KR100515767B1 - HlyU, Regulator of in vivo expressed virulence factors of Vibrio vulnificus - Google Patents

Abstract

The present invention relates to the hlyU gene, which is a virulence expression regulator in vivo of sepsis Vibrio vulnificus , and more particularly, to prepare a mutant strain which selectively deletes the hlyU gene, which is a virulence expression regulator, And to develop anti-Vibrio sepsis vaccines and therapeutic agents.

Description

In Vitro Virulence Factors of Sepsis Vibrio HH ｙ Ｕ {HlyU, Regulator of in vivo expressed virulence factors of Vibrio vulnificus}

The present invention relates to the hlyU gene, which is a virulence expression regulator in vivo of sepsis Vibrio vulnificus , and more particularly, to prepare a mutant strain which selectively deletes the hlyU gene, which is a virulence expression regulator, And to develop anti-Vibrio sepsis vaccines and therapeutic agents.

Vibrio vulnificus infections have a relatively short history, but clinical cases have been reported all over the world and are one of the new attentions. Although absolute cases worldwide are less than cholera and salmonella food poisoning, they are causing serious social problems because of their high lethality and tragic clinical symptoms.

V. vulnificus first became the first pathogenic bacterium after Hollis et al. In 1976 in the US Centers for Disease Control (CDC) reported the bacteriological properties of new basophilic Vibrio bacteria isolated from humans for the previous 11 years. The new Vibrio bacterium showed biochemical test results that were clearly distinguished from previously identified and classified Vibrio species, and were specifically named Lac (+) or lactose-fermenting Vibrio by breaking down lactose. The disease entity of this new Vibrio infection was first established in 1979 by Blake et al. Of the US CDC. Until then, they analyzed the data of 39 patients reported in the CDC and classified them into primary septicemia and wound infection according to clinical symptoms. In 1979, it was named by Vibrio vulnificus (vulnus = wound, ficus = forming) as a new species by Farmer.

V. vulnificus sepsis mostly occurs in men over 40 years old (about 90-95%) (more than 90%), and is rarely seen in normal people and occurs mainly in patients with underlying diseases. In the case of primary sepsis, analysis of cases around the world shows that most patients have chronic diseases. The most common ones are liver disease and drinking wall. Liver diseases include cirrhosis, chronic hepatitis and liver cancer. Other underlying diseases such as diabetes, pulmonary tuberculosis, chronic osteomyelitis, and rheumatoid arthritis have been identified, but less than 5% of the underlying diseases may not be found. In the United States, diabetes, malignant tumors, hemochromatosis and thalassemia are relatively high. Recently, the incidence of V. vulnificus sepsis has been reported in AIDS patients, and the US CDC recommends AIDS patients not to eat raw fish such as raw oysters in summer.

V. vulnificus is contaminated by fish and shellfish inhabiting the estuary and reaches the intestine. In the intestine, it passes through mucous, attaches to the intestinal epithelial cells, destroys it, invades the intestinal mucosa and enters the blood vessels. It is thought. V. vulnificus enters the bloodstream of highly susceptible patients with underlying diseases such as hepatic disease. The condition is called sepsis.

V. vulnificus sepsis has a short incubation period and, once developed, progresses rapidly and misses the timing of effective antimicrobial treatment. Research into the pathogenesis of V. vulnificus began in earnest in the mid-1980s. Initially, research was conducted to determine why V. vulnificus is more likely to be sepsis, unlike other Vibrio genera, and why primary sepsis occurs mainly in patients with hepatic disease. To date, more than 20 years after the study began in earnest, no comprehensive theories have been established that fully explain the symptoms and course of V. vulnificus sepsis.

Pathogenic bacteria selectively express different gene groups when they exist in the natural environment and when they cause infection in the body. The switches of genes necessary to adapt to the natural environment are turned off in vivo, and the switches of genes necessary to cause disease are selectively turned on to cause characteristic pathophysiology. V. vulnificus lives in estuary waters of 2.5% salinity and 25 ° C in natural environments, but is ingested with humans to cause opportunistic infections. Will rise to 37 ℃. Thinking of these two environmental factors alone, V. vulnificus will experience tremendous environmental changes during the infection process and will express a whole new set of genes to adapt to the new environment, presumably acting as a major virulence factor. Gene products selectively expressed in vivo can be useful for vaccine development as well as new therapeutic targets (Handfield and Levesque, FEMS Microbiol. Lett. 23: 69-91, 1999).

The present inventors have confirmed that V. vulnificus has a global regulatory system that detects changes in the environment and regulates the expression of virulence factors, and then studies molecular molecular biological results. As a result, virulence factors of V. vulnificus in vivo Efforts have been made to grasp the evidence that expression is regulated by global virulence regulators, such as quorum sensing systems or Vv-ToxRS systems.

That is, the present inventors conducted a study to search for an antigen gene selectively expressed in infected sepsis Vibrio in vivo, and found the hlyU gene, which is a regulatory factor expression regulator in vivo, to complete the present invention.

Accordingly, it is an object of the present invention to provide a mutant strain which selectively deletes the hlyU gene and hlyU gene, which are in vivo virulence expression regulators.

It is also an object of the present invention to provide an anti-Vibrio sepsis vaccine and a therapeutic drug development method using a mutant strain that selectively deletes the hlyU gene, which is a virulence expression regulator in vivo.

The present invention relates to the hlyU gene, which is a vibrio vulnificus virulence expression regulator represented by DNA sequence 1 or amino acid sequence 2.

The present invention also relates to a mutant strain that selectively deletes the hlyU gene, which is a vibrio vulnificus virulence expression regulator, and an anti-Vibrio sepsis vaccine prepared by containing the hlyU gene deletion mutant strain.

Hereinafter, the present invention will be described in detail.

Pathogenic bacteria that travel between the natural environment and the human body must survive in completely different environments. In the human body, it selectively inhibits expression of genes necessary only for survival in the natural environment, and selectively induces expression of virulence genes necessary for survival and disease in the human body. These virulence factors in the human body are the main antigens that the immune system recognizes and responds to.

In the present invention, in order to find antigens that selectively increase expression in the human body, the antigen expression library is screened by using the serum of the recovering patient who survived sepsis, and the gene is identified. Figure 1 shows such an in vivo induced antigen gene identification technique (IVIAT), first, the serum of the recovery phase patient by mixing the same amount of serum to create a sepsis Vibrio cells, crushed antigen cultured at 25 ℃ similar to the natural environment Absorb thoroughly with or the like to remove as many antibodies as possible from the in vitro expressed antigens. In this absorbing serum, only antibodies that can selectively react with antigens expressed in the human body remain. The sequence of the expression library clone DNA that reacts with the serum is identified and the genes are identified to demonstrate the pathological significance of the genes through various molecular biological and animal experiments.

The method of detecting the hlyU gene according to the present invention includes the following steps:

1) preparing a genomic expression library;

2) selectively screening the expressed gene in vivo using the serum of the sepsis patient;

3) preparing selective deletion mutants to characterize the pathophysiological significance of the found genes; And

4) comparing the cytotoxicity and mouse lethality of the prepared mutant strain with the natural strain.

Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited only to these Examples.

Example 1

<Genome Expression Library Preparation>

Chromosome DNA of V. vulnificus MO6-24 / O standard strain (obtained from J. Glenn Morris Jr. of the Division of Hospital Epidemiology of the University of Maryland School of Medicine, USA) was partially digested with restriction enzyme Sau 3A and then 0.5- Only 1.5 kbp DNA fragments were cloned into the Bam HI site of the pET30abc expression vector (Novagen Co.) and transformed by electroporation to E. coli DH5α. All of the transformed strains were collected and cultured at the same time to isolate the plasmid and electroporated again to the expression-only host cell E. coli BL21 (Novagen Co.) was used as a genome expression library of over 60,000 clones.

<Preparation of Serum from Recovery Patients>

Among the sera of Vibrio sepsis recovering patients who were admitted to Chonnam National University Hospital, they were confirmed by the bacteriological separation, and the serum separated from the fully recovered patients was used by mixing 1 ml. As a negative control, serum from a child who had never experienced seafood reproduction was used. In the 25 ℃ suspended in phosphate buffered saline with serum mixture heart infusion broth (Difco Co.) to react with ¹¹ of 10 V. vulnificus and slowly shaken at 4 ℃ overnight incubation at evening antibodies acting on the in vitro expression of antigen Was removed. In order to absorb the antibody against the cytoplasm and cell membrane antigen, the cell lysate solution was adsorbed onto nitrocellulose filter paper and then reacted with serum and overnight at 4 ° C. three times. Finally, the cell lysate was soaked in boiling water for 10 minutes and adsorbed onto nitrocellulose filter paper, and then the serum was absorbed once more to completely absorb the antibody against the denatured antigens. Patient serum prepared in this way was not absorbed all the antibodies that work with antigens expressed in V. vulnificus cultured in vitro at 25 ℃, only antibodies that can bind to the antigens expressed in vivo.

<Expression Library Screening>

1) The prepared expression library was serially diluted and plated with about 500 colonies per plate medium, followed by incubation overnight. Sterile velvet cloth was used to incubate replica plates in isopropyl b-D-thiogalactoside (IPTG) -containing medium for 5 hours and then induce antigen expression from cloned genes.

2) The bacterial culture plate was exposed to chloroform vapor for about 15 minutes so that the bacteria were lysed and the expressed protein was exposed. The nitrocellulose filter paper was then superimposed on this for 15 minutes to allow protein transfer.

3) Protein transfer filter paper was blocked with 5% skim milk powder, 0.5% Tween 20, pH 7.2 phosphate buffered saline in a 4 ℃ refrigerator overnight.

4) The recovery phase patient serum absorbed with the primary antibody was diluted 1: 5000 or more and operated for 1 hour at room temperature.

5) After the reaction with peroxidase-conjugated anti-human immunoglobulin antibody as a secondary antibody and the detection of reactive colonies using ECL chemiluminescence kit (Amersham Co.), 12 clones were selected.

Cloning of Virulence Genes Expressed in the Human Body

1) The above screening process was repeated 2-3 times to select one clone that reacted strongly and reliably with absorbed serum, and DNA sequencing was performed in both directions using pET30 primer (Novagen Co.).

2) Genes showing homology with the obtained DNA sequences were searched through BLAST analysis (GenBank database of the National Center for Biological Information). As a result, one clone was found to be 64% identical at the amino acid level with the cholera hlyU gene. Thus, the detected virulence expressing genes were named hlyU genes.

The DNA base sequence of the cloned in vivo virulence expression gene hlyU is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2.

< Preparation of hlyU deletion Mutant strains >

the upper and lower portions of hlyU gene, two pairs of primers (PhlyU-1, cg ggatcc tcgatatcgtcaactatag , PhlyU-2: cg ggatcc ttttaagttcatgtgttgg and PhlyU-3: cg ggatcc gaataatgcttttgcgtg, PhlyU-4: tacgtcggcactggcacctg, a restriction enzyme BamH inserted for cloning I recognition sites are underlined) to amplify by polymerase chain reaction. At this time, the amplification of the upper hlyU gene using the primers PhlyU-1 and PhlyU-2, and the DNA fragments below the hlyU using PhlyU -3 and PhlyU-4 were initially denatured at 95 ° C for 4 minutes, denatured at 94 ° C for 30 seconds, and annealed at 62 ° C. Second, expansion 72 ℃ 60 seconds, it was repeated 25 times and then amplified using a polymerase chain reaction under the condition that the reaction for the last 10 minutes at 72 ℃. In order to connect the two amplified DNA fragments with each other, the DNA fragments amplified by the primers PhlyU-3 and PhlyU-4 were first cloned into a PCR 2.1-TOPO cloning vector (Invitrogen Co.). The recombinant DNA was cut with BamH I, and then DNA fragments amplified by the primers PhlyU-1 and PhlyU-2 were cut with the same restriction enzyme BamH I and cloned. pDM4 plasmid cut from the top and bottom of hlyU using Xba I and Sac I restriction enzymes from recombinant TOPO vectors cloned in the same direction and cut with the same restriction enzymes (obtained from Debra Milton, Department of Molecular Biology, Umea University, Sweden) Cloned into. The recombinant plasmid thus prepared is electroporated to E. coli SM 10 λ pir , and the resulting transformed strain is conjugated with V. vulnificus to allow the recombinant plasmid to be delivered. V. vulnificus inside can not proliferate hlyU deletion DNA fragment with a deletion mutation is caused by allelic exchange (allelic exchange) between naturally occurring DNA fragment of the chromosome of V. vulnificus pDM4 strain PhlyU-1 and 4-primer PhlyU It was confirmed by the polymerase chain reaction using a partner.

Test 1 Cytotoxicity test of hlyU deletion mutant strain

Cytotoxicity of the hlyU mutant strain was measured by lactate dehydrogenase (LDH) release from HeLa cell line using CytoTox ™ Non-Radioactive cytotoxic assay kit from Promega, USA. The mutant strain and the natural strain were suspended in DMEM cell culture medium (Gibco Co.) and incubated for 90 minutes and 180 minutes in a 37 ° C. 5% CO ₂ incubator with a bacterial to HeLa cell ratio of 100. The results are shown in FIG. Referring to Figure 2, the natural type killed about 70% or more HeLa cells at 90 minutes, at 180 minutes. On the other hand, hlyU deletion mutants showed little killing effect at 90 minutes and less than 20% killing at 180 minutes.

Test 2 Examination of lethality in mice

SPF (specific pathogen free) 8-week-old CD-1 mice were injected with 10-fold serially diluted hlyU deletion mutant strains and natural strains, and lethality was observed for 48 hours. As a result, the 50% lethal dose (LD ₅₀ ) of the hlyU deletion mutant strain was 2.1 × ^{10 8} . On the other hand, LD ₅₀ of the natural strain was found to be 4.0 × 10 ⁶ , indicating a 53-fold reduction in homogenous history by hlyU deletion mutations.

As described above, it was found that hlyU gene which selectively increases expression in vivo and produced and deleted specific deletion mutant strains significantly reduced virulence. The gene will be used to develop live vaccines and new antimicrobial therapies that can effectively prevent and treat Vibrio sepsis.

1 shows in vivo induced antigen gene identification (IVIAT).

2 is a graph showing the cytotoxicity test results of hlyU deletion mutant strains .

<110> CHONNAM NATIONAL UNIVERSITY <120> HlyU, regulator of in vivo expressed virulence factors of Vibrio vulnificus <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 297 <212> DNA <213> Vibrio vulnificus <400> 1 atgaacttaa aagatatgga gcagaattct gctaaagctg tcgtattact caaagccatg 60 gccaatgaaa gacgcctgca aatcttatgc atgctacaca atcaagagct atcggtcggg 120 gaactttgtg ccaaattgca attaagtcag tctgcattgt ctcagcatct ggcatggttg 180 cgtcgtgatg gtttggtgac cacgcgtaaa gaagcacaaa cggtttacta cactctgaaa 240 agtgaagaag taaaagcaat gattaaactg ctgcacagtc tttattgcga agaataa 297 <210> 2 <211> 98 <212> PRT <213> Vibrio vulnificus <400> 2 Met Asn Leu Lys Asp Met Glu Gln Asn Ser Ala Lys Ala Val Val Leu 1 5 10 15 Leu Lys Ala Met Ala Asn Glu Arg Arg Leu Gln Ile Leu Cys Met Leu 20 25 30 His Asn Gln Glu Leu Ser Val Gly Glu Leu Cys Ala Lys Leu Gln Leu 35 40 45 Ser Gln Ser Ala Leu Ser Gln His Leu Ala Trp Leu Arg Arg Asp Gly 50 55 60 Leu Val Thr Thr Arg Lys Glu Ala Gln Thr Val Tyr Tyr Thr Leu Lys 65 70 75 80 Ser Glu Glu Val Lys Ala Met Ile Lys Leu Leu His Ser Leu Tyr Cys 85 90 95 Glu glu

Claims (2)

The hlyU gene, which is represented by DNA sequence 1 or encodes amino acid sequence 2, is a vibrio vulnificus virulence expression regulator. An anti-Vibrio sepsis live vaccine comprising as an active ingredient a mutant strain which selectively deletes the hlyU gene, which is a vibrio vulnificus virulence expression regulator according to claim 1.