KR100566479B1 - Cold-shock regulatory elements, constructs thereof, and methods of use - Google Patents

Abstract

Regulatory elements of the 5 'UTR of a cold shock induction gene are disclosed. This factor prolongs the expression of cold shock induction genes under conditions that elicit cold shock responses in bacteria, inhibits the expression of cold shock induction genes under physiological conditions, or cold shock induction conditions under conditions that elicit cold shock responses in bacteria. Improve their translation. Vectors and methods of protein expression with these elements are disclosed.

Description

Cold-shock regulatory elements, constructs, and methods of use

The present invention relates to the regulation of bacterial gene expression, and particularly to the inhibition of bacterial gene expression under conditions of physiological stress. More specifically, the present invention relates to inhibiting bacterial gene expression under conditions of physiological stress that induces cold shock response of bacteria.

Inhibition of bacterial gene expression may include regulation of transcription or synthesis of mRNA from a particular gene; Translational regulation, or regulation of translation efficiency, in which mRNA is translated into polypeptide sequences by ribosomes; And mRNA stability or efficiency where the number of specific mRNAs in the cell is degraded and inactivated. Regulating bacterial gene expression under physiological stress conditions that elicit a cold shock response of bacteria involves inhibition at all three levels described above.

Bacteria's response to physiological stress involves tightly regulating the expression of a small number of genes that act to allow cells to adapt to stress and function under stress conditions. For example, when bacterial cells are exposed to temperatures higher than their normal physiological temperature, a series of genes, called heat shock genes, are expressed. Such reactions to elevated temperatures are known and described in the prior art. Conversely, when bacterial cells are exposed to temperatures lower than their physiological temperature, a series of genes called cold shock (cs) genes are expressed. By expressing cold shock genes, cells first adapt to physiological stress and then grow under conditions of physiological stress. The present invention relates to a specific process for inhibiting the expression of cryogenic shock genes.

When E. coli cultures are transferred from 37 ° C to 15 or 10 ° C, many proteins, called cold shock proteins, are transiently induced during the growth lag period (Jones et al., 1987: Review, see, Thieringer et al., 1998). Yamanaka et al., 1998). CspA, consisting of 70 amino acid residues, was identified as a major cold shock protein (Goldstein et al., 1990), and its three-dimensional structure was analyzed by X-ray crystal structure analysis (Schindelin et al. 1994) and nuclear magnetic resonance analysis (Newkirk et al. 1994; Feng et al. 1998). Was determined to consist of five antiparallel beta-chain structures. cspA has been shown to bind single stranded DNA and RNA without high sequence specificity and to function as an RNA chaperone at low temperatures (Jiang et al. 1997).

Today, more than 50 CspA homologue proteins have been found in many protozoa. In addition, the sites of the so-called cold shock domains of the eukaryotic bio Y-box protein families such as human YB-1 and Xenopus FRGY-2 share 40% identity with E. coli cspA (for review, see Wolffe et al. 1992), which means that the low temperature impact zone is well preserved during the evolution. In E. coli, nine genes encoding cspA-type proteins, namely cspA to cspI, have been found (see Yamanaka et al. 1998). Of these, cspA, cspB and cspG are inducible to cold shock (Goldstein et al. 1990; Lee et al., 1994; Nakashima et al., 1996), and it is interesting that cspD is induced during stationary and malnutrition (Yamanaka and Inouye). , 1997). It has been reported that the broad cspA family of Escherichia coli may have the ability to respond to other environmental stresses (see Yamanaka et al., 1998).

cspA expression is transiently induced upon cold shock during a growth retardation period called the acclimation phase. It is believed that this period is required for the cells to adapt to new environmental conditions. Indeed, during the acclimation period, proteins specifically involved in translation processes such as CsdA (Jones et al., 1996), RbfA (Jones and inouye, 1996), and CspA (Goldstein et al., 1990) are produced, which are non-low temperature shocks at low temperatures. It is thought to play an important role in improving translation efficiency for proteins (for review, Yamanaka et al. 1998). Among these cold shock proteins, cspA has been investigated very extensively for its mechanism of cold shock induction (for review, Yamanaka et al. 1998). The cspA promoter is very active at this temperature even though CspA is rarely detected at 37 ° C. (Fang et al. 1997; Mitta et al. 1997). Even though the cspA promoter is replaced with the lpp promoter, the major constitutive promoter, cspA expression is still cold shock inducible (Fang et al., 1997), which suggests that cspA induction at low temperatures is primarily at the mRNA stability and translational level. Shows that it happens. The cspA promoter, however, contains an AT-rich upper element (UP element) over the -35 site (Fang et al., 1997; Golenberg et al. 1997; Mitta et al. 1997), which is believed to play an important role in efficient transcription initiation at low temperatures. do. It has been found that cspA mRNA becomes very stable upon cold shock, demonstrating that mRNA stability plays a critical role in inducing cold shock of cspA (Brandi et al. 1996; Goldenberg et al. 1996; Fang et al. 1997).

An important and unique feature of cspA mRNA is the unusually long 5'-untranslated site (5'-UTR) of 159 bases (Tanabe et al. 1992). This feature is also found in other Class I low temperature genes, such as cspB (Etchegaray et al. 1996) and cspG (Nakashima et al. 1996), which are dramatically induced after temperature reduction (see Thieringer et al., 1998 for review). This 5'-UTR is considered to play a decisive role in inducing cold shock of cspA (Brandi et al. 1996; Jiang et al. 1996; Goldenberg et al. 1996; Bae et al. 1997; Fang et al. 1997; Goldenberg et al. 1997; Mitta et al. 1997). .

Furthermore, a 14-base downstream box (DB), located 12 bases downstream of the translation initiation codon of cspA mRNA, partially complementary to a site called the anti-downstream box of the 16S rRNA (Sprengart et al. 1996). ) Has recently been found to play an important role in efficient translation at low temperatures (Mitta et al. 1997). This site of the RNA sequence designated as the downstream box is complementary to bases 1469-1483 in E. coli 16S rRNA (anti-DB sequence). The formation of a double helix between the DB and the anti-DB is believed to be related to translation enhancement. The DB sequence also relates to the translation of λ cI mRNA, an mRNA that lacks untranslated sites and SD sequences (Shean and Gottesman 1992; Powers et al. 1988). Interestingly, λ cI translation is improved at 42 ° C. in temperature sensitive strains where the amount of ribosomal protein S2 is reduced at 42 ° C. In S2 deficient ribosomes, reverse-DB sequences become more accessible to the DB, resulting in improved translation initiation of λ cI mRNA. However, the DB role in the initiation of λ cI translation has been disputed by Resch and his collaborators (Resch et al. 1996). These authors tested the DB function by constructing a lacZ translational fusion with the λcI gene. The removal of six bases, including some DB sequences, did not reduce the formation of the translation initiation complex, and thus disputes the presence of the DB. Despite the difficult role of DB capture (Sprengart and Porter 1997), the inventors found that the presence of DB sequences plays an important role in translation efficiency in cold shock mRNAs. Previously suggested to be involved in the formation of a stable starting complex at low temperatures. Thus, cspA expression is suppressed in a complex fashion at the level of transcription, mRNA stability and translation.

Here, a series of deletion variants were constructed at the 5'-UTR of cspA and their effects on cspA expression were analyzed by examining the amount of mRNA, mRNA stability and translational efficiency. In addition to mRNA stability, 5'-UTR has been found to play a major role in the translational efficiency of cspA mRNA, enhancing cspA expression upon cold shock. Specific sites of the 5'-UTR were found to mediate the inhibition process described above.

1 shows the effect of cspA upstream sites on plasmid pJJG78 and chromosomal cspA expression and synthesis of other cellular proteins: (A) pJJG78, (B) cspA upstream sites on chromosomal cspA expression and synthesis of other cellular proteins. Effect.

2 shows prolonged expression of CspA and inhibition of cold shock adaptation by pJJG78 and pUC19-600.

3 shows the deletion analysis of cspA upstream sites for cspA inhibitory function and inhibition of cold shock adaptation.

4 shows transcript levels from chromosomes and plasmid cspA.

5 shows the transcriptional conditions of the 5 'untranslated region of cspA mRNA for prolonged expression of cspA and inhibition of cold shock adaptation.

Figure 6 shows the effect on the production of other cold shock proteins and non-cold shock protein according to the overproduction of 5 'untranslated site of cspA mRNA.

Figure 7 shows the effect on cold shock response according to the co-overproduction of cspA with the 5 'untranslated site of cspA mRNA.

8 shows the effect on CspA production following overproduction of the first 25 nucleotide sequences of cspA 5 ′ UTR.

9 shows cold induction of beta-galactosidase: (A) Construction of cspA-lacZ fusions. Wild type cspA is shown at the top. In each expression plasmid, the cspA-lacZ fusion is shown from the 5 'end of the cspA promoter upstream to lacZ. The nucleotide number is +1 and starts at the transcription start position determined by Tababe et al. Cross hatched, open, spotted and deep bars indicate the cspA promoter, its 5 'untranslated site, cspA coding site, and lacZ coding site, respectively. The bold boxes indicate the SD sequences. The location of the missing site is shown by nucleotide number. (B) Induction patterns of various deletion constructs. In the middle of the logarithmic growth phase, cultures of E. coli Ar137 containing various plasmids were transferred from 37 ° C. to 15 ° C. Samples were taken at 0.1, 2, 3, 5, 7 and 10 hours after transfer and beta-galactosidase activity was measured. cspA-lacZ fusion: pMM67 (o); pMM022 (●); pMM023 (□); pMM024 (■); pMM025 (Δ); And pMM026 (▲).

10 shows an analysis of mRNA stability. (A) Primer extension analysis of cells containing cspA-lacZ fusions. In the middle of the logarithmic phase, the culture of E. coli Ar137 containing various plasmids was transferred from 37 ° C to 15 ° C. To measure mRNA stability at 37 ° C., incubate at 15 ° C. for 30 minutes, transfer back to 37 ° C., and add Rifampicin to the culture until a final concentration of 200 ug / ml. RNAs were extracted after 0 (lane 1), 1 (lane 2), 3 (lane 3), and 5 minutes (lane 4) after rifampicin addition. To measure mRNA stability at 15 ° C., rifampicin was added 1 hour after cold transfer of rifampicin and RNAs were added 0 (lane 5), 5 (lane 6), 10 (lane 7), and 20 after addition of rifampicin. Extracted after minutes (lane 8). Primer extension was performed. (B) Graph of the results for 37 ° C. and 15 ° C. shown in (A). The radioactivity of the transcript was measured using Phosphoimager and was prepared with 0% at 0% using the transcript: pMM022 (●); pMM023 (□); pMM024 (■); pMM025 (Δ); And pMM026 (▲).

11 shows analysis of mRNA levels and translation efficiency. (A) Primer extension analysis of cspA-lacZ fusions. In the middle of the logarithmic phase, the culture of E. coli Ar137 containing various plasmids was transferred from 37 ° C to 15 ° C. RNAs were extracted from the culture after 0 hours (lane 1), 0.5 hours (lane 2), 1 hour (lane 30, 2 hours (lane 4), and 3 hours (lane 5) after the temperature drop shift at 37 ° C. Primer extension was performed as described (Mitta et al. 1997) (B) Graph of relative amounts of mRNA from the radioactivity of transcripts shown in (A) using pMM67 transcript at 37 ° C. as 1 The amounts were calculated: Relative amounts are shown at the top of each column: column 1, 0 hours; column 2, after 0.5 hours; column 3, after 1 hours; column 4, after 2 hours; column 5, after 3 hours. C) Relative translational efficiency of cspA-lacZ mRNA The translational efficiency at 15 ° C. was calculated by dividing the increase in beta galactosidase activity by the amount of mRNA using the following formula for the first two hours after cold shock: [(Gal 2h) x (OD 2h)-(Gal 0h) x (OD 0h)] / (avg.mRNA), wherein (Gal 0h) and (Gal 2h) are on, respectively. Beta-galactosidase activity 0 and 2 hours after degree transition, and (OD 0h) and (OD 2h) are absorbance at 600 nm of cultures 0 and 2 hours after temperature transition, respectively; and (avg. MRNA ) Is the relative mean mRNA amount after 0.5, 1 and 2 hours after the temperature transition The relative translation efficiency of each mRNA was calculated with the efficiency of mRNA of pMM 67 as 100%: Column 1, pMM67, Column 2, pMM022; Column 3, pMM023; column 4, pMM024; column 5, pMM025; and column 6, pMM026.

12 shows the sequence similarity of cspA, cspB, cspG and cspI mRNAs of SD sequence attention and potential base binding between cspA mRNA and 16S rRNA. Nucleotide numbers of cspA (Tanabe et al. 1992), cspB (Etchegaray et al. 1996), cspG (Nakashima et al. 19960 and cspI mRNA (Wang et al. 1999) are given as +1 at the major transcription initiation sites. The same nucleotides in the three csp mRNAs are shown in bold type: The 13-base cognate sequences in cspA, cspB, cspG and cspI are boxed (upstream box). The location is underlined The potential base pair bonds between cspA mRNA and 16S rRNA are indicated by vertical lines The locations of sites sensitive to RNase VI (powers et al. 1988) are indicated by dotted lines.

13 shows the role of the 13-base upstream box sequence at the cspA 5′-UTR site in cspA-lacZ expression. (A) Preparation of capA-lacZ fusions. Constructs were drawn in the same manner as shown in FIG. 9A except for a box of wavy lines representing the 13-base upstream box sequence 5'-GCCGAAAGGCACA-3 '(SEQ ID NO: 48) upstream of the SD sequence. pKNJ37 is identical to pMM007 except that the 13-base sequence is deleted. In both pMM007 and pKNJ37, cspA is translated fused to lacZ. pKNJ38 is identical to pKM67 (Mitta et al. 1997), except that a 13-base sequence was added by replacing the DNA fragment between XbaI and HindIII with a synthetic oligonucleotide. In both pKM67 and pKNJ38, cspA is translated fused to lacZ. (B) cold shock induction of beta-galactosidase. cspA-lacZ fusions: pMM007 (o); pKNJ37 (●); pKM67 (Δ); And pKNJ38 (▲).

FIG. 14 compares secondary structure of 5′-UTRs for deletion constructs. The secondary structure of the 5'-UTR of each deletion construct was predicted using a nucleotide sequencing program (DNASIS-Mac; Hitachi Software Enginnering Co. Ltd) based on the method of Zuker and Stieger, 1982. Nucleotides were numbered in cspA mRNA starting with the transcription start site +1. Deletion positions in each variant are indicated by arrows using the nucleotide numbers of the deletion site. The highly conserved 13-base sequence of the SD sequence designated as the upstream box is indicated by a box. Initiation codons and SD sequences are also boxed.

15 shows cspB translation improvement by DB. (A) cspB-DB-inverse-DB complementarity: The cspB-DB sequence is boxed and covers the range of codons 5 to 9 (Mitta et al. 1997). Possible base pair binding between additional cspB mRNA-16S rRNA downstream of the DB is also shown. AUG codons are circled, SD sequences are boxed, L-shaped arrows indicate where the cspB gene is fused to lacZ (B) Translation cspB-lacZ fusion construct. At the top, the E. coli cspB gene is shown from its 5 'end. For pB3, pB13 and pB17, the lacZ gene is fused with cspB at residues +177 (3aa), +200 (13 aa) and +212 (17aa). pB13sd and pB17sd are identical to pB13 and pB17 except that their SD sequences were converted from 5′-AGGA-3 ′ to 5′CTTC-3 ′, respectively. (C) Beta-galactosidase activity of cspB-lacZ constructs obtained before (time 0) and after (between 1, 2 and 3) temperature transition from 37 ° C. to 15 ° C. E. coli AR137 cells were transformed with pB3, pB13, pB13sd, pB17 and pB17sd and grown, and then in the middle of the logarithmic phase (OD600 = 0.4), the cultures were transferred from 37 ° C to 15 ° C and beta-galactosidase Activity was measured. (D) mRNA levels of pB3, pB17 or pB13sd after temperature transition from 37 ° C. to 15 ° C .: cspB-lacZ mRNA was detected by primer extension before temperature reduction transition (time 0) and 1, 2 and 3 hours after temperature transition. . (E) mRNA stability from pB3, pB13, pB17 and pB13sd: E. coli AR137 cells transformed with pB3, pB13, pB17sd were grown under the following conditions. In the middle of the logarithmic growth phase, the culture was transferred to 15 ° C. and after 30 minutes, rifampicin was added at a final concentration of 0.2 mg / ml (time 0). Total RNA was extracted 5, 10 and 20 minutes after rifampicin addition. cspB-lacZ mRNAs were detected by primer extension.

16 shows the effect of a fully bound DB to enhance the translation of cspA. (A) Translation cspA-lacZ fusion construct. The cspA gene structure is shown from the 5 'end up. pJJG78DB1 and pJJG78DB2 were constructed from pJJG78 as described in the experimental procedure. The DB sequences of pJJG78DB1 (12 pairs) and pJJG78DB2 (15 pairs) are shown below. (B) Beta-galactosidase activity of cspA-lacZ fusion constructs after cold shock at 15 ° C. E. coli AR137 cells transformed with pJJG78, pJJG78DB1 or PJJG78DB2 were grown in LB medium and in the middle of the logarithmic growth phase (OD600 = 0.4), the cultures were transferred from 37 ° C. to 15 ° C. Beta-galactosidase activity was measured before (transmission time 0) and 1, 2, and 3 hours post-transition. (C) deletion of cspA-lacZ mRNA. Total RNA was extracted and used as a template for primer extension as described above from E. coli AR 137 cells containing pJJG78, pJJG78DB1 or PJJG78DB2. (D) mRNA stability from cspA-lacZ constructs. E. coli AR137 cells transformed with pJJG78, pJJG78DB1 and pJJG78DB2 were grown as described above. In the middle of the logarithmic growth phase, the cultures were transferred to 15 ° C. and 30 minutes later rifampicin was added at a final concentration of 0.2 mg / ml (time 0). Total RNA was extracted 5, 10 and 40 minutes after rifampicin addition. cspA-lacZ mRNA was detected by primer extension.

17 shows that the complete pair DB improves translation at 37 ° C. (A) pIN-lacZ construct. XbaI-SalI fragments from pJJG78 or pJJG78DB2 were inserted into the XbaI-SalI site of pIN-III to make pINZ and pINZDB1 and used to prepare pINZDB2, pINDB3 and pINZDB4, respectively. (B) Beta-galactosidase activity of the pINZ-lacZ construct. E. coli AR 137 cell cultures transformed with pINZ, pINZDB1, pINZDB2, pINZDB3 and pINZDB4 were grown at 37 ° C. under the same conditions described in FIG. 1. IPTG (1 mM) was added to each culture in the middle of the logarithmic phase. Beta-galactosidase activity was measured before IPTG addition (time 0) and after 0.5, 1, 2 and 3 hours. (C) mRNA sequence of pIN-lacZ construct showing the location of SD, AUG and DB. lacZ at pJJG78 has a 10-pair DB. The complete DB pair located after the fifth codon has 16 residues complementary to the inverse DB. (D) shows the rate of beta-galactosidase synthesis of the pINZ-lacZ construct. Cultures of E. coli AR137 cells containing pINZ or pINZDB1 were grown at 37 ° C. under the conditions described above. IPTG (1 mM) was added to each culture in the middle of the logarithmic growth phase. Beta-galactosidase synthesis rates were measured before IPTG addition (time 0) and after 0.5, 1, 2, 3 and 4 hours. Cells were pulse-labeled with trans- [35S] -methionine. Cell extracts from each time point were analyzed by 5% SDS-PAGE and beta-galactosidase synthesis was measured by phosphorimager. The beta-galactosidase synthesis ratios of pINZ and pINZDB1 are shown at each time point.

18 shows the ribosomal fraction of E. coli JM83 transformed with pINZ or pINZDB1. Ribosome particles were isolated as described by Dammel and Noller 1995. Cultures of E. coli JM83 containing pINZ or pINZDB1 were grown at 37 ° C. in LB medium containing 50 mg / ml ampicillin. In the middle of the logarithmic phase (OD600 = 0.4) 1 mM IPTG was added to each culture. Chloramphenicol (0.1 mg / ml) was added 15, 30 and 60 minutes after IPTG addition. Cell extracts were then spread on top of 5-40% (w / w) sucrose constructs. Polysomes and ribosomal units were separated by centrifugation at 15 ° C. for 2.5 hours at 4 ° C. Polysome Profiles were Detected Using the FPLC System 0.2 ml from each fraction (0.5 ml) was transferred onto nitrocellulose membranes using the Minifolod II Slot-Blot System (Schleicher and Schuell). lacZ mRNA was detected by hybridization using [32P] -labeled M13-47. Phosphoriser values from the hybridization are shown on the right. pINZ and pINZDB1 mRNAs are indicated by blocked and open squares, respectively.

19 shows translational enhancement by DB which fully binds at 37 ° C. (A) Measurement of pINZ and pINZDB1 mRNAs. Cultures of E. coli JM83 containing pINZ or pINZDB1 were incubated at 37 ° C. under the conditions described in FIG. 4. Total RNA extracted 15, 30 and 60 minutes after addition of IPTG (1 mM) was used as a template for primer extension according to the procedure described above. (B) Beta-galactosidase activity of pINZ and pINZDB1 in a multi-copy expression system. E. coli JM83 transformed with pINZ or pINZDB1 were grown at 37 ° C. under the conditions described in FIG. 20A. Beta-galaltosidase activity was measured before (hour 0) and 0.5, 1, 1.5, 2 and 2.5 hours (open circles and squares) before addition. Blocked circles and squares indicate activity in the absence of IPTG.

20 shows cell free synthesis of beta-galactosidase from pINZ and pINZDB1. (A) pINZ or pINZDB1 DNA (160 ng; 1 ul) was added to E. coli 30S extract (20 ul) (Promega) and subjected to transcription-translational binding reaction. Lane 1, pINZ DNA; Lane 2, pINZDB1 DNA; And lane 3, control reaction without added DNA. Samples were precipitated with acetone and analyzed by 15% SDS-PAGE to detect the production of beta-galactosidase. (B) Time course in vitro synthesis from pIN and pINZDB1 was performed as described above. Samples were taken after incubation at 37 ° C. for 15, 30, 60 and 120 minutes. (C) Each reaction from each of the time course experiments described above was run in duplicate using non-radioactive methionine, transferred to nitrocellulose membrane and hybridized with [ ³² P] labeled M13-47 oligonucleotide.

22 shows enhanced translation of pINZDB1 in cells using S2-deficient ribosomes. (A) Beta-galactosidase activity from pINZ and pINZDB1. E. coli CS240 and CS239 (Shean and Gottesman 1992) were transformed with pINZ or pINZDB1 and grown at 30 ° C. in LB medium. In the middle of the logarithmic phase the cells were transferred to 42 ° C. in the presence of 1 mM IPTG. Beta-galactosidase activity was measured in Miller units before transition to 42 ° C. (time 0) and after 0.5, 1, 1.5, 2.5 and 3.5 hours. (B) Induction of relative lacZ expression in cells between pINZDB1 and pINZ using S2-deficient ribosomes. Prior to the transition to 42 ° C. (time 0), the rate of beta-galactosidase expression from pINZ and pINZDB1 at CS239 for CS240 was determined as 1 and thus the rate after transition to 42 ° C. was calculated.

Summary of the Invention

The present invention encompasses isolated nucleic acid molecules that prolong the expression of cold shock inducing genes under conditions of physiological stress leading to cold shock in bacteria.

The invention also encompasses isolated nucleic acid molecules that inhibit the expression of cold shock inducing genes under physiological conditions.

The invention also encompasses isolated nucleic acid molecules that enhance the translation of cold shock inducing genes under conditions of physiological stress that elicit cold shock responses in bacteria.

Three essential factors that regulate the suppression of genes expressed under conditions of physiological stress that elicit a cold shock response in bacteria, mediated by the 5'-untranslated region (5'-UTR) of mRNA transcripts encoding cold shock inducing proteins The process was found. Special regions of the 5'-UTR of cold shock mRNA transcripts (A) transient nature of cs gene expression after cell exposure to physiological stresses that induce a cold shock response, (B) inhibition of cs gene expression at physiological temperature, And (C) mediate translation enhancement of cold shock induced mRNA transcripts by ribosomes.

DNA constructs encoding such inhibitory elements alone or in combinations thereof or in combination with other inhibitory sequences known in the art, such as promoters, downstream boxes and transcription termination sequences, may be used to induce physiological induction of bacterial low temperature shock response. It can be used for prolonging the expression of cs gene or heterologous gene under conditions, improving the translation efficiency and inhibiting the expression of these genes under normal physiological conditions. This may result in hyper-expression of the desired protein product, which may be unstable at physiological temperature, improperly overlap or exist in the inclusion body in the host cell at physiological temperature, or may be disrupted by the host cell. expression)

The present invention also provides the advantage that the translation of normal cell proteins is inhibited under conditions in which the preferred protein product is overexpressed. This allows the desired product to accumulate in the host cell and simplifies the separation of the desired product from the host cell polypeptide.

Accordingly, the present invention also encompasses transgenic bacteria having a vector comprising one or more of the aforementioned elements and a transgenic bacterium having one or more of the aforementioned elements and a vector having the gene sequence of interest for expression. Such target sequences may be cold shock gene sequences or heterologous genes.

As reported by Sprengart et al., The bacterial downstream box (DB) plays an important role in the translation of mRNA producing proteins. The DB binds to a portion of the bacterial 16S rRNA near the 3 'end and places the mRNA and rRNA in appropriate relative positions for translation to occur.

During the time when ADB binds to the DB of overexpressed mRNA, the 16S rRNA cannot participate in the translation of cellular mRNA rather than the bound overexpressed mRNA. Bacterial whole protein production machinery can be suspended by supplying the bacteria with an mRNA that coats the DB complementary to the ADB of the 16s RNA that binds all or substantially all of the 16S rRNAs.

The term "complementary" as used herein includes "substantially complementary". Thus, the term "complementary" does not require complete complementarity. The two sequences are "complementary" as defined by Kahl, Dictionary of Gene Technology VCH Publisher, InC (1995), incorporated herein by reference. That is, it is complementary if the two nucleotide sequences can form a double helix that is hydrogen bonded to each other according to the Watson-Crick base binding law. Two complementary RNA sequences or RNA and DNA sequences form a bond of A-U, G-C or G-U. There is no need for "complete complementarity".

As used herein, "homolog" refers to a molecule that has a molecular sequence that is substantially the same as the referenced nucleic acid sequence, but may include an additive, a deletion or a substituent. Homologous molecules are defined as such molecules that hybridize with reference nucleic acid molecularly precisely complementary nucleic acids under low or high stringency conditions and perform the same function as the referenced nucleic acid.

For example, and not by way of limitation, low stringency conditions for hybridization are: a filter containing DNA was run at 40 ° C. for 6 hours at 35% formaldehyde 5 × SSC, 50 mM Tris-HCl (pH 7.5), 5 mM. Solution containing EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA, and 500 μg / ml salmon sperm DNA, 10% (wt / vol) dextran sulfate, and 5-20 × 10 ⁶ cpm 32P-labeled probe Preheat at The filter is then incubated in the hybrid mixture at 40 ° C. for 18-20 hours and washed in a solution containing 2 × SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA and 0.1% SDS at 55 ° C. for 1.5 hours. . This wash solution is replaced with a fresh wash solution and incubated another 1.5 hours at 60 ° C. The filter is blotted dry and exposed to perform radiography. Preferably or if necessary, a third washing step is carried out at 65-68 ° C. for 1.5 hours and the filter is reexposed to the film.

For example, and not by way of limitation, high stringency conditions are as follows: the filter containing the nucleic acid to be probed was run at 65 ° C. for 8 hours to overnight, 6 × SSC, 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 0.02. Prehybridization is performed in a buffer containing% PVP, 0.02% Ficoll, 0.02% BSA and 500 μg / ml denatured salmon sperm DNA. The filter is hybridized in a prehybridization mixture containing 100 μg / ml denatured salmon sperm DNA and 5-20 × 10 ⁶ 32P-labeled probes at 65 ° C. for 48 hours. Washing of the filter was performed in a solution containing 2 × SSC, 0.01 PVP, 0.01% Ficoll and 0.01% BSA for 1 hour at 37 ° C., followed by washing in 0.1 × SSC for 45 minutes at 50 ° C. The filter is blotted dry and exposed to perform autoradiography. Alternative methods for high and low stringency hybridization, well known in the art, may be used alternatively.

As noted, the ADB is about 14 base nucleotide sequences located at the 3 'end portion of the 16S rRNA, near the decoding site of the 16S rRNA. Known bacteria 16S rRNA nucleotide sequences are known and can be found in the GenBank database. Thus, for a selected bacterium, the ADB can be readily identified by comparing the sequence of the ADB to a known bacterium, eg, E. coli. Once the ADB is identified, a DB complementary to the ADB can be prepared and allowed to be contained in the appropriate mRNA as described below.

The mRNA of the present invention is mRNA isolated or mRNA transcribed from the isolated DNA. The mRNA comprises a codon that is an initiation codon, preferably AUG. Other suitable start codons for the mRN include GUG and UUG.

MRNAs of the invention also typically comprise a downstream box sequence that is 3 'to the initiation codon. The codon of the DB may or may not be in-frame with the start codon. The DB sequence can be right next to the initiation codon so that there are no intervening nucleotides. Generally, the DB is separated from the start codon by interfering nucleotides between 1 and 30 nucleotides in size. The base sequence of the interference sequence is not critical and may consist of any nucleotide sequence. Preferably, the interfering nucleotide sequence is 7-15 nucleotides in size and most preferably 12 nucleotides in size. In addition, the DB may overlap with the start codon. That is, any one of the three nucleotides of the start codon of the mRNA of the present invention may form the 5 'end of the DB.

The DB sequence of the mRNA of the present invention is a nucleotide sequence complementary to the ADB of the bacterial 16S rRNA. Although the DB may be at least 20 bases, in general, the DB is 6 to 20 bases in size and preferably 8 to 14 bases in size. For example, the DB may contain nucleotides that are complementary to nucleotides that are 3 ', 5' or both to ADB. Regardless of the length of the DB, higher complementarity between the DB and ADB is associated with more effective annealing, which results in more effective inhibition of bacterial protein synthesis, according to the method of the present invention.

In addition to the start codon, the DB and any interfering sequences, the mRNA constructs of the invention may comprise a nucleotide sequence at 5 'of the start codon or at 3' of the DB.

For example, the mRNA construct may comprise a sequence at 3 'of the DB encoding the polypeptide or include a stop codon. Likewise, the mRNA construct may contain an untranslated sequence and / or a shine-dalgano sequence at initiation codon 5 '.

Except for any additional nucleotides at the 5 'or 3' end, the length of the mRNA construct, including the initiation codon, any interference sequence, and the DB, is between 8 nucleotides and 45 nucleotides in length. Of course, if the mRNA comprises a 5 'or 3' sequence in addition to the necessary components, such as the Shine-Dalgarno sequence, the mRNA can be longer to several hundred nucleotides in length.

Preferably, although not required, the mRNA construct lacks a site for enzymatic cleavage for RNA endonucleases. Particularly preferably there is no enzymatic cleavage site for the RNA endonuclease in the portion of the mRNA construct comprising the essential part of the construct, ie the start codon and the DB, otherwise the mRNA construct is degraded and the bacterial 16S rRNA Freely binds to bacterial mRNA.

MRNA constructs of the invention may have sequences that are similar or identical to mRNA sequences found naturally in bacteria. For example, several low-temperature mRNAs, such as mRNAs for the E. coli protein CspA, CspB, CspG, CsdA, and RbfA, are substantially complementary to the ADB of the shine-dalgano sequence, initiation codon, and E. coli 16S rRNA. And a downstream box. Other E. coli mRNAs, including the Shine-Dalgarno sequence, initiation codons and downstream boxes complementary to E. coli ADB, include RecA, Hns, NusA, InfB and CspD.

Non-limiting examples of suitable DBs for mRNA constructs are provided below. Each DB below is substantially complementary to the ADB of E. coli 16S rRNA with ADB.

ADB 3 '(-1481) UACUUAGUGUUUCA (-1469) 5' (SEQ ID NO: 1)

DB # 1: 5'AUGACUGGUAUCGU3 '(SEQ ID NO: 2)

DB # 2: 5'AUGACUGGUUUCGU3 '(SEQ ID NO: 3)

DB # 3: 5'AUGACUGGUUUAGU3 '(SEQ ID NO: 4)

DB # 4: 5'AUGAGUUAUGUAGA3 '(SEQ ID NO: 5)

DB # 5: 5'AUGGCGAAAAGAAU3 '(SEQ ID NO: 6)

Suitable mRNA constructs according to the invention can be prepared using any of the above or other suitable DBs. For example:

5'AUGX _(n) AUGACUGGUAUCGU3 '(SEQ ID NO: 7)

Where n is the total number from 0 to 30, X is G, C, U or A and each X occurrence is the same or not the same as another X occurrence. Alternatively, the 5 'end of the DB overlaps the start codon.

The DNA of the present invention is isolated DNA encoding mRNA suitable for the mRNA construct of the present invention. The DNA may further comprise additional nucleotide sequences comprising a promoter sequence towards the 5 'direction of the start codon. The promoter sequence can be used to regulate the transcription of mRNA constructs. The DNA may comprise a sequence having a function other than a promoter such as a shine-dalgano sequence in the 5 'direction of the initiation codon and / or a sequence having an unknown action. The DNA may comprise a stop codon sequence in the 3 'direction of the portion encoding the DB of the mRNA construct, or a sequence encoding a polypeptide and a sequence required for transcription termination.

Examples of suitable DNA for encoding mRNA constructs of the invention are 5'ATGY _(n) ATGACTGGTATCGT3 '(SEQ ID NO: 8), where n is the total number from 0 to 30, Y is G, C, T or A, and each Y occurrence is the same or not the same as another Y occurrence. Alternatively, the 5 'end of the DB overlaps the start codon ATG. DNA may include additional sequences at the 5 'and / or 3' ends of the DNA.

DNA sequences of the invention can be included in mediators or cloning vectors, such as plasmids or phage vectors. The DNA sequence in the vector can be located under the control of a promoter sequence located in the 5 'direction of the start codon. These vectors, including the DNA of the present invention, can be used to transform host bacteria that can be used to overexpress the mRNA of the present invention, ie bacteria transformed to higher levels than those produced in similar untransformed bacteria. MRNA is prepared. Any bacterium that can be transformed by the cloning vector is suitable as a host of the DNA sequences of the present invention. Methods of making cloning vectors and transforming bacteria are well known in the art, see, for example, Ausubel et al., "Recent Molecular Biology Protocols", J. Wiley & Sons, Inc. (1995).

Overexpression of the mRNA sequences of the present invention results in the production of mRNA at levels higher than those normally expressed in bacteria. Depending on the extent of mRNA overexpression, the production of bacterial proteins is inhibited. If mRNA is expressed at high levels, bacterial protein production will be completely stopped, ultimately causing the bacteria to die.

Therefore, constructs that produce mRNA are useful as antibiotics that inhibit or kill bacterial growth. The mRNA producing construct can be filled into bacteriophage, which allows the mRNA to be used as an infection prevention or topical antibiotic. The delivery strategy is thought to be designed to allow transformation of bacteria that cause food or animal infections, such as humans, dogs, cats, cattle, horses and poultry.

According to the method of the present invention, mRNAs comprising the initiation codon and the DB complementary to the ADB of the bacterial 16S rRNA are induced to be overexpressed in the bacterium and then annealed with the ADB of the bacterial 16S rRNA, by another mRNA in the bacteria. Suppresses the production of encoded proteins.

Any means of delivery that cause overexpression of the mRNA of the invention is suitable for the method of the invention. For example, the bacteria can be transformed by a medium containing a DNA sequence encoding the mRNA of the present invention.

If desired, expression of the mRNA sequences of the invention is controlled by placing the DNA sequence under the control of an inducible promoter. For example, if it is necessary to kill harmful bacteria or inhibit growth while competing for beneficial bacteria, the DNA sequence can be placed under promoter control that is only reactive to products present only in the first bacteria.

Another means of controlling the expression of protein production-inhibiting mRNA sequences is to use DNA sequences encoding mRNAs that are unstable under certain conditions.

For example, the mRNA 5 ′ untranslated region (5′UTR) of E. coli cold shock protein CspA comprises a 5 ′ region of the shine-dalgano region that is sensitive to degradation by RNase E at a temperature of about 37 ° C. Therefore, cspA mRNA containing 5'UTR has a half-life of about 12 seconds and is unstable under normal growth conditions. Other cold shock proteins such as E. coli CspB and CsdA are unstable at menstrual growth temperatures due to their mRNA instability. Under low temperature shocks, such as cooling to 15 ° C., the half-life of cspA mRNA increases rapidly up to about 15 minutes, which is 75 times the mRNA stability at normal physiological growth temperature.

This region, or 5'UTR of cspB or csdA mRNA, can be used to modulate the expression of the mRNA sequence of the present invention, as mRNA containing the 5'UTR of cspA mRNA is indeterminate at 37 ° C. Antibiotic effect is only exerted at or below physiological growth temperature. Cold shocked bacteria require new ribosomal elements, and their synthesis is inhibited by overproduction of mRNA containing DN sequences, so the antibiotic effect of the method of the present invention is enhanced under cold shock conditions.

The antibiotic effect of the method of the present invention, wherein the mRNA of the present invention is caused to be overexpressed in bacteria, increases simultaneously with the increase in the number of copies of the mRNA to be expressed. That is, minimal overexpression of the mRNA of the present invention inhibits protein production by bacteria, while the inhibition will not be sufficient to further inhibit the growth of bacteria or kill the bacteria. High levels of mRNA expression results are closely associated with increased protein production inhibition. If the copy number is high enough in bacteria, protein production will be completely suppressed.

Similar effects are known to be associated with ADB of bacterial 16S rRNA and DB complementarity of overexpressed mRNA. Overexpression of mRNA containing DB with 100% complementarity will bind more efficiently with ADB compared to mRNA containing DB with lower (75%) complementarity. Therefore, the protein inhibitory effect of mRNA with higher DB complementarity will be more pronounced compared to mRNA with lower DB complementarity. Therefore, when using mRNA with lower DB complementarity, obtaining the same or similar antibiotic effect as compared to having mRNA with higher DB complementarity would be useful for expressing mRNA with higher copy number.

In addition, the translation inhibition properties of the downstream box are advantageous for overexpression of heterologous genes in transformed bacteria after cold shock. Inhibition of translation of endogenous bacterial proteins causes high levels of heterologous gene products to accumulate in the transformed organism. In addition, constructs comprising a strong promoter and a downstream box coupled with the 5 'untranslated site of the cold shock inducing gene, which act to stabilize mRNA transcription under reduced temperature, will efficiently regulate the expression of high levels of heterologous genes under reduced temperature. .

Another important embodiment of the present invention relates to the role of the 5′-terminal untranslated region of mRNA for cspA, the major cold shock protein of E. coli, in cold shock adaptation.

When the incubation temperature of Escherichia coli cells growing in log phase is changed from 37 ° C. to 10 ° C., there is a lag period before starting cell growth again (Jones et al., 1987). Similar to the high temperature shock reaction, E. coli responds to temperature drops by inducing a specific type of gene expression called the low temperature shock reaction, including a series of protein induction called the low temperature shock proteins (Jones et al. 1992; Jones and Inoue 1994). . Cryogenic shock reactions occur during the period of adaptation of cell growth, which is thought to be required for cellular adaptation to low temperatures.

CspA, the major cold shock protein in Escherichia coli, is induced rapidly when temperature drops, and its synthesis reaches 13% of total protein synthesis (Goldstein, 1990). However, CspA production during the cold shock reaction is temporary and drops to low levels when cell growth begins at low temperatures. CspA consists of 70 amino acids and is 43% identical to the cold shock domains of eukaryotic Y box proteins known to be involved in gene regulation and mRNA masking (Wolfe et al., 1992; Wolfe, 1993). The tertiary structure of CspA was measured, consisting of five anti-parallel β plates forming β-pipe structures (New Kirk et al., 1994; Schindelin et al., 1994). The two RNA binding sites RNP1 and RNP2 are identical to the β2 and β3 plates. Seven of the eight fragrant residues are located on the same surface, and single-stranded DNA is linked to these surface aromatic residues (Newkerk et al., 1994). It is also suggested that CspA acts as an RNA chaperone that increases translation efficiency at low temperatures (Jones and Inoue, 1994).

Cold box

In one embodiment of the invention, the DNA sequence can sustain the transient expression of cold shock genes while bacteria adapt to the physiological stresses that cause cold shock reactions. Therefore, the temporal nature of the cold shock reaction and normal transient expression of the cold shock inducing gene are suppressed and expression continues at a high level for a longer time, for about 2-3 hours. DNA sequences capable of conferring such activity include a 5'-UTR or at least a 5'UTR portion and promoter of a 5'-UTR that is active under physiological stress conditions that induce a cold shock response. In addition, it was found that the entire 5'-UTR is not needed, and that a sequence that inhibits the transient expression of a cold shock gene such as cspA is present in the first 25 nucleotides of the 5'-UTR.

Comparison of nucleotide sequences with these activities with other cold shock genes revealed that cspB, cspG and csdA have similar sequences in their 5'-UTR and expressed in a transient manner in response to physiological stresses that induce a cold shock response. It is shown. This means that the genes are regulated in a similar way to cspA. Based on this sequence comparison, it can be seen that the sequences involved in the activity, hereinafter referred to as cold boxes, are located between +1 and +11 nucleotides of cspA, cspB, cspG and csdA 5'-UTR.

Coldboxes normally function to down-regulate the expression of cold shock genes. This was revealed by hyperexpression of cspA 5-UTR in Escherichia coli which leads to prolongation of E. coli cold shock gene expression. Coldboxes probably interact with the CspA protein itself or with another protein whose action depends on CspA. This was confirmed through observation of inhibition of hyperexpression and continuous expression of CspA protein in E. coli. Therefore, the cold box is likely to contain a repressor binding site that acts to suppress the expression of the cold shock gene after induction of the cold shock gene, thereby causing the transient expression of the gene. As CspA protein levels increase after gene induction, CspA initiates interactions with coldbox by directly binding to coldbox sequences or by indirectly stimulating another factor that interacts with coldbox and inhibits cold shock induction genes. cause.

Low temperature shock gene expression refresher at physiological temperature

5'UTR is unique because it is longer than most E. coli UTRs. The 5'UTR is responsible for several functions in cspA expression. It inhibits cspA expression at 37 ° C. This different activity was mapped through the analysis and preparation of defined deletions through the 5'-UTR site of Yamanaka et al. The sequence involved in cspA expression suppression at 37 ° C is between +56 and +117 of cspA 5'-UTR (see Yamanaka et al., Unpublished manuscript). For optimal inhibition it seems likely to require other sequences in the 5'-UTR. In other words, the effect of removing the +56 to +117 sites is important and does not take into account the overall level of inhibition observed with complete 5'UTR. Therefore, he also concluded that other sequences also play an important role in inhibiting cspA expression at 37 ° C. However, the localization of the minimal inhibitory active moiety to a particular region of the 5'-UTR is novel. 5'-UTR begins to cleave into the action domain and the +56 to +117 sites represent new sites of action.

UTRs also have a positive effect on mRNA stability at 15 ° C. This was measured through the increase to similar stability levels of mRNA constructs with UTRs. However, although a large number of mRNAs were present in the experiment, mRNAs are not translated unless a DB is present.

Therefore, the effect of increasing mRNA stability and increasing mRNA translation is mediated by sequences associated with cspA transcription. However, certain sequences that mediate RNA stability have not been well characterized at this site.

Improved translation of cold shock mRNA

5'-UTR enhances the translation of cspA transcription through sequences located between +117 and +143. Comparison of these sites for different cold shock induction revealed that 13 base sequences (+ 123- + 135) with the 5'-GCCGAAAGGCACA-3 'sequence were present in both cspA, cspB and cspGdp and improved translation. Therefore, the sequence mediates efficient mRNA translation. These 13 base sites show similarity to 16S rRNA similar to the previously observed DB, and the new translational enhancement site is complementary to different sites of 16S rRNA rather than DB. Therefore, this 5'-UTR site also aids csp mRNA translation with a downstream box-like mechanism that interacts with ribosomal RNA.

In another embodiment of the invention, expression plasmids have been prepared that allow expression at high levels of cryoshock inducing or heterologous genes. The expression plasmid comprises a DNA fragment encoding a 5′UTR or cold shock inducing gene region comprising one or more regulatory elements located downstream of a promoter that operate under physiological stress conditions inducing cold shock responses in bacteria. The promoter may be selected from the group comprising the cspA, cspB, cspG or csdA promoter, E. coli lpp promoter, or other promoters active under physiological stress conditions. The expression plasmid may also include DNA fragments encoding the 5′-UTR and transcription termination sequences, including one or more regulatory elements downstream of the promoter. Examples of transcription termination sequences are well known in the art and include sequences such as the popular strain rrnB terminator.

Expression plasmids of the invention may also comprise a restriction site or multiple restriction sites, said sites, or sites located between 5'-UTR encoding one or more regulatory elements and transcription terminators to facilitate insertion of heterologous genes. have.

Finally, expression plasmids of the invention may comprise additional sequences known in the art to facilitate efficient transcription of the expression gene. The sequence may comprise a DNA fragment encoding a shine-dalgano sequence located between the 5′UTR sequence and a restriction site, a shinedallano sequence and / or a downstream box located between the restriction sites. The source of the shinedalgano sequence is not particularly limited and may be derived from cold shock proteins or may be derived from other genes. The expression plasmid may be involved in the expression of high levels of heterologous genes for prolonged periods of time under physiological stress conditions causing a cold shock response of bacteria. Under these conditions, endogenous protein synthesis by the host bacteria is inhibited, which allows the heterologous gene product to accumulate at high levels in the cell.

In a preferred embodiment of the present invention, the expression vector comprises a promoter, 5′UTR, cold box, Shindalgano sequence and downstream box (DB). The expression vector can be used to allow the nucleic acid molecule encoding the protein of interest to be inserted into the expression vector using at least one restriction site.

In another embodiment of the invention, nucleic acid molecules encoding proteins that are unstable or improperly formed in bacterial host cells at physiological temperatures can be expressed at temperatures lower than the physiological temperature of the host cells. The nucleic acid molecule may preferably be inserted into a restriction site frame or at a site that allows nucleic acid transcription and mRNA translation. These conditions facilitate proper protein formation, increase stability or reduce the rate of degradation of the expression product.

Plasmids or vectors can be used to transform bacteria by any method known in the art, including, but not limited to, calcium chloride transformation, electropermeation, and the like. The type of bacteria to be transformed is also not particularly limited. As a preferred embodiment E. coli is used. Transgenic bacteria can be used to overexpress the desired protein or can be used to produce large quantities of plasmids or vectors for substantial isolation or purification.

In a preferred embodiment for the overexpression of the protein of interest, the nucleic acid molecule encoding the protein of interest uses one or more restriction sites, preferably if the start codon is upstream of the insertion site for the protein of interest, using an initiation codon frame. Inserted into plasmid. Alternatively, if the nucleic acid molecule encoding the protein of interest has its own initiation codon, the nucleic acid encoding the protein of interest can be inserted into the plasmid and the self initiation codon will be provided as an initiation codon for transcription.

Constructs can be designed and manufactured to include selective markers. That is, for example, there is a drug resistance gene that allows the transgenic bacteria to grow in the presence of a drug that inhibits the growth of the non-transgenic bacteria. Any optional marker known in the art can be used. Examples of selective markers include, but are not limited to, ampicillin resistance, neomycin resistance, kanamycin resistance, and tetracycline resistance.

Constructs may also include inducible promoters. Induction promoters can induce the synthesis of the protein of interest. For example, it may include, but is not limited to, a lacZ promoter that can be induced by adding IPTG to the culture.

In a preferred embodiment, the construct will comprise a promoter having activity under conditions that induce a cold shock response in bacteria such as changing the temperature of the culture medium containing the transforming bacteria to 10-15 ° C. Preferably, overexpression of the target protein under conditions that induce a cold shock reaction results in reduced synthesis of one or more native bacterial proteins. More preferably, a large number of native protein synthesis is reduced or inhibited.

The following examples are provided to illustrate one aspect of the invention and should not be construed as limiting the scope of the invention as defined in the claims.

Example

Example 1: Plasmid Preparation

PJJG02 was prepared from pJJG01 (Goldenstein et al., 1990) by the following method: A 998-bp fragment containing the whole cspA gene was obtained from HindIII and XmnI cleavage from pJJG01. This fragment was then treated with a cleno fragment of DNA polymerase and inserted into the SmaI position of pUC9.

pJJG21 was prepared from pJJG02 by creating an XbaI site upstream of the following Shine-Dalgano sequence:

+13 AATTT (A) C (T) TAG (A) AGGTAA + 153 (SEQ ID NO: 9) (the native nucleotides in parentheses were replaced with underlined nucleotides). pJJG81 was prepared from pJJG02 by creating an XbaI site upstream of the transcription initiation site of cspA having the following sequence: + 1ACGGTTCTAGACGTA + 15 (SEQ ID NO: 10) (underlined nucleotide refers to insertion base)

pJJG78 is a transcription hybrid of the lacZ and 0.6 kb cspA upstream sites hybridized by the following method: The 1-kb EcoRI / BamHI fragment containing cspA from pJJG21 was filled with a Klenow enzyme and inserted into the SmaI site of pUC19. . The 0.6-kb XbaI fragments, including cspA regulatory sites (-457 to +143), were then cut and inserted into the XbaI site in pKM005 (Inoue, M et al., 1983) in the forward direction.

pUC 19-600 was constructed by inserting a 0.6-kb EcoRI / XbaI fragment into the EcoRI / XbaI site of pUC19 in pJJG21. PJJG81 / X, S, including fragment 1 (Figure 3), was constructed by removing the 0.74-kb XbaI / SalI fragment from pJJG81. Both ends were self-linked after treatment with Klenow fragments. All other structures shown in FIG. 3 were prepared by PCR (Beibmannheim Protocol). PCR extended fragments were inserted into the SmaI site of pUC19. All PCR products were identified by DNA sequence (Rank et al., 1977).

p2JTEK was constructed as follows. primer

3549 5'- CGGCATTAAGTAAGCAGTTG- 3 '(SEQ ID NO: 11)

And primer

4428 5'- CTGGATCCTTTAATGGTCTGTACGTCAAACCGT-3 '(SEQ ID NO: 12)

The PCR product by was cloned into the SmaI site of pUC19. This PCR product contains a CSPA from -146 to +25 because the cspA transcription start site is defined as +1. Subsequently primers cspA transcription terminator

6290 5'- CGGAATTCAGCCTGTAATCTCT- 3 '(SEQ ID NO: 13)

Primer 4860 5'- CTGTCGACTTACTTACGGCGTTGC-3 '(SEQ ID NO.14)

Amplified by PCR using. PCR products were then cloned into the plasmids described above digested with EcoRI and then digested with EcoRI and SspI. 52-bp Kpn and EcoRI from BlueScript IISK were cloned into EcoRI and KpnI sites. All PCR products were identified by DNA sequence (Sang et al., 1977).

p6m TEK is the first PCR different primers; primers

3552 5'- GACAGGATTAAAAATCGAG- 3 '(SEQ ID NO: 15)

And primer 6196 5'- AACCGTTGATGTGCA-3 '(SEQ ID NO: 16)

It was constructed in the same way as p2JTEK except that it was performed using. The PCR product contains cspA because the cspA transcription start site is defined as +1. All PCR products were identified by DNA sequence (Rank et al., 1977).

Pulse-label experiments were performed by the method described above (Jiang et al., 1993). Proteins were analyzed either by polyacrylamide SDS-gel electrophoresis (Inoue et al., 1982) or by two-dimensional electrophoresis (John et al., 1987) as described above.

Each 5′-UTR deletion was introduced by two step PCR. As a first step, two PCRs were performed for each variant. One reaction is primer,

67F, 5'- ccttgctagCCGATTAATCATAAATATG-3 '(SEQ ID NO: 17)

(nucleotides -67 to -49 of cpsA) and a variant primer # 4311 comprising a preferred variant sequence and assisting in cspA,

5'- ccggatccagGTTGAACCATTTT- 3 '(SEQ ID NO: 18)

(Complementary to +186 to +198) and also using a variant primer F which contains the same variant and is in the same direction in cspA. The lower case is the outer nucleotide for constructing the NheI or BamHI site (underlined) and the values are given using the major transcriptional introductory at +1 and determined by Tanabe et al. (1992). Regarding the construction of pMM022, pMM023, pMM024, pMM025 and pMM026, primer DIR,

5'- ACTACACT / TTGATGTGCATTAGC-3 '(SEQ ID NO: 19) (complementary with sequences from -15 to +1 / +28 to +35),

Primer D2R,

5'- CAACGATAA / GCTTTAATGGTCTGT-3 '(SEQ ID NO: 20) (complementary with sequences from +13 to + 27 / + 56 to +64),

Primer D3R,

5′-TAAAGG / CTCTTGAAGGGACTT-3 ′ (SEQ ID NO: 21) (complementary with sequences from +41 to + 55 / + 86 to +91),

Primer D4R,

5'- CGGCGATAT / AATGTGCACTACGAGGG-3 '(SEQ ID NO: 22) (complementary with sequences from +69 to + 85 / + 118 to +126),

And primer D5R,

5'- TACCTTTAA / GGCGTGCTTTACAGATT-3 '(SEQ ID NO: 23) (complementary with sequences from +101 to + 117 / + 144 to ++ 152)

Was used as variant primer R, primer D1F,

5'- GCACATCAA / AGTGTAGTAAGGCAA-3 '(SEQ ID NO: 24) (nucleotide-* to +1 / +28 to +42), primer D2F, 5'- TAAAGC / TTATCGTTGATACCC-3' (SEQ ID NO: 25) (nucleotides +22 to +27 / +56 to +70), primer D3F, 5'- TCAAGAG / CCTTTAACGCTTCAAAA-3 '(SEQ ID NO: 26) (+ 55 / + 86 to nucleotide +49) 102), primer D4F, 5'-GCACATT / ATATCGCCGAAAGGC-3 '(SEQ ID NO: 27) (nucleotides +79 to +85 / +118 to +132), and primers D5F, 5'-AAAGCACGCC / TTAAAGGTAATACACT- 3 '(SEQ ID NO: 28) (nucleotides +108 to +117 / +144 to +159)

Were used as variant primers F, respectively, and the position of each deletion is indicated by a slash. A plasmid containing wild type cspA, pJJG02 (Goldstein et al., 1990) was used as template DNA. Each set of first PCR products was then mixed, denatured, annealed and expanded with Taq polymerase. The product was further expanded using primer 67F and primer # 4311. The final PCR product was digested with NheI or BamHI and inserted into the XbaI-BamHI site of pKM005 (Inoue 1983). For pKNJ37, PCR fragments were cloned into pRS424X, pRS414 derivatives (Simons et al., 1987), which transformed the unique SmaI site into an Xbal site.

Regarding the construction of pMM007, primer 67F and primer # 4311 as primers and pJJG02 as templates were performed. PCR fragments were digested with NheI or BamHI and inserted into the XbaI-BamHI site of pRS414X.

pKNJ38 was constructed as follows: Oligonucleotide # 8509,

5'- CTAGCCGAAAGGCACAAATTAAGAGGGTATTAATAATGAAAGGGGGAATTCCA-3 '(SEQ ID NO: 29), and oligonucleotides # 8510, 5'- AGCTTGGAATTCCCCCTTTCATTATTAATACCCTCTTAATTTGTGCCTTTCGG-3' (SEQ ID NO: 30)

After annealing first, pKM67 (Mita et al., 1997) was cleaved using Xbal and HindIII.

DNA sequences of all constructs were identified for DNA sequences using the chain termination method (Sang et al., 1977).

Different plasmids with E. coli AR137 were grown at 37 ° C. and grown to medium-log phase in 15 ml M9-casamino acid medium using a 125 ml flask. Cultures were transferred to a 15 ° C. shaking water bath. Incubation temperature was raised from 15 ° C. to 37 ° C. for 2-3 minutes under the conditions used. 1.5 ml cultures were taken immediately before the temperature was reduced (0 hours) and cooled at 1, 2, 3, 5, 7 and 10 hours. Beta-galactosidase activity of the culture was measured according to the method of Miller (1972) et al. The analysis was performed in duplicate at each time point.

cspB DNA fragments were amplified by PCR using synthetic oligonucleotide primers containing a BamHI site at the 5 'end. PCR fragments B3, B13 and B17 were prepared using the plasmid carrying the wild type cspB gene, pSJ7 (Lee et al., 1994) as template DNA. The 5'-terminal oligonucleotide primer used in each step of the PCR reaction is 5'-CCGGATCCAGCTTTAATATAGCT-3 '(SEQ ID NO: 31).

The 3'-terminal oligonucleotide primers for PCR products B3, B13 and B17 are respectively

5′-CCGGATCCAGCTTTAATATAGCT-3 ′ (SEQ ID NO: 32), 5′-CCGGATCCAGGTTAAACCATTT-3 ′ (SEQ ID NO: 33), and 5′-CCGGATCCAGACCTTTATCAGCGTT-3 ′ (SEQ ID NO: 34).

Deletion of the SD sequence in the cspB gene was made through site-direction mutagenesis using the QuickChange brand site directed mutagenesis kit (stratagen). PCR reaction uses pSJ7 plasmid as template and oligonucleotide

Bsd1 (5'-CATTCTACATGAAGTAACTTGAGCCTTTC-3 ') (SEQ ID NO: 35) and Bsd2 (5'-CATTCTACATGAAGTAACTTGAGCCTTTC-3') (SEQ ID NO: 36)

 To prepare pSJ7sd. PCR products B13sd and B17sd are prepared using pSJ7sd as a template. The 5 'and 3' terminal oligonucleotide primers used in these PCR reactions are the same as those used in PCR fragments B13 and B17. All of the PCR products were cloned at the BamHI site of the pRS414 vector (Simmons et al., 1987; Lee et al. 1944) to prepare pB3, pB13 and pB13sd, pB17 and pB17SD constructs.

The cspA-lacZ fusion construct was prepared by inserting annealed oligonucleotides into the EcoRI site of pJJG78 (Jiang et al., 1996). Oligonucleotides annealed with DB1 '(5'- AATTCCCACTTTGTGATT-3') DB1 (5'- AATTAATCACAAAGTGGG-3 ') (SEQ ID BO: 37), or DB2' (5'- AATTCCCACTTTGTGATTCAT-3 ') (SEQ ID NO PJJG78DB1 or pJJG78DB2 constructs were prepared using annealed DB2 (5'-AATTATGAATCACAAAGTGGG-3 ') (SEQ ID NO: 39), respectively.

The pIN-lacZ fusion construct was prepared by inserting XbaI-SalI fragments from pJJG78 or pJJG78DB2 into the XbaI-SalI site of pINIII to form pINZ and pINZDB1, respectively (Jiang et al., 1996). after,

Oligonucleotide ZDB2 (5'- CTAGCCCTTATTAATAATGAAAGGGGGAATTATGAATCACAAAGTGGG-3 ') (SEQ ID NO: 41) annealed with ZDB2' (5'- AATTCCCACTTTGTGATTCATAATTCCCCCTTTCATTATTAATAAGGG-3 ') (SEQ ID NO: 42)

pINZDB2 was prepared by inserting into the XbaI-EcoRI site of pINZ.

Oligonucleotide ZDB3 (5'- CTAGCCCTTATTAATAATGAATCACAAAGTGGG-3 ') (SEQ ID NO: 43) or ZDB4' (5'- AATTCCCATTATTA GAG) annealed with ZDB3 '(5'- AATTCCCACTTTGTGATTCATTATTAATAAGGG-3') (SEQ ID NO: 44) PINZDB3 and pINZDB4 were prepared by inserting annealed ZDB4 (5'-CTAGAGGG-TATTAATAATGAATCACAAAGTGGG-3 ') (SEQ ID NO: 45) into the XbaI-EcoRI site of pINZ, respectively. .

β-galactosidase activity

E. coli AR137 (pcnB-) (Harlocker et al., 1993) or JM83 (pcnB-) containing different plasmids was treated at 37 ° C. in a 20 ml LB medium containing 50 μg / ml ampicillin in a 125 ml flask. Grow up to mid-log stage. This culture was then transferred to a vibration bath at 15 ° C. or isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM. At each time point, 100 ml of culture was taken. Β-galactosidase activity was measured according to the method of Miller (Miller, 1972).

Example 2: Isolation of RNA, Extension of Primers and Ribosome Analysis

E. coli AR137 containing different plasmids was grown under the same conditions as used for the β-galactosidase assay described above. To determine the amount of cspA-lacZ mRNA, 1.5 ml cultures were taken at each time point and RNA was extracted by hot phenol extraction according to Sarmientos et al. (1983).

For the stability test of mRNA at 15 ° C., 1 hour after the temperature was lowered, rifampicin was added so that the final concentration was 200 μg / ml, and transcription was stopped, and 1.5 ml of the culture was taken at each time point. For the stability test of mRNA at 37 ° C, mRNA was accumulated by first treating at 15 ° C for 30 minutes. Next, 5 ml of culture was taken and mixed with 5 ml of medium containing 400 μg / ml rifampicin in a glass flask in a 37 ° C. vibratory bath. The medium was preheated to 60 ° C. Using this method the temperature of the culture was immediately raised from 32 ° C. to 37 ° C. within 1 minute.

CspA-lacZ using 32P-labeled primers M13-47, 5'- CGCCAGGGTTTTCCCAGTCACGAC-3 '(SEQ ID NO: 47), complementary to the 5'-terminal code sequence of lacZ by the primer extension method described above (Jiang et al.) mRNA was detected. The product was separated on a modified polyacrylamide gel (6%) and quantified using Phosphorimager (BioRad).

Pulse labeling

Cultures of E. coli AR137 (pcnB-) containing pINZ or pINZDB1 were grown in 600 ml LB medium in a 4 liter flask under the same conditions used for the β-galactosidase assay described above. In the mid-log stage, IPTG (1 mM) was added to each culture. The ribosomal particles were isolated by Dammel and Noller's method (1995), but the method was modified as follows: 100 ml aliquots from the original culture were taken at each time point and chloramphenicol was added to give a final concentration. The growth of the cells was stopped at 0.1 mg / ml. Cells were immediately collected by centrifugation (5000 × g for 10 min at 4 ° C.) and reproduced in buffer [20 mM Tris-HCl (pH 7.6), 10 mM MgCl 2, 6 mM β-mercaptoethanol and 1 mg / ml lysozyme] It was suspended and then frozen at -80 ° C for several hours. Cells were hemolyzed by freeze-thaw (Ron et al., 1996). Cell extracts (0.5 ml) are then placed on top of a 5-40% (W / W) sucrose gradient (7.5 ml), and the polysomes and ribosomes subunits at 4 ° C. using a Becjman SW-41 rotor. Separation was performed by centrifugation at 151,000 x g for 2.5 hours. The polysomes were detected by FPLC system and a total of 15 fractions were collected, 0.5 ml each.

detection of lacZ-mRNA

From each polysome fraction (0.5 ml), the Manifold ^?? 0.2 ml were spotted onto nitrocellulose membrane using II Slot-Blot System (Schleicher and Schuell). The lacZ-mRNA was detected by hybridization using 32P-labeled M13-47 primer (S. Inouye and M. Inouye, 1991) and the amount was measured using Phosphorimager.

Translation under laboratory conditions

Using the E. coli S30 Extract System for Linear Templates Kit (Promega), the transcription-translation reaction was performed according to the manufacturer's protocol as follows: 20 μl of Pre-mix containing all amino acids except methionine. To 10 μCi of trans- [35S] methionine (1,175 Ci / mmol; NEN Life Science Products) and E. coli S30 extract, 160 ng of pINZ or pINZDB1 (1 μl) were added, and the mixture was incubated at 37 ° C. for 45 minutes. The product was precipitated and annealed by 15% SDS-PAGE.

Example 3: Multicopy Effect of cspA Upstream Region on Cold Shock

The cspA gene was induced immediately after the temperature had dropped from 37 ° C. to 15 or 10 ° C., and the CspA production rate was found to peak after the temperature had dropped to 15 ° C. after 1 hour and to 10 ° C. after 2 hours. (Goldstein et al., 1990). After this point, CspA production drops back to baseline levels. This temporary production period of CspA corresponds to the growth period known as the Jag period, which is observed after cold shock (Jones et al., 1987). Thus, it is believed that this transient expression of CspA is required for the adaptation of cells to low temperatures.

In order to specify the expression of this transient CspA, the present inventors tried to identify the region required for the regulation of capA expression during the adaptation period. For this purpose, pJJG78 was first constructed, in which a 600 bp cspA upstream region was fused to the lacZ gene in a transcriptional manner (see FIG. 1). The cspA upstream region of 600 bp includes a region from -457 to +143, which is immediately before the shine-dalgano sequence of cspA because the cspA transcription initiation site is +1 (Goldstein et al., 1990). E. coli strain CL83 is transformed with pJJG78, and preparation of β-galactosidase was pulse-labeled with [35S] -methionine at 0, 0.5 and 3 hours after the temperature had dropped from 37 ° C. to 15 ° C. It was examined by them. As a control, CL83 cells alone as well as CL83 cells transformed with the vector pKM005 (Inouye, 1983) were used. It can be seen from FIG. 1B that the expression of cspA was highly induced for both CL83 and CL83 / pKM005 0.5 hours after the temperature was lowered (FIG. 1B, lanes 2 and 5). However, as described above (Goldstein et al., 1990), this high level of expression is transient and falls back to basal level at 3 hours (FIG. 1B, lanes 3 and 6). No cspA expression was detected at time point 0 (FIG. 1B, lanes 1 and 4), and no β-galactosidase was produced at all time points in both states (FIG. 1B, lanes 1-6).

In contrast to CL83 and CL83 / pKM005, the development of β-galactosidase was apparent in cells with pJJG78 (Fig. 1B, lanes 7-9), indicating that the 600bp upstream region of cspA was responsible for inducing cold shock. Imply sufficient. Surprisingly, the preparation of cspA is not transient and remains high at 3 hours after cold shock induction in cells with pJJG78 (Figure 1B, lane 9 compared to lanes 3 and 6). Since pJJG78 does not have a cspA code sequence, the high production rate of CspA 3 hours after cold shock induction is due to the chromosomal cspA gene. Under the conditions used, the chromosomal cspA gene does not appear to be inhibited, that is, inhibition is released. Interestingly, there is another band in the X-marked portion of Fig. 1B, whose expression pattern is almost the same as that of cspA. It is a cold shock protein, the preparation of which is also inhibited by the presence of pJJG78. This cold shock protein X has recently been identified as CsdA associated with ribosomes (Jones et al., 1994).

Synthesis of most cellular proteins is blocked on a larger scale at low temperatures than in CL83 and CL83 / pKM005 for cells with pJJG78 (compare FIG. 1B, lanes 8 and 9 with lanes 2, 3, 5, 6). This result suggests that the adaptation of cells to low temperatures is impaired by a more severe cold shock response when the cells carry a multicopy plasmid with part of the csp gene.

Since the sustained synthesis of cspA after cold shock is induced by pJJG78, the 600 bp cspA upstream region cloned into pJJG78 may insulate the factor responsible for the inhibition of cspA production after cold shock, leading to the inferred that sustained expression or termination of cspA may result. can do. To test this hypothesis, the 600bp upstream region of cspA was cloned back into pUC19. The plasmid is referred to as pUC19-600. The number of copies of pUC19 (300 copies / cell) is 10 times greater than pJJG78 (30 copies / cell) derived from pBR322. Pulse labeling tests were performed as described above (Jiang et al., 1993). As shown in FIG. 2, in CL83 cells, CspA production was elevated after 1.5 hours at 15 ° C. and lowered to basal levels after 3 hours (FIG. 2, lanes 1 to 6). CL83 cells with pJJG78 also observed CspA production after 24 hours at 15 ° C. (FIG. 2, lanes 7-12). The cspA production pattern in CL83 cells with pUC19-600 is similar to that for pJJG78 (FIG. 2, lanes 13 to 18). However, the expression level of cspA is much higher with pUC19-600 than with pJJG78, as judged from CspA preparation after 3-5 hours. Therefore, the greater the number of copies of cspA, the stronger the expression of cspA. In other words, CsdA (marked X) exactly shows the same expression pattern as CspA when looking at all lanes in FIG. 2.

As shown in FIG. 1B, pJJG containing cells showed specific inhibition in general protein synthesis at low temperatures. (Comparing lenses 8 to 11 with lenses 2 to 5 in FIG. 2, respectively.) Significantly in terms of protein synthesis rate and inhibition time, this inhibition was more apparent in cells containing pUC19-600 than in cells containing pJJG78. . (Compare lenses 14 to 17 in FIG. 2 with lenses 8 to 11) The higher copy number of the cspA 600-bp upstream has a stronger inhibitory effect on other cell protein synthesis. This means that low temperature shock adaptation is suppressed.

Example 4: Transient Generation of 5 ′ Undenatured Untranslated Portions of cspA mRNA

A series of internal fragments were generated by PCR and cloned into the SmaI site of pUC19 as shown in FIG. 3 to find the exact portion within 600-bp that is essential for cspA inhibition and cold shock adaptation inhibition at low temperatures. This arrangement is identified as a DNA sequence. The ability to inhibit CspA expression and inhibit the cold shock adaptation of the constructs at 15 degrees in each was studied by pulsatile classification experiments. First, deletion mutations were generated at the 5 ′ end of the 600-bp fragment. As shown in FIG. 3, fragment 3 (186-base erased), fragment 2 (312-base erased) fragment 2E (366-base erased), fragment 2G (390-Q base erased) Kept the jersey function. Next, fragment 2 was separated into fragments 2A and 2B, which matched by 23bp as shown in FIG. 3. Surprisingly, both 2A and 2B lost this feature. Fragment 2F, which is 33bp longer at the 5 'end than fragment 2B, was also generated, which remained functional. It has been found that cspA resistant constructs also result in inhibition of cold shock adaptation and vice versa.

The fact that fragment 2 has the function of cspA inhibition and cold shock adaptation while fragment 2A does not suggest that the cspA promoter portion alone is not sufficient for the function of the 600bp fragment. The fact that functional fragment 2G is 31bp longer at the 5 ′ end than nonfunctional fragment 2F suggests that both functions require a complete cspA promoter for the transcription of 5′UTR of cspA mRNA. Note that cspA mRNA has an unmodified sequence of 159-bases at the 5 ′ end (Golden et al., 1990). To verify this possibility, cspA transcripts generated from fragments cloned by primer extension (fragments 2, 2A, 2B, 2E, 2F) were studied. Primer 3550 and cspA coding corresponding to primer expansion ranging from +124 to +143 in two independent primers-5`UTR using total RNA sections isolated from cells containing various plasmids incubated for 1 hour at 15 ° C. With primers 3551- corresponding to the parts of the arrays +224 to +243. The former primer found cspA mRNA transcribed in plasmids and chromosomes, while the latter only found mRNA in the chromosomal cspA gene because the plasmid did not contain the cspA coding portion.

As shown in FIG. 4, the amount of transcription from the chromosomal cspA gene represented by primer 3551 is basically the same in all constructs (FIG. 4, lines 1-6). In contrast, cspA transcription surrounding 5′UTR shown by primer 3550 Volume amounts show two different levels. In nonfunctional constructs (pUC19-2A, pUC19-2B, pUC-2F), the amount of transcription detected by primer 3500 (lines 3, 4, and 6, respectively, in FIG. 4) was almost the amount of transcription of pUC19 (1, line 1 in FIG. Is the same as This means that the part of cspA cloned to this plasmid has not been transcribed. On the other hand, functional constructs (pUC19-2, pUC19-2E) showed higher cspA transcription detected by primer 3550 compared to pUC19 (line 1 in FIG. 4) (lines 2 and 5 in FIG. 4, respectively). . These results demonstrate that 5′UTR of cspA mRNA is transcribed in fragments 2 and 2E but not in fragments 2A, 2B and 2F. Therefore, the ability to prolong cspA appearance and inhibit cold shock adaptation at low temperatures is closely correlated with 5′UTR transcription of cspA mRNA.

To clearly demonstrate that 5'UTR transcription of cspA mRNA is essential for cspA inhibition and cold shock adaptation inhibition, total promoter fragments (-457 to -1) and 6 bases (+1 to +6) were cloned into pUC19. It became. This fragment is referred to as fragment 1 (see FIG. 3). Thus 5′UTR of most cspA mRNA was deleted in fragment 1. Fragmentation experiments shown in FIG. 5B may fragment cspA despite the fact that transcription from the cspA promoter was apparently found by primer extension (FIG. 5A). From these results it is concluded that at least +1 to +143 portions of cspA 5′UTR must be transcribed to affect cspA appearance and cold shock adaptation.

Example 5 Cold Shock Gene Affected by 5′UTR Overproduction of cspA mRNA

Next, we investigated the overproduction of 5'UTR of cspA mRNA to determine if cspA mRNA influences the appearance of other cold shock genes. The protein appearance of cold shock cells that overproduce cspA 5′UTR was analyzed by two-dimensional electrophoresis. Plasmid pJJG21 / X, S has 5`UTR of the whole cspA promoter and most cspA mRNAs (+1 to +143), and pJJG81 / X, S has the first 6 of 5`UTR of the whole cspA promoter and cspA mRNA Hold only the base part. Cells bearing these plasmids are momentarily labeled as previously described (Jiang et al., 1993). The protein synthesis rate and protein morphology at 37 ° C. are very similar for both (FIG. 6, A and B); note that no cold shock protein was found. When these cells were moved to a temperature of 15 ° C. for 1 hour (FIG. 6, C and D), the synthesis of cold shock protein (1) cspA (2) CspB ′ (3) CspB (4) CsdA was very active. Note the prediction that CspB ′ is accompanied by CspB and is either a modified form of CspB or an unidentified cold shock protein (Ezegarei et al., 1996). The rate of cold shock protein synthesis of both constructs is comparable according to the density of the sites. Although the synthesis of most other cellular proteins was significantly reduced in both than at 37 ° C, stronger inhibitory effects were observed in cells modified with pJJG21 / X, S. When cells were incubated for 3 hours at 15 ° C., the synthesis of most cellular proteins recovered to normal levels with a decrease in the overall cold shock protein in cells with pJJG81 / X, S (FIG. 6F). On the other hand, for cells with pJJG21 / X, S, production of total cold shock proteins (labeled 1 to 4) was still very high and production of other cellular proteins was reduced (FIG. 6E). The 5′UTR overproduction of mRNA results in inhibition of cspA as well as other cold shock genes, suggesting that cold shock protein genes are regulated by general mechanisms. It was also confirmed that the inhibition of cold shock adaptation was due to the 5′-UTR overproduction of cspA mRNA that inhibited the synthesis of other cellular proteins.

Based on the results stated above, 5′UTR overproduction of cspA mRNA involves the inhibition of other cellular proteins. This means that the cell growth during cold shock has a more severe inhibitory effect on cells that overproduce 5′UTR of cspA mRNA than on normal forms of cells. The growth of cells containing pUC19-600 or pUC19-2G (see Figure 3.) was indeed severely inhibited. This is caused by a long period of growth retardation. (no data)

Example 6: Effect of cspA Overproduction

Excessive appearance of 5′UTR of cspA mRNA results in prolonged overproduction of CspA (see FIG. 2). Therefore, the observed effect may be due to CspA overproduction rather than 5`UTR of cspA mRNA. This possibility can be experimented with CL83 cells carrying the entire cspA gene and containing pJJG02. The beat classification experiment proceeds as described above. As shown in FIG. 7, cspA and csdA (protein X gene) with CL83 containing pUC19 were induced 1 hour after temperature change to 15 ° C. (lanes 1 and 2) and returned to basal level at 3 hours after temperature change. (Lane 3). On the other hand, when cells were transformed with pJJG02, the appearance of cspA was not only induced at 15 ° C., but also higher than cells containing pUC19 as measured by gelatin electrophoresis on both sides (no data). Note that high CspA production is observed at 15 ° C. for 3 hours (lane 6). Although CspA overproduction for 3 hours after cold shock is very similar to the previously shown cspA 5`UTR overproduction, there is no long growth retardation period for cell growth and delayed production of other cold shock proteins such as CspB and CsdA. It is important to note that this absence was observed at the same time. This implies that the combined production of 5'UTR and CspA of cspA mRNA inhibited the effects of overproduction of 5UTR only, and that high levels of CspA production at 3 hours after cold shock were not the cause of this effect.

Example 7: Identification of Inhibitor Binding Sites

We sought to identify specific parts of cspA mRNA responsible for cspA inhibition in the 5`UTR. Because of the 11 base sequences commonly found in 5'UTRs in cspA, cspB, and csdA, this region was tested, which included an array of positions from +1 to +25 of the 5'UTR of cspA mRNA. This portion was placed under the control of the cspA promoter in pUC19 for p2JTEK construction. Cells containing p2JTEK were studied to examine the morphology of total protein synthesis three hours after a temperature change from 37 ° C. to 15 ° C. As shown in lane 3 of FIG. 8, CspA and CsdA production was obviously inhibited and accompanied by inhibition of other cellular proteins, which can be seen to have a brighter background compared to cells containing pUC19 (FIG. 8, lane 1). Cells containing p6mTEK only transcribed cspA mRNA (Fig. 8, lane 2) +1 to +6 and showed the same shape as pUC19 cells (Fig. 8, lane 1). This indicates that the portion of cspA inhibition is present in the first 25 nucleotide sequences of 5′UTR of cspA mRNA.

Example 8: Deletion Analysis of cspA 5′UTR

Already we construct cspA-lacZ fusions in which two lacZ genes are fused to cspA transcriptionally at +26 (pKM67; Mitta et al., 1997) or +143 (pJJG78; Jiang et al., 1996) of cspA mRNA. did. Beta galactosidase activity of cells containing pJJG78 was very low at 37 ° C. and increased approximately 10-fold over 2 hours after temperature change to 15 ° C. On the other hand, beta galactosidase activity of pKM67-containing cells was very high even at 37 ° C (Mita et al., 1997). It is believed to function as: (I) inhibition of cspA expression at 37 ° C., (II) mRNA stabilization against cold shock, (III) translation efficiency at 15 ° C. (Mitta et al., 1997).

To investigate which part of the 5'-UTR is involved in the positive or negative regulation of cspA expression, we attempted a deletion assay of 5'-UTR and tested various deletion effects on cold-shock induction of cspA. To this end, a series of 5'-UTR deletion mutants with 26 to 32 base deletions per about 30 bases are constructed and the resulting 5'-UTRs are translated fused to lacZ at the 13th amino acid residue of cspA. . The resulting plasmids pMM022, pMM023, pMM024, pMM025 and pMM026 are +2 to +27, +28 to +55, +56 to +86, +86 to +117, +118 to +143, respectively. And deletion mutations in the '-UTR (FIG. 9A). The deletion of +56 to +85 for pMM024 was originally designed, but analysis of the transformants included external base deletions at the +86 position. Plasmid pMM67 (Mita et al., 1997), a wild type cspA-lacZ translational fusion construct, was used as a control. In order to avoid the multiplication effect of the constructed gene on its expression, E. coli AR137 (Rofilato et al., 1986), a pcnB mutant known to maintain pBR322 derivatives under low copy numbers, is a host of transformation. Was used.

Transformed cells were grown in M9-casamino acid medium at 37 ° C., and the beta-galactosidase activity was measured after the temperature was reduced from 37 ° C. to 15 ° C. At 37 ° C. (time point 0 in FIG. 9B), beta-galactosidase activity was 10-fold in cells containing pMM024 (Δ56-86) and pMM025 (Δ86-117) than in cells containing wild type pMM67. While showing higher activity, other deletion mutants [pMM022 (Δ2-27), pMM023 (Δ28-55), and pMM026 (Δ118-143)] showed very low beta-galactosidase activity. These results suggest that the 5'-UTR region from base +56 to +117 is included in the expression suppression region of cspA at 37 ° C. Interestingly, beta-galactosidase activity increased almost fivefold with pMM024 (Δ56-86) after temperature reduction, but only less than two times with pMM025 (Δ86-117), which was pMM025. It is suggested that the region cleaved at (Δ86-117) plays an important role in the cold-shock induction of cspA. Similar to the results with pMM025 (Δ86-117), beta-galactosidase activity with pMM023 (Δ28-55) was hardly induced at low temperatures. In particular, since the beta-galactosidase activity is very low at both 37 ° C. and 15 ° C., the cleaved region at pMM026 (Δ118-143) appears to play a decisive role both at high and low temperatures in cspA expression (FIG. 9B). Deletion of the base +2 to +27 (pMM022) region, including the cold-box sequence, included in cspA autoregulation (Jiang et al., 1996), as would be expected, has little effect on cold-shock induction of cspA. .

Example 9: Analysis of cspA-lacZ mRNA

As described above, all deletion mutations in the 5'-UTR except pMM022 (Δ2-27) affect the cold shock induction of cspA. The cspA promoter is known to be active even at 37 ° C (Goldenberg et al., 1997; Fang et al, 1997; Mita et al., 1997). Since all deletion constructs have a full cspA promoter (FIG. 9A), the transcriptional efficiency of these constructs is believed to be the same. CspA mRNA stability, on the other hand, varies considerably depending on growth temperature (Brandy et al., 1996; Goldenberg et al., 1996; Breed, 1997; Fang et al., 1997; Goldenberg et al., 1997; Mita et al., 1997). Therefore, deletion mutation effects on cspA expression at low temperatures may be due to the different mRNA stability of the construct. To investigate this portion, primer extension analysis was performed by quantifying cspA-lacZ amounts for each mutation at different times after addition of rifampicin at 37 ° C. and 15 ° C. (FIG. 10A). Strain AR137, a pcnB mutant, was used to avoid positive or negative multiplication effects. The amount of transcript at each reaction time was measured using a phosphoimator, and the remaining mRNA amount (percentage amount at zero time) was plotted as shown in FIG. 10B. All transcripts had a half-life measured between 30 and 45 seconds and were unstable at 37 ° C. However, at 15 ° C., their half lives became very stable at 20 to 40 minutes. These half-lives are similar to those of the wild-type construct pMM67 obtained earlier (Mita et al., 1997) as well as the half-life of wild-type chromosome cspA (Pang et al, 1997; Goldenberg et al. 1997). The β-galactosidase activity induced at 15 ° C. compared to similar mRNA half-life at low temperatures is varied for all constructs as shown in FIG. 9B.

The results indicate that cspA induction efficiency measured by β-galactosidase activity is not related to mRNA stability of each deletion construct, but rather to the mRNA amount and / or translation efficiency of each construct. Therefore, the inventors of the present invention investigated the amount of mRNA for each construct at different time points after cold shock using the primer extension method. This result is shown in FIG. 11A and the amount of transcript was measured with a phosphoimager. Their relative amounts were calculated with the amount of pMM67 transcripts at zero time as 1 (FIG. 11B). At 37 ° C., the amount of transcript for pMM022 (Δ2-27) and pMM024 (Δ56-86) was similar to wild type construct pMM67 (column 1 of FIG. 11B). It should be noted that the β-galactosidase activity of pMM024 (Δ56-86) at 37 ° C. was at least 10 times higher than pMM022 (Δ2-27) (FIG. 9B). For pMM023 (Δ28-55), pMM025 (Δ86-117) and pMM026 (Δ118-143), the amount of transcript at 37 ° C. was about half of pMM67. It should also be noted that the β-galactosidase activity of pMM025 (Δ86-117) was at least 10 times higher than pMM023 (Δ28-55) and pMM026 (Δ118-143) (FIG. 9B). This result indicates that there is no association between transcript amount and β-galactosidase activity at 37 ° C.

Example 10 Transcription Control by 5′-UTR

After down-regulation of the temperature, the amount and induction pattern of cspA-lacZ mRNA rapidly increased in all constructs are shown in FIGS. 11A and 11B. They showed a very similar pattern in the accumulation of transcripts and wild-type pMM67, where maximum induction was observed after one hour of downshift. The pattern of mRNA levels was very similar between pMM67 and pMM024 (Δ56-86), while the other constructs showed a similar induction pattern, although at each time point their mRNA amounts were about half the amount of pMM67 mRNA. Since the promoter activity of all deletion constructs is considered to be the same, and their mRNA stability is also very similar to that of the wild type construct (FIG. 10B), the lower mRNA amount in all deletion constructs except pMM024 (Δ56-86) is 5′-. It is likely due to slower rate of transcription extension and / or transcription attenuation in the UTR. Notable findings indicate that the amount of mRNA for pMM026 (Δ118-143) accumulated after cold shock and the amount of mRNA for pMM022 (Δ2-27), pMM023 (Δ28-55) and pMM025 (Δ86-117) It was the same (see FIG. 11B). Nevertheless, the cold shock induction of β-galactosidase activity was very low throughout the cryoshock treatment period for pMM023 (Δ118-143), indicating that the mRNA for the construct was very incompletely translated. Relative translation efficiency at 15 ° C. is calculated as the increase in β-galactosidase activity and mRNA levels during cold shock for all constructs (see brief description in Fig. 11 symbol description). As shown in FIG. 11C, the translational efficiency of pMM026 (Δ118-143) mRNA was extremely poor and was calculated as 9.5% of pMM67 mRNA translation efficiency (column 6 in FIG. 11C). That is, it is clear that base deletions from +118 to +143 of the 5'-UTR negatively affect translation. In addition to pMM026 (Δ118-143), the translational efficiency of pMM023 (Δ28-55) and pMM025 (Δ86-117) mRNAs was also relatively low, calculated as 54% and 36% of pMM67 mRNA translation efficiency, respectively. These results clearly show that the translational efficiency of mRNA plays an important role in the regulation of cspA expression, in particular the +118 to +143 base region of the 5'-UTR plays an important role in the modification efficiency.

The comparison of the nucleotide sequences of the 5'-UTR regions of the cspA, cspB and cspG genes, which are the cold shock inducing genes, showed the 13 well-conserved base sequences (+123 to +135 of cspA in common) as shown in FIG. Base) is present.

Interestingly, these 13 sequences contain a palindromic sequence located at the top just near the Shine-Dalgarno sequence and forming a stable secondary structure (ΔG = -9.5 kcal; 12 and 14). It is also complementary to the 1023 to 1035 base regions of 16S rRNA (FIG. 12). In the pMM026 (Δ118-143) mRNA, this upstream box region is deleted, which may be a major cause of low mRNA translation efficiency.

To characterize the role of upstream boxes in translation efficiency, two new constructs were prepared. In one of these constructs (pKNJ37) exactly 13 base upstream-box sequences were deleted from wild type cspA-lacZ construct (pMM007) and in another construct (pKNJ38) 13 base sequences were shown in pKM67 as shown in FIG. 13A. (Mitta et al., 1997) to the upstream region of SD. The lacZ gene for pKM67 hybridizes at +26 bases, indicating that β-galactosidase was expressed at 37 ° C. without any further induction following cold shock as a result of substantial deletion at 5′UTR. It should be noted that both pMM007 and pMM67 carry exactly the same insert cspA in different vectors of pRS414 and pKM005, respectively. The cold shock induction patterns of the β-galactosidase activity of these two plasmids (pMM007 and pMM67) are similar to each other (data not shown). Cells were transformed with pKNJ37, pMM007, pKNJ38 and pKM67 and investigated the cold shock induction of β-galactosidase. The deletion of the upstream box (pKNJ37) significantly lowered β-galactosidase activity not only at 37 ° C. but also by cold shock. Contrary to these results, when the top box is inserted into 13 upstream bases of the SD sequence of pKM67, the essential expression of β-galactosidase is increased by about 20% at 37 ° C. (FIG. 13B). The increase is also maintained in low temperature shocks. The results support the notion that upstream-box sequences are associated with effective translation of cspA. Particular sequences of 5'-UTRs useful in the present invention are 5'- GCCGAAAGGCACA-3 '(SEQ ID NO: 48), 5'- GCCGAAAGGCUCA-3' (SEQ ID NO: 49) and 5'- GCCGAAAGGCCCA-3 '( SEQ ID NO: 50) (see FIG. 12).

It is currently believed that cspA expression is regulated at the level of transcription, mRNA stability and translation as follows: (iii) The cspA gene contains a strong promoter with an UP element, although the transcription of the cspA gene may cause any new Although protein synthesis is not required, it operates at both 37 ° C. and 15 ° C. (fang et al., 1997; goldenberg et al., 1997; Mitta et al., 1997). (Ii) cspA mRNA comprises a downstream-box (DB) sequence downstream of the initiation codon, which cspA mRNA plays an important role in improving translation initiation at low temperatures (Etchegaray and Inouye, unpublished: Mitta et al. , 1997). (Iii) cspA mRNA contains an unusually long 5'-UTR of 159 bases (Tanabe et al., 1992) and is very unstable at 37 ° C (Brandi et al., 1996; Goldenberg et al., 1996 Bae et al., 1997; Fang et al., 1997; Jiang et al., 1997; Goldenbert et al., 1997; Mitta et al., 1997). Immediately after cold shock, cspA mRNA is stabilized. In other words, stabilization of mRNA following cold shock does not require any new protein synthesis in the early days. When the +26 to +143 region of the 5'-UTR is deleted from the cspA-lacZ hybrid construct, high β-galactosidase activity is obtained even under 37 ° C (Mitta et al., 1997). For the 5'-UTR, there is a sequence presumed to be the RNaseE cleavage site upstream of the SD sequence (Fang et al., 1997). The cleavage site is thought to be related to severe instability of cspA mRNA because it results in 150-fold enhanced mRNA stability due to three base substitution mutations in this region, even at high temperatures of 37 ° C. (Fang et al. 1997). . In other words, it is clear that the exceptionally long 5′-UTR of cspA mRNA is responsible for instability at 37 ° C. In the same way that cspA can be induced by cold shock, it can be inferred that 5'-UTR produces extremely unstable cspA mRNA at 37 ° C. Although cspA mRNA stabilizes and accumulates at temperatures that are unacceptable in temperature sensitive RNaseE mutants, CspA production is not detected under these conditions (Fang et al., 1997), suggesting another role other than mRNA stability is 5 '. It's a valuable statement in that it suggests that it can exist in the -UTR.

Attempts were made to further elucidate the role of the exceptionally long 5'-UTR of cspA mRNA in cspA expression. A series of 26-32 base deletion mutants were prepared comprising the entire 5'-UTR. This mutated 5-'UTR region was translated fused to lacZ at the 13th amino acid residue of CspA following the DB sequence. At 37 ° C., pMM022 (Δ2-27), pMM023 (Δ28-55) and pMM026 (Δ118-143) exhibited β-galactosidase activity similar to wild type pMM67, pMM024 (Δ56-86) And pMM025 (Δ86-117) showed 10-fold higher β-galactosidase activity than pMM67, meaning that the base region at +56 to +117 is involved in inhibition of cspA expression at 37 ° C.

Based on β-galactosidase activity after downshifting the temperature, the mutants can be divided into three classes; In class I [pMM022 (Δ2-27) and pMM024 (Δ56-86)], β-galactosidase is induced in a form similar to pMM67, and in class II [pMM023 (Δ28-55) and pMM (Δ). 86-117), the cold shock induction of β-galactosidase is poor, and class III [pMM026 (Δ118-143) showed very low β-galactosidase activity both before and after cold shock. It is worth noting that these differences are not due to the amount or stability of the mRNA as can be seen from FIGS. 10 and 11. As mentioned above, these results support the notion that 5'-UTR plays another role in translation efficiency in addition to mRNA stability.

The relative translation efficiency after temperature downregulation for the different constructs showed a very different difference (FIG. 11C), which is in good agreement with the construct classification at 15 ° C. as mentioned above. The translation efficiencies of pMM022 (Δ2-27) and pMM024 (Δ56-86) (Class I) are slightly better than those of wild type pMM67, and pMM023 (Δ28-55) and pMM025 (Δ86-117) (Class II) ), The translational efficiency of pMM67 translational efficiency is 40-50%, and the translational efficiency of pMM026 (Δ118-143) (Class III) is 10% or less of pMM67 translational efficiency.

For pMM026 (Δ118-143), deletion mutations clearly affect not only mRNA stability but also translation efficiency. The deleted region was found to contain well-preserved 13-base sequences (+123 to +135 bases) in mRNA for the cold shock induced cspA group, cspA, cspG, and cspI (see FIG. 12). Such sequenced upstream boxes can form distinct secondary structures in both wild type pMm67 and Class I constructs (pMM022 (Δ2-27) and pMM024 (Δ56-86)) (FIG. 14). Class I constructs exhibit translation efficiencies similar to wild type. Class II (pMM023 (Δ28-55) and pMM025 (Δ86-117), which showed 50% of the wild type translation efficiency, did not show such secondary structure, but the estimated secondary near the SD sequence in such a construct. The structure is still similar to wild type constructs. In contrast, if the upstream box region is deleted [pMM026 (Δ118-143); Class III, which shows very poor translation efficiency], the SD region forms a more stable secondary structure. This seems to inhibit the mRNA recognition by ribosomes leading to poor translation efficiency in pMM026 (Δ118-143). The upstream box can therefore act to stop the formation of a stable secondary structure directly upstream of the SD sequence, which makes the ribosomes very accessible. Alternatively, since the upstream box sequence is complementary to the 1023 to 1035 base sequences of the 16S rRNA sequence (FIG. 12), the upstream box sequence forms a conjugate with the 16S rRNA in addition to the SD sequence and the lower box, thereby improving translation efficiency. It can be another cis-element (Mitta et al., 1997). Since the entire construct uses the same location of cspA to fuse to lacZ, the differences observed in translation efficiency are thought to exist at the translation initiation level, not at the translation extension level. This interaction between mRNA and 16S rRNA has been suggested to play an important role in translation initiation (McCarthy and Brimacombe, 1994). Based on the fact that the U residue at position 1052 interacts directly with the sixth base from the initiation codon, it has been found that there are 1023 to 1035 base regions of 16S rRNA near the position where 30S ribosomes interact with mRNA (Dontsova et al., 1992; Rinke-Appel et al., 1993). In addition, RNase V1 sensitivity in G1020, A1021 and A1022 was increased immediately after assembly of the 30S ribosomal subunits, which was reported to mean that the sites containing these residues were exposed to the surface (Power et al., 1998). .

In the same manner as the upstream box's role in translation, adding the upstream box sequence to pMM67 resulted in an increase in β-galactosidase activity by 20%. On the other hand, deletion of the exactly 13-base upstream box sequence (pKNJ37 (Δ123-135) in FIG. 13) resulted in a 50% reduction in β-galactosidase activity at 37 ° C. and a lower level of cold shock induction. . Note that the estimated secondary structure surrounding the SD sequence of pKNJ37 (Δ123-135) is identical to the wild type (FIG. 14).

In the heat shock response, the synthesis of heat shock sigma factor σ ³² is regulated at the translation level, and the secondary structure of rpoH mRNA plays an important role in the regulation (Nagi et al., 1991; Yuzawa et al., 1993). ). Recently, the secondary structure of rpoH mRNA has been determined through chemical and enzymatic probe assays, and the results are in perfect agreement with the previously assumed rpoH secondary structure (Morita et al., 1999). It has also been shown that mutations in rpoH mRNA that are believed to reduce mRNA stability increased rpoH expression and vice versa (Morita et al., 1999). Toeprinting assays using wild-type ropH mRNA and 30S ribosomes are completely temperature dependent for the appearance of toeprinting, which differs from the structure at 30 ° C for the rpoH mRNA secondary structure at 42 ° C accessible to ribosomes. And ropH mRNA structure itself is a determinant of rpoH expression regardless of other factors (Mirita et al., 1999). In other words, rpoH mRNA has been suggested to act as an RNA thermal sensor (Morita et al., 1999). Storz (1999) suggested that lcrF mRNA (Hoe et al., 1993) and λ phage cIII mRNA (Altuvia et al., 1989) from Yersinia pestis may be another example of an RNA thermal sensor.

In summary, stabilization of cspA mRNA following cold shock is a prerequisite for CspA production. Such stabilization does not require any new protein synthesis. As described herein, translational efficiency, which may include the secondary structure of the 5'-UTR surrounding the SD sequence of cspA mRNA, has been found to play an important role in cspA expression in addition to mRNA stability. That is, cspA mRNA can serve as an RNA thermometer as shown in rpoH mRNA. In order to understand the molecular mechanism of more precise cspA expression regulation, it remains to determine the secondary structure of cspA mRNA and to clarify the relationship between secondary structure and translational efficiency. In addition to the deletion assays described herein, point mutation analysis will provide us with information regarding the molecular structure of the structure and function of the 5'-UTR of cspA mRNA.

Example 11 Role of DB and Effect of Ideal Matching DB on Induction of CspB Cold Impact

Earlier, we demonstrated that the expression of cspB at low temperatures is controlled at the mRNA level (Etchegaray et al., 1996). Here, we first identify that DB is an important contributor to the translational induction of cspB at low temperatures. E. coli AR 137, pcnB variant (Lopilato et al., 1986), which retained the pBR322 derivative plasmid under low copy, was transformed with a series of cspB-lacZ translational fusions (FIGS. 15A and 15B). 15C shows β-galactosidase activity at various times after varying the temperature from 37 ° C. to 15 ° C. FIG. After 3 hours at 15 ° C., pB13 and pB17 showed the highest levels of β-galactosidase activity, which plays an important role in high cspB expression at low temperatures in the region of codons 3 to 13 (including DB). I mean. Β-galactosidase unit levels from the SD deletion constructs pB 13sd and pB 17sd demonstrate that SD is required for the induction of cspB. The primer extension assay (FIG. 15D) shows that the mRNA levels of pB3 and pB17 are nearly identical, but the β-galactosidase activity of pB17 is 7 times higher than the β-galactosidase activity of pB3, which indicates an initiation codon It is demonstrated that the differences in the lower sequences of s have a significant impact on mRNA translation efficiency, not on the amount of mRNA. Based on the amount of mRNA measured using a phosphorimager and the increase in β-galactosidase activity between 1 and 2 hours after cold shock induction, the translational capacity of pB17 is 18 times higher than that of pB13. It is measured to be 6 times higher than pB13. This can be explained by the potential to form additional base pairs between cspB-mRNA (pB17) and 16S rRNA as shown in FIG. 15A. This means that a longer DB (pB17) is more effective at buck than the shorter DB (pB13). When the SD sequence was deleted from pB 13, the translation efficiency was even lower than the translation efficiency of pB3, meaning that both SD and DB require full expression of cspB at low temperatures.

mRNA stability was found to play an important role in inducing cold shock of cspA (Brandi et al., 1996; Goldenberg et al., 1997; Fang et al., 1997). However, the dramatic effect of DB on lacZ expression could not explain the difference in mRNA stability under 15 ° C. between constructs with or without DB. 15E shows that the half-life for pB3, pB13, pB13sd and pB17 is 12, 22, 15 and 20 minutes, respectively.

It has been described previously that DB is essential for CspA production at low temperatures (Mitta et al., 1997). However, the wild-type DB of cspA has 10 pairs of 15 possible pairs for anti-DB in 16S rRNA (Mitta et al., 1997). Therefore, we investigated the DB of 12 (pJJG78DB1) or 15 (pJJG78DB2) bases complementary to the anti-DB of 16S rRNA under the cspA control system in pJJG78 to investigate whether the following additives enhance lacZ expression under 15 ° C. Was added at the position after the fifth codon of (see FIG. 15A). Mid-log phase cells (pcnB) grown at 37 ° C. were downregulated to 15 ° C. and β-galactosidase activity was measured 1, 2 and 3 hours after temperature change. FIG. 15B shows that β-galactosidase activity of pJJG78DB1 and pJJG78DB2 was three and eight times higher than pJJG78, respectively, at 1 hour after temperature drop at 15 ° C. After 2 and 3 hours at 15 ° C., β-galactosidase activity of pJJG78DB1 and pJJG78G2 was increased 3.5-fold and 10.5-fold higher than pJJG78, respectively. In addition, a DB effect was observed at 37 ° C., wherein β-galactosidase activity of pJJG78DB1 and pJJG78DB2 was about 2 and 4 times higher than that of pJJG78. In addition to mRNA stability, lacZ mRNA amounts (FIG. 15C) did not vary significantly between these constructs. The lacZ mRNA half-life from pJJG78, pJJ78DB1 and pJJG78DB2 was calculated to be 27, 23, and 25 minutes, respectively. In addition, computer analyzes (Zuker and Stieger 1982) showed that there was no significant difference in mRNA secondary structure between pJJG78, pJJ78DB1 and pJJG78DB2, which indicates that the insertion of a perfectly matched DB was responsible for their β-galactosidase expression. It suggests that there may be no particular effect on the mRNA secondary structure that may explain the difference. These results indicate that DB acts as a translation enhancer and that greater complementarity to anti-DB improves translation efficiency and / or that certain base pairs, such as the first three nucleotides of pJJG78DB2 derived DB, may play an important role in DB activity. It means.

Example 12 DB Action Analysis

The experiment described above was performed at 15 ° C. To investigate whether the DB operates at 37 ° C, the cspA cold shock control region upstream of SD of pJJG78 and pJJG78DB2 was replaced with the constitutive lpp promoter and lac promoter-operator fraction using the pINIII vector (Inouy, M. 1983). To produce pINZ and pINZDBI (FIG. 17), respectively. Cells transformed with pINZ or pINZDB1 (pcnB) showed very low β-galactosidase activity in the absence of IPTG, the lac promoter inducer. Following the addition of 1 mM IPTG, β-galactosidase activity was induced in both cells. After 3 hours of induction, the β-galactosidase activity of pINZ and pINSDB1 increased 18-fold and 37-fold, respectively (FIG. 17). However, β-galactosidase activity levels show a marked difference between the two constructs. That is, the activity with DB (pINZDB1) was 34 times higher than the activity without DB (pINZ), which means that the DB works well at 37 ° C.

The specific activity of β-galactosidase prepared from the vectors pINZ and pINZDB1 is almost identical (data not shown), and the addition of five amino acids present in the β-galactosidase sequence of pINZDB1 (due to DB) Does not affect enzyme activity. In addition, the stability of β-galactosidase prepared from pINZ and pINZDB1 is equivalent to half life of about 3 hours (data not shown).

The inventors then examined whether the DB acted individually with SD, the initial ribosome binding site. For this purpose, pINZDB2 was prepared by changing the SD sequences of pINZDB1 and GAGG to GCCC (FIGS. 17A and 17B). The β-galactosidase level of pINZDB2 induction was reduced to 1/7 of the pINZDB1 level, but still three times higher than the level of pINZ even 3 hours after IPTG induction (FIG. 17). However, as DB insertion results in pINZDB2 having secondary AUG codons downstream of the six codons, it may serve as a secondary start codon for the lacZ gene. Indeed, N-terminal sequencing indicates that 100% β-galactosidase generated from pINZDB2 is initiated in the second AUG codon compared to pINZDB1 (not shown data), which initiates at least 90% in the primary AUG codon. It is showing. In addition, secondary AUG codons are preceded by potential rather than by poor SD sequences (AAGG) in the regions corresponding to the second and third codons (underlined; FIG. 17B). In fact, when such secondary SD is removed by deletion of the 15-base sequence (codons 1 to 5; pINZDB3 in FIG. 17B), β-galactosidase activity at all time points is reduced to background levels ( FIG. 17C), meaning that secondary SD plays an important role in the translation of pINZDB2 lacZ mRNA (FIG. 17C). When the SD sequence was recreated with 5 base substitutions in pINZDB3 (pINZDB4; FIG. 17B), the β-galactosidase activity of such constructs was restored to a level comparable to that of pINZDB1 (FIG. 17C). It is important to note that the DB sequence starting at the first AUG codon was removed in pINZDB4 (FIG. 17B). Thus, high expression of β-galactosidase from pINZDB1 and pINZDB4 is due to the perfectly matched DB sequence (FIG. 17B). This result means that (a) the DB only functions when SD is present and (b) the location of the DB is elastically initiated at both codons 1 or 6.

Example 13: Translation Improvement by DB

Β-galactosidase activity shown in FIG. 17C means that the DB enhances the translation of pINZDB1. Therefore, the rate of β-galactosidase synthesis from pINZ and pINZDB1 was analyzed to examine the effect of DB on translation efficiency. β-galactosidase synthesis rate was measured by pulse-labeling for 5 minutes with [ ³⁵ S] -methionine after IPTG addition using pINZ and pINZDB1 with cells. After SDS-PAGE, the amount of radiolabeled β-galactosidase was measured using a phosphorimager (FIG. 17D). Prior to the addition of IPTG, the rate of β-galactosidase synthesis from pINZ and pINZDB1 was the same. However, the rate of β-galactosidase synthesis from pINZDB1 following IPTG induction increased continuously at each time point, while the rate of β-galactosidase synthesis from pINZ was little affected. 4 hours after IPTG addition, β-galactosidase synthesis rate from pINZDB1 was 6.5 times higher than pINZ. These results demonstrate that DB increases the translational efficiency of pINZDB1 in proportion to the increased synthesis of β-galactosidase.

To investigate whether DB improves translation initiation, we analyze the ability of lacZ mRNA from pINZ and pINZDB1 to form polysomes. For this experiment, pcnB cells were used to amplify the DB effect. Interestingly, cells bearing pINZDB1 could not form colonies on LB plates in the presence of 1 mM IPTG, while cells bearing pINZ formed colonies. The bactericidal effect of IPTG on cells bearing pINZDB1 may be due to overexpression of β-galactosidase. After IPTG addition, cell growth was stopped by chloramphenicol addition (0.1 mg / ml) at 15, 30 and 60 minutes and the polysomal profile was examined as shown in FIG. 17D. From each gradient fraction (500 ml), 200 ml were deposited on nitrocellulose membrane and the amount of lacZ mRNA was analyzed using 24-base anti-sense oligonucleotides (M13-47 oligonucleotides). The amount of lacZ mRNA was measured using a phosphoizer and shown in FIG. 17D. While the polysomal profile is similar, there is a big difference in the distribution of lacZ mRNA. That is, at 15 minutes, the lacZ mRNA is mainly in the upper half of the gradient with pINZ (fractions 8-14, corresponding to 70S-30S ribosomes), whereas with pINZDB1 the main peak (fractions 3-8) is of the gradient. It is formed in the lower half. At 30 minutes, lacZ mRNA from pINZ shifted to the position of 70s ribosomes, while lacZ mRNA from pINZDB1 maintained a similar pattern as at 15 minutes. At 60 minutes, the major fraction of lacZ mRNA from pINZ remained in the upper half of the gradient, but lacZ mRNA from pINZDB1 was widely distributed from higher order polysomes to the 70S ribosomal fraction. Thus, the reason why pINZDB1 with cells could not form colonies on LB plates containing 1 mM IPTG was due to the high level of free ribosome as a result of mass expression of translatable DB-containing mRNA (vind et al., 1993). It may be due to reducing the concentration of. This result probably means that the DB increases polysomal formation efficiency by improving translation initiation.

To determine the exact effect of the DB from the experiment, the amount of lacZ mRNA and β-galactosidase activity were measured at the same time points (15,30 and 60 minutes after IPTG induction) taken in the polysome profile. As shown in FIG. 18A, the amount of lacZ mRNA reached nearly maximum levels at 15 minutes for both pINZ and pINZDB1. The results of the phosphoimizer analysis indicated that the amount of pINZDB1 mRNA was 1.5, 1.4 and 1.3 times higher than pINZ mRNA at 15, 30 and 60 minutes, respectively. High mRNA levels for pINZDB1 are believed to be due to the highly effective polysome formation of pINZDB1 that can stabilize mRNA (Iost and Dreyfus 1995). Induction of β-galactosidase activity is shown in FIG. 18B. For pINZDB1, the activity is very high in the absence of IPTG and increases to 18,500 to 64,000 (3.5-fold) after 2.5 hours of incubation with the addition of IPTG. In the case of pINZ, the background activity before IPTG induction is very low and increases from 900 to 2,900 units (3 fold) at 2.5 hours. The increase in β-galactosidase activity of pINZDB1 between 30 and 60 minutes is 35 times higher than pINZ, such that β-galactosidase production efficiency for pINZDB1 is 26 times higher than that for pINZ based on the amount of mRNA. It is measured to be high. Thus, higher β-galactosidase production levels from pINZDB1 are due to high efficiency polysome formation.

In addition, β-galactosidase synthesis was tested in a cell-free system using pINZ and pINZDB1 to more directly demonstrate the translation-increasing effect of DB. Insertion of [ ³⁵ S] methionine into β-galactosidase (G band) using pINZDB1 (lane 2, FIG. 19) is about eight times higher than insertion (lane 1) using pINZ, while β The production of lactase (L band) was nearly identical in both lanes.

It has been suggested that structural changes in 16S rRNA in the absence of ribosomal protein S2 result in release of anti-DB sequences from the second stem, which gives higher accessibility to base pairs bearing DB (Shean and Gottesman). 1992; Powers et al., 1988). We analyzed the β-galactosidase expression of pINZ, pINZDB1 in E. coli CS 239 carrying the S2 temperature-sensitive mutation gene (Shean and Gottesman, 1992). In FIG. 20A, β-galactosidase activity of pINZDB1 increased rapidly with temperature change from 30 to 42 ° C. in S2 ^ts strain (CS239) (6.3 times for 0 to 3.5 hours), whereas in wild-type strain (CS240). The activity is slightly increased (1.1-fold for 0-3.5 hours). If the initial ratio of CS239's activity to CS240's activity at time 0 is considered to be 1, the rate increases significantly, reaching 5.8 in 3.5 hours after temperature change (FIG. 20B). In contrast, the lacZ gene without DB showed no significant difference in expression between CS240 and CS239, and the CS239 activity ratio to the activity of CS240 was maintained at the initial level throughout the incubation time (FIG. 20B). Similar experiments were performed with pINZDB3 (SD ⁻ , DB ⁺ ) and the activity ratio in CS239 to activity in CS240 increased 3.4 fold at 3.5 hours after temperature change (data not shown). These results clearly demonstrated that low levels of S2 protein at 42 ° C. cause significant stimulation of lacZ expression only when the lacZ gene contains DB, which is consistent with the suggestion of Shean and Gottesman (1992). .

delete

<110> THE UNIVERSITY OF MEDICINE AND DENTISTRY OF NEW JERSEY <120> COLD-SHOCK REGULATORY ELEMENTS, CONSTRUCTS THEREOF, AND       METHODS OF USE <130> 10-2000-7004441 <140> PCT / US99 / 19030 <141> 1999-08-20 <150> US 60 / 096,938 <151> 1998-08-20 <150> US 09 / 293,427 <151> 1999-04-16 <150> US 60 / 143,380 <151> 1999-07-12 <160> 71 <170> KopatentIn 1.71 <210> 1 <211> 14 <212> RNA <213> E. coli <400> 1 acuuugugau ucau 14 <210> 2 <211> 14 <212> RNA <213> E. coli <400> 2 augacuggua ucgu 14 <210> 3 <211> 14 <212> RNA <213> E. coli <400> 3 augacugguu ucgu 14 <210> 4 <211> 14 <212> RNA <213> E. coli <400> 4 augacugguu uagu 14 <210> 5 <211> 14 <212> RNA <213> E. coli <400> 5 augaguuaug uaga 14 <210> 6 <211> 14 <212> RNA <213> E. coli <400> 6 auggcgaaaa gaau 14 <210> 7 <211> 47 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: mRNA construct,       n = g, c, u or a       This sequence may encompass a construct wherein       the "n" region may be 0-30. <400> 7 augnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnaugacug guaucgu 47 <210> 8 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: DNA which       encodes for the mRNA construct, n = g, c, t, or a,       This sequence may encompass a construct wherein       the "n" region may be 0-30. <400> 8 atgnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnatgactg gtatcgt 47 <210> 9 <211> 15 <212> DNA <213> E. coli <400> 9 aatttctaga ggtaa 15 <210> 10 <211> 15 <212> DNA <213> E. coli <400> 10 acggttctag acgta 15 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 11 cggcattaag taagcagttg 20 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 12 ctggatcctt taatggtctg tacgtcaaac cgt 33 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 13 cggaattcag cctgtaatct ct 22 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 14 ctgtcgactt acttacggcg ttgc 24 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 15 gacaggatta aaaatcgag 19 <210> 16 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 16 aaccgttgat gtgca 15 <210> 17 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 17 ccttgctagc cgattaatca taaatatg 28 <210> 18 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 18 ccggatccag gttgaaccat ttt 23 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 19 actacacttt gatgtgcatt agc 23 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 20 caacgataag ctttaatggt ctgt 24 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 21 taaaggctct tgaagggact t 21 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 22 cggcgatata atgtgcacta cgaggg 26 <210> 23 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 23 tacctttaag gcgtgcttta cagatt 26 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 24 gcacatcaaa gtgtagtaag gcaa 24 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 25 taaagcttat cgttgatacc c 21 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 26 tcaagagcct ttaacgcttc aaaa 24 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 27 gcacattata tcgccgaaag gc 22 <210> 28 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 28 aaagcacgcc ttaaaggtaa tacact 26 <210> 29 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:       Oligonucleotide # 8509 <400> 29 ctagccgaaa ggcacaaatt aagagggtat taataatgaa agggggaatt cca 53 <210> 30 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence:       Oligonucleotide # 8510 <400> 30 agcttggaat tccccctttc attattaata ccctcttaat ttgtgccttt cgg 53 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 31 ccggatccag ctttaatata gct 23 <210> 32 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 32 ccggatccag atttgacatt ctaca 25 <210> 33 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 33 ccggatccag gttaaaccat ttt 23 <210> 34 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 34 ccggatccag acctttatca gcgtt 25 <210> 35 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 35 gaaaggctca agttacttca tgtagaatg 29 <210> 36 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 36 cattctacat gaagtaactt gagcctttc 29 <210> 37 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: annealed       oligonucleotide <400> 37 aattaatcac aaagtggg 18 <210> 38 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: annealed       oligonucleotide <400> 38 aattcccact ttgtgatt 18 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: annealed       oligonucleotide <400> 39 aattatgaat cacaaagtgg g 21 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: annealed       oligonucleotide <400> 40 aattcccact ttgtgattca t 21 <210> 41 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: annealed       oligonucleotide <400> 41 ctagccctta ttaataatga aagggggaat tatgaatcac aaagtggg 48 <210> 42 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: annealed       oligonucleotide <400> 42 aattcccact ttgtgattca taattccccc tttcattatt aataaggg 48 <210> 43 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: annealed       oligonucleotide <400> 43 ctagccctta ttaataatga atcacaaagt ggg 33 <210> 44 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: annealed       oligonucleotide <400> 44 aattcccact ttgtgattca ttattaataa ggg 33 <210> 45 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: annealed       oligonucleotide <400> 45 ctagagggta ttaataatga atcacaaagt ggg 33 <210> 46 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: annealed       oligonucleotide <400> 46 aattcccact ttgtgattca ttattaatac cct 33 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Primer <400> 47 cgccagggtt ttcccagtca cgac 24 <210> 48 <211> 13 <212> RNA <213> E. coli <400> 48 gccgaaaggc aca 13 <210> 49 <211> 13 <212> RNA <213> E. coli <400> 49 gccgaaaggc uca 13 <210> 50 <211> 13 <212> RNA <213> E. coli <400> 50 gccgaaaggc cca 13 <210> 51 <211> 47 <212> RNA <213> E. coli <400> 51 uugacaucca cggaaguuuu cagagaugag aaugugccuu cgggaac 47 <210> 52 <211> 40 <212> RNA <213> E. coli <400> 52 gccgaaaggc acacuuaauu auuaaaggua auacacuaug 40 <210> 53 <211> 32 <212> RNA <213> E. coli <400> 53 gccgaaaggc ucaaguuaag gaauguagaa ug 32 <210> 54 <211> 34 <212> RNA <213> E. coli <400> 54 gccgaaaggc ccaaaaugaa ggaaguaaaa uaug 34 <210> 55 <211> 162 <212> RNA <213> E. coli <400> 55 acgguuugac guacagacca uuaaagcagu guaguaaggc aagucccuuc aagaguuauc 60 guugauaccc cucguagugc acauuccuuu aacgcuucaa aaucuguaaa gcacgccaua 120 ucgccgaaag gcacacuuaa uuauuaaagg uaauacacua ug 162 <210> 56 <211> 136 <212> RNA <213> E. coli <400> 56 aaguguagua aggcaagucc cuucaagagu uaucguugau accccucgua gugcacauuc 60 cuuuaacgcu ucaaaaucug uaaagcacgc cauaucgccg aaaggcacac uuaauuauua 120 aagguaauac acuaug 136 <210> 57 <211> 134 <212> RNA <213> E. coli <400> 57 acgguuugac guacagacca uuaaagcuua ucguugauac cccucguagu gcacauuccu 60 uuaacgcuuc aaaaucugua aagcacgcca uaucgccgaa aggcacacuu aauuauuaaa 120 gguaauacac uaug 134 <210> 58 <211> 131 <212> RNA <213> E. coli <400> 58 acgguuugac guacagacca uuaaagcagu guaguaaggc aagucccuuc aagagcuuua 60 acgcuucaaa aucuguaaag cacgccauau cgccgaaagg cacacuuaau uauuaaaggu 120 aauacacuau g 131 <210> 59 <211> 130 <212> RNA <213> E. coli <400> 59 acgguuugac guacagacca uuaaagcagu guaguaaggc aagucccuuc aagaguuauc 60 guugauaccc cucguagugc acauuauauc gccgaaaggc acacuuaauu auuaaaggua 120 auacacuaug 130 <210> 60 <211> 136 <212> RNA <213> E. coli <400> 60 acgguuugac guacagacca uuaaagcagu guaguaaggc aagucccuuc aagaguuauc 60 guugauaccc cucguagugc acauuccuuu aacgcuucaa aaucuguaaa gcacgccuua 120 aagguaauac acuaug 136 <210> 61 <211> 65 <212> RNA <213> E. coli <400> 61 uuaaggaaug uagaauguca aauaaaauga cugguuuagu aaaaugguuu aacgcugaua 60 aaggu 65 <210> 62 <211> 39 <212> RNA <213> E. coli <400> 62 cuuaaccuuc gggagggcgc uuaccacuuu gugauucau 39 <210> 63 <211> 15 <212> RNA <213> E. coli <400> 63 uacuuagugu uucac 15 <210> 64 <211> 12 <212> RNA <213> E. coli <400> 64 aaucacaaag ug 12 <210> 65 <211> 15 <212> RNA <213> E. coli <400> 65 augaaucaca aagug 15 <210> 66 <211> 47 <212> RNA <213> E. coli <400> 66 ucuagagggu auuaauaaug aaagggggaa uuccaagcuu ggauccg 47 <210> 67 <211> 15 <212> RNA <213> E. coli <400> 67 cacuuuguga uucau 15 <210> 68 <211> 48 <212> RNA <213> E. coli <400> 68 ucuagagggu auuaauaaug aaagggggaa uuaugaauca caaagugg 48 <210> 69 <211> 48 <212> RNA <213> E. coli <400> 69 ucuagcccuu auuaauaaug aaagggggaa uuaugaauca caaagugg 48 <210> 70 <211> 33 <212> RNA <213> E. coli <400> 70 ucuagcccuu auuaauaaug aaucacaaag ugg 33 <210> 71 <211> 33 <212> RNA <213> E. coli <400> 71 ucuagagggu auuaauaaug aaucacaaag ugg 33

Claims (67)

delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete Any one of a polynucleotide selected from the group consisting of SEQ ID NOs: 48 to 50 which enhances the translation of a gene located downstream under conditions which cause a cold shock reaction in the bacterium; And a nucleic acid vector comprising a downstream box. The nucleic acid vector of claim 16 comprising a shine-dalgano sequence. 17. The vector according to claim 16, further comprising a nucleic acid molecule consisting of +1 to +11 nucleotides of 5 'UTR of the cold shock inducing gene selected from the group consisting of cspA, cspB, cspG and csdA. . 17. The vector of claim 16, further comprising a nucleic acid molecule consisting of +56 to +117 nucleotides of the cspA 5 'UTR. The vector of claim 16, wherein the gene is a cold shock inducing gene. 19. The vector of claim 18, wherein the gene is a cold shock inducing gene. 20. The vector of claim 19, wherein the gene is a cold shock inducing gene. The vector of claim 16, wherein the gene is a heterologous gene. 19. The vector of claim 18, wherein said gene is a heterologous gene. 20. The vector of claim 19, wherein said gene is a heterologous gene. 17. The method of claim 16, further comprising: a promoter; And one or more restriction enzyme recognition sites for insertion of additional DNA fragments located downstream of the polynucleotide and the downstream box. The device of claim 18, further comprising: a promoter; And one or more restriction enzyme recognition sites for insertion of additional DNA fragments located downstream of the polynucleotide and the downstream box. The system of claim 19, further comprising: a promoter; And one or more restriction enzyme recognition sites for insertion of additional DNA fragments located downstream of the polynucleotide and the downstream box. 27. The vector of claim 26, wherein said additional DNA fragment encodes a cold shock inducing gene. The vector of claim 27, wherein said additional DNA fragment encodes a cold shock inducing gene. 29. The vector of claim 28, wherein said additional DNA fragment encodes a cold shock inducing gene. 27. The vector of claim 26, wherein said additional DNA fragment encodes a heterologous gene. The vector of claim 27, wherein said additional DNA fragment encodes a heterologous gene. 29. The vector of claim 28, wherein said additional DNA fragment encodes a heterologous gene. A transformed bacterium containing the vector according to claim 16. A transformed bacterium containing the vector according to claim 18. A transformed bacterium containing the vector according to claim 19. In a method of overexpressing a gene, Transforming the bacteria with the nucleic acid vector according to claim 16; And Placing the bacteria under conditions that produce a cold shock reaction Overexpression method of the gene comprising a. In a method of overexpressing a gene, Transforming the bacteria with the nucleic acid vector according to claim 18; And Placing the bacteria under conditions that produce a cold shock reaction Overexpression method of the gene comprising a. In a method of overexpressing a gene, Transforming the bacteria with the nucleic acid vector according to claim 19; And Placing the bacteria under conditions that produce a cold shock reaction Overexpression method of the gene comprising a. 39. The method of overexpression of a gene according to claim 38, wherein the expression of one or more endogenous proteins is reduced by said overexpression. 40. The method of overexpressing a gene according to claim 39, wherein the expression of one or more endogenous proteins is reduced by the overexpression. 41. The method of overexpressing a gene according to claim 40, wherein the expression of one or more endogenous proteins is reduced by the overexpression. 39. The method of over-expression of a gene according to claim 38, wherein the conditions for generating a cold shock response include placing the bacteria at a low temperature at which a cold shock response can be induced. 40. The method of overexpressing a gene according to claim 39, wherein the conditions for generating a cold shock reaction include placing the bacteria at a low temperature at which a cold shock response can be induced. 41. The method of overexpressing a gene according to claim 40, wherein the condition for generating a cold shock reaction comprises placing the bacteria at a low temperature at which a cold shock response can be induced. 45. The method of overexpressing a gene according to claim 44, wherein said low temperature is 10-15 [deg.] C. 46. The method of overexpressing a gene according to claim 45, wherein said low temperature is 10-15 [deg.] C. 47. The method of overexpression of a gene according to claim 46, wherein said low temperature is 10-15 [deg.] C. Promoter; nucleic acid molecules consisting of +1 to +11 nucleotides of the 5 'UTR of the cold shock inducing gene selected from the group consisting of cspA, cspB, cspG and csdA; nucleic acid molecules consisting of +56 to +117 nucleotides of the cspA 5 ′ UTR; Any one polynucleotide selected from the group consisting of SEQ ID NOs: 48 to 50; Shine-dalgano sequence; Translation initiation codon; Downstream boxes of cold shock inducing genes; And one or more restriction enzyme recognition sites for insertion of additional nucleic acid fragments. 51. The vector of claim 50 comprising an additional nucleic acid fragment encoding a cold shock inducing gene. 51. The vector of claim 50 comprising an additional nucleic acid fragment encoding a heterologous gene. A transformed bacterium comprising the vector according to claim 50. In a method of overexpressing a gene, Transforming the bacteria with the nucleic acid vector according to claim 50; And Placing the bacteria under conditions that produce a cold shock reaction Overexpression method of the gene comprising a. 55. The method of claim 54, wherein the condition causing the cold shock response comprises placing the bacteria at a low temperature at which a cold shock response can be induced. delete delete delete delete delete delete delete delete delete delete delete delete

Images