KR100635347B1 - A 6-1-Oxobutyl-5,8-dimethoxy-1,4-naphthoquinone compound for inhibition of induced angiogenesis by malignant tumor-induced hypoxia and pharmaceutical composition containing the same - Google Patents

Abstract

The present invention provides a 6- (1-oxobutyl) -5,8-dimethoxy-1,4-naphthoquinone compound of formula (I) for inhibiting angiogenesis induced by hypoxia caused by malignant tumor (Hereinafter referred to as an oxo compound) and a pharmaceutical composition containing the same as an active ingredient and for inhibiting angiogenesis induction due to hypoxia caused by malignant tumors.

(Ⅰ)

(Ⅰ)

Naphthazarin, HIF-1α, VEGF, bFGF, Angiogenesis, Hypoxia

Description

6- (1-oxobutyl) -5,8-dimethoxy-1,4-naphthoquinone compound that inhibits angiogenesis induced by hypoxia caused by malignant tumors and pharmaceutical composition containing the same {A 6- (1-Oxobutyl) -5,8-dimethoxy-1,4-naphthoquinone compound for inhibition of induced angiogenesis by malignant tumor-induced hypoxia and pharmaceutical composition containing the same}

1A to 1C show toxicity assays in mouse-derived lung carcinoma (LLC), human-derived breast cancer cells (MCF-7) and human-derived vascular endothelial cells (HUVEC) treated with the OXO compound of formula (I), respectively. .

2A and 2B show toxicity assays in lung cancer lines (LLC) and human derived vascular endothelial cells (HUVEC) derived from mice treated with the OXO compound of formula (I).

Figure 3 shows the degree of HIF-1α and VEGF expression in hypoxic lung cancer cells (LLC) treated with the OXO compound of formula (I) by RT-PCR analysis.

Figure 4 shows the degree of HIF-1α and VEGF expression in hypoxic lung cancer cells (LLC) treated with OXO by Western analysis.

Figures 5a and 5b shows the ability to inhibit cell proliferation by treating the concentration of OXO compound of formula (I) in human-derived vascular endothelial cells (HUVEC) induced by treatment with angiogenesis factors bFGF and VEGF.

Figures 6a to 6c shows the ability to inhibit the formation of vascular tube (Tube) by treating the concentration of the OXO compound of formula (I) in HUVEC induced by treatment with angiogenesis factors bFGF and VEGF, respectively.

Figure 7a shows the weight change of the C57 mice transplanted with lung cancer lines, Figure 7b and 7c shows the ability to inhibit carcinoma growth by treating the OXO compound of formula (I) to a carcinoma formed by transplanting the lung cancer lines in C57 mice It shows the change of the size of a carcinoma. Figure 7d shows the weight of carcinoma of the mice transplanted with lung carcinoma, showing the ability to inhibit the carcinoma of the OXO compound of formula (I).

The present invention relates to an oxo compound of formula (I) and a pharmaceutical composition containing the same as an active ingredient for inhibiting angiogenesis induction caused by hypoxia caused by malignant tumors.

(Ⅰ)

(Ⅰ)

As the tumor proliferates, if no new blood vessels are formed, the proliferation and death of cancer cells are balanced and the pre-vascular phase of a few mm ³ is maintained. However, most tumors acquire the ability of some cancer cells to form neovascularization at some point of proliferation, from which the tumor grows rapidly, which is called angiogenic switch. Angiogenesis factors produced by cancer cells strongly increase membrane permeability and induce peripheral normal endothelial cell proliferation. In addition, angiogenesis is induced by the increase of hypoxia-related low pH and lactic acid, and the expression of VEGF and bFGF, angiogenesis factors, is regulated by HIF-1α gene, which is expressed during hypoxia of carcinoma. This may induce angiogenesis.

In hypoxic tumors, at least a portion of the genes are regulated due to the hypoxic state, which affects the progression of the tumor to malignancy. In this regard, a signal caused by hypoxia is transmitted to hypoxia-inducible factor-1 (HIF-1), so that various types of Hsp, hematopoietic factor and angiogenic factor Significant accumulation (Back et al., J. Cell Physiol., 32, 112-118, 1999; Back et al., J. Cell Physiol., 188, 223-235, 1999). This means that induction of growth factors involved in the expression and angiogenesis of a portion of the Hsp gene in tumor cells in hypoxic condition may improve resistance to radiation or chemotherapy, allowing tumor cells to survive (Willson et al. , Int. J. Radiat. Oncol. Biol. Phys., 16, 957-961, 1989; Murphy et al., Br. J. Cancer, 64, 69-73, 1991; Koong et al., Radiat. Res. , 138, S60-S63, 1994a; Koong et al., Int. J. Radiat. Oncol. Biol. Phys., 28, 661-666, 1994b; Wang et al., Blood, 82, 3610-3615, 1995; Forsythe et al., Mol. Cell Biol., 16, 4604-4613, 1996).

According to the results of studies on cancer to date, hypoxia occurring inside cancer tissues increases the stability of the transcription factor hypoxia inducer-1α (HIF-1α) and increases the expression of AP-1, This has already been shown to be a major trigger for the expression of vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), insulin-like growth factor-II (IGF-II) and its receptors. Angiogenesis induced by hypoxia is known to be caused not only by tumor progression but also by myocardial ischemia and retinal ischemia. This HIF-1α increases the expression of several genes involved in increased oxygen transport and decreased oxygen consumption. That is, HIF-1 factor plays a key role in the regulation of gene expression by hypoxia. Accordingly, inhibition of HIF-1α has emerged as a method of developing new anticancer therapies (Gregg L. Semenza., Nature reviews., 3, 721-732, 2003).

As found in the above findings and literature, many methods have been developed to suppress the factors that can lead to the progression of solid cancer (Brown et al., Int. J. Radiat. Biol., 65, 95-102, 1994). Giaccia, Seminars in Radiat.Oncol., 6, 46-58, 1996; Brown et al., Cancer Res., 60, 883-887, 1998; Koong et al., Cancer Res., 58, 1408-1416, 2000).

In this regard, the present inventors have found that the OXO compound of formula (I) derived from naphthazarin inhibits the effects of topoisomerase I and prolongs life in a life-expansion experiment transplanted with S-180 cancer in ICR mice. Gyu-Yong Song, et al., Arch Pharm Pharm Med Chem., 333, 87-92, 2000. Gyu-Yong Song ,. et al., Arch Pharm Res., 24 , 35-38, 2001)

Based on this, the present invention was found to have an angiogenesis inhibitory and anticancer activity through treatment with an OXO compound of formula (I), through effective inhibition of angiogenesis factors occurring in tumor cells in hypoxic state. . In other words, the present inventors demonstrated that hypoxic lung cancer cells and breast cancer cells were treated with OXO compounds to inhibit the expression of HIF-1α gene and VEGF expression, and also to reproduce reproduction in HUVEC induced by VEGF and bFGF, angiogenesis factors. The present invention was completed by finding inhibition of inhibition and tube formation.

The present invention is to provide a compound capable of anti-cancer action by inhibiting angiogenesis factors and angiogenesis induced during hypoxia in solid cancer cells.

Specifically, it is an object of the present invention to provide a compound that blocks the induction of angiogenesis factors and angiogenesis promoted by HIF-1α induced during hypoxia, an environment in which solid cancer can progress to malignancy.

The present invention relates to an oxo compound of formula (I) for inhibiting angiogenesis induced by hypoxia caused by malignant tumors.

(Ⅰ)

(Ⅰ)

The present invention relates to a pharmaceutical composition containing the oxo compound of formula (I) as an active ingredient.

The present invention also relates to a pharmaceutical composition containing an oxo compound of the formula (I) formulated as an injection.

The present inventors confirmed the anticancer effect of the OXO compound by inhibiting angiogenesis and angiogenesis induced hypoxia in solid cancer. Hereinafter, the present invention will be described in detail.

Synthesis of OXO Compound

Synthesis of 6- (1-oxobutyl) -5,8-dimethoxy-1,4-naphthoquinone ( 7 ) can be represented as follows.

Specific synthesis method is as follows. 2-formyl-1,4,5,8-tetramethoxynaphthalene methylated, brominated, methoxylated and formylated using 1,5-dihydroxynaphthalene (1) as a starting material according to the method of Terada et al. 5) was synthesized through Grignard reaction. 6.1 g (20 mM) of Substance 6 was dissolved in 100 mL of anhydrous benzene, and 8.68 g (100 mM) of manganese dioxide was added thereto, and the mixture was refluxed for 10 hours. The reaction mixture was cooled to room temperature, filtered, and the residue obtained by concentrating the filtrate under reduced pressure was subjected to silica gel column chromatography using a mixed solvent of hexane: ethyl acetate (7: 3) as an eluent, to give 4.1 g of a yellow crystal compound (7). Got. After dissolving 3.18 g (10 mM) of substance 7 in 50 mL of acetonitrile, an aqueous solution of 13.6 g (25 mM) of cerium ammonium (IV) nitrate was slowly added dropwise for 5 minutes and stirred for 30 minutes. 200 mL of cold water was added to the reaction mixture, and 300 mL of dichloromethane was extracted three times. The extracted solution was dehydrated with 25 g of anhydrous sodium sulfate, and the residue thus concentrated under reduced pressure was subjected to silica gel column chromatography using a mixed solvent of hexane: ethyl acetate (3: 2) as eluent to give 6- (1-oxobutyl) as a reddish brown solid. 2.02 g of -5,8-dimethoxy-1,4-naphthoquinone compound (8) was obtained (A. Terada, Y. Tanoue, A. Hatada, and H. Sakamoto.Synthesis of shikalin (± shikonin) and related) compounds, Bull.Chem.Soc ., 1987 , 60, 205-214)

Yield: 75%, Melting point: 148.3-149.6 ℃

¹ H-NMR (CDCl ₃ ): δ 7.35 (s, 1H), 6.83 (s, 2H), 3.90 (s, 3H), 3.84 (s, 3H), 3.01 (t, J = 7.21 Hz, 2H), 1.70-1.60 (m, 2H), 0.99 (t, J = 6.30 Hz, 3H)

Preparation Example 1 Preparation of OXO Compound-Containing Liquid

 OXO-containing liquid was prepared by the following method.

The OXO compound treated in the cells was used by dissolving in an emulsifier (DMSO) at a concentration of 200 μM and, if necessary, diluted with the medium to the concentration used in the following examples.

Preparation Example 2 Preparation of OXO Compound-Containing Injection

Injections containing OXO were prepared as follows.

Injections containing OXO compounds injected into test animals were prepared by adding OXO compounds to a solution of 1% by weight Tween 80 and the remaining distilled water to the concentration used in the examples below.

Example 1 Cancer Cell Proliferation Inhibitory Effect Experiment

 In order to measure the cancer treatment effect of the OXO of the present invention, experiments were performed for the inhibition of cancer cell proliferation using mouse cell line LLC cells and human breast cancer cell line MCF-7 and cytotoxicity using HUVEC, a human vascular endothelial cell. The cancer cells and human vascular endothelial cell lines were immersed in the culture medium (using a medium in RPMI 1640-fold fetal bovine serum containing 10% fetal bovine serum and M199 containing bFGF 3ng / ml) and refrigerated (4-6 ° C.). Used.

 MTT and XTT assays were performed to determine cytotoxicity. Each cultured cancer cell was dispensed in a 96 well plate (96 well plate) about 10,000 (for cancer cell lines) 5,000 per each well (for human vascular endothelial cell lines), and after 24 hours, the OXO solution prepared in Preparation Example 1 Subsequent dilution for each concentration was added 100ul. After 24 hours, MTT or XTT solution was added and reacted. Then, after incubation for 2 hours, the absorbance was measured by a microplate reader (wavelength: 570nm, 450nm) to measure the survival rate of cancer cells. Figures 1a-1c show the results of measuring the survival rate of the mouse lung cancer cell line, human breast cancer cell line, human vascular endothelial cell line according to the concentration of the OXO compound, respectively. As can be seen in Figures 1a-1c, when treated with OXO compounds showed a cytotoxic effect in a concentration-dependent manner. The higher the concentration of OXO compound, the lower the survival rate of cancer cells.

Example 2 Cytotoxic Effects in Cancer Cell Lines During Hypoxia Treatment

The cancer cell lines were treated in different concentrations with the OXO compound solution prepared as in Preparation Example 1, and exposed to hypoxic conditions (37 ° C incubator CO ₂ 5%, O ₂ 1%) for 24 hours. Inhibitory effect on cell proliferation was assayed. The cancer cell line was used while immersed in a culture medium (using RPMI 1640 medium containing 10% fetal bovine serum) and refrigerated (4-6 ° C.).

 XTT assay was performed to determine cytotoxicity. Each cultured cancer cell is dispensed by 10,000 (for cancer cell lines) each well into a 96 well plate, and after 24 hours, the OXO compound-containing solution prepared in Preparation Example 1 is diluted by concentration 100 Μl was added. After 24 hours, XTT solution was added and reacted. Then, after incubation for 2 hours, the absorbance was measured by a microplate reader (wavelength: 450nm) to measure the survival rate of cancer cells. Figure 2 shows the results of measuring the survival rate of the mouse lung cancer cell line, human breast cancer cell line according to the concentration of the OXO compound, respectively. As can be seen in Figure 2, when the OXO compound treatment showed a concentration-dependent cytotoxic effect. The higher the concentration of OXO compound, the lower the survival rate of hypoxic cancer cells.

Example 3 Inhibition of HIF-1α (Hypoxia inducible factor-1 alpha) Gene and Reduction of VEGF Gene Expression and Protein Accumulation

(1) Treatment of hypoxic state of cells and treatment of KMKKT

The culture medium of the cultured cells was exchanged three times with RPMI 1640 medium in a hypoxic state in a hypoxic chamber at 37 ° C. Thereafter, a low oxygen mixed gas containing 37 ° C., 5% CO ₂ , 85% N _2, and 10% H ₂ is supplied to the medium to make an equilibrium state (anaerobic state). The hypoxic chamber and the oxygen concentration in the medium were measured with an oxygen indicator (Forma Scientific, Marietta, USA) and the oxygen concentration was kept below 1%. After 12 hours, the cells treated in the hypoxic state were collected and tested. As a control, the normal oxygen cells were incubated in a 37 ° C. incubator with 5% CO ₂ and 95% air. Treatment of the OXO compound was carried out by subdiluting the solution with RPMI 1640 medium according to the concentration treatment as in Preparation Example 1. After 12 hours, total oxygen and low oxygen cells were harvested to separate total RNA. Total RNA was isolated using the Trizol, GIBCO-BRL Grand Island, NY, USA method. All the solutions used were treated with 0.1% diethyl pryrocarbonate-treated water (DEPC-dH ₂ O) to inhibit RNAse activity.

(2) Reverse Transcription Chain Polymerization (RT-PCR) Analysis

The RNA extracted above was subjected to reverse transcription chain polymerization to identify HIF-1α and VEGF genes. Genes were amplified using the primer base pairs in Table 1. The amplification was performed with a PerkinElmer thermal cycler (PerkinElmer, Norwalk, U.S.A). The amplified product was separated by electrophoresis on a 1.5% agarose gel, stained with ethidium bromide and photographed under ultraviolet (UV) illumination.

Primer Pairs for Amplifying HIF-1α and VEGF and β-actin Genes  HI-1α sense  5'-CTCAAAGTCGGACAGCCTCA-3 ' antisense  5'-CCCTGCAGTAGGTTTCTGCT-3 ' VEGF sense  5'-CCTCCGAAACCATGAACTTT-3 ' antisense  5'- AGAGATCTGGTTCCCGAAAC-3 ' β-actin sense  5'- AAGAGAGGCATCCTCACCCT antisense  5'- ATCTCTTGCTCTGAAGTCCA

Western analysis

Centrifugation of the sample extracted above (4 ℃, 12000rpm, 10 minutes) protein quantification of the supernatant taken (Lowry et al., J. Biol. Chem., 193, 265-275, 1951), take 30μg of protein 12% SDS-PAGE (Laemmli, 1970), stained with Coomassie blue solution, bleached and dried to confirm protein isolation. The same amount of protein was also taken and 12% SDS-PAGE and the protein was transferred to nitrocellulose membrane using a trans-blot instrument (BioRad, Richmond, U.S.A.). The protein-transferred nitrocellulose membrane was blocked for 1 hour with a tris-buffered saline (TBS) solution containing 5% skim milk powder, then the solution used for blocking was removed, and the membrane was washed three times over 10 minutes with TBST solution. Washed with. Antibodies against HIF-1α and VEGF protein diluted to appropriate concentrations using TBST solution were allowed to bind to HIF-1αVEGF protein transferred to the membrane after overnight at 4 ° C. β-actin (Sigma-Aldrich, St. Louis, MO, U.S.A.) was used as a control. Membranes were washed three times at 10 minute intervals with TBST solution to remove unbound antibodies. To confirm that the antigen-antibody reaction occurred, a second antibody that binds to the antibody was treated with horseradish peroxidase-bound anti-rabbit and anti-mouse IgG, reacted for 1 hour, and then treated three times with TBST solution. Wash at 10 minute intervals over time. Then, the last wash for 10 minutes with TBS solution. The washed membrane was checked for protein expression using an ECL system (Amersham, Buckinghamshire, England).

 In order to prove the anticancer effect of OXO compounds, the present inventors induced hypoxic state in mouse lung cancer cell line Lewis lung carcinoma (LLC) through the above experimental method to induce HIF-1α gene expression and neovascular factor. Phosphorus VEGF gene expression was induced by inhibiting the expression of HIF-1alpha gene by OXO treatment, it was confirmed that the accumulation of VEGF gene and protein is reduced as shown in FIG.

  In this regard, the present inventors have demonstrated the anticancer effect that OXO can regulate and inhibit the expression of angiogenesis factor VEGF by inhibiting the expression of HIF-1α in the hypoxic state caused by the solid tissue internal tissue state. In addition, it was found that gene expression and protein accumulation of HIF-1α and VEGF, angiogenesis factors, were significantly reduced (FIG. 3 and FIG. 4).

Example 4 Inhibition of Cell Proliferation in HUVECs Inducing Angiogenesis Factors

  As demonstrated above, the present inventors confirmed that the treatment of OXO in FIG. 3 and FIG. 4 destabilized HIF-1α to inhibit VEGF induction of angiogenesis factor. The effect of cell proliferation inhibition in HUVEC was confirmed. In other words, the results of HUVEC-induced HUVEC and bFGF-induced HUVEC, which are one of the angiogenesis factors, confirmed that the proliferation of HUVECs induced by both angiogenesis factors was suppressed. As a result, the possibility of inhibiting not only angiogenesis factors induced by HIF-1α expression in a hypoxic state but also neovascularization formed by expression of angiogenesis factors in solid cancers as solid cancers progress to malignancy already It was confirmed (FIG. 5).

Example 5 Inhibition of Cell Differentiation in HUVECs Inducing Angiogenesis Factors

  Angiogenesis factors in solid cancer itself are expressed during the progression of solid cancer, leading to angiogenesis in surrounding normal blood vessels, and whether angiogenesis is inhibited by OXO compound treatment. Inhibition of angiogenesis was confirmed in factor-induced HUVEC.

 In vitro cultured vascular endothelial cells were treated with growth factor VEGF or bFGF to induce tube formation, and some were treated with different concentrations of OXO compounds, followed by incubation for 7 hours, and OXO induced growth factors. The effect on the differentiation of was observed. As can be seen in Figure 6, the positive control group treated with growth factors only increased the angiogenesis, it was confirmed that HUVEC treated with the OXO compound has an angiogenesis inhibitory effect.

Example 6 Inhibition of Tumor Growth in Vivo

 In order to investigate the tumor growth inhibitory effect in vivo, the OXO compound-containing injection was prepared and administered intraperitoneally to test the tumor growth inhibitory effect.

 Lung cancer cell lines (LLCs) were implanted subcutaneously in rats, and then injected intraperitoneally with the OXO compound prepared in Formulation Example 2, which is Example 1, for 7 days, once daily from the third day. Carcinoma volume was measured from 4 days after cancer cell transplantation, and tumor size was removed on day 11 to determine its size and weight. Figure 7a shows the weight change of C57 mice transplanted with lung cancer lines, Figures 7b and 7c shows the size of the carcinoma between the control group not administered the OXO compound and the individual administered the OXO compound of 1 mg / kg and 2 mg / kg content, respectively 11 Figure 7d is a chart showing the results observed, Figure 7d is the result of measuring the weight of the carcinoma measured after removing the tumor. As can be seen in Figures 7a to 7d, in the case of the individual administered an oxo compound, it was confirmed that the carcinoma inhibitory effect is expressed, it was confirmed that the carcinoma suppression effect increases in proportion to the dose.

As described above, the oxo compound of the formula (I) of the present invention is cytotoxic, inhibition of angiogenesis induced by hypoxia in solid cancer, angiogenesis inhibitory effect and tumor growth inhibition effect by induction of angiogenesis factors. This can be usefully used for cancer treatment and prevention.

The embodiments of the present invention described above should not be construed as limiting the technical idea of the present invention. The protection scope of the present invention is limited only by the matters described in the claims, and those skilled in the art can change and change the technical spirit of the present invention in various forms. Therefore, such improvements and modifications will fall within the protection scope of the present invention, as will be apparent to those skilled in the art.

Claims (9)

delete From the group consisting of rheumatoid arthritis, diabetic retinopathy, neovascular glaucoma containing 6- (1-oxobutyl) -5,8-dimethoxy-1,4-naphthoquinone compound of formula (I) as an active ingredient Pharmaceutical composition for the treatment of the disease of choice.

Formula (Ⅰ) The pharmaceutical composition according to claim 2, wherein the in vitro dose of the 6- (1-oxobutyl) -5,8-dimethoxy-1,4-naphthoquinone compound is 2 to 10 µM. The pharmaceutical composition according to claim 2, wherein the in vivo dose of the 6- (1-oxobutyl) -5,8-dimethoxy-1,4-naphthoquinone compound is 1 to 2 mg / kg. . delete delete delete delete delete

Images