KR100614523B1 - Methods for Restoring Biological Functions of Senescent Cells - Google Patents
Methods for Restoring Biological Functions of Senescent Cells Download PDFInfo
- Publication number
- KR100614523B1 KR100614523B1 KR1020030051175A KR20030051175A KR100614523B1 KR 100614523 B1 KR100614523 B1 KR 100614523B1 KR 1020030051175 A KR1020030051175 A KR 1020030051175A KR 20030051175 A KR20030051175 A KR 20030051175A KR 100614523 B1 KR100614523 B1 KR 100614523B1
- Authority
- KR
- South Korea
- Prior art keywords
- sequence
- nucleotide sequence
- mrna
- cells
- sirna
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
본 발명은 카베올린의 mRNA에 상보적인 서열을 갖으며 상기 mRNA에 결합하여 카베올린 단백질의 발현을 억제하는 이중-가닥 siRNA (small interfering RNA)을 세포에 투입하는 단계를 포함하는 카베올린 단백질의 발현 억제 방법, 노화세포의 생물학적 기능 회복 방법 및 노화세포의 생물학적 기능 회복용 조성물에 관한 것이다.The present invention has a sequence complementary to the mRNA of the Caberoline and binds to the mRNA expression of the Caberoline protein comprising the step of injecting a small-stranded siRNA (small interfering RNA) to the cell inhibits the expression of the Caberoline protein It relates to an inhibitory method, a method for restoring biological function of senescent cells, and a composition for restoring biological function of senescent cells.
카베올린, siRNA, 노화, 카베올라Caveolin, siRNA, aging, caveola
Description
도 1은 노화 HDF 세포를 카베올린 mRNA를 표적으로 하는 센스-올리고뉴클레오타이드 또는 안티센스-올리고뉴클레오타이드를 처리한 결과를 보여주는 사진;1 is a photograph showing the results of treatment of sensitized HDF cells with sense-oligonucleotides or antisense-oligonucleotides targeting carveolin mRNAs;
도 2a는 카베올린 mRNA를 표적으로 하는 센스-올리고뉴클레오타이드 또는 안티센스-올리고뉴클레오타이드로 처리된 노화 HDF 세포에서 카베올라 구조를 보여주는 전자현미경 분석 사진. 화살표는 카베올라 구조를 지시하고, 막대는 100 nm를 표시하는 것이다.FIG. 2A is an electron micrograph showing the structure of Kaveola in sensitized HDF cells treated with sense-oligonucleotides or antisense-oligonucleotides targeting carveolin mRNA. Arrows indicate the Cabela structure, and bars indicate 100 nm.
도 2b는 카베올린 mRNA를 표적으로 하는 센스-올리고뉴클레오타이드 또는 안티센스-올리고뉴클레오타이드로 처리된 노화 HDF 세포에서 카베올라의 수 변화를 나타내는 그래프.2B is a graph showing the change in the number of Cabela in aged HDF cells treated with sense-oligonucleotides or antisense-oligonucleotides targeting carveolin mRNAs.
도 3a-3d는 노화 HDF 세포에서 카베올린-1의 하향조절에 의해 Erk 활성화가 회복됨을 보여주는 사진.3A-3D are photographs showing that Erk activation is restored by downregulation of caveolin-1 in senescent HDF cells.
도 4a-4c는 카베올린-1 mRNA를 표적으로 하는 siRNA (small interfering RNA)에 의해 카베올린-1의 하향조절 및 Erk 활성화가 회복됨을 나타내는 사진.4A-4C are photographs showing that downregulation of Eccaline-1 and Erk activation are restored by siRNA (small interfering RNA) targeting Caveolin-1 mRNA.
도 5a는 노화 및 젊은 HDF 세포에서 Erk 및 Elk 단백질의 인산화 정도를 보 여주는 사진. N은 핵, C는 세포질을 나타낸다.Figure 5a is a photograph showing the degree of phosphorylation of Erk and Elk protein in aging and young HDF cells. N represents the nucleus and C represents the cytoplasm.
도 5b는 노화 및 젊은 HDF 세포에서 EGF 처리에 따른 Erk 및 Elk 단백질의 인산화 정도를 보여주는 사진.Figure 5b is a photograph showing the degree of phosphorylation of Erk and Elk protein according to EGF treatment in aging and young HDF cells.
도 6은 카베올린 mRNA를 표적으로 하는 센스-올리고뉴클레오타이드 또는 안티센스-올리고뉴클레오타이드로 처리된 노화 HDF 세포에서 EGF 자극에 대한 Elk 인산화 정도를 보여주는 사진.FIG. 6 is a photograph showing the degree of Elk phosphorylation for EGF stimulation in aged HDF cells treated with sense-oligonucleotides or antisense-oligonucleotides targeting carveolin mRNA.
도 7a는 카베올린 mRNA를 표적으로 하는 센스-올리고뉴클레오타이드 또는 안티센스-올리고뉴클레오타이드로 처리된 노화 HDF 세포에서 p53 및 p21의 수준을 나타내는 사진.FIG. 7A is a photograph showing the levels of p53 and p21 in aged HDF cells treated with sense-oligonucleotides or antisense-oligonucleotides targeting carveolin mRNA.
도 7b는 카베올린 mRNA를 표적으로 하는 센스-올리고뉴클레오타이드 또는 안티센스-올리고뉴클레오타이드로 처리된 노화 HDF 세포에서 DNA 합성 속도를 증명하는 그래프.FIG. 7B is a graph demonstrating DNA synthesis rates in sensitized HDF cells treated with sense-oligonucleotides or antisense-oligonucleotides targeting carveolin mRNA.
본 발명은 카베올린 단백질의 발현 억제 방법에 관한 것으로서, 보다 상세하게는 카베올린 mRNA에 작용하는 siRNA (small interfering RNA)을 이용한 카베올린 단백질의 발현 억제 방법, 노화세포의 생물학적 기능 회복 방법, 노화세포의 생물학적 기능 회복용 조성물 및 siRNAs에 관한 것이다.The present invention relates to a method for inhibiting expression of a caveolin protein, and more particularly, a method for inhibiting expression of a caveolin protein using siRNA (small interfering RNA) acting on a caveolin mRNA, a method for restoring biological function of senescent cells, and an aging cell. It relates to a composition for restoring biological function and siRNAs.
카베올라 (Caveolae)는 세포질막의 일부류에 속하는 소낭 구조의 소기관이다 (Severs, N.J. (1988) J Cell Sci 90, 341-348; 및 Anderson, R.G. (1993) Proc Natl Acad Sci U.S.A. 90, 10909-10913). 카베올라는 말단에서 분화되는 세포종, 예컨대, 지방세포, 내피세포 및 근육세포에서 가장 풍부하게 존재한다. 또한, 카베올라는 비활성 신호전달 분자 (신호전달 캐스케이드의 활성화를 조절하고, 캐스케이드 사이의 크로스-토크 (cross-talk)의 활성화를 촉진하는 분자)의 저장에 관여하는 서브세포 구조로 작용하는 것으로 알려져 있다 (Engelman, J.A., et al., (1998) FEBS Lett. 428, 205-211; 및 Lisanti, M.P., et al., (1994) J Cell Biol 126, 111-126).Cabolae are organelles of vesicle structures belonging to a subset of the cytoplasmic membranes (Severs, NJ (1988) J Cell Sci 90, 341-348; and Anderson, RG (1993) Proc Natl Acad Sci USA 90, 10909-10913 ). Cabelaola is most abundantly present in cell species that differentiate at the ends, such as adipocytes, endothelial cells and muscle cells. Cabela is also known to act as a subcellular structure involved in the storage of inactive signaling molecules (molecules that regulate the activation of signaling cascades and promote cross-talk activation between cascades). (Engelman, JA, et al., (1998) FEBS Lett. 428, 205-211; and Lisanti, MP, et al., (1994) J Cell Biol 126, 111-126).
한편, 카베올라의 구조를 형성하는 데 가장 중요한 단백질인 카베올린 (caveolin)은 분자량 21-24 kDa의 내재성 막단백질로서, 카베올린 유전자 패밀리는 카베올린-1, 2 및 3으로 구성되어 있다. 카베올린-1 및 2는 공동으로 발현되며, 세포막에서 헤테로-올리고머 형태로 카베올라구조를 형성하고, 다양한 세포 타입에 존재한다 (Scherer, P.E., et al., (1996) Proc Natl Acad Sci U.S.A. 93, 131-135; Scheiffele, P., et al., (1998) J Cell Biol 140, 795-806; 및 Li, S., et al., (1998) FEBS Lett. 434, 127-134). 한편, 카베올린-3의 발현은 근육-특이적이다 (Tang, Z., et al., (1996) J Biol Chem 271, 2255-2261). 최근의 연구들은 카베올린에 대한 조절 역할뿐만 아니라 구조적 기능도 규명하고 있다. 예를 들어, 카베올린-결핍 포유동물 세포에서 카베올린-1 또는 -3 유전자의 안정된 발현은 카베올라 구조의 형성을 유도하는 것으로 규명되었다 (Lipardi, C., et al., (1998) J Cell Biol 140, 617-626).Meanwhile, caveolin, the most important protein for forming the structure of caveola, is an endogenous membrane protein having a molecular weight of 21-24 kDa, and the caveolin gene family is composed of caveolin-1, 2, and 3. Cabolin-1 and 2 are co-expressed and form a Cabela structure in the hetero-oligomeric form at the cell membrane and are present in various cell types (Scherer, PE, et al., (1996) Proc Natl Acad Sci USA 93 , 131-135; Scheiffele, P., et al., (1998) J Cell Biol 140, 795-806; and Li, S., et al., (1998) FEBS Lett . 434, 127-134). Meanwhile, the expression of Cabolin-3 is muscle-specific (Tang, Z., et al., (1996) J Biol Chem 271, 2255-2261). Recent studies have identified structural functions as well as regulatory roles for caveolin. For example, Kaveh De-deficient mammalian stable expression of caveolin-1 or -3 gene in animal cells has been identified to induce the formation of a carbenium come la structure (Lipardi, C., et al, (1998) J Cell Biol 140, 617-626).
카베올린은 카베올라 구조 내에서 스캐폴딩 단백질로서 기능하며, EGFR, G-단백질, Src-유사 키나아제, Ha-Ras, 단백질 키나아제 C, 내피 세포 니트릭-옥시드 신타아제 및 인테그린과 같은 신호전달 단백질들과 상호작용을 한다 (Li, S., Couet, J., et, al., (1996) J Biol Chem 271, 29182-291, Ko, Y.-G., et, al., (1999) J Immunol 162, 7217-7223, Ko, Y.-G., et, al., (1998) J Cell Biochem 71, 524-535, Garcia-Cardena, et, al., (1997) J Biol Chem 272, 25437-25440, Couet, J., et, al., (1997) J Biol Chem 272, 30429-30438, Okamoto, T., et, al. (1998) J Biol Chem 273, 5419-5422). Carbenium de la structure is Kaveh come within functions as a scaffolding protein in, EGFR, G- proteins, Src- similar kinase, Ha-Ras, the protein kinase C, endothelial nitric-oxide synthase and signaling, such as seed integrin Interact with proteins (Li, S., Couet, J., et, al., (1996) J Biol Chem 271, 29182-291, Ko, Y.-G., et, al., (1999) ) J Immunol 162, 7217-7223, Ko, Y.-G., et, al., (1998) J Cell Biochem 71, 524-535, Garcia-Cardena, et, al., (1997) J Biol Chem 272 , 25437-25440, Couet, J., et. Al., (1997) J Biol Chem 272, 30429-30438, Okamoto, T., et, al. (1998) J Biol Chem 273, 5419-5422).
또한, 카베올린의 짧은 세포질 N-말단 부위는 올리고머의 형성에 관여하며, 신호전달 분자들과의 상호작용을 매개하여 그 결과로 신호전달 분자를 비활성화 한다 (Lisanti, M.P., et al., (1994) J Cell Biol 126, 111-126). 카베올린-1의 하향-조절은 세포 형질전환을 유도하기에 충분하며 Erk 키나아제 캐스케이드를 과활성화한다 (Galbiati, F., et al., (1998) EMBO J. 17, 6633-6648). 대부분의 종양 조직에서 카베올린 수준은 정상 세포와 비교하여 상당히 낮으며, 이것은 카베올린에 의한 신호전달 억제 작용이 우회됨을 암시하는 것으로 암억제유전자라 불리기도 한다. 더욱이, EGFR, Raf, MEK-1, 또는 Erk-2가 카베올린-1과 함께 발현되면 인 비보 (in vivo)에서 세포질로부터 핵으로 전해지는 신호전달이 눈에 뛰게 억제된다 (Engelman, J.A., et, al., (1998) FEBS Lett. 428, 205-211).In addition, the short cytoplasmic N-terminal region of the caveolin is involved in the formation of oligomers and mediates interactions with signaling molecules, resulting in inactivation of signaling molecules (Lisanti, MP, et al., (1994). ) J Cell Biol 126, 111-126). Down-regulation of carveolin-1 is sufficient to induce cell transformation and overactivates the Erk kinase cascade (Galbiati, F., et al., (1998) EMBO J. 17, 6633-6648). In most tumor tissues, carveolin levels are significantly lower compared to normal cells, which is sometimes referred to as cancer suppressor genes, suggesting that the signaling inhibitory action by caveolin is bypassed. Further, EGFR, Raf, when MEK-1, or Erk-2 is expressed with -1 caveolin in vivo (in vivo) the signaling transmitted from the cytoplasm to the nucleus in a leap to the eye is inhibited (Engelman, JA, et , al., (1998) FEBS Lett . 428, 205-211.
인간 이배체 섬유아세포와 같은 많은 세포형이 인 비트로 (in vitro)에서 세포노화를 나타낸다. 노화에 이른 섬유아세포는 세포분열을 억제하는 유전자의 발현증가에 따른 성장정지현상을 보이고 (Chang, B.D., et al., (1999) Oncogene 26, 4808-18, Kagawa, S., et al., (1999) Cell Death Differ 6, 765-72, Ohkusu-Tsukada, K., et al., (1999) J Immunol. 15, 1966-72), 이 상태에서, 세포는 크고 편평한 형태를 가지며 β-갈락토시다아제 활성이 증가하는 등의 세포노화 현상을 보인다 (Park, W.Y., et al., (2000) J Biol Chem 275, 20847-52). 노화된 인간 이배체 섬유아세포 (HDF)에서는 EGF 자극에 대해서 세포분열을 유도하는 유사분열인자-활성화된 단백질 키나아제 (Erk-1/2) 활성화가 나타나지 않을 뿐 아니라 (Liu, Y., et al., (1996) J Biol Chem 16, 3604-7, Park, W.Y., et al., (2000) J Biol Chem 275, 20847-52, Ishigami, A., et al., (1993) Biochem Biophys Res Commun 196, 181-6), 더욱이, EGF 자극과 상관없이 세포질에 축적되어 있는 p-Erk1/2가 핵으로 운반되지 않는다 (Lim, I.K., et al., (2000) Mech Ageing Dev 119, 113-30, Lim, I.K., et al., (2001) Ann N Y Acad Sci 928, 176-81. Review, Tresin, I.M., et al., (2001) Exp Cell Res 269, 287-300). 결과적으로, 노화세포는 세포질 내의 고수준의 p-Erk에도 불구하고 세포분열유도를 위한 핵으로의 이동이 저하되어 있어 핵 내에서는 저수준의 p-Erk을 보여주며, 유전자조절인자 (Elk-1) 활성화가 부재한다 (Lipardi, C., et al., (1998) J Cell Biol 140, 617-626). In vitro (in vitro) the number of cell types such as human diploid fibroblasts represents a cell aging. Fibroblasts that reach aging show growth arrest with increased expression of genes that inhibit cell division (Chang, BD, et al., (1999) Oncogene 26, 4808-18, Kagawa, S., et al., (1999) Cell Death Differ 6 , 765-72, Ohkusu-Tsukada, K., et al., (1999) J Immunol. 15, 1966-72), in this state, the cells are large and flat in shape and β-gal Cell aging such as increased lactosidase activity (Park, WY, et al., (2000) J Biol Chem 275, 20847-52). Aged human diploid fibroblasts (HDF) not only show mitotic factor-activated protein kinase (Erk-1 / 2) activation that induces cell division for EGF stimulation (Liu, Y., et al., (1996) J Biol Chem 16, 3604-7, Park, WY, et al., (2000) J Biol Chem 275, 20847-52, Ishigami, A., et al., (1993) Biochem Biophys Res Commun 196, 181-6), moreover, regardless of EGF stimulation, p-Erk1 / 2 accumulated in the cytoplasm is not transported to the nucleus (Lim, IK, et al., (2000) Mech Ageing Dev 119, 113-30, Lim , IK, et al., (2001) Ann NY Acad Sci 928, 176-81.Review, Tresin, IM, et al., (2001) Exp Cell Res 269, 287-300). As a result, senescent cells show a low level of p-Erk in the nucleus due to reduced migration to the nucleus for induction of cell division despite high levels of p-Erk in the cytoplasm, and activation of gene regulatory factor (Elk-1). (Lipardi, C., et al., (1998) J Cell Biol 140, 617-626).
본 발명자들은 EGF 자극에 대한 노화섬유아세포의 저반응은 노화에 따른 카 베올린-1의 발현증가와 관련되어 있으며 젊은 HDF 세포에서 카베올린의 과발현이 EGF 신호를 하향-조절할 수 있다는 것을 개시한 바 있다 (Park, W.Y., et al., (2000) J Biol Chem 275, 20847-52). 또한, 본 발명자들은 카베올린-1의 mRNA의 전사 개시 부위에 결합함으로써 카베올린의 발현을 억제하는 안티센스 올리고뉴클에오타이드에 의해 노화 세포에서 감소된 성장인자 반응성이 어느 정도 회복된다는 것도 발표한 바 있다 (WO 02/21140). 그러나, 상기한 안티센스 올리고뉴클에오타이드에 의한 방법은 한계가 있고, 이에 보다 효율적인 노화 세포의 기능 회복 방법이 요구된다.We have shown that the low response of aging fibroblasts to EGF stimulation is associated with increased expression of Cabolin-1 with aging and that overexpression of Cabolin in young HDF cells can down-regulate EGF signals. (Park, WY, et al., (2000) J Biol Chem 275, 20847-52). In addition, the present inventors have also reported that by reducing the growth factor reactivity in senescent cells by antisense oligonucleotides that inhibit the expression of carveolin by binding to the transcription initiation site of the carveolin-1 mRNA, (WO 02/21140). However, the method of the antisense oligonucleotide described above is limited, and thus a more efficient method for restoring senescent cells is required.
본 명세서 전체에 걸쳐 다수의 인용문헌 및 특허 문헌이 참조되고 그 인용이 표시되어 있다. 인용된 문헌 및 특허의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.Throughout this specification, numerous citations and patent documents are referenced and their citations are indicated. The disclosures of cited documents and patents are incorporated herein by reference in their entirety, so that the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.
본 발명자들은 상술한 당업계의 요구를 해결하기 위하여 예의 연구 노력한 결과, 세포 노화에 관여하는 것으로 규명된 카베올린의 발현을 억제할 수 있는 siRNA (small interfering RNA)가 보다 효율적으로 노화세포의 생물학적 기능을 정상적으로 회복하는 것을 확인함으로써, 본 발명을 완성하게 되었다.The present inventors have made diligent research efforts to solve the above-mentioned needs of the art, and as a result, siRNA (small interfering RNA) capable of suppressing the expression of caveolin, which has been found to be involved in cellular senescence, has a more efficient biological function of senescent cells. By confirming that the normal recovery, the present invention was completed.
따라서, 본 발명의 목적은 카베올린 단백질의 발현 억제 방법을 제공하는 데 있다.Accordingly, it is an object of the present invention to provide a method for inhibiting expression of a caveolin protein.
본 발명의 다른 목적은 노화세포의 생물학적 기능 회복 방법을 제공하는 데 있다.Another object of the present invention to provide a method for restoring biological function of senescent cells.
본 발명의 또 다른 목적은 노화세포의 생물학적 기능 회복용 조성물을 제공하는 데 있다.Still another object of the present invention is to provide a composition for restoring biological function of senescent cells.
본 발명의 다른 목적은 카베올린 단백질의 발현 억제능을 갖는 siRNA를 제공하는 데 있다.
Another object of the present invention is to provide an siRNA having an expression inhibiting ability of a caveolin protein.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.
본 발명의 일 양태에 따르면, 본 발명은 카베올린의 mRNA에 상보적인 서열을 갖으며 상기 mRNA에 결합하여 카베올린 단백질의 발현을 억제하는 이중-가닥 siRNA (small interfering RNA)을 세포에 투입하는 단계를 포함하는 카베올린 단백질의 발현 억제 방법을 제공한다.According to an aspect of the present invention, the present invention comprises a step of injecting into the cell a double-stranded siRNA (small interfering RNA) having a sequence complementary to the mRNA of the Caberoline and binds to the mRNA to inhibit the expression of the Caberoline protein It provides a method for inhibiting expression of Caberoline protein comprising a.
본 발명의 다른 양태에 따르면, 본 발명은 카베올린의 mRNA에 상보적인 서열을 갖으며 상기 mRNA에 결합하여 카베올린 단백질의 발현을 억제하는 이중-가닥 siRNA (small interfering RNA)을 세포에 투입하는 단계를 포함하는 노화세포의 생물학적 기능 회복 방법을 제공한다.According to another aspect of the present invention, the present invention comprises the steps of injecting into the cell a double-stranded siRNA (small interfering RNA) having a sequence complementary to the mRNA of the Caberoline and binds to the mRNA to inhibit the expression of the Caberoline protein It provides a method for restoring biological function of senescent cells comprising a.
본 발명에 있어서, 타깃 분자가 되는 상기 카베올린은 카베올린-1, 2 및 3이며, 바람직하게는 카베올린-1이다.In the present invention, the above-mentioned caveolin which becomes a target molecule is caveolin-1, 2 and 3, Preferably it is caveolin-1.
본 명세서에서, 카베올린의 mRNA와 관련하여 사용되는 용어 "상보적인 서열"은 카베올린의 mRNA 서열과 완벽하게 상보적인 서열뿐만 아니라, 카베올린 mRNA에 결합하여 이중체 (duplex)를 형성할 수 있는 서열도 포함하는 것이다.As used herein, the term "complementary sequence" as used in connection with the mRNA of the caveolin is not only a sequence that is perfectly complementary to the mRNA sequence of the caveolin, but also can bind to the caveolin mRNA to form a duplex. It also includes sequences.
본 발명에 있어서, siRNA의 길이는 일반적으로 40 bp 이하이고, 바람직하게는 30 bp 이하이며, 보다 바람직하게는 25 bp 이하이다. 한편, 본 발명의 siRNA의 길이의 바람직한 범위는 19-40 bp 이며, 보다 바람직하게는 19-30 bp 이고, 가장 바람직하게는 19-25 bp 이다.In the present invention, the length of siRNA is generally 40 bp or less, preferably 30 bp or less, and more preferably 25 bp or less. On the other hand, the preferred length of the siRNA of the present invention is 19-40 bp, more preferably 19-30 bp, most preferably 19-25 bp.
본 발명의 바람직한 구현예에 따르면, 상기 siRNA는 서열목록 제 1 서열 또는 제 2 서열의 뉴클레오타이드 서열을 포함하는 카베올린의 mRNA의 일부 서열에 결합하는 것이며, 보다 바람직하게는 서열목록 제 1 서열을 포함하는 카베올린의 mRNA의 일부 서열에 결합하여 이중체를 형성하는 것이다.According to a preferred embodiment of the present invention, the siRNA binds to a partial sequence of the mRNA of the caveolin comprising the nucleotide sequence of the first or second sequence listing sequence, and more preferably comprises the first listing sequence sequence. To bind to some sequences of the mRNA of the caveolin to form a duplex.
본 발명의 바람직한 구현예에 따르면, 본 발명의 siRNA는 (a) 서열목록 제 3 서열의 뉴클레오타이드 서열 및 그에 상보적인 뉴클레오타이드 서열; 또는 (b) 서열목록 제 4 서열의 뉴클레오타이드 서열 및 그에 상보적인 뉴클레오타이드 서열을 포함하는 이중-가닥 siRNA 이며, 보다 바람직하게는 서열목록 제 3 서열의 뉴클레오타이드 서열 및 그에 상보적인 뉴클레오타이드 서열을 포함하는 이중-가닥 siRNA 이다.According to a preferred embodiment of the present invention, siRNA of the present invention comprises (a) the nucleotide sequence of SEQ ID NO: 3 sequence and the nucleotide sequence complementary thereto; Or (b) a double-stranded siRNA comprising a nucleotide sequence of SEQ ID NO: 4 and a nucleotide sequence complementary thereto, and more preferably a double-strand comprising a nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence complementary thereto It is strand siRNA.
본 발명에 있어서, siRNA의 세포 내로의 도입은 미세 주입법 (Capecchi, M.R., Cell, 22:479(1980)), 칼슘 포스페이트 공동-침전법 (Graham, F.L. et al., Virology, 52:456(1973)), 전기 천공법 (Neumann, E. et al., EMBO J., 1:841(1982)) 및 리포좀 이용법 (Wong, T.K. et al., Gene, 10:87(1980)) 등을 이용하여 실시할 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the incorporation of siRNA into cells is characterized by microinjection (Capecchi, MR, Cell , 22: 479 (1980)), calcium phosphate co-precipitation (Graham, FL et al., Virology , 52: 456 (1973) ), Electroporation (Neumann, E. et al., EMBO J. , 1: 841 (1982)) and liposomes (Wong, TK et al., Gene , 10:87 (1980)) It may be carried out, but is not limited thereto.
본 발명에 있어서, 세포는 동물세포, 바람직하게는 포유동물 세포, 보다 바람직하게는 인간의 세포를 의미한다.In the present invention, a cell refers to an animal cell, preferably a mammalian cell, more preferably a human cell.
본 발명의 다른 양태에 따르면, 본 발명은 카베올린의 mRNA에 상보적인 서열을 갖으며 상기 mRNA에 결합하여 카베올린 단백질의 발현을 억제하는 이중-가닥 siRNA (small interfering RNA)를 제공한다.According to another aspect of the present invention, the present invention provides a double-stranded siRNA (small interfering RNA) having a sequence complementary to the mRNA of the caveolin and binds to the mRNA to inhibit the expression of the caveolin protein.
상술한 본 발명의 방법은 본 발명의 siRNA를 이용하기 때문에, 서로 중복된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.Since the above-described method of the present invention uses the siRNA of the present invention, the overlapping contents are omitted in order to avoid excessive complexity of the present specification.
본 발명의 siRNA는 변형된 뉴클레오타이드로 이루어질 수도 있다. 예컨대, 2'-O-알킬 (예: 메틸, 에틸), 2'-O-알릴, 2'-O-알릴과 같은 2'-치환된 라이보스를 포함하는 뉴클레오타이드를 부분적으로 또는 전체적으로 포함할 수 있다. 또한, 치환된 염기를 갖는 뉴클레오타이드를 부분적으로 또는 전체적으로 포함할 수도 있다.The siRNA of the invention may also consist of modified nucleotides. Nucleotides, including, for example, 2'-substituted ribose, such as 2'-0-alkyl (e.g. methyl, ethyl), 2'-0-allyl, 2'-0-allyl; have. It may also comprise partially or wholly nucleotides with substituted bases.
바람직하게는, 본 발명의 이중-가닥 siRNA는 추가적인 뉴클레오타이드를 3'- 말단에 포함할 수 있으며, 이는 오버행잉 (overhanging) 부위를 형성한다. 이러 한 오버행잉 부위는 쌍을 이루지 않는 2개의 뉴클레오타이드로 구성된다. 보다 바람직하게는, 오버행잉 부위는 카베올린 mRNA와 상보적인 것이 바람직하다. 오버행잉 부위에 위치하는 뉴클레오타이드는 리보뉴클레오타이드 및 디옥시리보뉴클레오타이드 모두 가능하며, 바람직하게는 디옥시리보뉴클레오타이드이고. 가장 바람직하게는 상기 오보행잉 부위는 2개의 티미딘 디옥시뉴클레오타이드로 구성된다. 구체적인 실시예로서, 카베올린 mRNA의 타깃 서열을 서열목록 제 1 서열의 5'-말단에 AA가 추가적으로 있는 서열을 선택한 경우, 본 발명의 siRNA는5'-CCAGAAGGGACACACAGUUdTdT-3' 및 5'-AACUGUGUGUCCCUUCUGGdTdT-3'으로 구성되는 것이 가장 바람직하다. 또 다른 구체적인 실시예로서, 카베올린 mRNA의 타깃 서열을 서열목록 제 2 서열의 5'-말단에 AA가 추가적으로 있는 서열을 선택한 경우, 본 발명의 siRNA는 5'-CAUCUACAAGCCCAACAACdTdT-3' 및 5'-GUUGUUGGGCUUGUAGAUGdTdT-3'으로 구성되는 것이 가장 바람직하다.Preferably, the double-stranded siRNA of the present invention may comprise additional nucleotides at the 3'-terminus, which form an overhanging site. This overhanging site consists of two unpaired nucleotides. More preferably, the overhanging site is complementary to the carveolin mRNA. The nucleotides located in the overhanging site are both ribonucleotides and deoxyribonucleotides, preferably deoxyribonucleotides. Most preferably said misleading site consists of two thymidine deoxynucleotides. As a specific example, when the target sequence of the carveolin mRNA is selected to include AA additionally at the 5'-end of the first sequence of the sequence listing, the siRNAs of the present invention are 5'-CCAGAAGGGACACACAGUUdTdT-3 'and 5'-AACUGUGUGUCCCUUCUGGdTdT- Most preferably composed of 3 '. In another specific embodiment, when the target sequence of the caveolin mRNA is selected with an additional AA at the 5'-end of the second sequence, the siRNA of the present invention is 5'-CAUCUACAAGCCCAACAACdTdT-3 'and 5'- Most preferably, GUUGUUGGGCUUGUAGAUGdTdT-3 '.
본 발명의 또 다른 양태에 따르면, 본 발명은 카베올린의 mRNA에 상보적인 서열을 갖으며 상기 mRNA에 결합하여 카베올린 단백질의 발현을 억제하는 이중-가닥 siRNA (small interfering RNA)를 포함하는 노화세포의 생물학적 기능 회복용 조성물을 제공한다.According to another embodiment of the present invention, the present invention has a senescent cell having a sequence complementary to the mRNA of the caveolin and comprises a double-stranded siRNA (small interfering RNA) that binds to the mRNA and inhibits expression of the caveolin protein. It provides a composition for restoring a biological function of.
본 발명의 조성물 및 상술한 본 발명의 방법 가운데, 중복된 내용은 본 명세서의 복잡성을 피하기 위하여 그 기재를 생략한다.In the composition of the present invention and the above-described method of the present invention, the overlapping content is omitted to avoid the complexity of the present specification.
본 발명의 조성물은 연구용 조성물로서 제조될 수 있으나, 약제학적 조성물 로도 제조될 수 있다. 본 발명의 조성물이 약제학적 조성물로 제조되는 경우에는, siRNA 이외에 약제학으로 허용되는 담체도 포함한다. 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. The composition of the present invention may be prepared as a research composition, but may also be prepared as a pharmaceutical composition. When the composition of the present invention is prepared as a pharmaceutical composition, it includes a pharmaceutically acceptable carrier in addition to siRNA. Pharmaceutically acceptable carriers included in pharmaceutical compositions are conventionally used in the preparation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, Microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like. . In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.The pharmaceutical compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or an aqueous medium, or may be in the form of extracts, powders, granules, tablets or capsules, and may further include a dispersant or stabilizer.
적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed., 1995)에 상세히 기재되어 있다.Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 정맥내 주입, 피하 주입, 근육 주입, 복강 주입, 경피 투여 등으로 투여할 수 있다. 바람직한 투여 형태는 전신 투여인 정맥내 주입, 피하 주입, 근육 주입, 복강 주입 또는 경피 투여이다.The pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, it may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, or the like. Preferred dosage forms are systemic administration, intravenous, subcutaneous, intramuscular, intraperitoneal, or transdermal.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 소망하는 치료 또는 예방에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다. 본 발명의 바람직한 구현예에 따르면, 본 발명의 약제학적 조성물의 단위 투여량은 50-200 nM 의 siRNA 전신 또는 국부 농도가 달성되도록 투여하는 것이다. Suitable dosages of the pharmaceutical compositions of the invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, condition of food, time of administration, route of administration, rate of excretion and response to reaction, Usually a skilled practitioner can easily determine and prescribe a dosage effective for the desired treatment or prophylaxis. According to a preferred embodiment of the present invention, the unit dose of the pharmaceutical composition of the present invention is administered so that siRNA systemic or local concentration of 50-200 nM is achieved.
본 발명의 조성물에 의해 노화 세포의 생물학적 기능이 회복되어 젊은 세포와 유사한 생물학적 현상을 나타낸다. 예를 들어, 본 발명의 조성물에 의해 처리된 노화 세포는 EGF와 같은 성장인자에 대한 반응성이 회복되어 성장인자에 의한 신호 전달이 회복되며, 세포순환 (cell cycle)이 정상적으로 가동하게 된다.The biological function of senescent cells is restored by the composition of the present invention, showing a biological phenomenon similar to young cells. For example, the senescent cells treated with the composition of the present invention are responsive to growth factors such as EGF to restore signal transmission by the growth factors, and the cell cycle is normally operated.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시 예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it is to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. Will be self-evident.
실시예Example
시약 reagent
인간 이배체 섬유아세포는 신생아의 표피로부터 분리되었다 ( Park, S. C., et, al., (1999) J. Gerontol. 54, B78-B83). 모노클론 항-카베올린-1 항체 (C43420), 모노클론 항-카베올린-2 항체 (C57820) 및 모노클론 항-카베올린-3 항체 (C38320)는 Transduction Laboratories로부터 구입하였다. 폴리클로날 항-EGFR 항체 (sc-03), 폴리클로날 항-포스포-Erk 항체 (sc-7383), 폴리클로날 항-Erk1/2 항체 (sc-94), 항-p53 항체 (sc-126) 및 항-p21 항체 (sc-6246)는 Santa Cruz Biotechnology, Inc.로부터 구입하였다. 2차 호스래디쉬 퍼옥시다아제-접합 항-토끼 및 항-마우스 항체는 Jackson Immunochemicals로부터 구입하였다. 그 밖의 다른 생화학 시약들은 Sigma 및 Life Technologies, Inc.로부터 구입하였다.Human diploid fibroblasts were isolated from the epidermis of newborns (Park, SC, et, al., (1999) J. Gerontol. 54, B78-B83). Monoclonal anti-caberoline-1 antibody (C43420), monoclonal anti-caberoline-2 antibody (C57820) and monoclonal anti-caberoline-3 antibody (C38320) were purchased from Transduction Laboratories. Polyclonal anti-EGFR antibody (sc-03), polyclonal anti-phospho-Erk antibody (sc-7383), polyclonal anti-Erk1 / 2 antibody (sc-94), anti-p53 antibody (sc -126) and anti-p21 antibody (sc-6246) were purchased from Santa Cruz Biotechnology, Inc. Secondary horseradish peroxidase-conjugated anti-rabbit and anti-mouse antibodies were purchased from Jackson Immunochemicals. Other biochemical reagents were purchased from Sigma and Life Technologies, Inc.
실시예 1: 세포 배양Example 1: Cell Culture
인간 이배체 섬유아세포는 10% 태아 소혈청 (fetal bovine serum) 및 항생제가 첨가된 DMEM 배지 (Dulbecco's modified Eagle medium)내에서 10 ㎝ 플레이트에서 유지되었고 1:4로 계대 배양을 실시하였다. 본 발명자들은 젊은 세포는 25 파퓰레이션 더블링 (population doubling)이하의 세포, 늙은 세포는 60 파퓰레이션 더블링이상의 세포로 정의하였다. 모든 늙은 세포의 세포노화는 지연된 집단배가시간 및 Dimri 등의 방법 (Dimri GP. et al., Proc. Natl. Acad. Sci., 92:9363-9367(1995))에 따라 노화-연관된 β-갈락토시다아제 활성 분석에 의해 확인되었다. 반-콘플루언트 상태 (semi-confluent state)로 배양된 후, 노화-연관된 β-갈락토시다아제 (pH 6.0) 활성을 실험하였다. 요컨대, 세포를 PBS으로 세척하고 PBS내의 0.2% 글루타알데히드를 포함하는 2% 포름알데히드로 실온에서 5 분간 고정하였 다. 세포를 PBS으로 세척한 후, 세포를 β-갈락토시다아제 시약 (1 ㎎/㎖의 X-Gal, 40 mM 시트르산/소듐 포스페이트 버퍼, pH 6.0, 5 mM 포타슘 페로시아니드/포타슘 페리시아니드, 150 mM NaCl 및 2 mM MgCl2)과 37℃에서 반응시켰다.Human diploid fibroblasts were maintained in 10 cm plates in DMEMbe's modified Eagle medium with 10% fetal bovine serum and antibiotics and passaged 1: 4. The present inventors defined the young cells as less than 25 population doubling, the old cells as 60 cells or more. Cell senescence of all old cells was aged-associated β-gal according to delayed population doubling time and Dimri et al. (Dimri GP. Et al., Proc. Natl. Acad. Sci. , 92: 9363-9367 (1995)). It was confirmed by lactosidase activity assay. After incubation in a semi-confluent state, aging-related β-galactosidase (pH 6.0) activity was tested. In short, the cells were washed with PBS and fixed for 5 minutes at room temperature with 2% formaldehyde containing 0.2% glutaaldehyde in PBS. After washing the cells with PBS, cells were washed with β-galactosidase reagent (1 mg / ml X-Gal, 40 mM citric acid / sodium phosphate buffer, pH 6.0, 5 mM potassium ferrocyanide / potassium ferricyanide, 150 mM NaCl and 2 mM MgCl 2 ) were reacted at 37 ° C.
실시예 2: 안티센스 올리고뉴클레오티느 및 siRNA에 의한 카베올린-1의 하향-조절Example 2: Down-regulation of Cabolin-1 by Antisense Oligonucleotides and siRNAs
HDF 세포를 100 ㎜ 디쉬당 1 x 106 세포의 밀도로 접종하였다. 24 시간 후, 100 nM 안티센스 카베올린-1 올리고뉴클레오타이드 (TTTGCCCCCAGACAT; 인간 카베올린-1의 15-염기 초기 서열과 상보적)로 LipofectAMINE PLUS (Life technologies, Inc.)를 이용하여 HDF 세포를 형질감염하였다. 3 시간 후, 배지를 따라내고 완전 DMEM 배지로 교환하였다. 카베올린-1의 15-염기 초기 서열에 상응하는 센스-카베올린-1 올리고뉴클레오타이드 (ATGTCTGGGGGCAAA)를 대조구로 사용하였다 (Gille, R., et, all., (1992) Nature 358, 414-417). 모니터링을 목적으로, 본 발명자들은 올리고뉴클레오타이드의 N-말단에 FITC를 접합하였다.HDF cells were seeded at a density of 1 × 10 6 cells per 100 mm dish. After 24 hours, HDF cells were transfected with LipofectAMINE PLUS (Life technologies, Inc.) with 100 nM antisense carveolin-1 oligonucleotide (TTTGCCCCCAGACAT; complementary to the 15-base initial sequence of human caveolin-1). . After 3 hours, the medium was decanted and replaced with complete DMEM medium. Sense-caberoline-1 oligonucleotide (ATGTCTGGGGGCAAA) corresponding to the 15-base initial sequence of caveolin-1 was used as a control (Gille, R., et, all., (1992) Nature 358, 414-417) . For monitoring purposes, we conjugated the FITC to the N-terminus of the oligonucleotide.
인간 카베올린-1 mRNA를 표적으로 하도록 이중-가닥 siRNA 분자를 디자인하였다. 21-뉴클레오타이드 siRNA를 Dharmacon Research (Lafayette, CO)에 의뢰하여 제작하였으며, 상기 siRNA는 이중사슬 구조로서, 2'-OH는 비보호되고, 탈염되고, 순수 분리된 siRNA였다. 본 발명자들은 카베올린-1 mRNA의 5 부위를 표적으로 하였다. 표적 서열 C1은 AACACCUCAACGAUGACGUGG, C2는 AACCAGAAGGGACACACAGUU, C3은 AAUACUGGUUUUACCGCUUGC, C4는 AACAGGGCAACAUCUACAAGC 그리고 C5는 AACAUCUACAAGCCCAACAAC이다. GL2 루시퍼라아제 올리고뉴클레오타이드를 음성 대조구 (negative control)로 사용하였다. 노화 HDF 세포를 10-㎝ 플레이트에서 40% 콘플루언스까지 배양하고, 제조자의 사용 방법에 따라 올리고펙타민 (Invitrogen)을 사용하여 6 시간 동안 서냉복원된 (annealed) siRNAs (각각 0.5 nmole)로 형질감염시켰다. 30%의 태아 소혈청 및 3%의 페니실린-스트렙토마이신을 포함하는 DMEM를 각각의 디쉬에 첨가하여 최종 농도가 태아 소혈청 10% 및 페니실린-스트렙토마이신1%가 되도록 하였다. 추가적인 분석을 위하여 세포를 48 시간 후에 회수하였다.Double-stranded siRNA molecules were designed to target human caveolin-1 mRNA. 21-nucleotide siRNA was prepared by Dharmacon Research (Lafayette, Co.), wherein the siRNA was a double-chain structure, 2′-OH was an unprotected, desalted, purely isolated siRNA. We targeted 5 sites of carveolin-1 mRNA. Target sequence C1 is AACACCUCAACGAUGACGUGG, C2 is AACCAGAAGGGACACACAGUU, C3 is AAUACUGGUUUUACCGCUUGC, C4 is AACAGGGCAACAUCUACAAGC and C5 is AACAUCUACAAGCCCAACAAC. GL2 luciferase oligonucleotide was used as a negative control. Aging HDF cells were incubated in 10-cm plates up to 40% confluence and transfected with annealed siRNAs (0.5 nmole each) for 6 hours using oligofectamine (Invitrogen) according to the manufacturer's instructions. Infected. DMEM containing 30% fetal bovine serum and 3% penicillin-streptomycin was added to each dish so that the final concentration was 10% fetal bovine serum and 1% penicillin-streptomycin. Cells were harvested after 48 hours for further analysis.
실시예 4: 웨스턴 블롯 및 Erk 활성화 분석Example 4: Western Blot and Erk Activation Assay
세포 추출물을 SDS-폴리아크릴아미드 겔 전기영동으로 분리하고 표준적인 기술을 사용하여 니트로셀루로즈 필터 (Protran; Schleicher & Schuell)로 이동시켰다. 다음의 항체들이 사용되었다: 마우스 모노클론 항-카베올린-1 (Trans Labs), 마우스 모노클론 항-pErk (Santa Cruz), 토끼 폴리클론 항-Erk (Santa Cruz), 토끼 폴리클론 항-p-Elk (Cell Signaling Tech.), 토끼 폴리클론 항-Erk (Cell Signaling Tech.), 토끼 폴리클론 항-EGFR (Santa Cruz), 염소 폴리클론 항-액틴 (Santa Cruz), 마우스 모노클론 항-p53 (Santa Cruz) 및 마우스 모노클론 항-p21 (Oncogene). 면역 복합체를 퍼옥시다아제-접합 항-마우스 또는 항-토끼 이차 항체와 반응시키고 최종적으로 향상된 화학발광 검출 키트 (ECL kit; Amersham Phamacia Biotech)을 사용하여 시각화하였다.Cell extracts were separated by SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose filters (Protran; Schleicher & Schuell) using standard techniques. The following antibodies were used: mouse monoclonal anti-caberoline-1 (Trans Labs), mouse monoclonal anti-pErk (Santa Cruz), rabbit polyclonal anti-Erk (Santa Cruz), rabbit polyclonal anti-p- Elk (Cell Signaling Tech.), Rabbit polyclonal anti-Erk (Cell Signaling Tech.), Rabbit polyclonal anti-EGFR (Santa Cruz), goat polyclonal anti-actin (Santa Cruz), mouse monoclonal anti-p53 ( Santa Cruz) and mouse monoclonal anti-p21 (Oncogene). Immune complexes were reacted with peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies and finally visualized using an enhanced chemiluminescence detection kit (ECL kit; Amersham Phamacia Biotech).
실시예 5: 전자 현미경 분석Example 5: Electron Microscopy Analysis
센스 및 안티센스 올리고뉴클레오타이드-처리된 노화 HDF를 펠렛화 (pelletized)하고 3% 글루타알데히드/PBS(pH 7.4)로 고정하였다. 0.2 M의 소듐 카코딜레이트 버퍼(pH 7.4)로 세척한 후, 세포 펠렛을 카코딜레이트 버퍼내의 1% 오스뮴 테트르옥시드으로 1 시간 동안 처리하였다. 그 다음, 세포를 프로필렌 옥시드을 통하여 등급 에탄올에서 탈수하고 에폭시 수지 (Polyscience Co.)에 묻었다. 초박 시편 (ultrathin section)을 잘라내고 우라닐 아세테이트 및 리드 시트레이트로 염색하였다. 시편을 투과 전자 현미경 (H-600, Hitachi)으로 관찰하였다.Sense and antisense oligonucleotide-treated aging HDFs were pelleted and fixed with 3% glutaraldehyde / PBS pH 7.4. After washing with 0.2 M sodium cacodylate buffer (pH 7.4), the cell pellet was treated with 1% osmium tetroxide in cacodylate buffer for 1 hour. Cells were then dehydrated in grade ethanol through propylene oxide and buried in epoxy resin (Polyscience Co.). Ultrathin sections were cut out and stained with uranyl acetate and lead citrate. Specimens were observed by transmission electron microscopy (H-600, Hitachi).
실시예 6: 서브세포 분할 (Subcellular fractionation)Example 6 Subcellular Fractionation
핵 및 세포형질 추출물을 제조하기 위하여, 1-2 x 108 세포를 트립신으로 회수하고, 칼슘-결핍 PBS으로 3 회 세척하며, 10 mM Tris pH 7.4, 2 mM MgCl2, 1mM PMSF 및 프로테아제 억제제를 함유하는 버퍼에 2.5 x 108 세포/㎖로 재현탁하였다. 재현탁된 세포를 실온에서 1 분 배양한 다음, 얼음에 있는 튜브로 옮겨 5 분 동안 보관하였다. Triton X-100를 최종 농도가 0.5% 되도록 첨가하고 재현탁된 세포를 얼음에서 5 분간 반응시켰다. 세포 분해질을 260-게이지 바늘을 통하여 수 개의 패시지 (passage)에 의해 분리하고 위상차 현미경으로 시험하였다. SS-34 로터를 사용하여 Sorvall RC-5B 원심분리기로 300 x g, 4℃에서 10 분간 원심분리하여 핵을 세포질로부터 분리하였다. 분리된 핵을 10 ㎖의 버퍼로 세척하고 20 mM Hepes(pH 7.9), 0.42 M NaCl, 1.5 mM MgCl2, 25% (v/v) 글리세롤, 0.2 mM EDTA, 0.5 mM 디티오스레이톨 및 프로테아제 억제제를 포함하는 핵 추출 버퍼에 재현탁하였다. 핵 단백질을 추출하기 위하여 재현탁된 핵을 간헐적으로 흔들어 주며 얼음 위에서 30 분 동안 배양하고 최종적으로 마이크로원심분리기로 5 분 동안 회전 침전시켰다.To prepare nuclear and cytoplasmic extracts, 1-2 × 10 8 cells were recovered with trypsin, washed three times with calcium-deficient PBS, and 10 mM Tris pH 7.4, 2 mM MgCl 2 , 1 mM PMSF and protease inhibitors. Resuspend in 2.5 × 10 8 cells / ml in the containing buffer. The resuspended cells were incubated for 1 minute at room temperature and then transferred to a tube on ice and stored for 5 minutes. Triton X-100 was added to a final concentration of 0.5% and the resuspended cells were allowed to react on ice for 5 minutes. Cell lysates were separated by several passages through a 260-gauge needle and tested by phase contrast microscopy. Nuclei were separated from the cytoplasm by centrifugation at 300 × g, 4 ° C. for 10 minutes using a Sorvall RC-5B centrifuge using an SS-34 rotor. The isolated nuclei were washed with 10 ml of buffer and washed with 20 mM Hepes (pH 7.9), 0.42 M NaCl, 1.5 mM MgCl 2 , 25% (v / v) glycerol, 0.2 mM EDTA, 0.5 mM dithiostolitol and protease inhibitors. Resuspend in a nuclear extraction buffer containing. In order to extract the nuclear protein, the resuspended nuclei were incubated for 30 minutes on ice with intermittent shaking and finally spun down for 5 minutes with a microcentrifuge.
실시예 8: 면역세포화학 및 정량Example 8: Immunocytochemistry and Quantitation
각각의 형질감염된 노화 HDF를 24-웰 플레이트내의 커버슬립 상에서 배양하였고, EGF 및 BrdUrD로 24 시간 처리하였다. 배양물은 Lim의 문헌에 개시된 방법에 따라 면역세포화학을 위하여 처리되었다 (Lim, I.K., et al., (2000) Mech Ageing Dev 119, 113-30). 다음의 항체가 사용되었다: BrdUrd (1:100, 마우스, Roche), p-Elk (1:200, 토끼; Cell Signaling Technology, Inc), 카베올린-1 (1:500, 토끼; Trans Lab.), 팔로이딘 (1:1000; Molecular Probes) 및 4,6-디아미디노-2-페닐인돌 (DAPI) (1:1000; Sigma). 검출은 각각의 채널에 대해 개개의 필터세트로, ×40 배율에서 Bio-Rad 콘포칼 시스템으로 실시되었으며, 이미지는 Adobe Photoshop으로 조립되었다.Each transfected aging HDF was incubated on coverslips in 24-well plates and treated with EGF and BrdUrD for 24 hours. Cultures were processed for immunocytochemistry according to the method disclosed in Lim's literature (Lim, I.K., et al., (2000) Mech Ageing Dev 119, 113-30). The following antibodies were used: BrdUrd (1: 100, mouse, Roche), p-Elk (1: 200, rabbit; Cell Signaling Technology, Inc), caveolin-1 (1: 500, rabbit; Trans Lab.) , Paloidine (1: 1000; Molecular Probes) and 4,6-diimidino-2-phenylindole (DAPI) (1: 1000; Sigma). Detection was performed with a Bio-Rad confocal system at x40 magnification, with a separate set of filters for each channel, and images were assembled in Adobe Photoshop.
형광-표지된 세포는 콘포갈 현미경에 의해 시각화되었다. 양성 세포 (positive cell)는 병행 실시된 3 벌의 독립적인 실험으로부터 커버슬립을 가로질러 최소 10 필드 (field)에서 정량화 되었다. 통계 분석은 Microsoft Excel을 이용하여 실시하였다.Fluorescently-labeled cells were visualized by confogal microscopy. Positive cells were quantified in at least 10 fields across coverslips from 3 sets of independent experiments conducted in parallel. Statistical analysis was performed using Microsoft Excel.
실시예 결과Example Results
카베올린 발현의 하향 조절Down-regulation of Caberoline Expression
노화 HDF 세포는 카베올린을 고발현하였으며, EGF 자극에 대한 반응성이 감소하였다. 젊은 세포에서 카베올린-1의 과발현이 Erk 인산화를 감소시킨다는 것은 보고된 바 있다 (Park, W.Y., et al., (2000) J Biol Chem 275, 20847-52). 따라서, 본 발명자들은 노화세포에서 카베올린의 신호전달 저하 효과가 일차적으로 EGF 자극에 대한 노화세포의 저반응성과 관련이 있으며, 이들 세포에서 카베올린-1 수준의 조절은 Erk의 신호전달 효과를 변형시킬 수 있다고 추론하였다.Aging HDF cells expressed caveolin high and decreased responsiveness to EGF stimulation. It has been reported that overexpression of carveolin-1 in young cells reduces Erk phosphorylation (Park, WY, et al., (2000) J Biol Chem 275, 20847-52). Thus, the present inventors have found that the effect of caveolin signaling in senescent cells is primarily related to the low reactivity of senescent cells to EGF stimulation, and the regulation of caveolin-1 levels in these cells modifies the signaling effect of Erk. Inferred that it can be made.
노화세포에서 세포내의 카베올린 수준을 조절하기 위하여, 인간 카베올린의 15-염기 초기 서열과 상보적인 안티센스 올리고뉴클레오타이드 (AS-ON)를 제조하였으며, 15-염기 초기 서열에 상응하는 센스 올리고뉴클레오타이드 (S-ON)를 대조구로 사용하였다 (Gille, R., et, al., (1992) Nature 358, 414-417). 올리고뉴클레오타이드의 효능을 모니터하기 위하여, 접합된 형광성 올리고뉴클레오타이드를 사용하였다.To regulate intracellular caveolin levels in senescent cells, antisense oligonucleotides (AS-ON) complementary to the 15-base initial sequence of human caveolin were prepared and sense oligonucleotides corresponding to the 15-base initial sequence (S). -ON) was used as a control (Gille, R., et, al., (1992) Nature 358, 414-417). To monitor the efficacy of the oligonucleotides, conjugated fluorescent oligonucleotides were used.
본 발명자들은 노화세포에서 카베올린-1의 발현이 비정상적으로 높고, 카베올린-1은 대부분 노화 HDF 세포의 막 도메인에 위치하고 있다는 것을 확인하였다. 안티센스 올리고뉴클레오타이드의 효과를 동정하기 위하여, 본 발명자들은 면역세포화학 및 웨스턴 블롯으로 도스(dose) 반응성을 실험하였다. 센스 및 안티센스 올리고뉴클레오타이드는 Lipofectamine 시약의 존재 하에서 노화 HDF 세포 안으로 효과적으로 투과할 수 있었다. 흥미롭게도, 카베올린-1의 안티센스 올리고뉴클레오타이드는 핵에 위치하였고, 노화 HDF 세포에서 카베올린-1의 발현 수준을 억제할 수 있었던 반면, 센스 올리고뉴클레오타이드는 주로 세포질에 위치하였고 아무런 효과를 보이지 않았다. 카베올린-1의 발현은 노화세포에서 안티센스 올리고뉴클레오타이드에 의해 도스-의존적으로 감소하였다 (도 1). 따라서, 카베올린-1의 발현은 노화 HDF에서 AS-ON에 의해 상당히 감소하는 것을 알 수 있었다.The inventors confirmed that the expression of caveolin-1 in senescent cells is abnormally high, and that caveolin-1 is mostly located in the membrane domain of senescent HDF cells. To identify the effect of antisense oligonucleotides, we tested dose reactivity with immunocytochemistry and Western blot. Sense and antisense oligonucleotides could effectively penetrate into senescent HDF cells in the presence of Lipofectamine reagent. Interestingly, the antisense oligonucleotides of carveolin-1 were located in the nucleus and were able to inhibit the expression levels of carveolin-1 in sensitized HDF cells, while the sense oligonucleotides were mainly located in the cytoplasm and showed no effect. Expression of carveolin-1 was dose-dependently reduced by antisense oligonucleotides in senescent cells (FIG. 1). Thus, it was found that the expression of Cabolin-1 is significantly reduced by AS-ON in aging HDF.
카베올라 구조의 주요 구성 성분인 카베올린-1은 노화 HDF에서 카베올라 구조를 형성한다. 노화 HDF (S-ON 형질감염된 세포)의 플라즈마렘말 프로파일 (plasmalemmal profile)에 대한 전자 현미경 실험은 50-100 ㎚ 직경의 다수의 비-클래트린-코팅된 소낭 구조의 존재를 밝혀내었으며 이것들은 세포질막에 나란히 놓여 있었으며, 형태적으로 카베올라와 구별할 수 없었다 (도 2a). 대조적으로 AS-ON 형질감염된 세포의 프로파일은 카베올라-유사 구조를 거의 포함하고 있지 않았다. 다중 플라즈마렘말 프로파일의 정량 분석은 AS-ON 처리된 노화 HDF 세포는 S-ON 처리된 노화 HDF 세포보다 카베올라-유사 구조를 5배 덜 포함하지 않는 것을 보여주었다 (도 2b). 이 결과들로부터 카베올린-1에 대한 안티센스 올리고뉴클레오타이드는 노화 HDF에서 카베올린의 감소 뿐 만 아니라 카베올라 구조의 억제에도 작용한다는 것을 알 수 있었다.Carbenium main constituent of carbenium De -1 up of the structure forms a carbenium come la structure in aging HDF. Electron microscopy of the plasmalemmal profile of senescent HDFs (S-ON transfected cells) revealed the presence of multiple, non-clatrin-coated follicular structures of 50-100 nm diameter and these were cytoplasmic. side by side was laid on the film, morphologically could not be differentiated from all carbenium la (Fig. 2a). In contrast, profiles of the AS-ON transfected cells are carbenium come la - did not substantially contain a similar structure. Quantitative analysis of multiple plasmarema profiles showed that AS-ON treated senescent HDF cells contained 5 times less kaveola-like structure than S-ON treated aging HDF cells (FIG. 2B). These results indicate that antisense oligonucleotides against carveolin-1 act not only on the reduction of carveol in sensitized HDF but also on the inhibition of the caveola structure.
AS-ON 효과의 특이성을 확증하기 위하여, 본 발명자들은 카베올린-1에 대한 5 siRNA을 디자인하고 이들의 효능을 시험하였다. 도 4a에 나타나 있는 것처럼, 카베올린-1에 대한 siRNA의 C2 및 C5는 대조구에 비하여 노화 HDF에서 카베올린-1의 수준을 상당히 감소시켰다. 추가적인 실험을 위하여, 본 발명자들은 C2 siRNA를 사용하였고 본 발명자들은 siRNA 효과가 72 시간 지속될 수 있는 것을 관찰하였다 (도 4b).To confirm the specificity of the AS-ON effect, we designed 5 siRNAs for Cabolin-1 and tested their efficacy. As shown in FIG. 4A, C2 and C5 of siRNA against Cabolin-1 significantly reduced the levels of Cabolin-1 in aging HDF compared to the control. For further experiments, we used C2 siRNA and we observed that the siRNA effect could last 72 hours (FIG. 4B).
노화 HDF 세포에서 하류 신호전달 캐스케이드의 회복Recovery of Downstream Signaling Cascade in Aging HDF Cells
세포질에서 상승된 p-Erk 수준에도 불구하고, 노화 HDF에서는 EGF 자극에 대해 p-Erk의 이동 및 Elk의 인산화가 일어나지 않았다 (Lim, I.K., et, al., (2001) Ann N Y Acad Sci 928, 176-81. Review, Tresin, I.M., et, al., (2001) Exp Cell Res 269, 287-300). 그러나, EGFR 및 Erk의 발현 수준은 젊은 HDF 및 노화 HDF에서 크게 차이가 나지 않았다 (도 3a). p-Erk의 높은 기본적인 수준에도 불구하고, 노화 HDF에서는 EGF 자극에 대해 유사분열 반응이 관찰되지 않았다 (도 3b). 노화 세포에서 카베올린-1 수준의 조절 결과로서, 기본적인 p-Erk가 AS-ON 처리에 의해 감소한 반면, S-ON 처리에 의해서는 감소하지 않았다 (도 3c). 추가적으로 본 발명자들은 노화 HDF에서 카베올린-1 수준을 조절하여 EGF 자극에 대한 반응에서 Erk 시스템의 기능적인 회복을 시험하였다. S-ON 처리된 노화 HDF에서 EGF 자극에 의한 Erk 인산화의 수준은 크게 변화하지 않는 것으로 관찰된 반면, AS-ON 처리된 노화 HDF에서 Erk 활성화가 다시 시작되었으며, 이것은 젊은 세 포에서 관찰되는 것과 유사한 것이었다 (도 3d). AS-ON을 사용한 카베올린-1의 하향-조절에 의한 Erk 활성화의 회복을 확증하기 위하여, 본 발명자들은 siRNA을 사용하였다. 대조구-형질전환된 노화 HDF에서는 EGF 자극에 의한 Erk 인산화의 수준은 크게 변화하지 않는 것으로 관찰된 반면, C2-형질전환된 노화 HDF에서는 Erk 활성화가 다시 시작되었다 (도 4c). 따라서 이들 자료는 노화 HDF에서 EGF 신호 전달의 회복은 siRNA 및 안티센스 올리고뉴클레오타이드에 의한 카베올린-1 발현 수준의 감소에 기인하였다는 것을 보여준다.Despite elevated p-Erk levels in the cytoplasm, p-Erk migration and Elk phosphorylation did not occur in EGF stimulation in senescent HDF (Lim, IK, et, al., (2001) Ann NY Acad Sci 928, 176-81.Review, Tresin, IM, et, al., (2001) Exp Cell Res 269, 287-300). However, expression levels of EGFR and Erk did not differ significantly between young HDF and aging HDF (FIG. 3A). Despite the high basic level of p-Erk, no mitotic response was observed for EGF stimulation in aged HDF (FIG. 3B). As a result of the regulation of carveolin-1 levels in senescent cells, the basic p-Erk was reduced by AS-ON treatment, while not by S-ON treatment (FIG. 3C). In addition, we tested the functional recovery of the Erk system in response to EGF stimulation by regulating carveolin-1 levels in aging HDF. The level of Erk phosphorylation by EGF stimulation in S-ON-treated aging HDF was observed not to change significantly, whereas Erk activation resumed in AS-ON-treated aging HDF, similar to that observed in young cells. (FIG. 3D). To confirm the recovery of Erk activation by down-regulation of Cabolin-1 using AS-ON, we used siRNA. In control-transformed aging HDF, the level of Erk phosphorylation by EGF stimulation was observed not to change significantly, whereas in the C2-transformed aging HDF, Erk activation resumed (FIG. 4C). Thus, these data show that the recovery of EGF signal transduction in senescent HDFs was due to a decrease in carveolin-1 expression levels by siRNA and antisense oligonucleotides.
활성화된 Erk는 핵 내로 이동하며 계속하여 전사인자 패밀리의 구성원을 포함하는 수 개의 표적 전사인자들을 활성화한다 (Tresin, I.M., et, al., (2001) Exp Cell Res 269, 287-300, Roa, V.N., et, al., B (1994) Genes Dev 8, 1502-1513, Gille, R., et, al., (1992) Nature 358, 414-417, Hill. C.S., et, al., (1993) Cell 73, 395-406). 세린-인산화된 Elk의 양이 노화 세포에서 감소된다는 것은 공지된 것이다 (Tresin, I.M., et, al., (2001) Exp Cell Res 269, 287-300). 따라서, 본 발명자의 실시예에서, 본 발명자들은 카베올린-감소된 노화 HDF 세포의 EGF에 대한 반응에서 Elk 활성화 모드를 살펴보았으며, 젊은 HDF 및 노화 HDF에서 서브세포 분할 (subcellular fractionation)에 의해 p-Erk 및 p-Elk의 기본적인 수준을 측정하였다. p-Erk의 고수준에도 불구하고, Elk는 핵 내에서 매우 약하게 인산화되어 있었고, 이것은 Elk가 노화 세포에서는 비활성화되어 있다는 것을 암시하였다 (도 5a). 이 결과를 확증하기 위하여, 본 발명자들은 젊은 HDF 및 노화 HDF에서 Erk 및 Elk의 인산화 상태를 측정하였고, EGF 자극이 젊은 HDF에서는 30 분 이내에 Elk를 강하게 인산화였으나, 노화 HDF에서는 약하게 인산화한다는 것을 확인하였다 (도 5b). 또한, 본 발명자들은 S-ON 또는 AS-ON 처리 후에, 노화 HDF에서의 EGF 자극에 대한 Elk 인산화를 실험하였다 (도 6). 흥미롭게도, 노화 HDF에 AS-ON을 처리한 경우 EGF-유도 Elk 인산화가 회복되었다. 다만, 부분적으로 그리고 천천히 단지 60 분 후에 최고 활성에 이르렀다. 더욱이, 면역세포화학 분석으로 Elk는 단지 젊은 HDF 및 AS-ON 처리된 노화 HDF에서 인산화가 되며, 노화 세포 및 S-0N 처리된 세포에서는 약하게 인산화되는 것을 확인하였다.Activated Erk migrates into the nucleus and continues to activate several target transcription factors, including members of the transcription factor family (Tresin, IM, et, al., (2001) Exp Cell Res 269, 287-300, Roa, VN, et, al., B (1994) Genes Dev 8 , 1502-1513, Gille, R., et, al., (1992) Nature 358, 414-417, Hill.CS, et, al., (1993 ) Cell 73, 395-406). It is known that the amount of serine-phosphorylated Elk is reduced in senescent cells (Tresin, IM, et, al., (2001) Exp Cell Res 269, 287-300). Thus, in our examples, we looked at Elk activation mode in response to EGF of caveolin-reduced senescent HDF cells, and by subcellular fractionation in young HDF and sensitized HDF Basic levels of -Erk and p-Elk were measured. Despite the high levels of p-Erk, Elk was very weakly phosphorylated in the nucleus, suggesting that Elk was inactivated in senescent cells (FIG. 5A). To confirm this result, we measured the phosphorylation status of Erk and Elk in young HDF and aging HDF and confirmed that EGF stimulation strongly phosphorylated Elk within 30 minutes in young HDF but weakly phosphorylated in aging HDF. (FIG. 5B). In addition, we tested Elk phosphorylation for EGF stimulation in sensitized HDF after S-ON or AS-ON treatment (FIG. 6). Interestingly, treatment of aging HDF with AS-ON recovered EGF-induced Elk phosphorylation. Only partially and slowly reached peak activity after only 60 minutes. Moreover, immunocytochemical analysis confirmed that Elk is phosphorylated only in young HDF and AS-ON treated aging HDF, and weakly phosphorylated in senescent cells and S-0N treated cells.
세포 순환 조절 시스템의 조절Regulation of the Cell Circulatory Regulatory System
복제상의 노화 (replicative senescence)는 생장인자의 자극에도 불구하고 비가역적인 생장의 정지를 의미하므로, 노화 세포에서 카베올린의 상태를 조절하여 EGF-유도된 신호전달이 회복은 회복이 세포 순환에 미치는 영향에 대해 관심을 갖게 하였다. 따라서, 본 발명자들은 세포 순화-연관 분자들을 실험하였다. 노화 세포에서 세포 순환 프로그램을 맡고있는 시클린-의존적 키나아제 (cdk)/시클린 패밀리의 특정 구성원이 발현은 되나, 활성이 없다 (Dulic. V., et, al., (1993) Proc. Natl. Acad. Sci. USA, 90, 11034-11038). cdk 활성의 부재 및 세포 순환의 G1기에서의 정지는 G1-S cdk/시클린 억제제 p21 (WAF1) (Noda. A., et, al., (1994) Exp Cell Res 211, 90-98) 및 p16 (INK4a) (Alcorta. D.A., et, al., (1996) Proc Natl Acad Sci USA. 93, 13742-13747, Hara. E., et, al., (1996) Mol Cell Biol 16, 859-867, Brown. J.P., et, al., (1997) Science (Washington DC). 277, 831-834, Gire. V., et, al., (1998) Mol Cell Biol 18, 1611-1621, Galbiati. F., et, al., (2001) Mol Biol Cell 12, 2229-44)의 유도에 기인한다. 따라서, AS-ON 및 S-ON 처리된 노화 HDF에서 p53 및 p21의 수준을 측정하였고, p53 및 p21의 수준이 AS-ON 처리된 노화 HDF에서 상당히 감소하는 것을 확인하였다 (도 7a). G1-S 전환을 모니터하기 위하여, EGF 자극에 대한 반응에 있어서 BrdUrd 주입 속도의 변화를 관찰하였다. BrdUrd 인덱스는 DNA 합성 속도의 측정치이므로, S기 활성을 모니터하는데 사용될 수 있다. 결과를 보면, 항-BrdUrd 항체를 사용하여 모니터한 것에서 알 수 있듯이, AS-ON 형질감염된 노화 HDF의 거의 60%가 DNA 합성을 보인 반면, 대조적으로 S-ON 형질전환된 HDF에 의해서는 합성이 거의 일어나지 않았다 (도 7b).Replicative senescence refers to the irreversible arrest of growth in spite of stimulation of growth factors, thus restoring EGF-induced signaling by regulating the state of caveolin in senescent cells, and the effect of recovery on cell circulation. Interested in Thus, we experimented with cell purifying-associated molecules. Certain members of the cyclin-dependent kinase (cdk) / cyclin family responsible for cell circulation programs in senescent cells are expressed but inactive (Dulic. V., et, al., (1993) Proc. Natl. Acad. Sci. USA, 90, 11034-11038). Absence of cdk activity and arrest at the G1 phase of the cell circulation are indicated by the G1-S cdk / cyclin inhibitor p21 (WAF1) (Noda. A., et, al., (1994) Exp Cell Res 211, 90-98) and p16 (INK4a) (Alcorta. DA, et, al., (1996) Proc Natl Acad Sci USA. 93, 13742-13747, Hara. E., et, al., (1996) Mol Cell Biol 16, 859-867 , Brown.JP, et, al., (1997) Science (Washington DC). 277, 831-834, Gire. V., et, al., (1998) Mol Cell Biol 18, 1611-1621, Galbiati.F ., et, al., (2001) Mol Biol Cell 12, 2229-44). Thus, the levels of p53 and p21 were measured in AS-ON and S-ON treated aging HDFs, and the levels of p53 and p21 were found to be significantly reduced in AS-ON treated aging HDFs (FIG. 7A). To monitor G1-S conversion, changes in BrdUrd infusion rate in response to EGF stimulation were observed. Since the BrdUrd index is a measure of the rate of DNA synthesis, it can be used to monitor S phase activity. The results show that almost 60% of AS-ON transfected aging HDFs show DNA synthesis, as shown by monitoring with anti-BrdUrd antibodies, whereas in contrast, S-ON transformed HDFs do not. Rarely happened (FIG. 7B).
이상에서 상세히 설명한 바와 같이, 본 발명은 카베올린 단백질의 발현 억제 방법 및 노화세포의 생물학적 기능 회복 방법을 제공한다. 또한, 본 발명은 노화세포의 생물학적 기능 회복용 조성물을 제공한다. 본 발명의 방법은 카베올린 단백질의 발현을 효과적으로 억제하여, 놀랍게도 노화 세포를 젊은 세포로 역전시킬 수 있다.As described above in detail, the present invention provides a method for inhibiting expression of a caveolin protein and a method for restoring biological function of senescent cells. The present invention also provides a composition for restoring biological function of senescent cells. The method of the present invention can effectively inhibit the expression of the carveolin protein, surprisingly reversing senescent cells into young cells.
<110> Seoul National University Industry Foundation <120> Methods for Restoring Biological Functions of Senescent Cells <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 19 <212> RNA <213> Homo sapiens <400> 1 ccagaaggga cacacaguu 19 <210> 2 <211> 19 <212> RNA <213> Homo sapiens <400> 2 caucuacaag cccaacaac 19 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> small interfering RNA targeted to mRNA of caveolin <400> 3 aacugugugu cccuucugg 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> small interfering RNA targeted to mRNA of caveolin <400> 4 guuguugggc uuguagaug 19 <110> Seoul National University Industry Foundation Methods for Restoring Biological Functions of Senescent Cells <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 19 <212> RNA <213> Homo sapiens <400> 1 ccagaaggga cacacaguu 19 <210> 2 <211> 19 <212> RNA <213> Homo sapiens <400> 2 caucuacaag cccaacaac 19 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> small interfering RNA targeted to mRNA of caveolin <400> 3 aacugugugu cccuucugg 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> small interfering RNA targeted to mRNA of caveolin <400> 4 guuguugggc uuguagaug 19
Claims (12)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020030051175A KR100614523B1 (en) | 2003-07-24 | 2003-07-24 | Methods for Restoring Biological Functions of Senescent Cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020030051175A KR100614523B1 (en) | 2003-07-24 | 2003-07-24 | Methods for Restoring Biological Functions of Senescent Cells |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20050012082A KR20050012082A (en) | 2005-01-31 |
| KR100614523B1 true KR100614523B1 (en) | 2006-08-22 |
Family
ID=37223972
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020030051175A KR100614523B1 (en) | 2003-07-24 | 2003-07-24 | Methods for Restoring Biological Functions of Senescent Cells |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR100614523B1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100877824B1 (en) | 2005-11-11 | 2009-01-12 | 한국생명공학연구원 | E2EPF ubiquitin carrier protein-von Hippel-Lindau interaction and uses of thereof |
| KR100918668B1 (en) * | 2009-04-03 | 2009-09-22 | 주식회사 도담이앤씨 | Connection structure of pipe assembly for seperating sewage and raindrops at culvert intersection |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20010012890A1 (en) * | 1997-11-05 | 2001-08-09 | Thompson Timothy C. | Sequences for targeting metastatic cells |
| WO2002021140A1 (en) * | 2000-09-08 | 2002-03-14 | Metabolic Engineering Laboratories Co., Ltd. | Nucleic acid sequences and proteins involved in cellular senescence |
| US20020132788A1 (en) * | 2000-11-06 | 2002-09-19 | David Lewis | Inhibition of gene expression by delivery of small interfering RNA to post-embryonic animal cells in vivo |
| US20030092180A1 (en) * | 2001-08-27 | 2003-05-15 | David Lewis | Inhibition of gene expression by delivery of small interfering RNA to post-embryonic animal cells in vivo |
-
2003
- 2003-07-24 KR KR1020030051175A patent/KR100614523B1/en not_active IP Right Cessation
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20010012890A1 (en) * | 1997-11-05 | 2001-08-09 | Thompson Timothy C. | Sequences for targeting metastatic cells |
| US20030003103A1 (en) * | 1997-11-05 | 2003-01-02 | Thompson Timothy C. | Sequences for targeting metastatic cells |
| WO2002021140A1 (en) * | 2000-09-08 | 2002-03-14 | Metabolic Engineering Laboratories Co., Ltd. | Nucleic acid sequences and proteins involved in cellular senescence |
| US20020132788A1 (en) * | 2000-11-06 | 2002-09-19 | David Lewis | Inhibition of gene expression by delivery of small interfering RNA to post-embryonic animal cells in vivo |
| US20030092180A1 (en) * | 2001-08-27 | 2003-05-15 | David Lewis | Inhibition of gene expression by delivery of small interfering RNA to post-embryonic animal cells in vivo |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20050012082A (en) | 2005-01-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhou et al. | ZEB1 enhances Warburg effect to facilitate tumorigenesis and metastasis of HCC by transcriptionally activating PFKM | |
| Cho et al. | Senescent phenotype can be reversed by reduction of caveolin status | |
| Watanabe et al. | HMGA2 maintains oncogenic RAS-induced epithelial-mesenchymal transition in human pancreatic cancer cells | |
| Su et al. | Interleukin-17A mediates cardiomyocyte apoptosis through Stat3-iNOS pathway | |
| CN109789156B (en) | Application of miR-198 in treatment and diagnosis of skin squamous cell carcinoma | |
| Ono et al. | Notch2 negatively regulates myofibroblastic differentiation of myoblasts | |
| Valkov et al. | MicroRNA-1-mediated inhibition of cardiac fibroblast proliferation through targeting cyclin D2 and CDK6 | |
| Ma et al. | circACTA2 mediates Ang II-induced VSMC senescence by modulation of the interaction of ILF3 with CDK4 mRNA | |
| US11976279B2 (en) | Methods and compositions for managing vascular conditions using miR-483 mimics and HIF1alpha pathway inhibitors | |
| US9649379B2 (en) | Pharmaceutical composition and pharmaceutical kit for the treatment of hepatocellular carcinoma | |
| Santra et al. | Ectopic decorin expression up‐regulates VEGF expression in mouse cerebral endothelial cells via activation of the transcription factors Sp1, HIF1α, and Stat3 | |
| US8580562B2 (en) | Inhibitory RNA for modulating the molecular function of ZFAT gene | |
| Shi et al. | Neural cell adhesion molecule potentiates invasion and metastasis of melanoma cells through CAMP-dependent protein kinase and phosphatidylinositol 3-kinase pathways | |
| Pirkmajer et al. | HIF-1α response to hypoxia is functionally separated from the glucocorticoid stress response in the in vitro regenerating human skeletal muscle | |
| JP2006509504A (en) | Method for introducing siRNA into adipocytes | |
| Song et al. | MRTF‐A regulates myoblast commitment to differentiation by targeting PAX7 during muscle regeneration | |
| Zhu et al. | Cold shock proteins mediate GN with Mesangioproliferation | |
| WO2003102185A2 (en) | Methods and compositions for treating neoplasia relating to hnrnp a1 and a2 nucleic acid molecules | |
| KR100614523B1 (en) | Methods for Restoring Biological Functions of Senescent Cells | |
| Jiang et al. | MiR-210 suppresses neuronal apoptosis in rats with cerebral infarction through regulating VEGF-notch signaling pathway. | |
| Cai et al. | MicroRNA-149-Mediated MAPK1/ERK2 Suppression Attenuates Hair Follicle Stem Cell Differentiation | |
| Shi et al. | Hsa_circ_0088196 suppresses trophoblast migration and invasion by the miR‐525‐5p/ABL1 axis and the PI3K/AKT signaling pathway | |
| US9051568B2 (en) | Anti-sense microrna expression vectors | |
| US10260067B2 (en) | Enhancing dermal wound healing by downregulating microRNA-26a | |
| US20110275574A1 (en) | Method of inhibiting proliferation of hepatic stellate cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| AMND | Amendment | ||
| E902 | Notification of reason for refusal | ||
| AMND | Amendment | ||
| E601 | Decision to refuse application | ||
| J201 | Request for trial against refusal decision | ||
| AMND | Amendment | ||
| B701 | Decision to grant | ||
| GRNT | Written decision to grant | ||
| FPAY | Annual fee payment |
Payment date: 20120810 Year of fee payment: 7 |
|
| FPAY | Annual fee payment |
Payment date: 20130808 Year of fee payment: 8 |
|
| LAPS | Lapse due to unpaid annual fee |