP, to transform S17-1 lambda pir (S17- 1 lamda pir transformation) (Simon R, Priefer U, Puhler A (1983), A broad host-range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Bio / Technology 1: 784-791; Yin, S., Fuangthong, M., Laratta, WP, and Shapleigh, JP (2003), Use of a green fluorescent protein-based reporter fusion for detection of nitric oxide produced by denitrifiers.Appl.Environ.Microbiol. 69, 3938 -3944). The cloned vector (pFPRgfp) was sequenced to confirm insertion.

S17-1 lambda pir (pFPRgfp) is rifampin resistance (rifampin resistant) strain of Pseudomonas footage is KT2440-R (P. putida KT2440- R) the footage by the Pseudomonas strain with the bypass rental conjugation (biparental conjugation) KT2440 (P putida KT2440 (pFPRgfp) was prepared The specific experimental method was followed by the above reference.

Example 2: Measurement of Fluorescence on Paracoat Exposure of Reporter Strains

The strain prepared in Example 1 was grown overnight on an LB agar plate in the presence of paraquat, and then the strain was grown using Axioskop 2 low-power objectives for scanning and a 100X Plan-Neofluar Objective. , NA 1.30) was used to obtain a fluorescence image and a phase contrast microscope image. Images were captured using Axiocam and analyzed using AxioVision software (AxioVision Version 3.1) (FIGS. 3A-3D).

As a result, much higher expression of GFP was observed in the presence of paracoat than in the control plate (LB plate culture). As a result of comparing the fluorescence values of GFP using a microtiter plate reader VICTOR ³ (Biorad) (FIG. 3E), high RFU was obtained in the presence of paracoat as in the microscope. The relative fluorescence unit (RFU) is a value corrected by dividing the fluorescence value of the culture strain by the OD ₆₀₀ value of the culture strain. The values shown are the mean and standard deviation obtained after three independent experiments.

As a result, the reporter strain for detecting oxidative stress produced in Example 1 is expected to be reliable and useful for the detection of oxidative stress-induced environmental pollutants.

Example 3: Determination of GFP expression by concentration, hourly paracoat

Using the reporter strain prepared in Example 1, the results of measuring the expression level of GFP by concentration and time by paracoat are shown in FIG. 4. Figure 4 shows the fluorescence values obtained in liquid culture of P. putida KT2440 (pFPRgfp) reporter strain after putting the paracoat at various paracoat concentrations and incubation time. The ratio of FIG. 4 is a value by the following formula.

Ratio =

[In the cells exposed to the fluorescence intensity / contaminants _{OD 600 (fluorescence intensity / OD 600} of exposed cells)] / [ fluorescence values / untreated cells OD that are not exposed to contaminants ₆₀₀ (fluorescence intensity / OD ₆₀₀ in chemical untreated bacterial cells)]

As shown in the figure, it was found that the concentration of each expression was increased proportionally in the range of 0.05 to 1.0 mM paracoat, and the higher 10 mM paracoat resulted in a decrease in effect than the effect of 1.0 mM paracoat. High paracote concentrations, such as 10 mM, severely inhibit growth, possibly leading to poor GFP expression or saturation of the promoter binding site.

The hourly expression was the highest at 3 and 6 hours, and after 24 hours, the expression was decreased compared to the 3 hours.

Example 4 Determination of Oxidative Stress Induction by Environmental Pollutants

Using the produced reporter strain was measured the degree of oxidative stress induced by environmental pollutants. The overnight grown strains in LB liquid medium were fresh again until the OD ₆₀₀ was about 0.3, and then further incubated for 3 hours in the presence of contaminants.

After taking 2 ml of the strain, spin down by centrifugation, followed by washing twice with 800 μl of PBS (phosphate buffered saline) and measuring the fluorescence intensity (fluorescence intensity). The results are shown in FIG. 5. It was. Background control is a value obtained by incubating for 3 hours without adding other chemicals to the LB liquid medium. In the case of tobacco smoke, 2 sips of smoked cigarettes were placed in a 15 mL falcon tube, sealed and incubated for 3 hours.

As a result, not only paracoat but also menadione (MD) and hydrogen peroxide increased the expression of the fpr-gfp construct. In particular, paint thiner (1%) and stain cleaner (0.5%) increased GFP expression most, and almost all petroleum products (petroleum products; gasoline, diesel, was polisher, etc.) showed GFP expression. Increased.

In the case of benzoate, increasing GFP expression when present with Cu ²⁺ results in that metals can promote superoxide production of redox-cycling reagents. Both toluene and salicylate showed a 3 to 4 fold increase in GFP expression.

In the case of naphthalene does not seem to increase the expression level of GFP does not seem to cause a significant oxidative stress. As a non-toxic negative control, 10 mM succinate and 2% glucose (Luccose) was incubated in LB medium and as a result GFP expression did not increase.

Taken together, these reporter strains can be used to reliably measure the extent and oxidative stress of various contaminants.

Example 5 Confirmation of Oxidative Stress Inducement of Contaminants Through Northern Blot Analysis

In order to confirm the results, in order to confirm the expression of the fpr gene in the presence of paracoat , menadione, hydrogen peroxide, benzoate by measuring the amount of the actual mRNA, Northern analysis was performed and the results are shown in FIG. 6. The total RNA was isolated by treatment at the concentration of the chemical indicated in the figure for 10 minutes, and 10 µg of total RNA was loaded.

The result was the same as the reporter strain, and benzoate resulted in much more fpr gene expression in the presence of Cu ²⁺ . In the case of menadione, the difference between the expression level obtained from the reporter strain was obtained in the Northern analysis, which may be the difference between the Northern analysis measuring the amount of mRNA in the measurement time and the reporter strain measuring the protein expression of gfp .

As described above, the present invention provides a gene construct capable of detecting various oxidative stress causing contaminants quickly, accurately and at low cost, a biosensor comprising a reporter strain transformed by the gene construct, and oxidation using the same. It provides a method for the detection of stress-inducing pollutants.

Therefore, the present invention can be said to be a very useful invention in the field of environmental monitoring, which is an important criterion for evaluating the harmfulness of oxidative stress that can cause fatal damage to ecosystems including humans.

Attach sequence list electronic file  

Claims (7)

A promoter having the nucleotide sequence of SEQ ID NO: 3 as a promoter of the peredoxin-NADP ⁺ reductase ( fpr ) gene of Pseudomonas putida KT2440; And Biosensor for the detection of oxidative stress-induced contaminants comprising a gene structure comprising a GFP (Green Fluorescent Protein) gene operably linked to the promoter. Oxidation including a recombinant vector prepared by introducing a promoter having the base sequence of SEQ ID NO: 3 into pRK415gfp including the GFP gene as a promoter of the peredoxin-NADP ⁺ reductase ( fpr ) gene of Pseudomonas putida KT2440 Sensor for the detection of stress-induced contaminants. A biosensor for detecting an oxidative stress-inducing contaminant comprising a Pseduomonas reporter strain transformed by introducing the gene construct of claim 1 or the recombinant vector of claim 2. The biosensor of claim 3, wherein the pseudomonas is P. putida KT2240-R ( P. putida KT2240-R) strain which is a rifampin resistant strain. The biosensor comprising the Pseduomonas reporter strain transformed by introducing the gene construct of claim 1 or the recombinant vector of claim 2 is exposed to an oxidative stress-induced contaminant and measures the fluorescence value by GFP. To detect oxidative stress induced pollutants. The method of claim 5, wherein the oxidative stress-inducing contaminants are any one of paracoat, menadione, hydrogen peroxide, gasoline, diesel, toluene, paint thinner, stain remover, tobacco smoke, salicylate and benzoate. Method of detecting oxidative stress causing pollutants. The method of claim 5, wherein the fluorescence value is measured after the reporter strain is exposed to an oxidative stress-inducing pollutant and incubated for 3 to 6 hours.

Images