KR100655781B1 - Specific primer for identification of Cordyceps militaris and identification method using the same - Google Patents

Abstract

The present invention provides a specific primer for identifying the chrysalis subcutaneous fungus comprising (a) the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 or (b) the nucleotide sequence having substantial sequence homology with the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 It relates to the identification method used. According to the present invention of the above-described configuration there is an advantage that can be quickly and accurately identified pupa cordyceps by molecular biological method.

Pupa cordyceps, Cordyceps militaris, PCR technique, specific primer

Description

Specific primer for identification of Cordyceps militaris and identification method using the same}

1 is a view showing the specific primer sequence and location for the chrysalis vermin allotment according to the invention.

Figure 2 is a diagram showing the results of PCR analysis of Cordyceps sinensis and other strains of Cordyceps sinensis using the specific primer for identifying the chrysalis Cordyceps sinensis according to the present invention.

Figure 3 is a view showing the results of PCR analysis of edible mushroom strain and pupae Cordyceps sinensis strain using the specific primer for identifying the chrysalis Cordyceps sinensis according to the present invention.

The present invention relates to a specific primer for identifying a cordyceps militaris and a method for identifying a pupa cordyceps using the same. More specifically, the present invention relates to a specific primer for identifying pupa cordyceps, which can quickly and accurately identify pupa cordyceps by molecular biological method, and a method for identifying pupa cordyceps using the same.

Cordyceps sinensis is a type of mushroom named because of its appearance in the body of insects in winter and in the form of grass in summer. In other words, Cordyceps fungus invades the body of an insect and dies, then uses the host's nutrients to form a fruiting body.

Since ancient times, bat moth cordyceps has been used as a elixir for bully life. Records of the efficacy of cordyceps were first published in Chinese herbaceous life, and records used mainly for the treatment of renal and pulmonary dysfunction such as tuberculosis and jaundice. In recent clinical trials, various effects such as anticancer effects have been revealed, and research is being actively conducted.

Cordyceps fungus is a taxonomic genus belonging to the Bacillus arachnoid family of the Bacillus fungus. The representative genus is Cordyceps , which is widely distributed in Korea, China and Japan.

On the other hand, Cordyceps spp. Belongs to Cordyceps sinensis not all have a pharmacological effect. A type of fungus that is currently being used as a medicine in China, Cordyceps sinensis (Cordyceps sinensis), pupa Cordyceps sinensis (Cordyceps militaris ), Cordyceps ophioglossoides , Cordyceps sobolifera ), larvae, Cordyceps martialis , Beauveria bassiana ), among which the pupa cordyceps is a standard species of the genus Cordyceps (hereinafter referred to as cordyceps) and is widely distributed in Korea.

These pupa cordycepss produce mannitol in liquid culture and contain large amounts of many substances beneficial to humans, including expensive cordycepin, which are known to have antibacterial, antifungal, immune enhancing and anticancer effects, compared to other types of cordyceps. (Yunsung Hum. 2000. General Chemical Composition and Physiological Activity of Chrysalis of the Caterpillar Cordyceps. MS Thesis, Seoul National University). Accordingly, interest in chrysalis of the chrysalis is increasing, and in recent years, it has been spotlighted as a high-yield agricultural product in farms, and is cultivated in large quantities.

Cordyceps sinensis is identified according to the shape, size and color of the fruiting body, the breeding organ, or the type of host insect, but its size is very small and the classification system is not established, so it is not easy to identify without high level of expertise. In addition, the mycelium, a nutrient known to contain about four times more nutrients than fruiting bodies, has no morphological characteristics and thus is almost impossible to identify, resulting in difficulty in managing progeny.

In general, the most widely used method for identifying species at the genetic level is DNA finger print, and the nucleic acid fingerprint method is Restriction Fragment Length Polymorphism (RELP) analysis. There are methods using differences in nucleotide sequences of bosomes and PCR (Polymerase chain reaction) identification using specific primers.

In the double PCR process, a specific DNA fragment consisting of 10-20 bp, called a primer, is annealed to genomic DNA, followed by the addition of a heat-resistant DNA polymerase, and the synthetic reaction is repeatedly performed. Bound region is rapidly amplified, and the PCR amplification product is electrophoresed on an agarose gel and stained with ethidium bromide. It is a method for detecting and identifying DNA polymorphism of a species.

Currently, the PCR identification method is used to identify and diagnose bacterial diseases of humans or animals, and PCR diagnostic kits for detecting E. coli, cholera, etc., which are pathogenic bacteria related to food poisoning, have been developed.

Actually, the time required for PCR diagnosis is very short compared to other identification methods, and is completed within 5 hours. The cost of identification is also very low, and many samples can be tested simultaneously. The purpose of this study was to quickly and accurately identify pupa cordyceps sinensis using

The present invention has been made to solve the problems of the prior art, an object of the present invention is the specificity for PCR that can quickly and accurately identify the pupa cordyceps at the gene (DNA) level according to the development of molecular biological techniques To provide a primer.

It is another object of the present invention to provide an identification method capable of quickly and accurately identifying pupa cordyceps using the specific primer for PCR.

In order to achieve the above object, the present inventors selected and analyzed the primers most suitable for use in the present invention from the nucleotide sequence of the genes specifically present only in the pupa cordyceps, and by performing PCR with the selected primers to identify the pupa cordyceps strain The present invention was completed by confirming that it can be quickly and accurately identified from other strains or edible mushroom strains included in the genus Choongcho (see FIGS. 2 and 3).

As a result of analysis and selection by the inventors, and then confirmed through a series of experiments, primers that can be effectively used to identify pupa cordyceps strains by performing PCR according to the purpose of the present invention include CMS-F4 (SEQ ID NO: 1) and CMS. It was found that it is preferable to have a sequence of -R1 (SEQ ID NO: 2). Accordingly, the present invention provides a specific primer for identifying chrysalis fungus sect. Comprising a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 or a nucleotide sequence having substantial sequence homology with the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2.

CMS-F4: 5'ATTTATATTATTTGATGTATTCGGTG3 ': 26 bp (SEQ ID NO: 1)

CMS-R1: 5'ATAACATCGTATTGGACCATTATCT3 ': 25 bp (SEQ ID NO: 2)

On the other hand, the present invention relates to a method for identifying pupa cordyceps strains by performing PCR using the primers described above.

In addition, the present invention provides a nucleotide sequence having a specific sequence homology with the nucleotide sequence of the specific DNA product of the chrysalis of the genus Cordyceps sinensis as the PCR product using the primer (SEQ ID NO: 3 or SEQ ID NO: 3) See FIG. 1). DNA fragments comprising the nucleotide sequence as described above can be used as a probe in the identification method of various pupa cordyceps including PCR.

The sequence having substantial sequence homology with the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 3 refers to a base sequence having a slight sequence variation compared to the nucleotide sequence shown in Figure 1 but having the same sequence function. In the above, the sequence variant means a case where one or a plurality of bases are deleted, substituted, or added.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it is to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. Will be self-evident.

Example 1 Isolation of Genomic DNA from Strains

Cordyceps militaris ) 13 strains and 13 other strains included in Cordyceps spp., genomic DNA of 10 edible mushroom strains were extracted by the method described in Kim Sung-hwan et al. (Applied and Environmental Microbiology, 1999).

The pupae Cordyceps sinensis strains have been grown in Korea for a long time ( C. militaris 2456, 5915, 7860, 8760, 8980, 2671, 7159, 7619, see Table 1), and reliable and reliable from international strain banks in the Netherlands. CBS registered strain ( C. militaris CBS 108.90, 109.70, 110.70, 178.59, 181.64, see Table 1).

Other strains of Cordyceps sinensis and edible mushroom strains used are shown in Table 1.

number Name Collection date Picking place One Cordyceps pentatomi 9070 02. 08. 05 Chundeung Mt 2 Cordyceps longissima 6821 01. 07. 10 Hanla mt 3 Cordyceps sphecocephala 2338 98. 08. 02 Odae mt 4 Cordyceps gracilis 2101 98. 07. 07 Samag mt 5 Cordyceps pruinosa 7496 01. 07. 28 Jiri Mt 6 Cordyceps yongmoonensis 2397 98. 08. 12 Yonmoon mt 7 Cordyceps scarabaeicola 5014 00. 07. 11 Guryungryung Mt 8 Cordyceps scarabaeicola 252 93. 08. 20 Guryungryung Mt 9 Cordyceps scarabaeicola 9044 02. 08. 01 Taebaeg Mt 10 Shimizuomyces poradox 5280 00. 07. 23 Chundeung Mt 11 Paecilomyces tenuipes 1944 97. 10. 04 Samag mt 12 Cordyceps pruinosa 7495 01. 07. 28 Jiri Mt 13 Cordyceps pruinosa 7497 01. 07. 28 Jiri Mt 14 Cordyceps militaris 2456 98. 08. 17 Sorak Mt 15 Cordyceps militaris 2671 98. 09. 26 Sorak Mt 16 Cordyceps militaris 5915 00. 08. 25 Sorak Mt 17 Cordyceps militaris 7159 01. 07. 19 Mai Mt 18 Cordyceps militaris 7619 01. 07. 30 Hanla mt 19 Cordyceps militaris 7860 01. 08. 01 Hanla mt 20 Cordyceps militaris 8760 02. 07. 20 Taegi Mt 21 Cordyceps militaris 8980 02. 07. 25 Chiag mt 22 Cordyceps militaris CBS 108.90 23 Cordyceps militaris CBS 109.70 24 Cordyceps militaris CBS 110.70 25 Cordyceps militaris CBS 178.59 26 Cordyceps militaris CBS 181.64 27 Hericium coralloides NIAST 48007    28 Lentinus edodes 29 Pleurotus ostreatus 30 Flammulina velutipes 31 Sparassis crispa 32 Morchella esculenta 33 Griofola frondosa 34 Tuber melanosporum 35 Hericium erinaceum KUMC 1008 36 Hericium erinaceum NIAST 48001

Example 2. Selection and Synthesis of Primer

By analyzing the nucleotide sequence of the gene specifically present only in pupa cordyceps, the best primer for use in the present invention was selected to prepare a primer set capable of amplifying the pupa cordyceps fungi species.

Preferred primer sets of the invention are named CMS-F4 and CMS-R1 and are represented by SEQ ID NO: 1 and SEQ ID NO: 2. DNA fragments amplified by the primers and the positions (underlined portions) of the primers are shown in FIG. 1.

CMS-F4: 5'ATTTATATTATTTGATGTATTCGGTG3 ': 26 bp (SEQ ID NO: 1)

CMS-R1: 5'ATAACATCGTATTGGACCATTATCT3 ': 25 bp (SEQ ID NO: 2)

Example 3 Polymerase Chain Reaction

As a substrate, genomic DNA isolated in Example 1 was used, and the reaction for PCR analysis was performed by a general molecular biological experiment. That is, PCR was performed under the composition and reaction conditions of the following mixture.

The PCR reaction solution was 30-50 μl, and its composition was 50 mM KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl ₂ , 200 μM dNTP, 20pM specific primer set (CMS-F4, CMS-R1), 20ng mold DNA, 1U Taq polymerase.

At this time, specific primer sets (CMS-F4, CMS-R1) were used DNA fragments (26 bp, 25 bp) having the nucleotide sequence represented by SEQ ID NO: 1 and SEQ ID NO: 2 selected in Example 2.

After mixing the mixture well, first heat treatment at 94 ° C. for 4 minutes to degenerate the genomic DNA into a template, and then repeat the cycle of treating 50 seconds at 94 ° C., 50 seconds at 52 ° C. and 50 seconds at 72 ° C. Finally it was treated for 10 minutes at 72 ℃.

Example 4 Polymerase Chain Reaction Results of Various Strains

The PCR product amplified in Example 3 was electrophoresed on a 1% agarose gel to stain DNA with ethidium bromide and observed under UV light.

The results are shown in FIGS. 2 and 3. Figure 2 is a diagram showing the results of PCR analysis of Cordyceps sinensis and other strains of Cordyceps sinensis using the specific primer for identifying the chrysalis Cordyceps sinensis according to the present invention.

In FIG. 2, lanes 1 to 13 are other strains included in Cordyceps spp., Namely, 1; C. pentatomi 9070, 2; C. longissima 6821, 3; C. sphecocephala 2338, 4; C. gracilis 21015, 5; C. pruinosa 7496 , 6; C. yongmoonensis 2397, 7; C. scarabaeicola 5014, 8; C. scarabaeicola 252, 9; C. scarabaeicola 9044, 10; Shimizuomyces poradox 5280, 11; Paecilomyces tenuipes 1944, 12; C. pruinosa 7495, 13; C. pruinosa 7497.

In addition, lanes 14-18 of FIG. 2 are Cordyceps militaris strains, that is, 14; C. militaris 2456, 15; C. militaris 5915, 16; C. militaris 7860, 17; C. militaris 8760, 18; C. militaris 8980.

As shown in FIG. 2, in the lanes 1 to 13 showing other strains of the genus Cordyceps sinensis, DNA products amplified by the specific primer sets (CMS-F4 and CMS-R1) were not observed, but lanes 14 − of the chrysalis Cordyceps sinensis strains. At 18, a 610 bp DNA product was observed.

On the other hand, Figure 3 is a diagram showing the results of PCR analysis of edible mushroom strains and pupae Cordyceps sinensis strain using the specific primer for identifying the chrysalis Cordyceps sinensis according to the present invention. In Figure 3, lanes 1 to 10 are edible mushroom strains, that is, 1; Hericium coralloides , 2; Shiitake mushrooms ( Lentinus edodes ), 3; Pleurotus ostreatus , 4; Flammulina velutipes , 5; Sparassis crispa , 6; Morel, Morchella esculenta , 7; Griofola frondosa , 8; Tuber melanosporum , 9; Roe deer mushroom ( Hericium erinaceum KUMC 1008), 10; It represents the Herculium erinaceum NIAST 48001.

In addition, lanes 11-18 of FIG. 3 show Cordyceps militaris strains, that is, 11; C. militaris 2671, 12; C. militaris 7159, 13; C. militaris 7619, 14; C. militaris CBS 108.90, 15; C. militaris CBS 109.70, 16; C. militaris CBS 110.70, 17; C. militaris CBS 178.59, 18; C. militaris CBS 181.64.

As shown in FIG. 3, DNA products amplified by specific primer sets (CMS-F4 and CMS-R1) could not be observed in lanes 1 to 10 of the edible mushroom strain, but in chrysalis 11 to 18 of the pupa stage Cordyceps 610 bp DNA product was observed.

Furthermore, the DNA product amplified by the PCR using the specific primer according to the present invention was confirmed in the case of the chrysalis of the registered strain of CBS as well as the native chrysalis of the Korean native chrysalis (lane 11-13).

Example 5 Analysis of Specific DNA Products of Chrysalis Cordyceps Sinensis

As a PCR product using the primer, the nucleotide sequence (SEQ ID NO: 3) of the specific DNA product of pupa cordyceps was analyzed, and is shown in FIG. 1 together with the position of the primer set according to the present invention.

As described above, according to the present invention, it is possible to quickly and accurately identify the chrysalis cordyceps from other fungi and edible mushroom fungi.

Another effect of the present invention is that the mycelium without morphological features can be accurately identified, and can be usefully used for pupal caterpillar fungi and quality control of mycelia.

Attach sequence list electronic file  

Claims (6)

A primer having the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2. Chrysalis cordyceps specific DNA fragment having the nucleotide sequence of SEQ ID NO: 3. DNA fragment complementary to the base sequence according to claim 1. DNA fragment complementary to the base sequence according to claim 2. Chrysalis insecticide identification method to identify the chrysalis insecticidal strain by performing a polymerase chain reaction using the primer set according to claim 1. In the method of identifying the chrysalis Cordyceps sinensis strain by electrophoresis and staining after PCR reaction to confirm the amplification product, After performing a PCR reaction using the primer set of claim 1 characterized in that the step of identifying the DNA fragment according to claim 2.

Images