KR100552547B1 - TNF Receptor Associated Factor (TRAF) Modulators, Preparations and Their Uses - Google Patents

Abstract

DNA sequences encoding proteins capable of binding tumor necrosis factor receptor-associated (TRAF) molecules, TRAF-binding proteins encoded by the DNA sequences, allotropes, analogs or fragments and derivatives thereof, DNA sequences and proteins It relates to methods for producing and the use of DNA sequences and proteins.

Description

NTF receptor associated factor (TRF) modulators, their preparation and uses thereof

The present invention relates to a DNA sequence encoding a protein capable of binding TRAF2, thereby to a protein encoded by it, to any activity regulated by a disease associated with NF- _K B induction or by other molecules binding to TRAF2 or such proteins. It relates to the use of such protein and DNA sequences in treating associated diseases.

Tumor necrosis factor / nerve growth factor (TNF / NGF) receptor superfamily is defined by structural similarities between the extracellular domains of these components (Bazan, 1993; Beutler and van Huffel, 1994; Smith et al., 1994). . Except for the two receptors, p55 TNF receptor and Fas / APO1, the various components of these receptor families do not clearly show structural similarities in these intracellular domains. Nevertheless, there are significant functional similarities between receptors, which means that these receptors have a common signaling pathway. One example of such similarity is that some receptors of the TNF / NGF family have the ability to activate the transcription factor NF- _K B. This common ability is explained by the ability of cytoplasmic proteins to activate NF- _K B. TNF receptor associated factor 2 (TRAF2) binds to structurally similar intracellular domains of several receptors of the TNF / NGF family. The mechanism by which TRAF2 works and how it responds to the different receptors to which it binds is not yet known.

TRAF1, TRAF2 (Rothe, M., Wong, sc, Henzel, WJ and Goeddel, D. (1994) Cell 78: 681-692; PCT published application WO 95/33051), TRAF3 (Cheng, G., et al) One member of the recently identified protein family called TRAF, which includes several identified proteins, including TRAF6 (Cao et al., 1996a), is TRAF2. All proteins belonging to the TRAF family have significantly higher amino acid identity to their C-terminal domains, while N-terminals are irrelevant. Referring to Figure 1 illustrating the structure of TRAF2, it can be seen that the ring finger motif and two TFIIIA-like zinc finger motifs are included at the C-terminus. At the C-terminus of the molecule is a "TRAF" comprising a C-terminus of the domain between the leucine zipper between amino acids 264-358 (called N-TRAF) and the amino acids 359-501 (called C-TRAF). Domain ", which serves to bind TRAF to the receptor and to other TRAF molecules to make homodimers and heterodimers.

The transcription factor NF- _K B is activated by a signaling cascade initiated by some TNF / NGF receptors and mediated by TRAF2. NF- _K B is a member of a dimeric protein with similarity to Rel oncozin, which acts as an electron factor in dimeric form. These factors are interspersed and participate in regulating the expression of multiple genes. Although initially identified as a constitutive factor present in B cells in the Ig _K light chain expression step, NF- _K B was found to act as an inducible transcriptional activator. In most known cases, NF- _K B acts as a primary factor, ie its induction of activity acts by activating an existing molecule in an inactive form in the cell rather than de novo synthesis, which is NF- _K. Depends on inducible transcription factors that initiate the B gene. The effect of NF- _K B is very high in multiphase dielectric. Many of these effects share common features that are rapidly induced in response to extracellular stimuli. NF- _K B major activators are immune defense inducers, including viruses, components of bacteria, cytokines that regulate immune responses, UV light and others. Thus, many genes induced by NF- _K B contribute to immune defense (see Blank et al., 1992; Grilli et al., 1993; Baeuerle and Henkel, 1994, for review).

One major feature of NF- _K B-regulation is that these factors can exist in a cytoplasmic DNA unbound form that is induced to translocate the nucleus, bind DNA and activate transcription. This dual form of the NF- _K B protein is regulated by a group I- _K B protein comprising repeat domains first distinguished from the erythrocyte protein ankyrin (Gilmore and Morin, 1993). In the unstimulated form, NF- _K B dimers occur in association with I- _K B molecules in the cytoplasmic position and interfere with interaction and transcriptional activity with NF- _K B-bound DNA sequences. Separation of I- _K B from NF- _K B dimers consists of an important step of activating it by many inducible factors (DiDonato et al., 1995). It is still far from knowing the mechanisms involved in this regulation. It is also useful to understand how to determine cell specificity for responsiveness to various NF- _K B-inducing factors.

One of the most potent inducers of NF- _K B is cytokine tumor necrosis factor (TNF). Two different TNF factors, p55 and p75 receptors. Their expression levels vary considerably from cell to cell (Vandenabeele et al., 1995). The p75 receptor prefers to respond to cell-bound TNF types (TNF is expressed in β-transmembrane and soluble protein types), while the p55 receptor responds more effectively to soluble TNF molecules (Grell et al. , 1995). The intracellular domains of the two receptors are structurally unrelated and bind to other cytoplasmic proteins. Nevertheless, these two receptors may induce at least some of the TNF effects, including the cytotoxic effects of TNF and the induction of NF- _K B. This feature is cell specific. The p55 receptor can induce the activation or cytotoxicity of NF- _K B in all cells that can exert such effects in response to TNF. Although p75-R is expressed in large amounts, it may be effective only in response to stimulation of p55-R (Vandenabeele et al., 1995). Apart from the TNF receptor, various other receptors of the TNF / NGF receptor family; CD30 (McDonald et al., 1995), CD40 (Berberich et al., 1994; Lalmanach-Girard et al., 1993), lymphotoxin beta receptors, and Fas / APO1 (Rensing-Ehl et al., 1995) And the like can induce the activity of NF- _K B. In addition, IL-1 type I receptors that effectively stimulate NF- _K B activation share most of the effects of TNF receptors despite their structural similarity.

The activation of NF- _K B due to the stimulation of these various receptors is due to the induced phosphorylation of the I- _K B molecules associated with it. These phosphorylation reactions are attached to the tail of I- _K B and degrade most of them in the proteasome. The nature of the kanase that phosphorylates I- _K B and the mechanism by which it stimulates the receptor are not yet known. However, there have been some harvests identifying three-receptor associated proteins that have been shown to participate in phosphorylation reactions in the last two years (see Figures 2A and 6). The protein, called TRAF2, first cloned by D. Goeddel and his colleagues (Rothe et al., 1994) appears to play an important role in NF- _K B-activation by various TNF / NGF receptor families. When a large amount of protein is expressed, it itself stimulates NF- _K B activation, and activated p75 TNF-R (Rothe et al., 1994), lymphotoxin beta receptor (Mosialos et al., 1995), CD40 ( Rothe et al., 1995a), bind to CD-30 (unpublished data) and mediate NF- _K B induction by them. TRAF2 does not bind to either the p55 receptor or the Fas / APO1 receptor, but can bind to the p55 receptor-associated protein called TRADD, which is called Fas / APO1 called MORT1 (or FADD-Boldin et al., 1995b and 1996). -Have the ability to bind to the associated protein. Another receptor-interacting protein called RIP (Stanger et al., 1995) can interact with TRAF2 and FAS / APO1, TRADD, p55 TNF receptor and MORT-1. Thus, RIP is associated with induction of cytotoxicity of cells (cell death), suggesting that the ability to interact with TRAF2 is associated with activation of NF- _K B, and also FAS / APO1, MORT-1 , p55 TNF receptor and TRADD and TRAF2 have a further action to enhance the interaction in the pathway inducing NF- _K B activation. This association allows the p55 TNF receptor and Fas / APO1 to stimulate NF- _K B activation (Hsu et al., 1995; Boldin et al., 1995; Chinnalyan et al., 1995; Varfolomeev et al., 1996; Hsu et al., 1996). Promoting NF- _K B activation by the IL-1 receptor occurs independently of TRAF2 and may involve a recently cloned IL-1 receptor-associated protein-kinase called IRAK (Croston et al., 1995 ).

It is not yet known which mechanism activates TRAF2, but several cytoplasmic molecules that bind TRAF2 have been identified (Rothe et al; Rothe et al., 1995b). However, the information on these molecules did not provide clues on how TRAF2 stimulates the phosphorylation of I- _K B and whether it has any enzymatic activity in TRAF2 itself. There is no information on the mechanisms that show TRAF2 cell specific activation patterns by different receptors as observed in NF- _K B induction by the two TNF receptors.

In addition to the foregoing, in various TRAF proteins, TRAF2 binds to the p55 (CD120a) and p75 (CD120b) TNF receptors, as well as to several other receptors of the TNF / NGF family of receptors directly or via other adapter proteins described above. In the FAS / APO1 receptor, there are adapter proteins such as MORT-1, TRADD, and RIP. TRAF2 is thus important for the activation of NF- _K B (Wallach, 1996). However, TRAF3 interferes with the activation of NF- _K B by some receptors in the TNF / NGF family of receptors (Rothe et al., 1995a), whereas TRAF6 interferes with the induction of NF- _K B by IL-1. (Cao et al., 1996a).

Thus, for the importance of maintaining NF- _K B activation and cell viability, the various cellular pathways involved in this activation have not yet been identified, but how the various TRAF proteins are directly or indirectly involved.

In addition, as is known for signal pathways associated with the TNF / NGF receptor family and its various adapters, mediators / regulators proteins (co-pending Israel Patent Application Nos. 114615, 114986, 115319, 116588), FAS / APO1 ligands have both beneficial and detrimental effects on cells. For example, TNF contributes to the defense of organisms against tumors or infectious agents, induces the death of tumor cells and virus-infected cells, enhances the antimicrobial activity of granulocytes and thereby recovers from damage, thus In this case, cell death induced by TNF is preferred. However, excess TNF is detrimental, and it is known that TNF plays a major etiological role in many diseases such as pulmonary shock, anorexia nervosa, rheumatic diseases, inflammation and host response to grafts. In such cases, cell death induced by TNF is undesirable. FAS / APO1 ligands also have both desirable and detrimental effects. Such FAS / APO1 ligands kill autoactive T cells during their maturation through their receptors, which kill T cells that recognize auto-antigens during T cell generation to prevent autoimmune diseases. In addition, various tumor cells and HIV-infected cells have FAS / APO1 receptors on their surface and are thus destroyed by activation of the receptors by their ligands or antibodies specific thereto, thus apoptosis mediated by these receptors. ) Activate intracellular pathways. However, FAS / APO1 receptors may also mediate deleterious effects, such as the indiscriminate death of tissues found in certain diseases such as acute hepatitis, which involve the destruction of liver cells.

In view of the foregoing, TNF / NGF) receptor family of receptor is the one hand and can induce cell death path, on the other hand it may be induced through the cell survival pathway induction of NF- _K B, which two kinds of the opposite Intracellular balance between pathways is well maintained. For example, when it is desired to maximally destroy cancer cells or other infected or diseased cells, it is desirable to have TNF and FAS / APO1 ligands that induce only cell death pathways without NF- _K B induction. Conversely, in order to protect cells from inflammation, graft-host response, acute hepatitis, it is desirable to block the induction of cell death of TNF and FAS / APO1 ligands and instead induce NF- _K B induction. Similarly, in certain pathogenesis it is desirable to block intracellular signal pathways mediated by the p75 TNF receptor and IL-1 receptor, while in other circumstances it is desirable to enhance such intracellular pathways.

Summary of the Invention

It is an object of the present invention to provide novel proteins, allotropes, analogs, fragments thereof or derivatives thereof capable of binding to tumor necrosis factor-associated (TRAF) proteins. Since the TRAF protein is involved in the regulation of the activation of the transcription factor NF- _K B initiated by some TNF / NGF receptors and other factors described above, by binding to the TRAF protein the protein of the invention can bind to such receptors. It may affect the intracellular signaling process initiated by various ligands (eg, TNF, FAS ligands, and others), for example, by regulating NF- _K B activation by interacting directly or indirectly with TRAF proteins. .

The novel protein of the invention is a direct matter for adjusting the intracellular biological activity of TRAF proteins (e.g., obstruction of NF- _K B activation by TRAF2 and TRAF6 and TRAF3 by induction of NF- _K B activation).

The novel proteins of the invention interact directly or indirectly with TRAF proteins (eg, FAS / APO1 receptor, p55 TNF receptor, p75 TNF receptor, IL-1 receptor and their associated proteins such as MORT-1, TRADD, RIP). It is an indirect regulator of intracellular biological activity of a variety of different proteins.

Another object of the present invention is to provide antagonists, allotropes, analogs, fragments, derivatives thereof to the novel TRAF-binding protein, which interferes with the signaling process and, more specifically, the NF in the cell-survival process if desired Interfere with _K B activation and its associated action. Similarly, the TRAF-binding protein of the present invention or the TRAF protein to which it binds (such as TRAF3) is itself an interference with NF- _K B activation, and the object of the present invention is therefore such TRAF-binding to activate signal processing. It provides an antagonist to the protein and, more specifically, blocks it from interfering with NF- _K B activation if desired, thus enhancing NF- _K B activation.

Another object of the present invention is to use novel TRAF-binding proteins, allotropes, analogs, fragments and derivatives to isolate and characterize additional proteins and factors that may be involved in TRAF protein activity or in the aforementioned receptor activity. For example, it is possible to bind to TRAF proteins and to affect their activity and to separate other receptors or other cellular proteins upstream or downstream in the signaling process to which such novel proteins, analogs, fragments and derivatives thereof bind, and To characterize.

Another object of the invention is to induce intracellularly interfering with a novel TRAF-binding protein or an interfering substance capable of binding to or interacting with its allotrope, such an inhibitor is TRAF protein-associated activity such as NF- _K B activation. Or interfere with TRAF-associated activity (such as TRAF3) interferers to enhance NF- _K B activity, if desired.

Alternatively, it is an object of the present invention to use the novel TRAF-binding proteins, allotropes, analogs, fragments and derivatives thereof described above as antigens for the isolation of polyclonal or monoclonal antibodies. Alternatively, antibodies can be used to purify novel proteins from other sources, such as cell extracts or transformed cell lines.

In addition, these antibodies can be used for diagnostic purposes, such as abnormal by mediation by TRAF proteins or by p55 TNF receptor, FAS / APO1 receptor or other related receptors and their associated cellular proteins (eg MORT-1, TRADD, RIP). It can be used to identify diseases associated with cellular function, which can directly or indirectly regulate intracellular processes through interaction with TRAF proteins.

Another object of the present invention is to provide a pharmaceutical composition comprising the novel TRAF protein, allotropes, analogs, fragments and derivatives thereof, and a pharmaceutical composition comprising antibodies and other antagonists thereof.

According to the invention, a number of novel TRAF-binding proteins, in particular TRAF2-binding proteins, have been isolated. Such TRAF2 binding proteins have significant specificity for binding to TRAF2 (see Examples below) and thus are modulators of TRAF2 intracellular activity. TRAF2 is involved in the regulation and mediation of at least one intracellular signaling pathway that is a pathway associated with cell survival in which TRAF2 is directly involved in NF- _K B activation, which plays an important role in cell survival. In fact, one of these novel proteins called NIK (NF- _K B induction kinase) binds to TRAF2 and stimulates NF- _K B activation. NIK is a kinase that shares sequences similar to several MAPKK kinases (see below). In addition, TRAF2, which can directly or indirectly interact with the aforementioned p55 TNF receptor, p75 TNF receptor, FAS / APO1 receptor and these associated proteins MORT-1, TRADD, RIP, or NF- _K B activation by these receptors or Induction regulator. Thus, TRAF2 is a regulator of cell survival pathways (as opposed to cell death pathways) mediated by these receptors and their associated proteins and the degree of interaction of these receptors or proteins with TRAF2 is dependent on these receptors (activated by these ligands). Is an important factor in determining whether or not cells will live or die. Thus, proteins of the present invention, such as NIK, play a major role in the interaction between TRAF2 and other proteins / receptors that interact with TRAF2, and by binding specifically to TRAF2, proteins such as NIK can modulate their activity. And have activity regulated by interaction with TRAF2.

TRAF-binding proteins, including TRAF2-binding proteins, including NIKs, were isolated and cloned using two hybrid-systems, partially or completely sequenced, and characterized. TRAF2-binding as described below. It is highly specific for the protein and therefore is called a specific TRAF2 modulator.

As described herein, TRAF activating proteins such as TRAF2 activity mean that they are active in regulation and mediation in cell survival pathways that are particularly associated with NF- _K B activation / induction. Similarly, TRAF-binding protein, in particular TRAF2-binding protein, activity means that it modulates and mediates the activity of TRAF- (particularly TRAF2) by specifically binding to TRAF (particularly TRAF2). The regulation and mediation of cell survival pathways associated with NF- _K B activation / induction are directly or indirectly related to TRAF proteins, particularly TRAF2, and such TRAF or TRAF2 binding proteins are indirect to all of the aforementioned proteins. Many others that are modulators, are involved in cell survival, particularly NF- _K B activation / induction, and that TRAF2 (or other TRAF proteins) can bind or interact directly or indirectly with TRAF2 (or other TRAF proteins) Is an indirect regulator of substances.

Thus, the present invention provides DNA sequences that encode proteins capable of binding to tumor necrosis factor-associated (TRAF) molecules.

One embodiment of the DNA sequence of the invention is a sequence that encodes a protein capable of binding to TRAF2.

Another embodiment of the DNA sequence of the present invention is a sequence encoding a protein capable of binding to an amino acid sequence comprising amino acid residues 222-501 of the amino acid sequence of TRAF2.

Other embodiments of the DNA sequences of the invention include the following;

(a) a cDNA sequence designated as clone 9 consisting of the nucleotide sequences shown in FIG. 3A;

(b) a cDNA sequence designated as clone 10 consisting of the nucleotide sequences shown in FIG. 4;

(c) a cDNA sequence designated as clone 15 consisting of the nucleotide sequence shown in FIG. 5A;

(d) a fragment of sequences (a)-(c) encoding a biologically active protein capable of binding an amino acid sequence comprising amino acid residues 222-501 of the amino acid sequence of TRAF2;

(e) a DNA sequence capable of encoding a protein capable of binding to an amino acid sequence comprising amino acid residues 222-501 of the amino acid sequence of TRAF2 and hybridizing to the sequences (a)-(d) under mild stringent conditions ;

(f) a DNA sequence encoding a biologically active protein capable of binding to an amino acid sequence comprising amino acid residues 222-501 of the amino acid sequence of TRAF2, and (a)-(e) genetically condensed into a DNA sequence.

Another embodiment of the above-described DNA sequences of the present invention includes the following;

a DNA sequence selected from the sequences contained in those designated cDNA clones 9 and 15;

DNA sequences encoding proteins capable of modulating NF- _K B activity; And

DNA sequence selected from the sequences contained in cDNA clone 10.

A further embodiment of the DNA sequence of the present invention is a DNA sequence consisting of a DNA sequence encoding the protein NIK (NF- _K B induction kinase).

Embodiments of the DNA sequence of the present invention encoding NIK proteins include the following;

(i) a DNA sequence encoding a protein NIK, its allotropes, fragments or derivatives thereof capable of binding TRAF2 and modulating NF- _K B activity;

(ii) (a) a cDNA sequence derived from the coding portion of the native NIK protein; (b) a DNA sequence encoding a biologically active NIK and capable of hybridizing to (a) the sequence under slightly stringent conditions; And (c) a DNA sequence that encodes a biologically active NIK and whose genetic code is condensed into the sequence defined in (a) and (b); a DNA sequence such as (i) selected from;

(iii) a DNA sequence, such as (i) or (ii), consisting of at least a portion of the sequence shown in FIG. 6 and encoding at least one active NIK protein, its allotropes, analogs or fragments;

(iv) a DNA sequence such as (iii) encoding an NIK protein, allotrope, analog, or fragment having at least a portion of the amino acid sequence shown in FIG. 6.

In another aspect, the invention provides a protein or an allotropy, analogue or fragment and derivative thereof encoded by the DNA sequence of the invention which can bind TRAF2, in particular the amino acid sequence 222-501 of TRAF2. To provide. Specific examples of these proteins / polypeptides, allotropes, analogs or fragments and derivatives thereof include the following;

(a) a protein encoded by designation as clone 10;

(b) a NIK protein, an analog, an analog, or a fragment and derivative thereof encoded by the DNA sequence encoding the NIK protein, its allotropes, analogs or fragments and derivatives;

(c) the NIK protein, its allotropes, analogues or fragments and derivatives encoded by said DNA sequence encoding said NIK protein, its allotropes, analogs or fragments and derivatives wherein the protein, its allotropes, analogs or fragments is shown in Figure 6 Has a portion of the amino acid sequence of

In another aspect, the present invention provides a vector consisting of said DNA sequence according to the present invention which can be expressed in a host cell selected from eukaryotic or prokaryotic cells and transformed eukaryotic or prokaryotic cells comprising such vector. .

The present invention is also suitable for obtaining the protein, its allotropes, analogs or fragments according to the invention and for the expression and post-transcriptional regulation of the proteins, their allotropes, analogs or fragments required for isolating the expressed proteins, their allotropes, analogs or fragments. Provided are methods for making proteins, allotropes, analogs or fragments thereof encoded by said DNA sequences consisting of growing the above-described transformed host cells.

In another aspect, the invention provides antibodies, or active fragments or derivatives thereof, that are specific for TRAF-binding proteins, allotropes, analogs or fragments thereof, or specific for NIK proteins, allotropes, analogs or fragments thereof.

In another aspect, the present invention provides a screening method as follows;

(i) A method for screening ligands that can bind proteins, allotropes, analogs or fragments and derivatives thereof comprises contacting the cell extract to an affinity chromatography matrix to which the proteins, allotropes, analogs or fragments and derivatives are bound so that the ligands are matrixed. Bound to elute, isolate and analyze the ligand.

(ii) A method for screening DNA sequences encoding ligands capable of binding to proteins, allotropes, analogues or fragments thereof and derivatives according to the invention as described above uses a yeast two hybrid process, wherein Sequences encoding their allotropes, analogs or fragments and derivatives are in the first hybrid vector and the cDNA sequence or the sequence of the genomic DNA library is in the second hybrid vector and these vectors are transduced into the yeast host cell and positive The converted cells are separated and the second hybrid vector is extracted to obtain a sequence encoding the ligand.

Similarly, there is provided a method for isolating a protein, an allotrope, an analog or a fragment thereof according to the present invention which can directly bind TRAF2, which utilizes a yeast two hybrid process wherein the sequence encoding TRAF2 is the first hybrid vector. Carried by and the cDNA or genomic DNA library is carried by a second hybrid vector, the vector is used to transform the yeast host cell to isolate a positive transformed cell and encode a protein capable of binding to TRAF2. The second hybrid vector is extracted to obtain the sequence.

Another feature of the invention is a method of mediating or modulating NF- _K B activity or any other intracellular signaling activity mediated by TRAF2 or other molecule to a protein, allotropes, analogs or fragments thereof and derivatives described above. Wherein the method comprises introducing a DNA sequence encoding the protein, its allotropes, analogs or fragments and derivatives into a cell suitable for entry into the cells or encoding the protein, its allotropes, analogs or fragments and derivatives Eggplants consist of treating the cell by introducing a vector into the cell, wherein the vector has the ability to insert the sequence into the cell in such a way that the sequence can be expressed in the cell.

Embodiments of such methods of mediating or regulating NF- _K B activation or other intracellular signaling processes intracellularly by TRAF2 or other molecules include;

(i) in the above method, the cells are treated by introducing into the cell a suitable vector having a DNA sequence encoding a protein, its allotropes, analogs or fragments and derivatives, wherein the vector comprises a sequence of Consists of having the ability to insert sequences into cells in a way that can be expressed.

(ii) transfecting the cells with a recombinant animal virus vector to treat the cells, wherein (a) a viral surface protein (ligand) capable of binding to a specific cell surface receptor on the surface of the cell to be treated. A recombinant animal viral vector is constructed having a first sequence encoding and a second sequence encoding a protein, its allotropes, analogs or fragments and derivatives according to the invention, wherein the protein encoded in the second sequence is intracellular. Once expressed at can mediate or regulate NF- _K B activation or other intracellular signal-providing activity by TRAF2 or another molecule; (b) infecting the constructed vector of (a) with a cell.

Similarly, the present invention provides a method of mediating TRAF2 modulated effects in a cell, which comprises providing and treating the cell with a suitable composition comprising the antibody or active fragment or derivative thereof according to the invention described above, The composition is made available for extracellular use when the TRAF2-bound protein or portion thereof is exposed to the extracellular surface, and the composition is ready for use intracellularly when the TRAF2-bound protein or portion thereof is exposed to the intracellular surface. do.

Another method of mediating TRAF2 regulated effects in cells is as follows;

(i) treating the cell with an oligonucleotide sequence that encodes an antisense sequence for at least a portion of the DNA sequence that encodes a TRAF2-binding protein, which DNA sequence may be one of the foregoing. And the oligonucleotide sequence can block the expression of TRAF2-binding protein.

(ii) In the method mentioned in (i), the oligonucleotide sequence is introduced into a cell using the above-mentioned recombinant virus, wherein the second sequence of the virus encodes such oligonucleotide.

(iii) there is a method using the lysozyme process, which intracellularly encodes a vector encoding a lysozyme sequence capable of interacting with the cellular mRNA sequence encoding the TRAF2-binding protein, its allotropes, analogs or fragments and derivatives thereof of the present invention. When introduced into cells in a form that can be expressed and such lysozyme sequences are expressed in the cell, they interact with the cellular mRNA sequence to cleave the mRNA and interfere with the expression of TRAF2-binding proteins in the cell.

In all methods of the invention, the proteins of the invention may specifically be NIK or allotropes, analogs or fragments and derivatives of NIK.

In the methods of the invention and embodiments thereof, treating or treating diseases associated with mediating NF- _K B activation or other activity by TRAF2 or other molecule capable of binding to proteins, allotropes, analogs or fragments thereof and derivatives thereof A method of prophylaxis includes a method in which an effective amount of a protein, its allotropes, analogs or fragments and derivatives thereof, or DNA molecules or proteins encoding it, or any of its allotropes, analogs or fragments and derivatives, binds to TRAF2. It consists of administering to a patient a molecule capable of interacting with the same protein, its allotropes, analogs or fragments and derivatives. In the method of the present invention, a protein encoded by clone 10, an NIK protein, an allotrope, analog or fragment and derivative thereof or a DNA molecule encoding the same is administered to the patient. The protein encoded by clone 10 interfere with the NF- _K B activation and NIK induces NF- _K B activation.

Another aspect of the invention provides a pharmaceutical composition capable of modulating TRAF2 mediated effects in cells comprising at least one of the TRAF2 protein, its allotropes, analogs or fragments thereof, and derivatives or mixtures thereof according to the invention.

Other pharmaceutical compositions according to the present invention include the following;

(i) A pharmaceutical composition capable of modulating TRAF2-mediated effects in cells is an active ingredient which encodes a TRAF2-binding protein, an allotrope, an active fragment or an analog thereof according to the invention and which can bind to cell surface receptors. It consists of a recombinant viral vector that encodes.

(ii) A pharmaceutical composition capable of modulating TRAF2-mediated effects in cells consists of an oligonucleotide sequence that encodes the antisense sequence of the TRAF2-binding protein mRNA sequence according to the invention as an active ingredient.

Another embodiment of the pharmaceutical composition is a disease of a disease associated with NF- _K B activation or any other activity mediated by TRAF2 or other molecule to which the protein, its allotropes, analogs or fragments and derivatives according to the invention bind. A pharmaceutical composition for treating or preventing a condition, wherein the composition binds a protein according to the invention, an analog, an analog or fragment and a derivative thereof or a DNA molecule or protein encoding the same, an analog, an analog or fragment or a derivative thereof. Consisting of molecules that may interfere with the interoperability of TRAF2 or other molecules with proteins, their allotropes, analogs or fragments and derivatives. In another suitable embodiment the pharmaceutical composition consists of a protein encoded by clone 10, an NIK protein, an allotrope, analog or fragment and derivative thereof or a DNA molecule effective amount encoding the same.

In another specific embodiment the invention provides a pharmaceutical composition for preventing or treating a disease associated with NF- _K B activation or any other activity by TRAF2 or any other molecule to which the protein NIK binds. It consists of molecules that can interfere with kinase activity. In such compositions, the hindered molecule can be an effective amount of NIK mutated to the active site, and thus the mutated NIK serves to interfere with the kinase activity of the native NIK, particularly NIK.

One known disease associated with NF- _K B activation (abnormal) is AIDS, and the other is autoimmune diseases and tumors.

Other features and embodiments of the present invention are as follows;

(i) identifying and producing ligands capable of modulating cellular activity mediated by TRAF2;

a) screening a ligand capable of binding to a polypeptide consisting of at least a portion of TRAF2 having amino acid sequences 221-501 of TRAF2;

b) identifying and characterizing ligands (except TRAF2) of a portion of the receptors of the TNF / NGF receptor family found in the screening step;

c) Ligands are purified in actual isolated form.

(ii) identifying and making ligands capable of modulating cellular activity mediated by proteins, allotropes, analogs or fragments and derivatives thereof according to the invention

a) screening a ligand capable of binding to a polypeptide consisting of at least a portion of the NIK sequence shown in FIG. 6;

b) identifying and characterizing ligands (except TRAF2) of a portion of the receptors of the TNF / NGF receptor family found in the screening step;

c) Ligands are purified in actual isolated form.

(iii) identifying and making ligands capable of modulating cellular activity mediated by NIK

a) screening a ligand capable of binding to a polypeptide consisting of at least a portion of the NIK sequence shown in FIG. 6;

b) identifying and characterizing ligands (except TRAF2) of a portion of the receptors of the TNF / NGF receptor family found in the screening step;

c) Ligands are purified in actual isolated form.

(iv) identifying and making ligands that can directly or indirectly modulate cellular activity mediated by NIK.

a) screening molecules capable of modulating activity regulated by NIK;

b) identifying and characterizing the molecule;

c) Ligands are purified in actual isolated form.

(v) a method for identifying and making ligands capable of directly or indirectly modulating cellular activity mediated by proteins, allotropes, analogs or fragments and derivatives thereof according to the invention,

a) screening molecules capable of modulating activity regulated by proteins, allotropes, analogs or fragments and derivatives thereof according to the invention;

b) identifying and characterizing the molecule;

c) Ligands are purified in actual isolated form.

Further features of the present invention can be seen in the following detailed description of the invention.

Throughout the specification, the terms "prime and mediation of TRAF (or TRAF2) in cells" and "mediation and regulation" are meant to encompass both in vitro and in vivo treatments and interference or enhancement / enhancement.

1 illustrates the structure of TRAF2 molecules in a diagram.

Figures 2a-b graphically illustrate some of the proteins involved in NF- _K B activation, including novel TRAF-binding proteins (e.g. NIKs) of the present invention, where (a) illustrates a partial structure (b) Describes a more complete structure.

3A-B show the nucleotide sequence (a) at the 5 ′ end of clone 9 and its deduced amino acid sequence (b) encoded therein.

4 shows the nucleotide sequence of clone 10.

5A-B show the nucleotide sequence of clone 15 (a) and its deduced amino acid sequence (b) encoded therein.

6 shows the nucleotide sequence of NIK and the amino acid sequence inferred thereby.

Figure 7 shows the sequence of murine protein kinase mMEKK (murine MAPK or ERK kinase) and other kinases and the sequence of protein NIK. Portions corresponding to motifs I to XI conserved in protein kinases are marked.

The present invention relates to DNA sequences encoding proteins that can bind to tumor necrosis factor receptor-associated factor (TRAF) molecules and to proteins encoded thereby.

In a suitable embodiment, the invention relates to cDNA sequences contained in clones 6, 10, and 15 (represented in FIGS. 3A, 4, and 5A, respectively) encoding proteins capable of binding to TRAF2 and to the proteins encoded thereby. do.

In another suitable embodiment of the invention, the invention relates to a DNA sequence encoding a NIK protein and to a NIK protein.

The aforementioned DNA and amino acid sequences are new sequences that are not in the DNA sequence or amino acid sequence in "GENEBANK" or "PROTEIN BANK".

If encoding a biologically active protein or polypeptide capable of binding to amino acids 222-501 of TRAF2, fragments of the above-described DNA sequences and DNA sequences capable of hybridizing to these sequences or portions under slightly stringent conditions are also described herein. It is included in the range of.

The present invention relates to a DNA sequence encoding a biologically active protein or polypeptide capable of binding to the amino acid sequence 222-501 of TRAF2, with the genetic code condensed on the DNA sequence.

For TRAF2, some components of the TNF / NGF receptor family associate directly or indirectly with TRAF2 to activate the transcription factor NK- _K B, which is an adapter protein of these receptors and the NK- _K B activity of these TNF / NGF receptors Appears to induce or regulate (FIG. 2B). Another receptor, the IL-1 receptor, independently activates the NK- _K B activity of TRAF2. One suitable embodiment of a suitable TRAF2-binding protein of the present invention is an NIK protein, which binds to NIK and stimulates NK- _K B activity in a very specific manner. NIK is a serine / threonine kinase having a sequence similar to several MAPKK kinases (see Examples below). NIK analogs lacking the kinase activity of NIK or mutants produced according to the invention (see Examples) failed to activate NK- _K B even though these analogs / mutants were expressed intracellularly. In addition, NIK analogs / mutants expressed in cells are NK by TNF and other substances such as bacterial toxin LPS, forbol myristate acetea (protein kinase C activator), and HTLV-1 protein TAX. Interfered with _K B activation. Induction of NF- _K B activity by TNF is accomplished by two TNF receptors (p55 TNF receptor / p75 TNF receptor) and NIK analogs / mutants seem to interfere with induction of NK- _K B activity through these receptors. Similarly, TNF and FAS / APO1 receptor ligands induce NK- _K B activity through the associated receptor, FAS / APO1, and such derivatives are blocked by NIK mutants / analogs. In addition, the receptor has adapter proteins MORT-1, TRADD, RIP, which can also induce NK- _K B activity, but this induction is also hampered by NIK analogs / mutants. In addition, such NIK mutants / analogs block NK- _K B activity by IL-1 (function through the IL-1 receptor). Thus, it can be seen that NIK participates in the NK- _K B activity inducing cascade common to the TNF / NGF receptor family and the IL-1 receptor. This is observed by observation that NIK analogs / mutants lacking kinase activity (also called dominant-negative mutants) do not in any way affect the TNF-induced activity of Jun kinases when expressed in cells. This indicates that NIK specifically enhances phosphorylation of I- _K B without affecting the MAP kinase involved in Jun phosphorylation.

Accordingly, the present invention relates to biologically active TRAF-binding proteins such as TRAF2-binding proteins such as NIK proteins, allotropes, analogs or fragments and derivatives thereof and DNA sequences encoding them. The preparation of such analogs, fragments, and derivatives refers to standard procedures (see Examples; Sambrook, 1989), in which the DNA encoding sequence removes, adds, or substitutes one or more codons for the native protein. At least one amino acid residue creates an encoded analog. Acceptable analogs are those capable of (or without) any other binding or enzymatic activity while retaining the ability to bind TRAF2, for example to bind to TRAF2 but to bind downstream of proteins or other factors. It becomes an analog that can not or cannot catalyze the reaction by signal. In this way analogs with so-called domain-negative effects are produced, ie, the analogs lack the ability to bind TRAF2 or there is no continuous signaling ability after such binding. Such analogs are used to interfere with the CD40, p55 TNF receptor, p75 TNF receptor (FAS / APO1) and compete with native TRAF2-binding proteins to effect mediated by a variety of receptor-associated proteins (adapters) as described above. It is used to interfere with other related receptors. Similarly, so-called dominant-positive analogs are produced to act to enhance the TRAF2 effect. They can have the same or better properties than TRAF2 binding properties and have the same or better properties of signaling of native TRAF2-binding proteins. In a similar manner biologically active fragments of the clones of the invention can be made according to the methods described above for making analogs. Suitable fragments of the DNA sequences of the present invention are those that encode proteins or polypeptides having TRAF2 binding capacity or those that mediate any other binding or enzymatic activity described above. Thus, the encoded protein fragments of the present invention are made to have a dominant-negative or dominant-positive effect as described above for analogues. Similarly, modifying the side chains of one or more amino acid residues of a protein, its allotropes, analogs or fragments to make derivatives or by conjugating the protein, its allotropes, analogs or fragments to other molecules such as antibodies, enzymes, receptors, etc. Known in the art.

Hybrid with cDNA sequences derived from coding portions of native TRAF-binding proteins in the DNA sequences of the invention encoding TRAF-binding proteins (eg, TRAF2-binding proteins, ie NIKs), allotropes, analogs or fragments and derivatives thereof Also included are DNA sequences that can be run under slightly stringent conditions and such hybrid DNA sequences encode biologically active TRAF-binding proteins. Thus, such hybridizable DNA sequences include DNA sequences that are relatively homogeneous to the native TRAF-binding protein cDNA sequence (eg, TRAF2-binding protein cDNA sequences such as NIK), which will result in various TRAF-binding protein allotropes. It can be a TRAF-binding protein-like sequence that can be a naturally occurring sequence that encodes a protein belonging to a group of TRAF-binding protein-like sequences that encodes a protein having activity of a TRAF-binding protein (e.g. TRAF2- such as NIK). Binding protein). In addition, these sequences include synthetically generated sequences that do not occur in nature, which are similar to the native TRAF-binding protein cDNA sequences but contain many desired modifications. Such synthetic sequences include all possible sequences that encode TRAF-binding proteins (eg, NIK) allotropes, analogs or fragments and derivatives having the activity of TRAF-binding proteins.

To obtain sequences similar to naturally occurring TRAF-binding proteins, the native TRAF-binding protein cDNA or a portion thereof is used as a probe according to standard procedures for screening and isolating naturally derived DNA or RNA samples from various tissues (eg, Sambrook et al. al., standard process set forth in 1989).

Similarly, to make various synthetic TRAF-binding protein analogous sequences encoding allotropes, analogs or fragments and derivatives of TRAF-binding proteins (eg, TRAF2-binding proteins, NIK), such isotopics, analogs or fragments and derivatives The use of a variety of standard processes related to making is described in detail below.

Proteins or polypeptides "actually corresponding" to TRAF-binding proteins include TRAF-binding proteins and polypeptides or proteins that are analogs to TRAF-binding proteins.

An analog that actually corresponds to a TRAF-binding protein is that at least one or more amino acids in the amino acid sequence of the TRAF-binding protein are substituted, deleted or added to another amino acid, provided that the resulting protein or polypeptide is identical to the corresponding TRAF-binding protein. Or higher biological activity.

Very few changes are made to TRAF-binding proteins, such as allotropes, to actually correspond to TRAF-binding proteins. The number of changes is less than 10, suitably less than 5, and the most appropriate number is less than 3. Any technique can be used to make a biologically active protein that corresponds to a true TRAF-binding protein, one technique of which is a slight variation using conventional mutation techniques in the DNA encoding the protein. Proteins expressed by such clones are screened for their ability to bind TRAF proteins (eg TRAF2), the regulation of the aforementioned intracellular pathways and the ability to alter TRAF protein (eg TRAF2) activity in mediation.

A "conservation" change does not change the activity of the protein and does not change the size, charge, or shape of the protein and is therefore screened first, which does not change the biological activity.

Conservative substituents of TRAF-binding proteins are analogs in which at least one amino acid in a polypeptide is substituted while retaining conservability with a different amino acid sequence. Such substitutions are suitably made as set forth in Table 1A, wherein the substituents are determined by routine experimentation to provide modified structural and functional properties of the synthesized polypeptide molecule while retaining the biologically active characteristics of the TRAF-binding protein. do.

Or another group of substituents of the TRAF-binding protein is one in which at least one amino acid in the polypeptide is removed and a different residue is inserted at that position, as shown in Table 1b below. Such substitutions made in polypeptides are described in Schulz et al., Principles of Protein Structure Springer-Verlag, New York, NY, 1798 and Figs. 3-9 of Creighton, T.E. Protein; Structure and Molecular Properties, W.H. Based on analysis of the frequency of amino acid changes in protein similarity between different species, as shown in Table 1-2 of Freeman & Co., San Francisco, CA 1983. Based on this analysis, another conservative substituent was exchanged in one of the following five groups.

 Original amino acid  Exemplary Substituents Ala Gly; Ser Arg Lys Asn Gln; His Asp Glu Cys Ser Gln Asn Glu Asp Gly Ala; Pro His Asn; Gln Ile Leu; Val Leu Ile; val Lys Arg; Gln; Glu Met Leu; Tyr; Ile Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val Ile; Leu

1. a small aliphatic, nonpolar or weakly polar residue; Ala, Ser, Thr, (Pro, Gly) 2. polar negatively charged residues and amides thereof; Asp, Asn, Glu, Gln 3. polar positively charged residues; His, Arg, Lys 4. large aliphatic nonpolar residues; Met, Leu, Ile, Val (Cys) 5. large aromatic residues; Phe, Tyr, Trp

The three amino acids in parentheses play an important role in protein structure. Gly is the only one that does not have any side chains and thus gives the chain flexibility. However, this tends to promote the formation of secondary structures other than the α chain. Because of its structural features, Pro tends to harden the chains and create structures such as β-rotation in general, and in some cases Cys can participate in disulfide bonds, which play an important role in the folding of proteins. Tyr is quite similar to Ser and Thr because of its hydrogen bonding potential.

Conservative amino acid substitutions as described above according to the present invention are known in the art and it can be expected that the amino acid substitutions can maintain the biological and structural properties of the polypeptide. Most of the deletions and substitutions according to the invention do not result in disruptive changes in the characteristics of the protein or polypeptide molecule. By "characteristic" is meant to be inclusive, including changes in secondary structures such as α-chain, β-sheet, and the like, modulation of the effect of TRAF proteins on cell death, and changes in biological activity such as binding to TRAF proteins.

Examples of making amino acid substitutions in proteins that can be used to make analogues of TRAF-binding proteins that can be used in the present invention include any known method, which is described in US Pat. 4,959,314; 4,588,585; 4,737,462 to Mart et al .; 5,116,943 (Koths et al.,); 4,965, 195 to Namen et al. 4,879, 111 to Chong et al .; 5,017,691 (Lee et al.,) And lysine substituted proteins are detailed in US Pat. No. 4,904,584 (Shaw et al.,).

In addition to conservative substitutions that do not significantly change the activity of the TRAF-binding protein described above, weakly conservative substitutions and somewhat random substitutions that result in a significant increase in the activity of the TRAF-binding protein are also within the scope of the present invention.

Once the exact effects of substitutions or deletions have been identified, those skilled in the art will recognize that the effects of substitutions, deletions and the like can be assessed through routine binding and cell death tests. Screening using these standard tests does not require excessive experimentation.

At the genetic level, such analogues use site-direct mutations in the nucleotides of the DNA sequence encoding the TRAF-binding protein to make a DNA sequence encoding the analog, synthesize DNA and express the polypeptide in recombinant cell culture. You can make it. In general, analogs have a quantitative increase in the same or biological activity as naturally occurring proteins (Ausubel et al., Current Protocols in Molecular Biologu, Greene Publications and Wiley Interscience, New York, NY, 1987-1995; Sambrook et al., Molecular Cloning; A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 1989).

Site-mutations of DNA encoding TRAF-binding protein intrinsic or initially prepared analogs may be used to encode a same polypeptide or to have a sequence that differs from the native sequence (due to changes due to degeneracy of the known genetic code). Binding protein can be prepared. Site-specific mutations can make analogs using a large number of nucleotides adjacent to a particular oligonucleotide sequence that encodes a DNA sequence with the desired mutation, the analogue being a primer sequence of sufficient size to create a stable double helix on both sides of the reversed deletion. To provide. Generally primers of 20 to 25 nucleotides in length are suitable, with about 5 to 10 complementary nucleotides alternating on each side of the sequence. In general, site-specific mutation techniques are those known to those skilled in the art and are exemplified in Adelman et al., DNA 2; 183 (1983).

As will be appreciated, site specific mutation techniques generally utilize phage vectors present in single stranded and double stranded forms. Typical vectors useful for site-specific mutations are the M13 phages detailed in Messing et al., Third Cleveland Symposim on Macromolecules and Recombinant DNA, Editor, A. Walton, Elsevier, Amsterdam (1981). These phages are commercially available and are generally known to those skilled in the art. Alternatively, single-stranded DNA can be obtained using a vector comprising single-stranded phage containing the origin of replication (Veira et al., Meth. Enzymol. 153; 3, 1987).

In general, site-directed mutations according to the present invention should yield a single stranded vector comprising a DNA sequence encoding the relevant polypeptide. Oligonucleotide primers with the desired mutated sequences are prepared using automated DNA / oligonucleotide synthesis. Such primers are annealed to a vector comprising a single stranded protein sequence and treated with a DNA polymerase such as E. coli polymerase I Klenow fragment to fully synthesize the strand containing the mutation. Thus, the mutated sequence and the second strand have the desired mutation. Such heterologous double vectors are used to transduce appropriate cells, such as E. coli JM101, and to clone clones comprising recombinant vectors with mutated sequences.

After selecting such clones, the mutated TRAF-binding protein sequence is removed and transferred to the appropriate vector, where the vector is generally the expression vector of the form used for transfection into the appropriate host.

Thus, the genes or nucleic acids encoding TRAF-binding proteins are those detected, obtained and modified in vitro, in vivo using known DNA or RNA amplification techniques such as PCR and chemical oligonucleotide synthesis. PCR can be used to amplify (increase in number) specific DNA by repeated DNA polymerase reactions. Such a reaction can replace cloning; All nucleic acid sequences should be known at this time. To run the PCR, a primer complementary to the desired sequence is made. In general, primers can be made by automated DNA synthesis. Because primers are designed to hybridize to any part of a gene, they create an environment that can tolerate mismatches to complementary base pairs. Amplification of such misleading pairs results in mutated products and the formation of peptides with new properties (eg site specific mutations) (Ausubel., Ch. 16). In addition, coupling complementary DNA (cDNA) synthesis using reverse transcriptase in PCR, using RNA as a starting material for the synthesis of the extracellular domain of the prolactin receptor without cloning.

In addition, PCR primers are made such as having a termination codon at both ends of the amplified gene portion, having a new restriction enzyme cleavage site, and the like. When restriction enzyme cleavage sites are located at the 5 'and 3' ends of the amplified gene sequence, gene fragments encoding TRAF-binding proteins or fragments thereof can be made to ligation other sequences and cloning sites into the vector.

PCR or other methods of amplifying RNA and DNA are known to those skilled in the art and can be used in accordance with the present invention without undue experimentation, according to the techniques presented in Yagi. Known methods for amplifying DNA or RNA include amplification processes associated with polymerase chain chain reaction (PCR) (see US Pat. No. 4,683,195; 4,683,202; 4,800,159; 4,965,188 (Mullis et al.,); 4,921,794 to Tobor et al. ;); 5,142,033 (Innis et al.,); 5,122,464 (Wilson et al.,); 5,091,310 (Innis); 5,066,584 (Gyllensten et al.,); 4,889,818 (Gelfand et al,); 4,994,370 (Silver et al.,) ); 4,766,067 (Biswas); 4,656,134 (Ringold); Innis et al., Eds, PCR Protocols; A Guide to Method and Applications) and RNA mediated amplification using antisense RNS to target sequences as templates for double stranded DNA synthesis (Ruzick et al., Science 260; 487 (1993); Sano et al., Science 258; 120, combined with US Pat. No. 5,130,238 (Malek et al., NASBA) and antibody labeled DNA amplification). (1992); Sano et al., Biotechniques 9; 1378 (1993); Sano et al., Science 258; 120 (1992); Sano et al., Biotchnique 9; 1378 (1991).

In a similar manner, biologically active fragments of TRAF-binding proteins (eg, TRAF2-binding proteins such as NIK or allotropes thereof) can be made as described above by analogues of TRAF-binding proteins. Appropriate fragments of TRAF-binding proteins are those that possess TRAF-binding protein capacity and are capable of mediating the biological activity of TRAF proteins and the biological activity of other proteins directly or indirectly associated with TRAF proteins. Thus, TRAF-binding protein fragments have a dominant-negakib or dominant-positive effect as described above for analogues. Such fragments represent a specific class of analogs of the invention, ie they are part of a TRAF-binding protein derived from a complete TRAF-binding protein (eg, one of a TRAF2-binding protein such as NIK or its allotropes). Some or fragments have some of the desired activity. Such fragments can be peptides.

Similarly, binding a TRAF-binding protein, analog or fragment to a side chain of one or more amino acid residues of a TRAF-binding protein, analog, fragment thereof, as known to those skilled in the art, to standard molecules or other molecules such as antibodies, enzymes, receptors, etc. To make derivatives. Thus, the "derivatives" referred to herein include derivatives made from functional groups in the side chains or N- or C-terminal groups of residues by methods known to those skilled in the art and are also within the scope of the present invention. Derivatives may have chemical moieties such as carbohydrate or phosphate residues if such fragments have the same or greater biological activity as TRAF-binding proteins.

For example, the derivatives may be aliphatic esters of carboxyl groups, ammonia or amides of carboxyl groups reacted with primary or secondary amines, free amino or N-acyl derivatives of amino acids that form acyl moieties (eg alkanoyl or carboxyl aroyl groups) Or O-acyl derivatives (eg, seryl or threonyl residues) of free hydroxyl groups forming an acyl moiety.

"Derivative" is intended to include only derivatives in which one amino acid has not been changed to one of the 20 naturally occurring amino acids.

TRAF-binding proteins are proteins or polypeptides, ie amino acid sequences. By definition, a polypeptide consisting of a large amino acid sequence comprising the entire amino acid sequence of a TRAF-binding protein is also within the scope of the present invention, as long as it does not affect the basic and novel features of the present invention. They may be cleaved to retain the biological activity of the TRAF-binding protein or to leave a protein or polypeptide having increased activity or biological activity of the TRAF-binding protein. Accordingly, the present invention includes fusion proteins of other amino acids or peptides with TRAF-binding proteins.

As mentioned above, the "TRAF-binding" protein of the present invention is any protein capable of binding to TRAF and modulating its activity intracellularly. In particular, the examples are TRAF2-binding proteins capable of modulating TRAF2-associated intracellular signal activity as described above, in particular due to interactions between TRAF2 and members of the various TNF / NGF receptor families detailed below. The relevance of TRAF2 to the induction of specific NF- _K B activity. Specific examples of such TRAF2-binding proteins are NIK proteins and various NIK dominant-negative analogs / its thereof that are capable of binding specifically to TRAF2 and have an action of inducing NF- _K B activity and block such activity. Allotropes, analogs or fragments and derivatives.

All of the foregoing changes are within the scope of the present invention as long as they preserve the homogeneity of proteins, their allotropes, analogs or fragments and derivatives capable of binding to amino acid sequences 222-501 of TRAF2.

With the ability to bind TRAF2, all proteins and polypeptides of the invention are considered modulators of TRAF2 signaling. As such, the molecules of the present invention are CD30, CD40, lymphotoxin beta (LT-β) receptor. TRAF2 ligand binds to the p55 TNF receptor or p75 TNF receptor and other receptors and adapters described herein and plays an important role in the signaling process inducing transcription factor NF- _K B activity. Of particular interest is the NIK protein encoded by clone 10 of the present invention and its partial protein, wherein the detailed sequence of NIK and the protein encoded by clone 10 (originally referred to as NMPI) are Ser / Thr protein kina The amino acid sequence corresponding to the I-XI motif feature can be encoded in the sequence and thus the function of this protein can be estimated.

Novel clone proteins, allotropes, analogs or fragments and derivatives thereof may have the following uses;

(i) These TRAF2-induced effects are further necessary - to enhance one or mimic the NF- _K B activation in situations where the NF- _K B to be activated is enhanced, such as stimulation and or enhance the function of TRAF2-tumor and immune Or to enhance the function of a receptor that binds to it. In such cases, proteins of the invention, allotropes, analogs or fragments and derivatives thereof that enhance TRAF2 or receptor effects are induced intracellularly using known methods. For example, if the proteins encoded by the DNA clones of the present invention are intracellular proteins, they should only be induced into cells that require TRAF2 effects, and cells are essential for a system capable of specifically inducing these proteins. One way of doing this is to make a recombinant animal virus such as that derived from Vaccinia and to introduce the following two genes; Genes encoding ligands that can bind to the cell surface to be specifically expressed by the cells, such as AIDs (HIV) virus gp120 or TRAF2, which can specifically bind to some cells (leukocytes associated with CD4 lymphocytes) Introduce a gene encoding any other ligand that specifically binds to a cell having a receptor that specifically binds to such a recombinant animal viral vector capable of binding to such cell; Another gene is a gene that encodes a protein of the invention. Therefore, when the protein encoding sequence is introduced into the cell through the virus, the cell-surface binding protein is expressed on the surface of the virus so that the virus specifically targets tumor cells or cells having other receptors. When expressed, the receptor or TRAF2 effect is enhanced to induce the desired immune-stimulatory effect in these cells. The construction of such recombinant animal viruses is in accordance with standard procedures (eg Sambrook et al., 1989). Another possibility is to introduce a sequence encoded by a protein of oligonucleotide type that is taken up by and expressed in the cell.

(ii) they can be used to interfere with NF- _K B activity and to interfere with the effects of TRAF2 or the effects of receptors binding to it, for example, when tissues such as AIDS, septic shock or graft-host macromolecular response are damaged. There is a need to block intracellular signals induced in. In such a situation, oligonucleotides having anti-sense coding sequences for the proteins of the present invention that effectively interfere with the translation of mRNA encoding proteins according to standard processes can be induced intracellularly and thus block their expression to You can block the effect. Or other oligonucleotides may be used; The ability to bind TRAF2 in a manner that interferes with the binding of other molecules to the protein is preserved while the oligonucleotide may not mediate any activity or modulation of this molecule. Molecules having these characteristics may act as interfering substances that can interfere with the interaction with the natural ligands with TRAF2, to remove the effects mediated by TRAF2, such as NF- _K B activation. Such oligonucleotides can be introduced into cells using this recombinant viral approach and the second sequence carried by the virus is an oligonucleotide sequence.

Another possibility is to use antibodies specific for the proteins of the invention to interfere with intracellular signal activity.

Another way to prevent unwanted effects is the recently developed lysozyme method. Lysozyme is a catalytic RNA molecule that specifically cleaves RNA. Lysozyme can be made to cleave the selected target RNA, eg, to cleave mRNA encoding the protein of the invention. Such a lysozyme has a sequence specific for the mRNA of the protein, and can interact with (complementary binding) after cleavage of the mRNA, thereby reducing or not completely reducing the expression of the protein. Depends on To induce lysozyme into selected cells (eg, cells with TRAF2 binding proteins), appropriate vectors such as plasmids, animal virus (retroviral) vectors, etc. are used, i) agents such as cDNA encoding that the virus is a lysozyme. 2 sequences (Methods etc., concerning ribozymes see Chen et al., 1992; Zhao and Pick, 1993).

(iii) is used to isolate, identify, and clone other proteins that can bind to them, such as isolate, identify, and clone proteins involved in intracellular signal processes downstream of TRAF2. For example, a DNA sequence encoding a protein of the invention may be used in a yeast two-hybrid system, where a cDNA or other sequence of a genomic DNA library encoding a protein capable of binding a clone protein ( "prey") is used as "bait" to isolate, clone and identify. In the same way, one can determine whether the protein of the invention binds to other receptors of other cellular proteins such as the TNF / NGF superfamily of receptors.

(iv) isolate, identify, and clone other proteins of the same class, such as proteins that bind or functionally relate to TRAF2, proteins involved in intracellular signaling processes, using encoded proteins, allotropes, analogs or fragments and derivatives thereof can do. For this purpose, one may use the two yeast hybrid systems described above, or a system using non-stringent Southern hybridization following recently developed PCR cloning.

(v) Another method of using the encoded proteins, allotropes, analogs or fragments and derivatives thereof of the present invention is that other proteins having the ability to bind TRAF2 or other proteins or factors involved in intracellular signaling processes or It is used in affinity chromatography methods for separating and identifying factors. In such uses, the proteins, allotropes, analogs or fragments and derivatives thereof of the present invention are individually attached to an affinity chromatography matrix and then contacted with isolated proteins or factors that appear to be involved in cellular extracts or intracellular signal processes. Let's do it. After affinity chromatography, other proteins or factors bound to the protein, its allotropes, analogs or fragments, and derivatives are eluted and separated for characterization.

(vi) As described above, the antibodies of the present invention, allotropes, analogs or fragments thereof and derivatives thereof can be used as immunogens (antigens) to make antibodies specific thereto. Such antibodies can be used to purify proteins of the invention from transformed cells that produce cell extracts or such proteins, allotropes, analogs or fragments and derivatives thereof. In addition, these antibodies can be used to make diagnoses for identifying diseases associated with abnormalities in the receptor system that have excessive or underestimated TRAF2-induced cellular effects. Thus, such antibodies may be an important diagnostic tool when the disease of the protein of the present invention is associated with a dysfunctional intracellular signal system. "Antibody" refers to polyclonal antibodies, monoclonal antibodies, chimeric antibodies, anti-idiotype antibodies against soluble or isolated labeled antibodies, and lack of Fc fragments of native antibodies that can bind antigen. Fab, F (ab ') ₂ fragments, and the like.

(vii) Antibodies comprising antibody fragments useful in the present invention can be used to quantitatively or qualitatively detect clones of the present invention or to detect the presence of cells expressing the clones of the present invention in a sample. This is possible using immunofluorescence techniques using fluorescently labeled antibodies with light microscopy, flow cytometers or fluorimeters.

Antibodies (or fragments thereof) useful in the present invention can be used with immunofluorescence or immunoelectron microscopy for in situ detection of clones of the present invention. In situ detection consists of removing a tissue sample from a patient and providing a labeled antibody of the invention to the sample. The antibody (or fragment thereof) may be appropriately provided by overlapping the labeled antibody (or fragment thereof) in the biological sample. This process can be used to detect the presence of clones as well as their distribution in examined tissues. Using the present invention, those skilled in the art will be able to implement various histological methods for such in situ sensing.

Testing of the clones of the present invention generally detects biological samples such as biological fluids, tissue extracts, lymphocytes or leukocytes, or newly cultured cells, such as cells cultured in tissue culture, to identify encoded proteins. It consists of culturing in the presence of a labeled labeled antibody and detecting the antibody according to known methods.

(viii) the encoded protein of the present invention is used as an indirect regulator of many other proteins as to whether they can bind to other proteins in the cell, wherein the other cellular proteins are incorporated into other intracellular proteins or intracellular domains of transmembrane proteins. Combine directly.

For such regulation, other intracellular proteins or intracellular domains of transmembrane proteins can be introduced into cells using the methods described in (ii) above.

Any standard screening procedure can be used to examine the isolation, identification and characterization of the proteins of the invention. For example, yeast two hybrid systems, one of the screening processes, can be used to identify proteins of the invention. Similarly, other processes, such as affinity chromatography, DNA hybrid procedures, etc., known in the art, can be used to isolate, identify, and characterize proteins of the invention, and to further protein, factors, which can bind to the proteins of the invention, Receptors, etc. can be isolated, identified and characterized.

In addition, the discovered proteins capable of binding to the proteins of the present invention may be provided in a similar manner (other factors having or capable of binding to the proteins of the present invention and which provide a factor related to downstream of the associated signaling process. , To isolate, identify, and characterize the protein, in the same manner as using the protein of the present invention), to provide a protein related to a separate signal process.

Encoded proteins and DNA sequences of the present invention can be made using any standard recombinant DNA process (eg Sambrook et al., 1989), eukaryotic or prokaryotic, comprising sequences encoding proteins in appropriate eukaryotic or prokaryotic cells. Transform into a vector. Thus, the present invention also encompasses such expression vectors and transformed host cells for making proteins of the invention. As mentioned above, these proteins include allotropes, analogs or fragments and derivatives of the proteins and thus also include vectors comprising these proteins, allotropes, analogs or fragments and derivatives thereof, and also include transformed host cells. Included are those that can make such analogs and fragments. Derivatives of these proteins are derivatives in which proteins or analogs and fragments thereof produced by transformed host cells are modified by standard methods.

The invention also relates to pharmaceutical compositions that modulate the effects mediated by TRAF2. Pharmaceutical compositions may comprise (i) one or more DNA sequences of the invention subcloned in a suitable expression vector; (ii) proteins, allotropes, analogs or fragments thereof and derivatives or mixtures thereof according to the invention; (iii) at least one of the recombinant viral vectors encoding proteins, allotropes, analogues or fragments thereof and derivatives according to the invention.

The pharmaceutical composition is provided to the patient in an appropriate amount depending on the disease to be treated, the weight of the patient and other factors absent by the physician.

As mentioned above, one of the specific embodiments of the TRAF-binding protein of the present invention is NIK, which is a TRAF2 binding protein. Since the NIK according to the present invention specifically binds to TRAF2 and is a modulator of TRAF2, and has the ability to regulate and mediate the activity of TRAF2 in NF- _K B activation, TRAF2 may be independently or different in the cell survival pathway. Based on the discovery that it plays an important role in binding to the p55 TNF receptor, p75 TNF receptor, FAS / APO1, MORT-1, TRADD, RIP), drugs that can enhance or interfere with TRAF2-NIK interactions as needed You can devise For example, if there is a need to increase the cytotoxicity induced by TNF, it is desirable to interfere with TRAF2-NIK interaction or specifically to interfere with TRF2 or NIK induction of NF- _K B activity induction. Similarly, to enhance the TRAF2-NIK interaction when it is necessary to interfere with the cytotoxicity induced by TNF or specific to reinforce the TRAF2- specific or NIK- specific NF- _K B activation induced NF- _K It is desirable to increase B activity. Many diseases require such drugs. Among them, acute hepatitis, which causes acute damage to the liver, by inducing Fas ligand resulting in FAS / APO1 receptor-mediated death of liver cells; Diabetes due to autoimmune-induced cell death, such as the death of β-langerhans gland cells of the pancreas; Cell death due to transplant rejection (kidney, heart, liver, etc.); Death of oligodendrocytes in the brain with multiple infarctions; Suicide of AIDS-inhibited T cells due to the proliferation of AIDS virus and thus AIDS.

In such cases, it is desirable to disrupt the FAS / APO1-receptor mediated apoptosis pathway and enhance FAS / APO-1 receptor mediated NF- _K B activity through TRAF2 and TRAF2-NIK induction. One of this way is how to increase the amount of NIK in the cells or to increase the amount of TRAF2 and NIK by increasing the NIK- or TRAF2-NIK-induced NF- _K B cell activity by increasing the activity level of NF- _K B Interaction with the FAS / APO1 receptor and cytotoxic mediators (MACH, see FIG. 2B) by allowing them to survive or by increasing the direct or indirect interaction between the FAS / APO1 receptor and TRAF2 (or TRAF2-NIK). Decrease to increase NF- _K B activity and induction of cell survival.

Conversely, in the case of tumors and infected cells (see discussion above), FAS / APO1 receptor-mediated cytotoxicity is increased to increase cell death. In such cases it interferes with the FAS / APO1 receptor-TRAF2 (or FAS / APO1 receptor-TRAF2-NIK) interaction or directly interferes with NIK to reduce the induction of NF- _K B activity.

NIK or one or more NIK allotropes, analogs or fragments may act as "natural" interferers that interfere with NIK or NIK-TRAF2 interactions and may interfere with the induction of NF- _K B activity. Such blockers may be used as the specific blockers described above, such as blockers may be used when it is necessary to increase cell death by increasing the cytotoxic effects of TNF or FAS / APO1 receptor ligands. Indeed, as illustrated in the Examples below, various NIK analogs and mutants were isolated according to the present invention, which are kaanase-deficient analogs / mutants and TRADD, TNF tn, FAS / APO1 receptor and their associated proteins. , RIP, as well as can block NF- _K B activation induced mediated by MORT1 IL-1 receptors (activity thereof is irrelevant to pass made through the NIK TRAF2) to NF- _K B activation induced also block mediated by And can also block activity mediated by bacterial endotoxin (LPS), phorbol myristate acetate, HTLV-1 protein TAX. Similarly, other substances such as peptides, organic compounds, antibodies and the like can also be screened to obtain certain drugs that may interfere with TRAF2-NIK interaction or NIK activity.

In a similar manner, when it is necessary to increase NF- _K B activity in various situations as described above, for example, the amount of NIK or TRAF2 can be increased in cells by various standard methods as detailed herein (eg, For example, a suitable composition comprising NIK or TRAF2 can be made by introducing DNA encoding NIK or TRAF2 into the cell to increase expression or by injecting directly into the cell or using other methods known in the art. Can be). Similarly, peptides, organic compounds and the like can also be screened to obtain certain drugs that can increase NIKE activity or TRAF2-NIK interaction.

Examples of how to create and screen peptide blockers of NIK-TRAF2 interactions include existing studies on peptide blockers of ICE or ICE-like proteases, strategies for epitope analysis using peptide synthesis, and studies of ICE substrate specificity. Based. Minimum conditions required for efficient cleavage of peptide by ICE is a methylamine on the right side of the four amino acids and P ₁ on the right side of the cutting location to favor the aspartic acid in the P ₁ position found that between the cutting position (Sleath et al , 1990; Howard et al., 1991; Thornberry et al., 1992). In addition, the prologogen lipid peptide (tetrapeptide) acetyl-Asp-Glu-Val-Asp-a- (4-methyl-comaryl-7-amide) [abbreviated Ac-DEVD-AMC] is also present after FAS-R stimulation and Corresponds to the sequence in poly (A-ribose) polymerase (PARP) found to be cleaved in cells after other apoptotic processes (Kaufmann, 1989; Kaufmann et al., 1993; Lazebnik et al., 1994). And is effectively cleaved by CPP32 (a member of the CED / ICE protease family) and the MACH protease.

Since Asp appears to be important at the P1 position of the substrate, a method was developed by Gelyson (Geysen, 1985; Geysen et al., 1987) for tetrapeptides with the fourth amino acid Asp and various amino acid complexes at the first three residues. This method screens for binding to the active site of the protease. This method attaches many different peptides to the solid support and screens for specific interaction with the antibody. The binding of the MACH protease to a particular peptide can be detected using various methods known to those skilled in the art, such as radiolabeling. Geysen's method can test at least 4000 peptides each working day.

In a similar manner, the exact binding moiety or similarity that determines the interaction between TRAF2 and NIK (or between any other TRAF protein and TRAF-binding protein) is identified, and such peptides are linked to TRAF2 (or TRAF). Peptides that can interfere with interactions, such as synthesized peptides having sequences similar to or complementary to those of the binding moiety that compete with the native NIK (or TRAF-binding protein) to which they bind, are screened.

Other members of the intracellular signaling pathway, such as the MACH protease of the cell death pathway, interact with TRAF2-NIK (or TRAF-TRAF binding protein) without interfering with the case of cell physiological cell death, which is also a member of the CED3 / ICE protease family. Because it would be beneficial to devise a peptide interferer that selectively interferes with, peptides that bind to TRAF2 (or TRAF) or NIK (or TRAF-binding protein), as described above, may be TRAF2 / NIK (or TRAF / TRAF-binding protein). Can be synthesized with a phlorogene substrate peptide to test whether it selectively binds to another peptide that is specific for). Peptides identified as specific for TRAF2 / NIK are modified to enhance cellular densities and reversibly or irreversibly interfere with the activity of TRAF2 or NIK. Thornberry et al., (1994) reported that tetrapeptide (acyloxy) methyl ketone Ac-Tyr-Val-Ala-Asp-CH ₂ OC (O)-[2,6- (CF ₃ ) ₂ ] Ph is a potent ICE. Reported as interfering substance. Similarly, Milligan et al. (1992) reported that tetrapeptide blockers with chloromethylketone (non-reversible) or aldehyde (reversible) groups inhibited ICE. Benzyloxycarboxyl-Asp-CH ₂ OC (O) -2,6-dichlorobenzene (DCB) has also been shown to interfere with ICE (Ashima et al., 1995). Thus, in a similar manner, a peptide that is a blocker of TRAF2 / NIK activity by modifying a tetrapeptide that selectively binds TRAF2 or NIK to have an aldehyde group, chloromethyl ketone (acyloxy) methyl ketone or CH ₂ OC (O) -DCB group Make In addition, to improve the permeability, chemically modified or induced to enhance the cell membrane permeability of the peptide so that such peptide can enter the cytoplasm through the membrane. Muranishi et al. (1991) reported the induction of thyrotropin-releasing hormone with lauric acid to make lipophilic lauryl derivatives with improved cell membrane transmembrane properties. Zachria et al. (1991) performed the transport of peptides through cell membranes by replacing sulfoxide oxidation of methionine and peptide bonds thereof with ketomethylene isoester (COCH ₂ ). This is part of a known modification and derivation process that is well known to those skilled in the art.

In addition, drugs or peptide blockers that can interfere with the activity by NIK-TRAF2 interaction and the interference of TRAF and TRAF-binding proteins can bind or complex with molecules that can enter the cell.

U.S. Patent 5,149,782 can associate a molecule to be transported through a cell membrane with membrane mixtures such as fusogenic polypeptides, ion-channel forming polypeptides, other membrane polypeptides, mystic acids, long chain fatty acids such as palmidic acid, and the like. . Such membrane mixtures have been described as being able to insert molecular binding materials into the lipid bilayer of cell membranes and allow them to enter the cytoplasm.

U.S. Patent 5,108,921 to Low et al., Describes a method for transporting molecules, including but not limited to proteins and nucleic acids, through a membrane by means of receptor mediated endocytosis activity mechanisms. Such receptor systems include galactose, mannose, mannose-6-phosphate, transferrin, asialglytoprotein, transcobalmin (vitamin B ₁₂ ), α-2 macroglobulin, insulin and epidermal growth factor (EGF) that recognize them. Other peptide growth factors, and the like. Low et al., Found that nutrient receptors such as biotin and folate enhance the transport through membranes due to the associated membrane transduction process, where a large number of biotin and folate are present on most cell surfaces and membrane receptor mediated. have. Thus, a complex formed between a compound to be transported into the cytoplasm and a ligand such as biotin or folate is brought into contact with the cell membrane containing the biotin or folate to initiate receptor mediated membrane-through transport and entry of the desired compound into the cell. .

ICD is known to have the ability to allow free substitution at the P ₂ position, and because it can tolerate such substitution, it is predicted to be a strong and highly selective affinity label with biotin (Thornberry et al., 1994). . As a result, the biotin molecule is added by modifying or inducing the P ₂ position and the N-terminus of the tetrapeptide blocker to enhance the permeability of such peptide blocker through the cell membrane.

In addition, as is known in the art, when a leader / signal peptide sequence is fused to a desired peptide sequence to make a “chimeric peptide,” such chimeric peptide can be transported to the cytoplasm through the cell membrane.

Those skilled in the art of peptides are known as peptides that interfere with TRAF-TRAF binding protein interactions, such as peptide blockers that block TRAF2-NIK interactions according to the present invention. It will be appreciated that it contains drugs or interferences that mimic peptides that can be screened quickly.

Implementing or enhancing transport of peptide blockers through cell membranes, as described above, applies to TRAF-binding proteins such as NIKs, allotropes, analogs or fragments, and other peptides and proteins that can exert such effects intracellularly. Means that.

For the "antibodies" mentioned throughout this article, we refer to anti-idiotype (anti-Id) antibodies and enzymes for polyclonal antibodies, monoclonal antibodies (mAbs), chimeric antibodies, soluble or bound labeled antibodies. Antibody fragments that can be made by any known technique, such as cleavage, peptide synthesis, and recombinant techniques.

Polyclonal antibodies refer to heterologous population antibody molecules derived from the plasma of animals immunized with antigen. Monoclonal antibodies refer to a real homogeneous group of antibodies specific for the antigen, which have in fact similar epitope binding sites. mAbs are described in Kohler and Milstein, Nature 256: 495-497 (1975); U.S. Patent 4,376,110; Ausubel et al., Eds., Harlow and Lane ANTIBODIES; A LABORATORY MANAUAL, Cold Spring Harbor Laboratory (1988); and Colligan et al., eds, Current Protocols in Immunology, Greene Publishing Assoc. and Wiley Interscience N.Y., (1992-199). Such antibodies are any immunoglobulin, including IgG, IgM, IgE, IgA, GILD and downstream thereof. Hybridomas making the mAb of the present invention can be cultured in vitro, in vivo, in situ. High titer monoclonal antibody production in vivo or in situ is an appropriate method.

Chimeric antibodies are molecules with different moieties that can be derived from different animal species with various moieties derived from murine mAbs and human immunoglobulin alleles. Primarily chimeric antibodies are used to reduce immunogenicity and increase productivity, for example murine mAbs use human / murine chimeric mAbs because they have high titers in hybridomas but high immunogenicity in humans. Chimeric antibodies and methods for producing them are known in the art (Cabily et al., Proc. Natl. Acad. Sci. USA 81; 3273-3277 (1984); Morrison et al., Proc. Natl. Acad. Sci. USA 81: 6851-6855 (1984); Boulianne et al., Nature 312: 643-646 (1984); Neuberger et al., Nature 314: 268-270 (1985); Taniguchi et al., European Patent Application 171496 (published Feb 19, 1985); Morrison et al., European Patent Application 173494 (published Mar 13, 1996); Kudo et al., European Patent Application 184187 (published June 11, 1986); Sahagan et al., J. Immunol 137; 1066-1074 (1986); Robinson et al., International Patent Application No. Wo 8702671 (published May 7, 1987); Liu et al., Proc. Natl. Acad. Sci. USA 84; 3439-3443 ( 1987); Sun et al., Proc. Natl. Acad. Sci. USA.84-214-218 (1987); Better et al., Science 240; 1041-1043 (1988) and Harlow and Lane, Antibodies; A Laboratory Manual, supra.

An anti-idiotype (anti-Id) antibody is an antibody that recognizes a unique determining site that generally associates with the antigen binding site of the antibody. Id antibodies can be prepared by immunization of animals of the same species and of the same genotype (eg, mouse strain) as the mAb source that produced the anti-Id. Immunized animals recognize and respond to the idiotype determining regions of the immunized antibody by preparing antibodies to these idiotype epitopes (see US Pat. No. 4,699,880).

Anti-id antibodies can be used as "immunogens" to induce an immune response that makes so-called anti-anti-id antibodies in other animals. The anti-anti-id is identical to the epitope of the original mAb that induced the anti-ID. Therefore, by using the antibody against the idiotype determining region of the mAb, other clones expressing the antibody having the same specificity can be identified.

Thus, in appropriate animals, such as BALB / c mice, using mAbs generated against the TRAF-binding proteins, allotropes, analogs or fragments and derivatives thereof of the invention (e.g., NIK proteins, allotropes, analogs or fragments and derivatives thereof). Anti-Id antibodies can be induced. The pancreatic cells of such immunotreated mice are used to produce anti-Id hybrids that secrete anti-Id mAbs. In addition, the anti-Id mAb is bound to keyhole limpet hemocyanin (KLH) to immunize additional BALB / c mice. The serum of these mice may comprise an anti-anti-Id antibody having the binding properties of the native mAb specific for the epitope of the TRAF-binding protein or its allotropes, analogs or fragments and derivatives.

Thus, anti-Id mAbs have "idiotopes" that are structurally similar to epitopes to be evaluated, such as these unique idiotype epitopes or GRB protein-a.

"Antibodies" include fragments such as Fab, F (ab ') ₂ , which can bind to antigen as well as native antibodies. Fab and F (ab ') ₂ fragments lack Fc fragments of native antibodies and are more quickly removed from the circulation and have somewhat less specific tissue binding than native antibodies (Wahl et al., J. Nucl. Med. 24; 316-325 (1983).

Fab and F (ab ') ₂ and other fragments of the antibodies of the invention can be used to detect and quantify the TRAF-binding proteins described herein in detail for native antibody molecules. Such fragments can generally be made by proteolysis using enzymes such as papain (creating Fab fragments) or pepsin (creating F (ab ') ₂ fragments).

If an antibody reacts specifically to a molecule, the molecule binds to an antibody that has the ability to specifically bind to the molecule. "Etitope" refers to a moiety recognized by an antibody so that the antibody can bind to any part of the molecule. Epitopes or “antigen determinants” are generally composed of chemically active surface groups of molecules such as amino acids or side chains of sugars and have tertiary structural and specific charge characteristics.

An “antigen” is a molecule or portion of a molecule that can bind to an antibody that can be further induced in an animal to make an antibody that can bind to an epitope of an antigen. An antigen has one or more epitopes. The specific reactions mentioned above refer to antibodies that correspond to antigens in a very specific manner and not to other antibodies caused by other antigens.

Antibodies comprising portions of antibodies useful in the present invention can be used to quantitatively or qualitatively detect TRAF-binding proteins (eg, NIKs) in a sample or to confirm the presence of cells expressing TRAF-binding proteins of the invention. It utilizes immunofluorescent techniques using fluorescently labeled antibodies (see below) incorporating light microscopy, flow cytometry or fluorometry sensors.

The antibody (or fragment thereof) of the invention is used histologically to detect in situ of the TRAF-binding protein of the invention on immunofluorescence or immunoelectron microscopy. In situ detection is done by removing the histological specimen from the patient and providing the labeled antibody of the invention to the specimen. The antibody (or fragment thereof) may be appropriately provided by providing or overlapping the labeled antibody (or fragment thereof) in the biological sample. This procedure can be used to determine the presence of TRAF-binding proteins as well as their distribution in the tissues examined. Using the present invention, those skilled in the art will recognize that a wide variety of histological methods (such as the staining process) can be modified for such in situ detection.

Biological testing of TRAF-binding proteins of the invention is generally performed on freshly obtained tissues or tissue cultures, such as biological fluids, tissue extracts, lymphocytes or leukocytes, in the presence of detectable labeled antibodies capable of identifying TRAF-binding proteins. It consists of culturing the cultured cells and detecting the antibody using a variety of known methods.

Biological samples are treated with a solid support or carrier, such as nitrocellulose or other support or carrier capable of immobilizing cells, cell particles or soluble proteins. The support or carrier is washed with appropriate buffer after treatment with the detectable labeled antibody according to the invention as described above. The solid support or carrier is washed again to remove unbound antibody. The amount of label bound to the solid support or carrier is sensed using conventional methods.

"Solid support", "solid support", "solid support", "solid support", "support" or "carrier" means any support or carrier to which an antigen or antibody can bind. Known supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon amylase, natural or modified cellulose, polyacrylamide, gabbro and magnetite. Natural carriers may be to some extent soluble or insoluble for the purposes of the present invention. The support material may have any possible structural shape as long as it can bind an antigen or an antibody. Thus, the support or carrier shape may be circular, such as beads, cylindrical, such as the inside of a test tube or the outside of a rod. Or the surface may be flat, such as a sheet, a test strip, or the like. Suitable supports or carriers include polystyrene beads. One skilled in the art can use other suitable carriers that can bind antigens or antibodies and can determine them through any experiment.

Other procedures, such as washing, stirring, mixing, filtration, etc., can be added depending on the particular situation or the conventional process. Antibodies according to the present invention can be used for enzyme immunoassay (EIA) and detectable labeling by linking enzymes. Again, such an enzyme reacts with a substrate when exposed to an appropriate substrate, creating a chemical moiety that can be detected by spectrophotometry, fluorescence measurements, or other visual means. Enzymes used for detectable labeling of antibodies include maleate dehydrogenase, staphylococcus nuclease, delta-5-steroid isomerase, east alcohol dehydrogenase, alpha-glycerophosphate dehydrogena Agent, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonucleases, eurease, catalase, glucose-6-s Fate dehydrogenase, glucoamylase, acetylcholine-esterase, and the like. It can be detected by the color development method using a color development substrate for the enzyme. It can be detected by visually comparing the extent of enzymatic reaction of the substrate against similarly prepared standards.

Various other immunoassays can be used to detect them. For example, by radioactive labeling of antibodies or antibody fragments, R-PTPase can be detected via radioimmunoassay (RIA). For RIA, Laboratory Techniques and Biochemistry in Molecular Biology, Work, T.S. et al., North Holland Publishing Company, NY (1978) with particular reference to the chapter entitled "An Imtroduction to Radioimmune Assay and Related Techniques" by Chard. It is described in detail in T. Radioactive epitopes can be detected by counters or scintillation counters or by self-radiation.

Fluorescent compounds can be used to label antibodies according to the invention. When the fluorescently labeled antibody is exposed to light of an appropriate wavelength, the presence of fluorescence can be confirmed. Commonly used fluorescent labeling compounds include fluorescent isothiocyanates, rhodamine, phycoerytin, phycocyanin, allophycocyanin, o-phthalaldehyde, and phlolocamine.

Antibodies can be labeled using metals that generate fluorescence such as ¹⁵² E or other lanthanides. Such metals can be bound to antibodies using metal chelate groups such as diethylenetriamine pentaacetic acid (ETPA).

Antibodies can bind to chemiluminescent compounds for detectable labeling. Antibodies bound to chemiluminescent compounds can be determined by sensing the presence of luminescence that occurs during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, threomatic acridinium esters, imidazoles, acridine salts and oxalate esters.

Similarly, bioluminescent compounds can be used to label the antibodies of the invention. Bioluminescence is a type of chemiluminescence found in the biological system in which catalytic proteins increase the effect of chemiluminescence reactions. The presence of biological luminescence can be determined by sensing the presence of luminescence. Important bioluminescent compounds for labeling purposes are luciferin, luciferase and ecuorin.

The antibody molecules of the invention can be used for immunoassay tests known as "two-site" or "sandwich" tests. The amount of unlabeled antibody (or fragment of antibody) in a typical immunoassay is bound to a solid support or carrier and the addition of a detectable labeled soluble antibody detects and detects three complexes formed between the solid, antigen and labeled antibody. Can be quantified.

Common and appropriate immunoassay assays include a "forward" assay, in which the antibody bound to a solid phase is first contacted with the sample to extract antigen from the sample to form an antigen complex with the solid phase. After an appropriate incubation period, the solid support or carrier is washed to remove fluid sample residues containing unreacted antigen and contacted with a solution containing an unknown amount of labeled antibody (which acts as a "reporter" molecule). . After the second incubation period for binding the labeled antibody to the antigen complex bound to the solid support or carrier, the solid support or carrier is washed a second time to remove unreacted labeling antibody.

Another form of "snadwich" test utilizes the antigen of the present invention usefully, so-called "simultaneous" or "reverse" test. Simultaneous testing consists of a one-step culture step in which the antibody bound to the solid support and the labeled antibody are added to the sample to be tested simultaneously. After incubation is complete, the solid support or carrier is washed to remove labeled antibodies that are not bound to the fluid sample residue. Labeled antibodies associated with a solid support or carrier are determined as in a "forward" sandwich test.

In the "reverse" test, the labeled antibody solution is first added to the fluid sample and the unlabeled antibody is added to the solid support or carrier after the appropriate incubation time. After the second culture, the solid phase is washed in a conventional manner to remove the labeled antibody solution that has not reacted with the residue in the sample to be tested. Labeled antibodies associated with a solid support or carrier can be determined, such as a "simultaneous" or "forward" test.

As noted above, the present invention also relates to pharmaceutical compositions consisting of recombinant animal viruses encoding TRAF-binding proteins, wherein the vector includes a specific target cell (cancer cell) surface protein for inserting TRAF-binding sequences into cells. Encodes viral surface proteins that can bind to The pharmaceutical composition of the present invention also comprises an oligonucleotide (a) encoding the anti-sense sequence of the TRAF-binding protein sequence as an active ingredient and a drug (b) blocking the TRAF-binding protein-TRAF interaction.

The pharmaceutical composition according to the present invention contains a sufficient amount of the active ingredient to fulfill the desired purpose. In addition, the pharmaceutical composition consists of a pharmaceutical composition acceptable carrier consisting of excipients and auxiliaries capable of processing the active compound into a pharmaceutically available formulation and stabilizing the formulation to be administered to a patient, Known to

TRAF-binding proteins and their allotropes or isotypes, as mentioned in the co-application, have significantly different levels in different tissues, with different patterns of isotypes in different ways in the expression of various other proteins involved in intracellular signaling pathways. It appears to be expressed as. This difference leads to a tissue-specific response to Fas / APO1-ligand and TNF. As with other CED3 / ICE verbs (Wanh et al., Alnemri et al., 1995), the present invention relates to a MACH allotropy comprising an incomplete CED3 / ICE moiety (e.g., MACHα3) is a co-expressed MACHα1-MACHα2 molecule. It has been found to have a disturbing effect on the activity of; It has been shown to block the induction of cell death by Fas / APO1 and p55-R. Expression of such inhibitory allotropes in cells is involved in the cell's self-defense mechanism against Fas / APO1 and TNF-mediated cytotoxicity. The extensive heterogeneity of the MACH allotropes significantly exceeded those observed in other proteases of the CED3 / ICE family, allowing for very precise control of the function of the active MACH allotropes.

According to the present invention, analogs / mutants of TRAF-binding protein, ie TRAF2-binding protein NIK, were isolated. Such NIK analogs / mutants (see Examples below) interfere with NF- _K B activity mediated by NIK-mediated and TNF receptors, FAS / APO1 receptors, related proteins, IL-1 receptors and other agents . As mentioned above, TRAF-binding proteins or possible allotropes have various effects in different tissues on their interaction with TRAF proteins and thus affect intracellular signaling by TRAF proteins or TRAF proteins.

Some of the possible TRAF-binding proteins may function differently. For example, NIK or some NIK analogs or verbs act to enter sites of molecules associated with Fas / APO1 and TNF receptors through interaction with or independent of other non-cytotoxic effects such as TRAF2.

Modification of the function of these receptors is quite detrimental to the organism due to the Fas / APO receptor ability to cause cell death and the ability of the TNF receptor to stimulate other tissue-damaging activity. In addition, excessive or deficient function of these receptors contributes to the pathogenesis of various diseases (Vassalli, 1992, Nagata and Golstein, 1995). Identifying molecules that participate in the signaling of receptors and finding ways to modulate the activity of these molecules is finding new therapies. The interaction of TRAF-TRAF-binding proteins in investigating the role of TRAF proteins in TNF- or Fas / APO1-mediated NF- _K B activity, such as TRAF2 and TRAF-binding protein NIK, in TRAF2-NIK interactions, such as Enhancing these interactions (enhancing NF- _K B activity) is necessary to preserve the cells as drugs that can block the interaction of TRAF2-NIK when needed to kill (by interrupting NF- _K B activity). It is particularly important to devise a drug.

The present invention also relates to a protein or ligand capable of binding to the TRAF-binding protein of the invention and thus mediating or regulating the activity of the TRAF-binding protein. Such proteins or ligands can be screened, isolated and produced according to the methods described above. For example, a novel protein / ligand that excludes I- _K B and TRAF2 if the known NIK actually binds to I- _K B in isolation of a number of new ligands, including proteins that can bind to the NIK protein of the present invention. Becomes

As mentioned above, such novel TRAF-binding protein-binding proteins / ligands such as NIK-binding proteins act as interferers or enhancers of activity mediated by TRAF2-NIK interactions or NIK-mediated activity. This plays an important role in various etiological and other situations as described above. Another function of this TRAF-binding protein-binding protein / ligand can be used as a specific material for the purification of TRAF-binding protein by affinity chromatography and thus a novel binding protein attached to an appropriate chromatographic matrix. Ligands can be passed through a solution or extract comprising a TRAF-binding protein such as NIK to form a solid or substitution / support matrix to effect its purification. Such affinity chromatography methods are known and follow the standard procedures common in the art.

Similarly, the above-described TRAF-binding proteins, allotropes, analogs or fragments and derivatives thereof of the present invention are used to purify various TRAF2s to which they bind by affinity chromatography. For example, TRAF2 can be purified using TRAF-binding proteins such as NIK, allotropes, analogs or fragments thereof, and NIK mutants. In the same way the NIK proteins of the invention, analogs / mutants thereof of the invention can be isolated and produced (see examples below) using ratio-like methods or other methods known to those skilled in the art (see examples below) and any other TRAF2-binding protein. Can be verified and produced. Methods for identifying and producing such TRAF-binding proteins, such as TRAF2-binding proteins, include a screening step, which converts TRAF (eg TRAF2) or portions thereof (corresponding to SEQ ID NOs: 222-501) into a substrate or "bait". Can be used to obtain a protein or other ligand that binds to it, to identify and characterize the protein / ligand thus obtained and to produce such protein / ligand in isolated or purified form. All steps are known to those skilled in the art and are detailed below.

The invention is illustrated by the following examples, which are not intended to be limiting.

i) two hybrid screens and two hybrid β-galactosidase expression tests; (ii) induced expression of proteins, metabolic labeling immunoprecipitation; (iii) in vitro binding; (iv) assessment of cytotoxicity; (v) Northern analysis and sequencing and other processes used in the following examples are described in detail in the published literature on intracellular signal generating proteins and their pathways prior to the present invention (Boldin et al., 1995a, 1995b). , and Boldin et al., 1996). Such processes are described in detail in co-pending Israel applications 114615, 114986, 115319, 116588, 117932, 120367 and PCT / US96 / 10521. Accordingly, all of these published documents and applications are incorporated by reference.

Materials and methods

i) cDNA library

a) B-cell cDNA library

Oligo dT primed library (Durfee et al., 1993) made in human B cells was used. The cDNA fused to the GAL 4 active domain of the library was inserted into the XhoI site of the pACT vector pSE1107.

b) λgt10 testicular cDNA library

Human testis cDNA library was used. The library is a random hexanucleotide primed library with an average size of 200 to 400 bp.

ii) yeast strain

Two yeast strains were used as host strains for transformation and screening; HF7c strain used for two hybrid screens and SFY526 strain used for βgalactosidase biological test. Both strains have the nutritional markers trp1 and leu2, so these yeast strains cannot grow on minimal synthetic media lacking tryptophan and leucine, and must be transformed by wild-type plasmids with these genes (TRP1, LEU2). Can be. These two yeast strains lack their GAL4 and GAL80 genes (gal4-542 and gal80-538 mutations).

SFY526 and HE7c have lacZ receptors in their genotypes; In SFY526, the UAS and TATA portions of the GAL1 promoter are fused, and in the HF7c, the TATA portion of the CYC1 promoter and the GAL4 17mer consensus sequence 3 copy are fused to lacZ. GAL1 UAS and GAL4 17mer are reactive with GAL4 transcriptional activators. The HF7c strain also has an HIS3 receptor fused to the UAS and TATA portions of the GAL1 promoter.

iii) Cloning of Human TRAF2

Human TRAF2 was cloned by PCR using the HL60 cDNA library (TRAF2 and other details are described in Rothe et al., 1994; Rothe et al., 1995a; Cheng et al., 1996; Hsu et al., 1996; Wallach , 1996). The primers used were: a) a 30-mer forward primer CAGGATCCTCA ATG GCTGCAGCTAGCTGCA corresponding to the coding sequence of hTRAF2 from the codon for the first methionine (underlined) and comprising the BamHI site and b) the stop codon of the human TRAF2 gene ( Underlined) and the linker contains a SalI restriction enzyme moiety. 32-mer reverse primer GGTCGAC TTA GCGCCCTGTCAGGTCCACAATG. PCR program was 1 minute at 94 ° C. after the initial denaturation step (94 ° C., 2 minutes); 1 minute at 64 ° C .; It consists of repeating 30 times 40 second at 72 degreeC. The amplified human TRAF2 is inserted into BamH1-Sal of the pGBT9 vector bound to the GAL 4 DNA binding domain.

iv) two hybrid screens of B-cell library

The techniques used to identify factors associated with specific molecules that act as "bait" are two hybrid screens (see the above references and patents for details). In the present invention, TRAF2 cloned into the vector pGBT9 acts as bait. TRAF2 is co-expressed with the B-cell cDNA library screened in yeast strain HF7c. PCR-cloned TRAF2 is a recombinant fused with a GAL4 DNA binding domain and the screened cDNA library is fused to the GAL4 active domain in the pSE1107 vector. The reporter gene in HF7c is fused with HIS3 to the upstream active sequence (UAS) of the GAL1 promoter, which is reactive to GAL4 transcriptional activators. Transformants comprising pGBT9 and pSE1107 can be selected for growth on plates without either tryptophan or leucine. In the second step, the positive clone is selected from a plate containing 50 mM 3-aminotriazole (3AT) free of tryptophan, leucine, histidine by expressing two hybrid proteins interacting with each other to activate GAL1-HIS3.

v) β-galactosidase test

Positive clones selected from the two hybrid screens are subjected to lacZ color development test in SFY526 yeast cells (Clontech Laboratories' manual (see literature and application above for details). In brief, the transformants are grown at 30 ° C. for 2-4 days until the diameter is about 2 mm and transferred to Whatman filters. Freeze / thaw filters to allow cell infiltration and buffers containing 0.33 mg / ml X-gal and 0.35 mM β-mercaptoethanol (16.1 mg / ml Na ₂ HPO ₄ .7H ₂ O; 5.5 mg / Ml NaH ₂ PO ₄ H ₂ O; 0.75 mg / ml KCl; 0.75 mg / ml MgSO ₄ .7H 2 O, pH = 7). Observe in colonies whether blue color is generated, indicating that there is β-galactosidase induction.

vi) expression of cloned cDNA

Prepare two similar expression vectors;

a) pUHD10-3 vector comprising an open reading frame (ORF) of clones 9, 10 or 15 fused to hemagglutinin (HA) etiport.

b) A pHUD10-3 vector derived from the FLAG octapeptide immediately preceding the cloned TRAF2, ie called FLAG / B6 / TRAF2.

Constructs containing ORFs of clones 9, 10 or 15 are transfected into HeLa-Bujard cells alone or with FLAG / B6 / TRAF2 using standard calcium-phosphate methods (Gossen, M. and Bujard, M. (1992). )).

vii) luciferase test

Wash three times with cold PBS and resuspend using 400 μl extraction buffer (0.1MK ₂ HPO ₄ / KH ₂ PO ₄ pH = 7.8; 1 mM DTT) to give generally ⁵ × 10 ⁵ transfected cells. Freeze and thaw three times in liquid nitrogen to obtain cell lysate. Cell debris is removed using centrifugation (10,000 × g, 5 min). Add 200 μL luciferase buffer (25 mM glycylglycine, 15 mM K ₂ HPO ₄ / KH ₂ PO ₄ pH = 7.8; 4 mM EGTA, 2 mM ATP, 1 mM DTT) to 50 μL cell lysate for luciferase assay. . Subsequently, 100 μL 0.2 mM D-luciferin, 25 mM glycylglycine, 1 mM DTT are added to the reaction. Luciferase activity is determined by light generation for 10 seconds using a Lumotron luminometer (see above document and application).

Example 1 Cloning of New Clones 9, 10, 15

CDNA libraries made from B-cells are screened for proteins associated with TRAF2 using the two hybrid techniques described in (iv). Only transformants that express both TRAF2 and the proteins that can interact with it have a GAL4 DNA-binding domain and a transcriptional activation domain. According to the results, the reporter gene was activated and expressed when HIS3 was fused to the UAS and TATA portions of the GAL1 promoter.

As many as 2000 clones were screened that could grow on Trp-, Leu-, His 3AT plates. DNA prepared from 165 randomly selected positive clones was used for co-transfection of SFY526 yeast strain with TRAF2 cloned into pGBT9 vector. Tests for β-galactosidase activity were performed on transformed SFY526 yeast colonies as described in (v). The blue color generated means that the yeast contains a cDNA encoding a protein or polypeptide capable of binding to TRAF2.

The result of two hybrid screens; The results of the ability of the clones selected on the 3AT plate to grow and the ability to induce LacZ as measured by the color test are shown in Table 1. There are two cDNAs encoding known proteins among the selected positive clones; TRAF2 self-associates to form alloforms, and the intracellular lymphotoxin beta receptor domain binds to TRAF2. Three of the cloned cDNAs (clones 9, 10, 15) are novel.

Positive clones were further tested for binding specificity tests, ie, interoperation with irrelevant bait. As shown in Table 2, clones 9 and 10 reacted only with TRAF2 and none of the other unrelated proteins examined. In addition, clone 15 did not react with MORT1, nor did it react with the intracellular domains of p55 TNF receptor and p75 TNF receptor, but only weakly with Lamin and Cycline D.

Two additional constructs were created to narrow the parts of TRAF2 that interact with clones 9, 10, and 15. One consists of the N-terminus of amino acids 1-221 of TRAF2, including the Ring Finger and Zink Finger motifs, and the other, the C-terminus of amino acids 222 to "TRAF-domain" and an additional 42 amino acids. Includes only 501. These two structures act as baits in both hybrid tests. The results show that clones 9 and 10 did not interact with the structures consisting of amino acids 1 to 221 of TRAF2, but with the C-terminal structure consisting of "TRAF-domains," Has the same effect.

Select clones 9, 10 and 15 to summarize the results of two hybrid screens using TRAF2 as bait Growth at 50mM 3AT Color test (minutes) Clone name as defined by the sequence Number of independent clones  +++  10  TRAF2  150  ++  20  New clone number 9  6  +++  15  New clone number 10  2  ++++  10  Lymphotoxin beta receptors  2  +  15  New clone number 15  5

Specific tests (interaction with bait independent of two hybrid tests)  bait shank clone  Clone 9  Clone 10  Clone 15  LAMIN  -  -  +  cyclin D  -  -  +  p75-IC  -  -  -  p55-IC  -  -  -  MORT1  -  -  -  TRAF2  +++  +++  +++

Several PCR steps are applied to cDNA clone 10 to clone full length cDNA from cDNA libraries obtained from RNA of human tissue. Such proteins are termed NIK for "NF- _K B induced kinase" because they contain a protein-kinase moiety. When initially analyzed (prior to obtaining NIK by PCR), the sequence of clone 10 appears to encode the native NMPI (co-application IL117800) protein. Such NMPIs or clones 10 that encode proteins appear to have sequences corresponding to I to XI conserved motifs with Ser / Thr protein kinase characteristics.

Example 2; Sequencing of Novel Clones

Three of the novel cDNA clones (clones 9, 10) were purified and amplified in E. coli to sequence these DNAs. All three clones were shown to be partial cDNA clones.

The total length of clones 9, 10, 15 was 2000, 2700, 1300 base pairs, respectively.

3 and 5 show some sequences of clones 9 and 15 and FIG. 4 shows the entire sequence of clone 10.

5A-B show the entire nucleotide sequence of clone 15 sequenced at the 5 ′ and 3 ′ ends and the analogous amino acid encoded thereby. Clone 15, a partial cDNA clone, was found to encode a protein of 172 amino acids.

Clones 9 and 15 were partial clones that lacked most of the 5 'portion of the DNA sequence. The inferred amino acid sequence shown in Figures 3b, 4b, 5b started at the first nucleotide of each clone.

The sequence of fully analyzed clone 10 (partial cDNA clone) is shown in Figure 6, underlined by the start codon ATG of nucleotide 232, and the stop codon at nucleotide 3073 is asterisk. The fully sequenced NIK clone of FIG. 6 contains the NIK coding sequence as 4596 nucleotides in length, which encodes a NIK of 947 amino acid residues.

Data bank investigations show that the new amino acid sequence of NIK is highly homogeneous for the group of kinases that can act as MAP kinases.

7 is

Mouse MEKKK (S1);

BYR2 (S2);

Tpl-2 (S3);

Ewing's Sarcoma Oncogen (S4);

SS3 (S5);

(STE11) (S6);

(NPK1) (S7);

(BCK1) (S8);

The (NIK) (S9) array is shown.

Some of these kinases have been shown to have oncogen activity in the mutant form.

Example 3: Coimmunoprecipitation of Expression of Cloned cDNA and TRAF2

TRAF2 with FLAG attached to the pUHD10-3 expression vector was transfected into HeLa-Bujard cells and the construct comprising the ORFs of clones 9, 10, and 15 was fused to HA epitopes as detailed in Materials and Methods (iv). Cells are grown for 24 hours in Dulbecco's Eagle's Medium (DMEM) added with 10% fetal calf serum and ³⁵ S-methionine and ³⁵ S-cysteine. At the end of the culture, the cells were irradiated with radioimmunoprecipitation buffer (10 mM Tris-HCl, pH7.5, 150 mM NaCl, 1% Nonident P-40, 1% deoxycholate, 0.1% SDS, 1 mM EDTA, 1 mL / 5X10). ⁵ cells) and the lysates are stabilized by incubation with irreversible rabbit antiserum and protein G-Sepharose beads (Pharmacia, Sweden). Lysates were incubated with anti-FLAG (purchased from Eastman Kodak Co,) or anti-HA (clone 12CA5 (Field, J. et al., (1988)) monoclonal antibody for 1 hour at 4 ° C. for immunoprecipitation. Protein is analyzed by self-spinning after SDS-PAGE.

In the results of each experiment, partial cDNA clones 9, 10 and 15 were found to encode proteins with molecular weights of 50-65, 45 and 26 kDa, respectively.

Clone 15 showed no interaction with TRAF2, the proteins encoded by clones 9 and 10 (NIK) and full-length NIK precipitated with TRAF2 protein. Cell samples were transfected with TRAF2 and one of these two clones, immunoprecipitated with anti-FLAG or anti-HA antibodies and then subjected to SDS-PAGE analysis as described above, with three bands on each line. One band corresponding to 9 or 10 encoded protein and the other two bands correspond to 42 kDa and 44 kDa corresponding to TRAF2.

Example 4; function test

NIK was shown to induce NF- _K B in gel delay test. Generally, 0.5-1X106 293 EBNA cells were cloned into pcDNA3 and 10 μg of clone 10 (line 1 in FIG. 7), pcDNA3 3 containing cDNA for p75 TNF receptor. 7 μg (line 3 in FIG. 7) or clone 10 (10 μg) and p75 TNF receptor (3 μg) (line 2 in FIG. 7). The total amount of transfected DNA in each transfection was 15 μg with the “empty” pcDNA3 vector. Criteria are 293 EBNA cells transfected with 15 μg pcDNA3 vector only (line 4 in FIG. 7). Cells are grown 24 hours in DMEM medium and 10% fetal calf serum according to Schreiber et al., (Schreiber, E. et al., (1989)), then obtained and processed. Samples are placed on 5% polyacrylamide gel and monitored using a ³² P-radiolabeled oligonucleotide corresponding to the NF- _K B binding site as a probe (probes are GATGCCATTGGGGATTTCCTCTTT and CAGTAAAGAGGAAATCCCCAATGG).

Table 4 shows that NIK induces NF- _K B activation more effectively than TRAF2. Clone 10, on the other hand, had no such effect.

Reporter gene testing was performed as follows.

293 EBNA cells are either pcDNA3 containing HIV LTR linked to the luciferase reporter gene, pcDNA3 plasmid containing cDNA for p75 TNF receptor only, or pcDNA3 plasmid containing clone 10 cDNA only or pcDNA3 plasmid containing cDNA for p75 TNF receptor And co-transfect with pcDNA3 plasmids listed in Tables 4 and 5 below.

The results of Table 5 are explained as follows;

a) Clone 10 transfection did not induce NF- _K B activation and NIK strongly induced NF- _K B activation;

b) Substituting lysine (NIK *) for active site lysine of clone 10 and NIK strongly inhibits NF- _K B induction by cDNA in column 1 of Table 4.

Deletion of the 3'UTR of NIK (NIK-3'UTR) significantly increases the expression of NIK and consequently interferes with NF- _K B induction when expressed mutated.

Activation of NF- _K B by NIK. The numbers indicate the number of ice activity lost when detected with a "phosphoimager" plate.  Transfected cDNA  Number  Area (mm2) Blank vector  327 70.7 TRAF2 3411 70.7 NIK 6532 70.7 Clone 10  343 70.7

Clone 10, dominant-negative effect of NIK K-; TRAF2, TRADD, MORT1 / FADD, TNFR-i, TNFR-II, TNFR-I / FAS chimera, mutations induced NF- _K B activity by over-expression of RIP, NF- _K B activation by NIK, luciferase test . NF- _K B Inducer Vector blank NIK NIK-3'UTR Clone 10 NIK ^* NIK ^* -3'UTR TRAF2225-501 aa TRAF2 300 1000 25 30 ND TRADD 300 800 1000 100 100 5 ND MORT1 / FADD 300 1000 25 80 90 TNFR-I 200 800 1000 50 100 5 ND TNFR-II 200 750 800 20 90 6 ND FAS Chimera 300 1200 25 50 30 RIP 300 800 75 50 ND NIK 500 100 10 MD TNF 200 80 RelA 1000 ND ND 1000 ND ND ND

Example 5; Additional Features of NIK

In addition to the specificity test of Example 2 above, an additional isolated partial clone of NIK (NIK 624-947) in the two-hybrid diets of NIK was added to the C-terminus of TRAF2 (of TRAF C-domain). In specific binding, in contrast, the full-length NIK binds to both the C-TRAF domain and its upstream portion (N-TRAF domain). NIK does not bind to TRAF3. In addition, chimeric molecules comprising the C-TRAF domain of TRAF2 and the N-terminus of TRAF3 bind to partial NIK molecules (NIK 624-947) but not to full length NIK. Binding seems to require both C-TRAF and N-TRAF of TRAF2.

In addition, since NIK does not self-associate, p55 TNF receptor and p75 TNF receptor; It does not bind to the intracellular domains of the CD40 receptor (a member of the TNF / NGF receptor family) and FAS / APO1 (CD95 receptor). NIK also does not bind to the associated intracellular proteins of these receptors such as MORT-1, TRADD, and RIP. This result correlates with that shown in Table 2 above, which correlates with the binding specificity of proteins encoded by clones 9, 10, 15. Various interactions between various receptors and proteins are shown in Figures 2a and 2b, more fully shown in Figure 2b.

In Northern blot analysis, there is a single transcript of NIK expressed at different levels, and these transcripts are about 5000 nucleotides in size, essentially the same as the cloned NIK cDNA (see Figure 6).

In addition, for proteins encoded by Clone 10 (originally designated NMPI), full-length NIK proteins contain serine / threonine protein kinase motifs similar to several MAP kinase kinase kinases (MAPKKK). This can be seen in the sequence sequence shown in FIG.

In in vitro testing of NIK kinase activity, NIK is self-phosphorylated, but not autophosphorylated if lysine adjacent to the active site lysine is replaced by alanine (NIK analogue or mutation designated NIK KK429-430AA). Sieve indicates that lysine was replaced with alanine at positions 429 and 430). This correlates with the results of Example 4 and correlates with the results of Table 4, which correlate with NIK * mutants.

As described above, overexpression of NIK in 293 EBNA cells induces NF- _K B beyond that induced by TRAF2 overexpression, but partial overexpression of NIK (NIK 624-947) induces NF- _K B activity. I couldn't. In addition, the aforementioned NIK analogs / mutants NIK KK429-430AA also failed to induce NF- _K B activation when overexpressed in these cells. Thus, induction of NF- _K B activity by NIK depends on the intrinsic kinase function of NIK. In contrast, RIP with a kinase domain (FIGS. 2A, B) induces NF- _K B activity even when its kinase activity is eliminated by mutation.

NF- _K B activity during NIK overexpression is indistinguishable from that produced by treatment of cells with TNF or by TNF or TRAF2 overexpression, and the major components of NF- _K B activated by NIK are p50 and p65. NIK overexpression causing the I _K Bα this decomposition is decomposition of N- acetyl-NORD rusinol -Leu-Leu- (ALLN) Blocking with (due to TNF) is a SDS-PAGE with a slow movement accumulated I _K B I molecule which _K Indicates that Bα is phosphorylated.

According to another test, NF- _K B was expressed in 293-EBNA cells by overexpression of p55 TNF receptor, p75 TNF receptor, or p55 TNF receptor in which the intracellular domain of p55 TNF receptor was substituted with FAS / APO1 receptor. It has been shown to be activated. In addition, NF- _K B is activated by overexpression of TRAF2, TRADD, RIP or MORT1 but NF- _K B is not activated by MORT1 deletion mutants lacking the "death domain" portion of MORT1. As mentioned above, full length NIK, but not NIK mutation NIK KK429-430AA or partial NIK (NIK 624-947), was shown to induce NF- _K B activity. It has also been shown that the expression of NIK KK429-430AA or NIK 624-947 in 293 EBNA cells in the presence of receptors or other associated proteins blocks the induction of NF- _K B activity by all these substances. NIK activity is directly related to _K B activity. Similarly, the aforementioned inhibitions exhibited by inactive NIK molecules have been shown to have weak NF- _K B activity.

NF- _K B is also activated by IL-1 (FIG. 2B). This IL-1 effect is independent of TRAF2 (IL-1 does not bind TRAF2 and the IL-1 effect is not blocked by TRAF2 dominant-negative mutations). However, this IL-1 effect has been shown to be hampered by NIK mutations. In addition, NF- _K B activity observed during overexpression of the p65 Rel verb in 293-EBNA cells was not affected by the expression of kinase-deficient NIK mutations, which NIK directly affected the function of the Rel protein. Although not shown, it participates in the activation induced by these receptors.

The cytotoxic activity of TNF is negatively regulated by some NF- _K B-derived genes (mediated by MORT1-associated protease MACH- FIG. 2B). The results of antagonism of NF- _K B mediated gene induction and MACH activation explain whether TNF itself as well as IL-1 induces cell resistance to TNF cytotoxicity. In this context, according to the present invention, expression of NIK dominant-negative mutations in 293 EBNA cells is significantly increased in sensitivity to death by TNF, and overexpression of native NIK (full length, wild type) results in overexpression of TNF or p55 TNF receptors. Prevents the cell from dying (this receptor has an intracellular domain that includes a "death domain" portion when there is no TNF when expressed in the cell, which can induce cytotoxicity; see co-application).

Example 6; Further Testing of NIK Biological Activity

According to the present invention, the expression of NIK dominant-negative mutations is characterized by (i) known bacterial endotoxins, lipopolysaccharides (LPS); (ii) known phorbol myristate acetate known as protein kinase; (iii) It was found that other inducers, including the HTLV-1 protein TAX, block induction of NF- _K B activity in 293-EBNA cells.

In addition, the expression of dominant-negative mutations of NIK in 293-EBNA cells was found to be ineffective in TNF-induced activation of Jun kinases, which in a specific direct manner affected NIK's MAP involved in Jun phosphorylation. It acts to enhance the phosphorylation of I- _K B without giving it.

Based on all of the foregoing, the kinase activity of NIK is part of the signal generation responsible for NF- _K B activation and such a cascade response is common between the two TNF receptors, the FAS / APO1 receptor and the IL-1 receptor. to be. NIK seems to play a particularly important role in this reaction. When NIK binds to TRAF2, it causes NIK to be affected by the TNF receptor and the FAS / APO1 receptor. Analysis of the MAP kinase response shows that when NIK is supplemented by TRAF2 with stimulated receptors, it acts as a substrate for kinase, which phosphorylates and activates other kinases when they are phosphorylated. Or directly induces NF- _K B activation by direct phosphorylation of I- _K B). IL-1 induced NF- _K B activation is independent of TRAF2, therefore NIK activation by IL-1 receptors is stimulated by another protein IRAK, serine / threonine kinase supplemented with IL-1 after stimulation ( Cao et al., 1996b) and by TRAF6 binding to IRAK (Cae et al., 1996a, FIG. 2B). As mentioned above, the cascade reaction of the target of NIK or kinase activated by it is similar to I- _K B. NIK phosphorylates TRAF proteins or regulatory proteins capable of binding TANK-I / TRAF (Cheng and Baltimore, 1996; Rothe et al., 1996) to form binding sites for other proteins.

references

Adelman et al., (1983) DNA 2, 183.

2. Alnemri, E.S. et al. (1995) J. Biol. Chem. 270, 4312-4317.

3. Ausubel, F.M. et al. eds., Current Protocols in Molecular Biology.

Baeuerle, P. A., and Henkel, T. (1994) Annu Rev Immunol.

5. Bazan, J.F. (1993). Current Biology 3, 603-606.

6. Berberich, I., Shu, G. L., and Clark, E. A. (1994), J Immunol 153, 4357-66.

7. Beutler, B., and van Huffel, C. (1994). Science 264, 667-8.

8. Blank, V., Kourilsky, P., and Israel, A. (1992). Trends Biochem. Sci 17, 135-40.

9. Boldin, M.P. et al. (1995a) J. Biol. Chem. 270, 337-341.

10. Boldin, M. P., Varfolomeev, E. E., Pancer, Z., Mett, I. L., Camonis, J. H., and Wallach, D. (1995b). J. Biol. Chem. 270, 7795-7798.

11.Boldin, M.P. et al. (1996) Cell 85, 803-815.

12. Cao, Z. et al. (1996a) Nature 383, 443-446.

13. Cao, Z. et al. (1996b) Science 271, 1128-1131.

14. Chen, C.J. et al. (1992) Ann. N.Y. Acad. Sci. 660: 271-273.

15. Cheng, G., Cleary, A.M., Ye, Z-s., Hong, D.I., Lederman, S. and Baltimore, D. (1995) Science 267: 1494-1498.

16. Cheng, G. and Baltimore, D. (1996) Genes Dev. 10, 963-973.

17. Chinnalyan, A. M., O'Rourke, K., Tewari, M., and Dixit, V.M. (1995) Cell 81, 505-512.

18. Creighton, T.E., Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, Ca. 1983.

19. Croston, G.E., Cao, Z., and Goeddel, D. V. (1995). J Biol Chem 270, 16514-7.

20. DiDonato, J. A., Mercurio, F., and Karin, M. (1995). Mol Cell Biol 15, 1302-11.

21. Durfee, T. et al. (1993) Genes Dev. 7: 555-569.

22. Field, J. et al. (1988) Mol. Cell Biol. 8: 2159-2165.

23. Geysen, H.M. (1985) Immunol. Today 6, 364-369.

24. Geysen, H.M. et al. (1987) J. Immunol. Meth. 102, 259-274.

25. Gilmore, T. D., and Morin. P.J. (1993). Trends Genet 9, 427-33.

26. Gossen, M. and Bujard, M. (1992) PNAS 89: 5547-5551.

27.Grell, M., Douni, E., Wajant, H., Lohden, M., Clauss, M., Baxeiner, B., Georgopoulos, S., Lesslauer, W., Kollias, G., Pfizenmaier, K , and Scheurich, P. (1995). Cell 83, 793-802.

28. Grilli, M., Chiu, J. J., and Lenardo, M. J. (1993). Int Rev Cytol.

29. Hanks, S. K., Quinn, A. M., and Hunter, T. (1988). Science 241, 42-52.

30. Howard, A.D. et al. (1991) J. Immunol. 147, 2964-2969.

31.Hsu, H., Shu, H.-B., Pan, M.-G., and Goeddel, D.V. (1996). Cell 84, 299-308.

32. Hsu, H., Xiong, J., and Goeddel, D.V. (1995). Cell 81, 495-504.

33. Kaufmann, S.H. (1989) Cancer Res. 49, 5870-5878.

34. Kaufmann, S.H. (1993) Cancer Res. 53, 3976-3985.

35. Lalmanach-Girard, A. C., Chiles. T. C., Parker, D. C., and Rothstein, T. L. (1993). J Exp Med 177, 1215-1219.

36. Lazebnik, Y.A. et al. (1994) Nature 371, 346-347.

37. Mashima, T. et al. (1995) Biochem. Biophys. Res. Commun. 209, 907-915.

38. McDonald, P. P., Cassatella, M. A., Bald, A., Maggi, E., Romagnani, S., Gruss, H. J., and Pizzolo, G. (1995). Eur J Immunol 25, 2870-6.

39. Messing et al., Third Cleveland Symposium on Macromolecules and Recombinant DNA, Ed. A. Walton. Elsevier, Amsterdam (1981).

40. Milligan, C.E. et al. (1995) Neuron 15, 385-393.

41.Mosialos, G., Birkenbach, M., Yalamanchili, R., VanArsdale, T., Ware, C., and Kieff, E. (1995). Cell 80, 389-399.

42. Muranishi, S. et al. (1991) Pharm. Research 8, 649.

43. Nagata, S. and Golstein, P. (1995) Science 267, 1449-1456.

44. Rending-Ehl, A., Hess, S., Ziegler-Heitbrock, H. W. L ,, Riethmuller, G., and Engelmann, H. (1995). J. Inlamm. 45, 161-174.

45.Rothe, M., Pan, M.-G., Henzel, W.J., Ayres, T.M., and Goeddel, D.V. (1995b). Cell 83, 1243-1252.

46. Rothe, M., Sarma, V., Dixit, V.M., and Goeddel, D. V. (1995a). Science 269, 1424-1427.

47. Rothe, M., Wong, S. C., Henzel, W. J., and Goeddel, D. V. (1994). Cell 78, 681-692.

48. Rothe, M. et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 93, 8241-8246.

49. Ruzicka et al., (1993) Science 260, 487.

50. Sambrook et al. (1989) Molecular cloning: a laboratory manual, Cold Spring. Harbor Laboratory Press, Cold Spring Harbor, N.Y.

51.Sano et al., (1992) Science 258, 120.

52. Sano et al., (1991) Biotechniques 9, 1378.

53. Schreiber, E., Matthias, P., Muller, M.M. and Schaffner, W. (1989), Nuc. Acids Res. 17: 6419.

54. Schulz et al., G.E., Principles of Protein Structure, Springer-Verlag, New York, N.Y. 1798.

55. Sleath, P. R. et al. (1990) J. Biol. Chem. 265, 14526-14528.

56. Smith, C. A., Farrah, T., and Goodwin, R. G. (1994). Cell 76, 959-962.

57. Stanger, B.Z. et al. (1995) Cell 81, 513-523.

58. Thornberry, N.A. et al. (1992) Nature 356, 768-774.

59. Thornberry, N.A. et al. (1994) Biochemistry 33, 3934-3940.

60. Vandenabeele, P., Declercq, W., Beyaert, R., and Fiers, W. (1995). Trends Cell Biol. 5, 392-400.

61. Varfolomeev, E.E., Boldin, M.P., Goncharov, T.M., and Wallach, D. (1996)., J. Exp. Med. in press.

62. Vassalli, P. (1992) Ann. Rev. Immunol. 10, 411-452.

63. Veira et al., (1987) Meth. Enzymol. 153, 3.

64. Wallach, D. (1996) Eur. Cytokine Net. 7, 713-724.

65. Wang, L. et al. (1994) Cell 78, 739-750.

66. Wilks, A.F. et al. (1989) Proc. Natl. Acad. Sci. USA, 86: 1603-1607.

67. Zaccharia, S. et al. (1991) Eur. J. Pharmacol. 203, 353-357.

68. Zhao, J.J. and Pick, L. (1993) Nature 365: 448-451.

Sequence Listing

(1) General Information

(i) the applicant;

(A) Name; eda research and development corporation, limited

(B) distance; Wezman Institute of Science

(C) cities; P.O.B. 95

(E) week; Rehoboth

(F) postal codes; 76100

(G) telephone numbers; 972-8-9344093

(H) pex numbers; 972-8-9470739

(A) name; Walch David

(B) distance; 24 Borochove Street

(C) city; Rehoboth

(E) country; Israel

(F) postal codes; 76406

(A) name; Marinin Nikolai

(B) distance; Byte Claw, Wezman Institute of Science

(C) city; Rehoboth

(E) country; Israel

(F) postal codes; 76100

(A) name; Boldin Mark

(B) distance; Byte Claw, Wezman Institute of Science

(C) city; Rehoboth

(E) country; Israel

(F) postal codes; 76100

(A) name; Covalenko Andrey

(B) distance; Byte Claw, Wezman Institute of Science

(C) city; Rehoboth

(E) country; Israel

(F) postal codes; 76100

(A) name; Met Igor

(B) distance; Levin Ipstein Street 60

(C) city; Rehoboth

(E) country; Israel

(F) postal codes; 76462

(ii) the name of the invention; TNF receptor associated factor (TRAF) modulators, their preparation and uses thereof,

(iii) number of sequences; 11

(iv) computer-readable form

(A) medium form; floppy disk

(B) Computer; IBM PC Compatibility

(C) operating system; PC-DOS / MS-DOS

(D) Software; PatentIn Release # 1.0, Version # 1.30 (EPO)

(v) current application information;

Application number; PCT / IL97 / 00117

(vi) pre-application data;

(A) application number; IL 117800

(B) filing date; April 2, 1996

(vi) pre-application data;

(A) application number; IL 119133

(B) filing date; August 26, 1996

(2) Information about sequence 1

(i) Sequence features

(A) length; 1906 bp

(B) form; nucleic acid

(C) strand; single strand

(D) phase; linear

(ii) molecular form; DNA

(iii) hypothesis; none

(xi) SEQ ID NO 1

[SEQ ID NO 1]

(2) Information about sequence 2

(i) Sequence features

(A) length; 604 amino acids

(B) form; amino acid

(C) strand; single strand

(D) phase; linear

(ii) molecular form; protein

(xi) SEQ ID NO: 2

[SEQ ID NO 2]

(2) Information about sequence 3

(i) Sequence features

(A) length; 2631 bp

(B) form; nucleic acid

(C) strand; single strand

(D) phase; linear

(ii) molecular form; cDNA

(xi) SEQ ID NO 3

[SEQ ID NO 3]

(2) Information about sequence 4

(i) Sequence features

(A) length; 1253 bp

(B) form; nucleic acid

(C) strand; single strand

(D) phase; linear

(ii) molecular form; cDNA

(xi) SEQ ID NO: 4

[SEQ ID NO 4]

(2) Information about sequence 5

(i) Sequence features

(A) length; 417 amino acids

(B) form; amino acid

(C) strand; single strand

(D) phase; linear

(ii) molecular form; protein

(xi) SEQ ID NO: 5

[SEQ ID NO: 5]

(2) Information about sequence 6

(i) Sequence features

(A) length; 4596 bp

(B) form; nucleic acid

(C) strand; single strand

(D) phase; linear

(ii) molecular form; cDNA

(xi) SEQ ID NO: 6

[SEQ ID NO: 6]

(2) Information about sequence 7

(i) Sequence features

(A) length; 947 amino acids

(B) form; amino acid

(C) strand; single strand

(D) phase; linear

(ii) molecular form; protein

(xi) SEQ ID NO: 7

[SEQ ID NO: 7]

(2) Information about sequence 8

(i) Sequence features

(A) length; 30 bp

(B) form; nucleic acid

(C) strand; single strand

(D) phase; linear

(ii) molecular form; Other nucleic acids

(A) description; / desc = "oligonucleotide PCR primer"

(xi) SEQ ID NO: 8

[SEQ ID NO: 8]

(2) Information about sequence 9

(i) Sequence features

(A) length; 32 bp

(B) form; nucleic acid

(C) strand; single strand

(D) phase; linear

(ii) molecular form; Other nucleic acids

(A) description; / desc = "oligonucleotide PCR primer"

(xi) SEQ ID NO: 9

[SEQ ID NO: 9]

(2) Information about sequence 10

(i) Sequence features

(A) length; 24bp

(B) form; nucleic acid

(C) strand; single strand

(D) phase; linear

(ii) molecular form; Other nucleic acids

(A) description; / desc = "oligonucleotide PCR primer"

(xi) SEQ ID NO: 10

[SEQ ID NO: 10]

(2) Information about sequence 11

(i) Sequence features

(A) length; 24bp

(B) form; nucleic acid

(C) strand; single strand

(D) phase; linear

(ii) molecular form; Other nucleic acids

(A) description; / desc = "oligonucleotide PCR primer"

(xi) SEQ ID NO: 11

[SEQ ID NO: 11]

Claims (20)

A polypeptide that binds to TRAF2 and modulates the activity of NF-κB, the polypeptide comprising: (a) the amino acid sequence of SEQ ID NO: 7 (NIK: NF-κB induction kinase); or (b) a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 3 (clone 10). The polypeptide of claim 1, wherein the polypeptide is encoded by the nucleotide sequence of polypeptide SEQ ID NO: 3 (clone 10). The polypeptide of claim 1, wherein the polypeptide is an amino acid sequence of SEQ ID NO: 7 (NIK: NF-κB induction kinase). A DNA sequence that encodes a polypeptide that binds to TRAF2 and modulates the activity of NF-κB, wherein the DNA sequence is a cDNA sequence consisting of the nucleotide sequence of SEQ ID NO: 3. DNA sequence of SEQ ID NO: 6 encoding protein NIK (NF-κB induction kinase). A vector comprising the DNA sequence according to any one of claims 4 and 5. 7. The vector of claim 6, which can be expressed in eukaryotic host cells. 7. The vector of claim 6, which can be expressed in prokaryotic host cells. A transformed eukaryotic or prokaryotic host cell carrying the vector according to claim 6. In a method of producing a TRAF-binding protein, Growing the transformed host cell according to claim 9 under conditions suitable for expressing said protein; If necessary, modification after modification to obtain the protein; Separating the expressed protein. An antibody specific for a polypeptide according to claim 1. In the method for isolating and identifying the polypeptide according to claim 1 capable of directly binding to TRAF2, Applying a yeast double-hybrid process, wherein the sequence encoding TRAF2 is transferred by any hybrid vector and the sequence of the cDNA or genomic DNA library is transferred by a second hybrid vector; Transforming the yeast host cell with the vector; Positively transformed cells are isolated; Extracting a second hybrid vector to obtain a sequence encoding a protein that binds to TRAF2. A pharmaceutical composition for the treatment of cancer, inflammation, graft-host reaction and acute hepatitis, comprising as an active ingredient a recombinant animal viral vector encoding a cell surface receptor binding protein and a polypeptide according to claim 2. Pharmaceutical compositions for the treatment of cancer, inflammation, graft-host reactions and acute hepatitis. Cancer, inflammation, grafts, characterized in that the pharmaceutical composition for the treatment of cancer, inflammation, graft-host reaction and acute hepatitis contains an effective amount of a protein encoded by clone 10 (SEQ ID NO: 3). Pharmaceutical compositions for the treatment of host reactions and acute hepatitis. Pharmaceutical compositions for the treatment of cancer, inflammation, graft-host reactions and acute hepatitis, characterized by containing an effective amount of a DNA molecule encoding a protein encoded by clone 10 (SEQ ID NO: 3) Pharmaceutical compositions for the treatment of cancer, inflammation, graft-host reactions and acute hepatitis. A pharmaceutical composition for the prophylaxis and treatment of cancer, inflammation, graft-host reaction and acute hepatitis, the cancer comprising an effective amount of the polypeptide of SEQ ID NO: 7 (NIK: NF-κB induction kinase) , Pharmaceutical compositions for the prevention and treatment of inflammation, graft-host reaction and acute hepatitis. In pharmaceutical compositions for the prevention and treatment of cancer, inflammation, graft-host reactions and acute hepatitis, it contains an effective amount of the DNA molecule of SEQ ID NO: 6 encoding the NIK (NF-κB induction kinase) protein. A pharmaceutical composition for the prevention and treatment of cancer, inflammation, graft-host reaction and acute hepatitis. In the method for screening a ligand capable of binding to a polypeptide according to claim 1, Contacting the affinity chromatography matrix to which the polypeptide is attached and a cell extract, wherein the ligand binds to the matrix; Eluting, separating, and analyzing the ligands. In the method for screening a DNA sequence encoding a ligand capable of binding to the polypeptide according to claim 1, Applying a yeast double-hybrid process, wherein the sequence encoding the polypeptide is transferred by any hybrid vector and the sequence of the cDNA or genomic DNA library is transferred by a second hybrid vector; Transforming the yeast host cell with the vector; Positively transformed cells are isolated; Extracting a second hybrid vector to obtain a sequence encoding said ligand. An antibody specific for a polypeptide according to claim 3.