KR100587535B1 - A Recombinant hFSH Gene, and An Expression Vector Containing Thereof - Google Patents

Abstract

The present invention relates to a retrovirus vector for the transfer and expression of human follicle hormone (hFSH) recombinant gene in animal cells and transgenic animals.

The present invention provides a recombinant hFSH gene linked with a CTP DNA fragment in which the hFSH α gene and the hFSH β gene are linkers, and a retrovirus vector containing the recombinant hFSH gene.

According to the present invention, not only the FSH-producing transgenic animal can be more efficiently produced, but also the recombinant hFSH gene can be transferred using the retrovirus vector system according to the present invention, and thus it is applicable to gene therapy.

Follicle Stimulating Hormone, FSH, CTP, Recombinant, Vector, Transformation

Description

Recombinant hFSH Gene, and An Expression Vector Containing Thereof}             

1 is a schematic flowchart showing a process of connecting two DNA fragments of FSH α and FSH β to each other by CTP.

Figure 2 is a table showing the nucleotide sequence of the recombinant FSH gene according to the present invention and the amino acid sequence accordingly.

3 is a flowchart illustrating a process of cloning the recombinant FSH gene according to the present invention under a β-actin promoter of a retrovirus vector.

4 is a graph showing the expression level of the recombinant FSH gene according to the present invention.

The present invention relates to a retrovirus vector for the transfer and expression of human follicle hormone (hFSH) recombinant gene in animal cells and transgenic animals.

FSH (follicle hormone) is a type of glycoprotein secreted from the anterior pituitary gland. In women, it promotes the development of primordial follicles to induce oocyte maturation and stimulates the secretion of estradiol in the follicles. Induces the development of behavioral and mammary glands. In men, it is known as a hormone that stimulates basal cells of the testicles and is involved in sperm formation. Due to these characteristics, FSH is used as an injection for infertile women with chronic aovulation syndromes such as aovulation cycle, amenorrhea and dysmenorrhea, IVF (In Vitro Fertilization) and ICSI (Intracellular Sperm Direct Injection, Intra) It is also used for reproductive surgery such as Cytoplasmic Sperm Injection.

Several gonadotropins and thyroid stimulating hormones, including FSH, are composed of non-covalent bonds of two subunits of α and β, and the α subunit of each hormone appears to be common in the same species, but the β subunit has various forms. This results in different biological characteristics (Pierce and Parsons, Annu. Rev. Biochem . 50: 465-495, 1981). Hormones formed from these subunits exhibit biological activity only when they are composed of heterodimers by the combination of each subunit, and specific oligosaccharide binding to each hormone is known to be dependent on dimer formation.

As for the hormones which are completed by the combination of the subunits, the combination stage of the subunit is considered to be very inefficient. As a means of overcoming these limitations, nucleic acid sequences corresponding to two subunits are placed in a single DNA chain to be expressed from the same DNA fragment, thereby transforming the complex of the multisubunit into a single chain, thereby improving the stability and activity of the protein. Attempts have been made to increase (Arora et al., J. Biol. Chem. 269: 26165-26171, 1994; Sano et al., Proc. Natl. Acad. Sci. USA 89: 1534-1538 , 1992) In the above studies, the linker sequence was used for the most appropriate arrangement of each subunit, and the use of this linker was designed to provide hormonal flexibility, hydrophilicity, and resistance to proteolytic enzymes, resulting in a single chain of biological stability. (Sugahara et al., Proc. Natl. Acad. Sci. USA 92: 2041-204, 1995; Matzuk et al., Endocrinology 126: 376-383, 1990), and are also involved in post-translational processing, resulting in efficient secretion. To promote (Muyan and Boime. Mol. Endocrinol. 12: 766-772, 1998).

Based on the above report, to date, recombinant genes consisting of one single chain of α and β genes in all gonadotropins and thyroid stimulating hormones including FSH have been reported and efficient expression of these recombinant genes in mammalian cells has been reported. (Sugahara et al., J. Biol. Chem. 271: 10445-10448, 1996; Narayan et al., Methods 21: 59-66, 2000). However, since these recombinant genes are expressed in cells by general DNA transfection methods, it is very difficult to apply them in the field of application such as more efficient gene transfer, expression and production of transgenic animals.

Therefore, there is a need to develop a new vector system for more efficient and systematic gene transfer and expression rather than a DNA transfection method.

It is an object of the present invention to provide a novel form of recombinant hFSH gene that is easy to transfer and express.

Still another object of the present invention is to provide an expression vector containing the recombinant hFSH gene.

The present invention for achieving the above object relates to a recombinant hFSH gene linked to the hFSH α gene and the hFSH β gene by a linker CTP DNA fragment and a retrovirus vector containing the recombinant hFSH gene.

In the present invention, the recombinant DNA sequence of human FSH gene consisting of human follicle hormone (hFSH) α, hFSH β and linker, and FSH β-CTP (C-terminal protein) linker- FSH α DNA sequence Provide the sequence (SEQ ID NO: 1). In addition, the present invention provides a retrovirus vector constructed using the recombinant hFSH gene in order to improve the efficiency of gene transfer and expression.

The advantage of the retroviral vector system is that it is genetically stable compared to other foreign gene transduction methods (Temin, Genome 31: 17-22, 1989), so that only a single non-repeating gene is inserted when the foreign gene is inserted into the genome of the target cell. It can be selectively introduced into the chromatin region and can infect various kinds of cells with various kinds of foreign genes with high efficiency (Rohdewohld et al., J. Virol. 61: 336-343, 1987).

In hormones consisting of two subunits, such as gonadotropin or thyroid stimulating hormone, the production of each subunit as a single-chain derivative is an attempt to increase the biological activity and stability of hormone proteins. In this regard, the present inventors introduced CTP as a linker for more efficient expression of two subunits. A schematic flowchart showing the process of linking two DNA fragments of FSH α and FSH β to each other by CTP is shown in FIG. 1.

FSH α and β subunits and CTP were directly cloned from the human pituitary gland cDNA library by PCR to obtain 102 bp CTP, 454 bp FSH α and 402 bp FSH β fragments, respectively. In addition, the pGEM-Teasy-FSH-CTP plasmid was constructed by connecting the FSH α and FSH β subunits with a CTP linker. Sequencing was performed using the constructed TG promoter primer of pGEM-Teasy-FSH-CTP.

In this case, the recombinant hFSH gene according to the present invention, in which the hFSH α gene and the hFSH β gene are linked to a CTP DNA fragment which is a linker, is 946 bp (SEQ ID NO: 1), and the nucleotide sequence thereof and the amino acid sequence thereof are shown in FIG. 2.

We then isolated the recombinant FSH gene from the pGEM-Teasy-FSH-CTP plasmid and cloned it under the β-actin promoter in a retrovirus vector. As a result, the recombinant FSH gene can be transferred to target cells using a retrovirus vector system, thereby improving the transfer rate and expression rate of the gene.

According to the present invention, the DNA fragment corresponding to CTP is introduced into the linker between the β and α genes of FSH to indirectly connect the carboxy terminus of FSH β and the amino terminus of FSH α to regulate the secretion and signaling of FSH, Increased hormone-specific post-translational modifications can be achieved.

Hereinafter, the present invention will be described in more detail with reference to Examples. The following examples are merely illustrative for describing the present invention, and thus the scope of the technical spirit of the present invention is not changed or reduced.

Example 1  : Recombination of human FSH gene consisting of FSH α, FSH β and linker (construction of plasma pGEM-Teasy-FSH-CTP)

To clone the α and β genes of FSH, corresponding nucleic acid sequences were identified in the genbank. FSH α was selected in the mRNA sequence (genbank accession no. NM_000735) except for the signal peptide sequence, and CTP corresponds to 145 residues in amino acid sequence 113 when expressed in the β subunit mRNA sequence (genbank accession no. NM_000737) of hCG. For FSH β, exon 1 (genbank accession no. M16646) and exon 2 (genbank accession no. M16647) were selected.

As primers for FSH α, 5'ATCGATGCTCCTGATGTGCAGGATTGC3 '(SEQ ID NO: 2) as the + strand primer added with the restriction enzyme site of ClaI and 5'GGATCCGGATAAGGAGGAAGGCA GTAA3' (SEQ ID NO: 3) were used as the strand primer added with the BamHI site. The primer for the CTP linker is 5'AGATC TTCCTCCTCTTCCTCAAAGGCC3 '(SEQ ID NO: 4) with the BglII site added, and 5'ATCGATGCTTTGTGGAGGATCGGGGT3' (SEQ ID NO: 5) with the strand strand added with the Cla I site, and primer for FSH β. 5'AAGCTTAGGATGAAGACACTCCAGTTTTTCTTC3 '(SEQ ID NO: 6) as the HindIII plus strand and 5'AGATCT TTCTTTCATTTCACCAAAGGAGCAGTA3' (SEQ ID NO: 7) were used as the strand primer with the BglII site added.

The template used in performing PCR was 0.1 ng of human pituitary gland cDNA (Clontech 639324, USA), and the polymerase was selected from the Advantage-HF2 (Clontech, USA) enzyme, which is known to have a low failure rate. PCR was performed at 94 ° C by mixing 100 ngole + and-primer, 5 μl of 10 × F2 dNTP mix, 5 μl of 10 × F2 PCR buffer, and 1 μl of 50 × dvantage-HF2 polymerase to 0.1 ng of template DNA. After standing for 1 minute, the reaction was repeated 35 times at 94 ° C for 30 seconds (modification) and at 68 ° C for 1 minute (primer adhesion and extension). After the reaction, the mixture was left at 68 ° C for 3 minutes for final elongation. After completion of the reaction, electrophoresis was performed on 1.5% agarose gel.

Each product was extracted and introduced into the pGEM-T Easy vector. Each fragment was integrated into a single vector to construct pGEM-Teasy-FSH-CTP, and the DNA sequences of each fragment were confirmed by sequencing (see FIG. 1). ).

Example 2  : DNA sequence of recombinant FSH gene

The recombinant FSH gene constructed in Example 1 was sequencing, and the nucleotide sequence of the DNA (SEQ ID NO: 1) and the amino acid sequence encoded by this nucleotide sequence are shown in FIG. Figures 1 to 402 bases correspond to FSH β, 397 to 498 bases are CTP linker, and 493 to 946 bases correspond to gene of FSH α. The English letter (denoted by M, K, T, L, etc.) under the base sequence represented by A, T, G, or C means amino acids corresponding to three base combinations.

The FSH protein produced by the recombinant FSH gene according to the present invention consists of 255 amino acids, which has an amino acid sequence almost identical to that of natural FSH (consisting of 221 amino acids). The difference in the number of amino acids (34) between recombinant FSH protein and native FSH protein comes from introducing CTP to link FSH alpha and FSH beta. Despite these differences, however, recombinant FSH is expected to be identical to native FSH in all aspects, including physiological activity. The reason is that recombinant FSH produced in insect cells to which recombinant FSH gene has been transferred by baculovirus vector system can The same has been reported for the same activity (Kato et al., Journal of Molecular Endocrinology 20: 55-65).

Example 3  : Construction of retrovirus vector to transfer and express hFSH gene (Construction of Plasmid pLNβ-FSH-CTP)

About 1 Kb of FSH-CTP fragments were isolated from pGEM-Teasy-FSH-CTP to construct a retrovirus vector by cloning to the position of the E. coli LacZ gene of the retroviral vector pLNβZ (see FIG. 3). The newly recombined pLNβ-FSH-CTP was mass-separated using the Qiagen maxiprep kit and used in the next experiment.

Separately, the constructed vector pLNβ-FSH-CTP was transfected into the E. coli HB101 strain in a conventional manner, and the transfected strain was deposited with the Biotechnology Research Institute on Jan. 8, 2003 to receive the accession number KCTC 10579BP.

Example 4  : Expression of hFSH using Retrovirus Vector System

The retroviral vector recombined in Example 3 was transfected into PT67 by calcium phosphate method and selected for 2 weeks using a selection solution to which G418 (500 µg / ml) was added. The virus stock was harvested after incubating the formed NeoR (G418 resistant) PT67 cell population in DMEM / FBS (10%) for 48 hours. The virus was infected with 293mGPHy (Kim et al., Asian-Aust. J. Anim. Sci. 14: 163-169, 2001), a pseudotype retrovirus-producing cell developed by the inventors of the present invention, and G418 (600 μg / ml). The added sorting solution was selected for 2 weeks. Selected NeoR (G418 resistant) 293mGPHy-LNβZ cells were transiently transfected with 20 μg of pHCMV-G by calcium phosphate method and incubated at 37 ° C., 5% CO 2 for 8 hours and exchanged for new culture. After 48 hours, the culture medium containing retrovirus was harvested.

Virus-containing culture was added to the cell culture to infect CHO (Chinese Hamster Ovary) cells. Polybrene (5 ㎍ / ml) was added to increase the virus infection rate. CHO cells were infected with virus and then cultured for 2 weeks in a selective culture solution containing G418 (800 ㎍ / ml) as in NIH3T3.

FHO was quantified by harvesting the culture medium after culturing CHO-LNβ-FSH-CTP cells for 24 hours after infection and selection. Quantification of FSH was performed using an electrochemistry iluminescence immunoassay (ECLIA) analyzer (Elecsys 2010, Roche) with an Elecsys FSH reagent kit. As a control, cultures of CHO cells not infected with virus were used, and the expression level of the FSH-CTP gene was compared using the derived results (see FIG. 4).

In FIG. 4, "Con" of the X axis represents CHO cells to which the FSH gene has not been transferred, and "Co-inf" represents two retrovirus vectors (LNβ) having a β-actin promoter-FSH α gene and a β-actin promoter-FSH β gene. -FSH α and LNβ-FSH β) independently independently double-transferred CHO cells, "FSH-CTP" refers to CHO cells in which the recombinant FSH gene under the β-actin promoter has been transferred by the LNβ-FSH-CTP retrovirus vector it means.

As a result, CHO cells without FSH-CTP transfer (Con in Fig. 4) and cells co-infected with FSH α and β (Co-inf in Fig. 4) showed 0.18 mIU / ml and 0.19 mIU / ml, respectively. In comparison, the culture solution of CHO-LNβ-FSH-CTP (FSH-CTP in FIG. 4) showed 3.16 mIU / ml. In other words, the expression of FSH recombined with a single chain was about 17 times higher than that of the control group, indicating that the secretion of hormone proteins in the form of linking two subunits using a linker is increased.

As described and demonstrated in detail above, the present invention provides a method for efficiently transferring and expressing human FSH hormone genes in cells or animals. The inventors have demonstrated that the expression rate of genes is increased by combining FSH genes consisting of two genes into one. In addition, the retrovirus vector system was constructed as a means of transferring recombinant FSH gene to increase the efficiency of gene transfer rate.

By using this method, the FSH-producing transgenic animals may be produced more efficiently. In addition, since the recombinant hFSH gene can be transferred using a retrovirus vector system, it is also applicable to gene therapy.

<110> The Education & Research Foundation for Industry, University, and Research Institute in Chungnam National University (ERFIUR) <120> A Recombinant hFSH Gene, and An Expression Vector Containing          Thereof <160> 7 <170> KopatentIn 1.71 <210> 1 <211> 946 <212> DNA <213> recombination hFSH gene <400> 1 aagcttagga tgaagacact ccagtttttc ttccttttct gttgctggaa agcaatctgc 60 tgcaatagct gtgagctgac caacatcacc attgcaatag agaaagaaga atgtcgtttc 120 tgcataagca tcaacaccac ttggtgtgct ggctactgct acaccaggga tctggtgtat 180 aaggacccag ccaggcccaa aatccagaaa acatgtacct tcaaggaact ggtatacgaa 240 acagtgagag tgcccggctg tgctcaccat gcagattcct tgtatacata cccagtggcc 300 acccagtgtc actgtggcaa gtgtgacagc gacagcactg attgtactgt gcgaggcctg 360 gggcccagct actgctcctt tggtgaaatg aaagaaagat cttcctcctc ttcctcaaag 420 gcccctcccc cgagccttcc aagtccatcc cgactcccgg ggccctcgga caccccgatc 480 ctcccacaaa gcatcgatgc tcctgatgtg caggattgcc cagaatgcac gctacaggaa 540 aacccattct tctcccagcc gggtgcccca atacttcagt gcatgggctg ctgcttctct 600 agagcatatc ccactccact aaggtccaag aagacgatgt tggtccaaaa gaacgtcacc 660 tcagagtcca cttgctgtgt agctaaatca tataacaggg tcacagtaat ggggggtttc 720 aaagtggaga accacacggc gtgccactgc agtacttgtt attatcacaa atcttaaatg 780 ttttaccaag tgctgtcttg atgactgctg attttctgga atggaaaatt aagttgttta 840 gtgtttatgg ctttgtgaga taaaactctc cttttcctta ccataccact ttgacacgct 900 tcaaggatat actgcagctt tactgccttc ctccttatcc ggatcc 946 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer for polymerizing hFSH sequence <400> 2 atcgatgctc ctgatgtgca ggattgc 27 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer for polymerizing hFSH sequence <400> 3 ggatccggat aaggaggaag gcagtaa 27 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer for polymerizing hFSH sequence <400> 4 agatcttcct cctcttcctc aaaggcc 27 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer for polymerizing hFSH sequence <400> 5 atcgatgctt tgtggaggat cggggt 26 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer for polymerizing hFSH sequence <400> 6 aagcttagga tgaagacact ccagtttttc ttc 33 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer for polymerizing hFSH sequence <400> 7 agatctttct ttcatttcac caaaggagca gta 33

Claims (3)

delete An expression retrovirus vector containing the recombinant hFSH gene of SEQ ID NO: 1, wherein the hFSHα gene and the hFSHβ gene are linked by a CTP DNA fragment which is a linker. The expression retroviral vector of claim 2, wherein the vector is pLNβ-FSH-CTP (KCTC 10579BP).

Images