KR100494375B1 - And controler of plant pathogen using chitinase producing bacteria from soil - Google Patents

Abstract

The present invention secretes chitinases for the defense of various plant pathogens, thereby decomposing chitin constituting the cell wall of pathogenic fungus or the ovarian cell wall of nematodes, thereby retaining the ability to retain plants from phytopathogens. The present invention relates to a plant disease control agent using chitin-decomposing microorganisms extracted from soil with soil. The main configuration of the present invention comprises the steps of collecting the soil from the soil containing abundant crab shells and smearing on chitin medium; Separating the strains forming a zona pellucida on a colloidal chitin medium containing 0.2% colloidal chitin into sweet colonies; Mixing the isolated strains and culturing again in a large amount of chitin liquid medium; Inoculating the cultured strains with a mixture of crab shell and agricultural by-products to form a microbial agent; And culturing the microbial agent until the maturity index is two.

Description

And Controler of Plant Pathogen using Chitinase Producing Bacteria from soil}

The present invention secretes chitinases for the defense of various plant pathogens, thereby decomposing chitin constituting the cell wall of pathogenic fungus or the ovarian cell wall of nematodes, thereby retaining the ability to retain plants from phytopathogens. The present invention relates to a plant disease control agent using chitin-decomposing microorganisms extracted from soil with soil.

The damage of crops caused by pests causes economic losses of up to 220 trillion won worldwide. Most of the plant diseases that occur in horticultural crops such as watermelons, cucumbers, eggplants, peppers, strawberries, and melons are devastating by filamentous fungi and nematodes. The main pathogenic strains were Pythium ultimum , Fusarium solani , Root oxysporum , Rhizoctonia sp. (Mozalococcal disease), Fusarium moni (withering disease), Alternaria kiki (spotted deciduous disease), Colletotrichum gloeosporioides (leaf anthrax), Penicillum expansum (blue fungal disease), Stemphylium sp. (Leaf blight), Septoria solani (round plaque ), Puccinia adenophora (rust disease), Phytophthora capsici (blight plague), Heterodera trifolii (root rot of legumes ), Pratylenchus sp. And Tylenchus spp have.

Excessive use of pesticides in order to control these diseases causes environmental pollution and human toxicity, resulting in a total crisis on agriculture. At the moment when demand for high-quality, non-polluting, non-pesticide-free crops is increasing, the development of environmentally friendly farming methods has emerged as the only alternative to meet both farm income growth and consumer needs.

Consumers' preference for pollution-free food is becoming more common in recent years due to improved living standards, but it is almost impossible to maintain agricultural production at the current level without using pesticides or fertilizers. In addition, many organic synthetic pesticides have been developed and used to control plant diseases, but the use of such organic medicines may cause greater disasters such as the emergence of drug resistant strains as well as environmental pollution.

Because of these problems, many scholars have attempted to control pathogenic bacteria using microorganisms, and some of these attempts have incubated useful microorganisms to inoculate soil.

However, it is almost impossible to adapt the cultured microorganisms to the field because these methods are rapidly reduced by competition from the environmental competition of about 100 to 10 billion indigenous microorganisms in the soil. .

On the other hand, natural by-products such as crabs and shrimp shells are distributed around the east coast of Korea, Alaska, Maine, and Canada, producing about 1.5 × 10 ⁸ tons per year. Part of the production has been used to produce chitosan, but most of it is being discarded.

Most of the major components of the crab shell is made up of chitin, so in order to be biologically degraded, chitin-degrading microorganisms producing chitinase must be involved. Accordingly, the present inventors have studied methods for plant disease prevention and control and plant growth with the persistence of such chitin-decomposing microorganisms (microbial agents).

Accordingly, an object of the present invention is to secrete chitinase for the defense of various plant pathogens from soil, and to decompose chitin constituting the cell wall of pathogenic fungus or the ovarian cell wall of nematode, thereby preventing the plant from various plant pathogens. To provide a plant disease control using chitin-decomposing microorganisms extracted from soil having the ability to retain.

delete

Plant disease control agent using chitin-decomposing microorganism extracted from the soil for achieving the above object is the step of collecting the soil from the soil containing abundant crab shells and smearing on chitin (chitin) medium; Separating the strains forming a zona pellucida on a colloidal chitin medium containing 0.2% colloidal chitin into sweet colonies; Mixing the isolated strains and culturing again in a large amount of chitin liquid medium; Inoculating the cultured strains with a mixture of crab shell and agricultural by-products to form a microbial agent; And culturing the microbial agent until the maturity index is two.

delete

Referring to the configuration of the present invention in detail as follows.

Chitin-degrading microorganisms are first collected from soils, field soils and coastal soils containing large amounts of crab shells and chitins around the coast, diluted with distilled water appropriately, and plated on agar medium containing 0.2% colloidal chitin.

Then, the bacteria that form the halo zone around the colonies are selected on the agar medium containing 0.2% colloidal chitin (the microorganisms forming the projection zone are all complexes. Is defined here as a chitin-decomposing microorganism.)

Then, all strains forming the zona pellucida are mixed and shaken incubated at a rotational speed of 170 times per minute for 5 days in a chitin liquid medium at about 30 ° C.

Hereinafter, the contents of the present invention will be described in more detail with reference to examples, but the scope of the present invention is not limited to these examples.

<Selection of Chitin-Degrading Microorganisms and Composts Using the Same>

Take ashore soil rich in crab shells, mix 90 ml of distilled water with 10 g of soil, shake incubation at 170 revolutions per minute, dilute appropriately, and then agar medium containing 0.2% colloidal chitin. (0.2% Na ₂ HPO ₄ , 0.05% KNO ₃ , 0.1% KH ₂ PO ₄ , 0.1% NH ₄ Cl, 0.05% MgSO ₄ 7H ₂ O, 0.05% CaCl ₂ · 2H ₂ O, 0.01% yeast extract, 1 % colloidal chitin and agar 0.2%) to find strains that form a halo zone around the colonies, and again smeared on agar medium containing 0.2% colloidal chitin (single strain) as shown in FIG. Secured them.

All of these strains were mixed to form a chitin liquid medium at about 30 ° C. (0.2% Na ₂ HPO ₄ , 0.05% KNO ₃ , 0.1% KH ₂ PO ₄ , 0.1% NH ₄ Cl, 0.05% MgSO ₄ · 7H ₂ O , 0.05% CaCl ₂ · 2H ₂ O, 0.01% yeast extract, 1% colloidal chitin) for 5 days, shaken at 170 revolutions per minute for 5 days, and then these strains were treated with green first compost registered as a by-product fertilizer. The compost (completely mature byproduct fertilizer, ie the primary fermentation is complete here) was inoculated with the crab shell to form a microbial formulation.

After that, the microbial agent was covered with vinyl, and the water content was measured so that the water content was 45 to 60%. . After maturation until the maturity index reaches 2 over time, chitinase activity, β-1,3-glucanase activity and dehydrogenase Dehydrogenase activity, acid phosphatase activity, alkaline phosphatase activity and microbial irradiation were measured (secondary fermentation completed).

1) Base Sequence of 16S rDNA of Isolated Strains

After the isolated strain was shaken for 24 hours in LB liquid medium at 30 ℃, the cells were recovered to separate genomic DNA as shown in Table 1. 16S rRNA of these strains was polymerized by using 5'-TGG CTC AGA ACG AAC GCT GGC CCG-3 'as the forward primer and 5'-CCC ACT GCC TCC CGT AGT-3') as the reverse primer. Cloning was carried out by polymerase chain reaction. The base sequence of the analyzed 16S rDNA is as follows.

Strain 16S rRNA sequence HJ-927 Bacillus subtilis (KACC 10113) KJA-118 Bacillus cereus (KACC 10004) KJA-424 Paenibacillus illinoisensis (KACC 10910) HJ-928 Serratia marcescens (kacc 10002)

a) KJA-118 (identified as Bacillus cereus using 16s rRNA sequence)

b) HJ-928 (identified as Serratia marcescens using 16s rRNA sequence)

14 tggctcagattgaacgctggcggcaggcttaacacatgcaagtcgagcggtagcacaggg 73

74 gagcttgctccctgggtgacgagcggcggacgggtgagtaatgtctgggaaactgcctga 133

134 tggagggggataactactggaaacggtagctaataccgcataacgtcgcaagaccaaaga 193

194 gggggaccttcgggcctcttgccatcagatgtgcccagatgggattagctagtaggtggg 253

254 gtaatggctcacctaggcgacgatcccta 282

c) KJA-424 (identified as Paenibacillus illinoisensis using 16s rRNA sequence)

14 tggctcaggacgaacgctggcggcgtgcctaatacatgcaagtcgagcggacttgatgag 73

74 aagcttgcttctctgatggttagcggcggacgggtgagtaacacgtaggcaacctgccct 133

134 caagcttgggacaactaccggaaacggtagctaataccgaatacttgcttccttcgcctg 193

194 aaggaagctggaaagacggagcaatctgtcacttgaggatgggcctgcggcgcattagct 253

254 agttggtgaggtaacggctcaccaaggcgacgatgcgtacccgacctgagagggtgatcg 313

314 gccacactgggactgagacacggcccagactcctacgggaggcagcagt 362

d) HJ-927 (identified as Bacillus subtilis using 16s rRNA sequence)

349 ctgcctcccgta-ggagtctgggccgtgtctcagtcccagtgtggccgatcaccctctca 291

290 ggtcggctacgcatcgttgccttggtgagccgttacctcaccaactagctaatgcgccgc 231

230 gggtccatctgtaagtggtagccgaagccaccttttatgtttgaaccatgcggttcaaac 171

195 aaccatccggtattagccccggtttcccggagttatcccagtcttacaggcaggttaccc 254

170 aaccatccggtattagccccggtttcccggagttatcccagtcttacaggcaggttaccc 111

110 acgtgttactcacccgtccgccgctaacatcagggagcaagctcccatctgtccgctcga 51

50 cttgcatgtattaggcacgccgccagcgttcgtc 17

1) Analysis of soil maturity and inorganic elements over time

The maturity level and each item were measured in 2 weeks. Organic matter concentration was determined by the incineration method, and total nitrogen was measured by the Kjeldahl method. Cations (Ca ²⁺ , Mg ²⁺ , K ^+, etc.) were decomposed and measured by ICP (Inductively Coupled Plasma). Soluble phosphoric acid was measured at 660 nm using a UV spectrophotometer to show the compost components over time. At this time, the maturity level was measured by the maturity kit, and the standard maturity index is shown in Table 3.

(%) Adjacency Index Water content Organic matter content C / N ratio T-N P ₂ O ₅ Ca ²⁺ K ⁺ Mg April 30 57.20 28.57 16.57 0.52 1.82 3.44 0.72 1.05 4 May 10 50.58 28.24 23.65 0.65 1.91 3.53 0.72 1.29 4 May 23 53.01 28.49 27.51 0.61 2.03 3.91 1.07 1.88 4 June 7 49.65 28.30 24.87 0.66 2.49 3.85 0.92 1.79 3 June 21 48.83 27.58 23.07 0.69 2.01 3.90 0.74 1.78 3 July 5 49.29 27.15 21.01 0.76 2.40 4.26 0.73 1.90 3 19 July 49.76 27.26 24.01 0.66 2.10 4.36 0.76 1.80 2 August 2 45.54 28.89 20.28 0.83 2.81 4.42 0.78 1.76 2

Maturity index Homelessness Compost characteristics One Completion Dirt smell 2 Under housing Almost finished 3 Under housing Currently in housing 4 Grief Long stay 5 Immature Fresh

As shown in Table 2, the microbial agent of the present invention can be used as a compost (plant control plant) after almost two months of ripening, and also, C / N ratio, TN, P ₂ O ₅ , It turns out that content of Ca2 ⁺ , K2 ⁺ , Mg is very high.

2) Chemical Characteristics of Microbial Agents and Commercial Composts

Table 4 shows the chemical properties of the microbial agent produced by the above method and commercial compost generally sold.

Treatment % C / N gK g ^-1 T-N O.M K Ca Mg Microbial agents 1.02 25.33 14.83 3.9 24.9 18.7 Commercial compost 0.96 32.55 19.67 6.95 13.7 19.4

As shown in Table 4, it was confirmed that the microbial agent of the present invention is inferior in chemical properties when composted with fertilizer at all property values.

3) Enzymes in Microbial Agents

In order to prepare an enzyme extract from the microbial preparation, the mixture was mixed at a rate of 2.5 ml of distilled water per 1 g of the microbial preparation, shaken for 30 minutes, and centrifuged at 10,000 rpm for 15 minutes to obtain a supernatant. 56 g of ammonium sulfate per 100 ml of the filtrate was added thereto, and the precipitate obtained by centrifugation at 10,000 rpm for 15 minutes was dissolved in a small amount of cold distilled water, dialyzed, lyophilized, and stored frozen. Each enzyme activity was measured using what was diluted to an appropriate concentration as a crude extraction enzyme solution. Chitinase activity and β-1,3-glucanase activity were colloidal chitin and lami as substrates using Tabatabai (1982). After reacting the laminin (laminarin) was measured using a spectrophotometer at 420nm and 550nm, respectively. Dehydrogenase activity was also measured using a spectrophotomer at 485 nm using Tabatabai (1982) method, and acid phosphatase activity and alkaline kinase (Alkaline activity) were also measured using Tabatabai (1982) method. The buffer was reacted with acid (pH 6.5) and alkali (pH 11), respectively, and measured using a spectrophotomer at 410 nm.

(1) Chitinase activity

As shown in FIG. 2, the chitinase activity in the compost according to the composting process increased initially during the composting process and then remained constant after about 2 months of progression.

(2) β-1,3-glucanase activity

As shown in Figure 3, β-1,3-glucanase activity in the compost according to the compost maturation process (β-1,3-glucanase activity) is constantly increased from the early to the middle of the composting process to some extent It remained constant after about two months of progress.

(3) Dehydrogenase activity

As shown in FIG. 4, the dehydrogenase activity in the compost according to the composting process increased constantly from the beginning to the end of the composting process.

(4) Acid phosphatase activity

As shown in Figure 5, the acid phosphatase activity in the compost according to the composting process was kept constant early in the composting process, but sharply increased after mid.

(5) Alkaline phosphatase activity

As shown in Figure 6, the alkaline phosphatase activity in the compost according to the composting process was kept constant from the beginning to the end of the composting process.

<Example 1>

A microbial formulation was prepared by mixing 1.0% of inoculant containing excellent chitin-degrading bacteria, such as unsterilized crab shell, vermiculite, rice straw, rice bran, and chitin (chitin) to examine the distribution of microorganisms in the prepared microbial formulation. colloidal chitin 10g, Na ₂ HPO ₄ 2g, KNO ₃ 0.5g, KH2PO4 1g, NH ₄ Cl 1g, MgSO ₄ 7H ₂ O 0.5g, CaCl2H ₂ O 0.5g, yeast extract 0.1g, agar 20g, distilled water 1ℓ ) Was cultured in a medium containing was determined. At this time, bacteria were inoculated in yeast extract agar (yeast extract 3g, glucose 1g, K ₂ HPO ₄ 0.3g, KH ₂ PO ₄ 0.2g, cyclohexamide 0.05g, agar 15g, distilled water 1L) and counted after 7 days. , Filamentous fungi were inoculated in Rose begal agar (1 g KH ₂ PO ₄ , MgSO ₄ · 7H ₂ O 0.5 g, peptone 5 g, glucose 10 g, rose bengal 0.033 g, streptomycin sulfate 0.033 g, agar 20 g, distilled water 1 L) Count after elapsed.

(Log10 CFU) mold Germ Chitin Degradation Microorganisms April 30 6.41 10.21 4.83 May 10 6.07 10.21 5.41 May 23 5.53 10.17 7.07 June 7 5.39 10.09 7.26 June 21 5.33 10.01 7.39 July 5 5.26 10.07 7.60 19 July 5.37 10.44 8.42 August 2 5.22 10.41 8.39

As shown in Table 5, microbial changes in the compost over time when the microbial agent stayed up decreased the colony number of microorganisms over time in fungi, while the colony of chitinase producing bacteria increased.

Example 2 Controllability Test on R. solani

After the microbial agent was extracted with 50 mM NaOAc buffer, the culture medium grown for 1 day under constant temperature (30 ^° C.) on LB medium was prepared. R cultured in 5 ml of the prepared solution and PDB (Potato Dextrose Broth 24g / l). 5 ml of solani were added at the same time and incubated at 27 ° C. for 3 days (up to here, the experiment was an optical microscope). The culture solution was filtered through a 0.2 μm filter paper, and then fixed on 2 ml of 1.25% glutaraldehyde and 1.25% paraformaldehyde (in 0.05 M cacodylate buffer pH 7.2) at 4 ° C. for 4 hours. The fixed samples were dehydrated with 50, 70, 90, and 100% ethanol for 15 minutes, and then washed three times with t-butyl alcohol for 15 minutes. After lyophilization for 24 hours. The lyophilized sample was coated in gold palladuim and then shown in FIG. 8 under a scanning electron microscope (HITACHI S-2400, JAPAN). In this case, in FIG. 8, A is a normal shape of R. solani , B is a R. solani ( In light microscope) modified in shape by a microbial agent, C is a normal shape of R. solani , and D is a shape by microbial agent. Modified R. solani ( In scanning electron microscopic). Please note that there is no experimental condition when adding R. solani here and In light microscope.

As shown in FIG. 8, R. solani in its normal state clearly maintains its appearance, but when the microbial agent of the present invention is contained, it can be seen that the mycelia of R. solani are short-circuited or severely damaged.

Example 3 Growth Inhibition Test for Pathogenic Nematodes

In order to examine the microbial treatment in the hatch of root gall nematode, the microbial agent was leached into 50 mM NaOAc buffer and incubated at 30 ° C. for 3 days in LB medium. 100 ul of culture (1.6 × 10 ⁷ cfu / ml) was mixed in 2 ml distilled water. Therefore, 87 nematode eggs were treated in 1 ml solution, and the test tube containing nematode eggs was incubated with shaking to blow air at 27 ° C for 7 days in an inverted microscope (ZEISS, Axiovert 135M). , germany) and shown in T1, T2, and T3 of FIG. On the other hand, hatching of nematode eggs in the distilled water-treated spheres as the control was shown in C1, C2, C3 of FIG. 9, respectively. In FIG. 9, C1 and T1 represent M. incognita eggs on day 0, C2, and T2 represent M. incognita eggs (primary juvenile) on day 4, and C3 and T3 represent M. incognita eggs (second juvenile) on day 7. Means.

In addition, the morphology of nematodes was changed when incubated with the microbial agent leaching solution and Meloidogyne incognita eggs, and is shown in FIG. 10 by SEM. At this time, A is the normal shape of the M. incognita egg in a normal state, B is M. incognita egg cultured with the microbial leaching solution , C is M. incognita egg cultured with the microbial leaching solution .

As photographed in FIG. 9, nematodes (C1, C2, C3) cultured in water form large larvae in stages over time, but nematodes (T1, T2, T3) grown with microbial agent cultures grow in size. It was found to be significantly inhibited compared to this control. On day 4, a partial eggshell deformation was observed, as indicated by the arrow. On day 7, the nematode showed no growth and the eggshell was completely destroyed.

In addition, as photographed in Figure 10, the microbial agent leaching solution is M. The strong attachment of incognita eggs causes them to lose their normal shape, which can be shown to inhibit growth.

Example 4 Pathogenicity Assay by Fertilizing with Soil when Microbial Preparation is Completed

After 2 weeks, peppers sown in 20-cell tray (125㎝ ³ / cell) were fertilized with a mixture of vermiculite: sand: soil 1: 1: 2 and then fertilized with microorganisms and commercial compost. It was formal. After 6 weeks in the greenhouse, keeping the temperature at 25 ~ 30 ℃ and 60 ~ 70% humidity, the microorganisms, microorganisms + pathogens, and commercial compost are finally inoculated by inoculating the pathogens into peppers fertilized with microorganisms and commercial compost. , Commercial compost + hospital group of pepper. At this time, the pathogen P. capsici KACC 40483 was incubated in V8 medium for 3 days at 30 ℃.

Sterile water was poured into the medium to produce a zygote sac and left at 25 ° C. for 3 days under fluorescent light. Spilled sterile water was released when placed in a refrigerator at 4 ℃ of cold (chilling temperature) for 1 hour, and stored at 25 ℃ for 30 minutes. Mycelia and sporangial residues were filtered with water through four layers of sterile cotton to remove Mycelia and sporangials. The strainer suspension is diluted to a proper inoculation concentration (1X10 ⁶ ml ^-1 ) in sterile water before inoculating the pepper, and then 5 holes per pot (1cm dia X 4cm deep) in the pot where the pepper is grown for 8 weeks. after embellish, it was swollen by 10 ml to each well (the method is described for forming a zoospore from station germs of Phytophthora capsici. fungus Phytophthora capsici, but inoculated by making a zoospore because it zoospore the infection of the plants on a culture medium Also, the reason for the inoculation into the pepper pot was to inoculate the pepper roots by inoculating the pot because the host was sick.

Crop sampling was performed at 0, 1, 3, 5, 7, 9 days after inoculation of pathogens. The sample was carefully washed with running tap water, and then rinsed with distilled water, and a photograph of growth including the roots of pepper crops is shown in FIG. 7, and then the weight of live, root lethality, activity of β-1,3-glucanase, chitinase activity, and rhizosphere. The persistence of the microorganisms in the soil was measured.

1) live weight measurement

As shown in FIG. 11, the root and stem biomass of commercial compost and microbial agent were higher than commercial compost + pathogen and microbial agent + pathogen. However, the biomass of the root and stem of the microbial agent + pathogen was 54% and 36% higher than those of commercial compost + pathogen, respectively. Therefore, it can be seen that the microbial agent protects the plant from the soil contaminated with late blight compared to commercial composting. (In FIG. 11, ▲ denotes a microbial agent, △ denotes a microbial agent + pathogen, ■ commercial compost, and □ commercial. Compost + pathogen.)

2) Root Mortality

The root mortality rate was 250 mg of the roots (live weight) in 50 mM phosphate buffer (pH7.4), 2,3,5, -triphenylterazoium chiloride, made 0.6%, and 5 ml was added. The roots were rinsed twice with sterile water. Formazan was extracted twice after soaking the roots in 95% ethanol for 4 hours at 70 ℃. After adjusting the final volume of the extract to 20 ml with 95% ethanol, the absorbance at 490 nm was measured and shown in Figure 12. (At this time, in Figure 12 ▲ is a microbial agent, △ is a microbial agent + pathogen, ■ Commercial compost, □ is commercial compost + pathogen.)

As shown in the graph of Figure 12, the root mortality rate of the commercial compost + pathogen treatment increased to 78% at 9 days of pathogen inoculation. In particular, on the 9th day of sampling, root rot was already developed as well as bleaching and bleaching on the leaves of commercial compost + pathogen treatment.

However, no symptoms were observed in the microbial treatment + pathogen treatment. Therefore, it can be seen that the microbial agent of the present invention antagonizes the pathogen.

3) Measurement of β-1,3-glucanase Activity in Soil

1 g of root root zone soil, 0.25 ml of toluene, 4 ml of 50 mM NaOAc buffer (pH 5.0), and 0.5 ml of laminarin 1.0 ml were mixed in a test tube at 37 ° C. for 2 hours. Thereafter, 1 ml of 0.5 M CaCl ₂ and 4 ml of 0.5 M NaOH were added and mixed well. After centrifugation at 3000 rpm for 20 minutes to remove the soil in the mixture, only the supernatant was filtered through Whatmant No. 2 filter paper. 500 μl of the filtered solution was added to 1.5 ml of Dinitrosalysilic acid (DNS), and then boiled in boiling water for 5 minutes to terminate the reaction. β-1,3-glucanase activity was measured for absorbance at 550 nm, and the standard curve was plotted in FIG. 13 by measuring the amount of glucose, a reducing end group produced from laminarin (where 1 unit of activity was 37 1 μmol of laminarin was defined as the amount of free enzyme for 1 hour at ° C. Also, ▲ is the microbial agent, △ is the microbial agent + pathogen, ■ is commercial compost, and □ is commercial compost + pathogen.)

As shown in FIG. 13, the amount of the enzyme liberating laminarin was measured in the microbial agent and the microbial agent + pathogen treatment group at about 0.65 to 0.7 unit, but the root mortality rate of the commercial compost + pathogen treatment group was measured at about 0.45 to 0.5 unit. . Therefore, it can be seen that the β-1,3-glucanase activity in the soil is excellent when using the microbial agent of the present invention.

4) Chitinase Activity

1 g of root root zone soil, 0.25 ml of toluene, 4 ml of 50 mM NaOAc buffer (pH 5.0), and 1 ml of 0.5% Colloidal chitin were mixed in a test tube at 37 ° C for 2 hours. Thereafter, 1 ml of 0.5 M CaCl ₂ and 4 ml of 0.5 M NaOH were added and mixed well. After centrifugation at 3000 rpm for 20 minutes to remove the soil in the mixture, only the supernatant was filtered through Whatmant No. 2 filter paper. 1.0 ml of Schales' reagent and 0.75 ml of filtered solution were added and then boiled in boiling water for 5 minutes to terminate the reaction. Chitinase activity was measured at 420 nm absorbance. The standard curve is a graph of Fig. 14 by measuring the amount of N-acetylglucosamine (NAG), a reducing end group generated from colloidal chitin (wherein 1 unit of activity releases 1 μmol of NAG for 1 hour at 37 ° C). In addition, ▲ is the microbial agent, △ is the microbial agent + pathogen, ■ is commercial compost, □ is commercial compost + pathogen.)

As shown in FIG. 14, the amount of NAG-releasing enzyme was measured in the microbial agent and the microbial agent + pathogen treatment group as about 0.9 to 1.1 unit, but the root mortality rate in the commercial compost + pathogen treatment group was about 0.3 to 0.5 unit. . Therefore, when using the microbial agent of the present invention, it can be seen that exhibits excellent Chitinase activity in the soil.

5) Measurement of the persistence of microorganisms in rhizosphere soil

The colony number of chitinase producing bacteria in the soil was measured by the activity of chitinase and β-1,3-glucanase in the root zone of red peppers fertilized with microbial agent and microbial agent + pathogen, commercial compost and commercial compost + pathogen. Indicated.

As shown in FIG. 15, the activity of about 6.8 to 7.4 Log 10 was measured in the soil of the microbial agent and the microbial agent + pathogen, but the activity of about 4.2 to 4.5 Log 10 was measured in the commercial compost and commercial compost + pathogen soils. The activity of the source soil of microbial and microbial agent + pathogenic pepper was about 2-3 times higher than that of commercial compost and commercial compost + pathogenic pepper. In particular, the chitinase and β-1,3-glucanase activity of the root soil of the microbial agent + pathogen pepper at 9 days after inoculation of the pathogen was 65% and 35% higher than that of the microbial agent.

Example 5 Tomato Blight Control Effect of Chitin Degrading Microorganism (Microbial Agent)

On July 12, 2002, about 20% of fungal late onset occurred in 400 pyeong of tomato growing house in Daejeon-myeon, Damyang-gun, Jeollanam-do. So this microbial agent was applied to the soil. Treatments were microbial treatment and non-treatment treatments were installed in three random egg mass method. Sampling was conducted from the 60th day and experiments were carried out until the 90th day at intervals of 5 days. The results of the photographing are shown in FIGS. 16 and 17, the incidence of wilting of tomato crops is shown in FIG. 18, and the chitinase activity is shown in FIG. 19.

As shown in the photographs shown in Figures 16 and 17, the tomato crop fertilized with the microbial agent of the present invention can be seen that the development state such as the size of the stem and leaf size is significantly developed compared to the untreated.

In addition, as shown in the graph shown in Figure 18, withering disease of tomato crop was measured from 60 days after fertilization, but the incidence was insufficient to be 25 days and showed an incidence of about 5% after 30 days. On the other hand, the untreated tomato crop showed an incidence of about 25% or more after the same 30 days.

In addition, as shown in the graph shown in Figure 19, it can be seen that the chitinase activity in the soil has about twice the activity compared to the untreated.

  Therefore, it can be seen that the microbial agent of the present invention induces high resistance to wilting disease of tomato crops.

<Example 6>

In May 2003, this microorganism was shaken on 400 pyeong of a kale planting house in Kim Sang-sik's Kail House, Dori Farm, Golden-ri, Dambuk-gun, Damyang-gun, Jeollanam-do, Korea. Live weight, dry weight, chloroplast, and number of leaves after each passage were measured, respectively, and are shown in Table 6, respectively. At this time, the population of this chitin-degrading microorganism was about 1 × 10 ⁷ viable cells / ml. Each test section was provided with the treatment section of the present invention and no treatment section.

Treatment date Live weight (g) (G) in building Chloroplasts (mg g ^-1 FW) ground game No treatment 3 weeks after meal 10.37 1.32 1.51 9.2 4 weeks after formality 19.00 1.99 1.47 10.2 Treatment group after culturing for one week 3 weeks after meal 17.71 1.88 2.23 11.6 4 weeks after formality 42.50 2.86 2.17 12.6

As shown in the photo of Fig. 20, the kale treated with the suspension solution using the microbial agent of the present invention can be seen that it has a large stem and a wide, many leaves visible to the naked eye as compared to the control.

In addition, as shown in Table 5, the kale treated with the suspension solution using the microbial agent of the present invention was increased to 7 ~ 23g in foliar fertilized treatment after incubation in vivo compared to the untreated, and also in the building compared to the untreated After incubation, more than 0.5-0.9 g of foliar fertilized treatments increased. In addition, the chloroplast content decreased slightly during the experimental period, but the chloroplast content was increased from about 32% to 2.23∼2.17 (mg) in the non-treated group compared to 1.51-1.47 (mg g ^-1 FW). g ^-1 FW), and the number of leaves increased by about 2 sheets in the leaf fertilized group after incubation compared to the untreated group.

  Therefore, it can be seen that the microbial agent of the present invention has an excellent effect on promoting the growth of kale crops due to the increase in live weight, dry weight, chloroplasts, and leaves.

<Example 7>

In May 2003, this microorganism was shaken on 400 pyeong of Yongseul-chae's cultivation house at Kimri-sik, Duri Farm, Golden-ri, Dukyang-myeon, Damyang-gun, Jeollanam-do, Korea. Live weight, dry weight, chloroplast, and number of leaves after the main passage were measured, respectively, and are shown in Table 7, respectively. The growth photograph after 1 week was shown in FIG. 21.

At this time, the population of this chitin-degrading microorganism was about 1 × 10 ⁷ viable cells / ml. Each test section was provided with the treatment section of the present invention and no treatment section.

Treatment date Live weight (g) (G) in building Chloroplasts (mg g ^-1 FW) ground game No treatment 3 weeks after meal 47.2 2.06 1.55 13.6 4 weeks after formality 57.6 2.62 1.52 15.4 Treatment group after culturing for one week 3 weeks after meal 113.2 6.46 2.55 21.4 4 weeks after formality 136.6 7.62 2.54 22.4

As shown in the photo of Figure 21, it can be seen that the kale treated with the suspension solution using the microbial agent of the present invention has a large stem and a wide and many leaves visible to the naked eye as compared to the control group.

As shown in Table 7, after the formulation, the agave treated with the suspension solution using the microbial agent of the present invention increased after cultivation, compared with the non-treated in vivo, increased 66 ~ 79g in foliar fertilized treatment, and also in the building After cultivation compared to the non-treated group, 4 ~ 5g or more increased in the foliar fertilized treatment group. In addition, the chloroplast content tended to decrease gradually during the experiment, but the chloroplast content was 1.55 to 1.52 (mg g ^-1 FW) in the untreated group, but the chloroplast content was increased from about 40% to 2.55 ~ 2.54 (mg g ^-1 FW), and the number of leaves increased by 7-8 sheets in the leaf fertilized group after incubation compared to the untreated group.

  Therefore, it can be seen that the microbial agent of the present invention has an excellent effect on promoting the growth of agave crops due to the increase in weight, dry weight, chloroplasts, and leaves.

As can be seen from the above detailed description, the plant disease control agent using chitin-degrading microorganisms extracted from the soil obtained for the present invention exhibits antimicrobial activity against various pathogens, thereby preventing the growth of pathogens as well as the nematode growth. It is very effective in controlling plant diseases because it has both a function as a preventive agent for preventing plant diseases and a function as a plant disease control agent.

delete

In addition, plant disease control agents can be used for any one selected from pepper blight, cucumber mozzarella, tomato wilted disease, soil fungus, and nematodes to improve resistance to pathogens.

In addition, since the microbial agent of the present invention is not pathogenic to the other crops, it can be used safely as a plant disease control agent, as well as promoting plant growth.

1 is a photograph of a single strain forming a single colony by smearing the soil containing abundantly crab shell in agar medium according to the present invention.

2 is a graph showing changes in chitinase activity in compost according to the microbial maturation process.

Figure 3 is a graph showing the change of β 1-3 glucanase activity (β 1-3, glucanase activity) in the compost according to the microbial maturation process.

Figure 4 is a graph showing the change in dehydrogenase activity in the compost according to the microbial maturation process.

5 is a graph showing the change in acid phosphatase activity in the compost according to the microbial maturation process.

Figure 6 is a graph showing the change in alkaline phosphatase activity in the compost according to the microbial maturation process.

Figure 7 is a photo of the growth of pepper crops.

Figure 8 is a photograph of the effect of the microbial agent on R. solani hypae.

Figure 9 is a microbial leaching solution photograph of the nematode Meloidogyne incognita eggs.

10 is a photograph of the change of nematodes, Meloidogyne incognita eggs incubated with a microbial agent leaching solution .

11 is a graph showing changes in live weight of leaves (A) and roots (B).

12 is a graph depicting changes in root mortality.

FIG. 13 is a graph showing changes in the activity of β-1,3-glucanase activity in soil.

14 is a graph depicting changes in the activity of chitinase in soil.

FIG. 15 is a graph showing the number of colonies of chitinase producing bacteria in the soil. FIG.

16 growth of tomato crops. Photographs of treatment and control treatments treated with microbial agents on crops contaminated with late blight.

17 shows growth of tomato crops. Photographs of treatment and control treatments treated with microbial agents on crops contaminated with late blight.

18 is a graph showing the incidence of wilting disease of tomato crops.

19 is a graph depicting chitinase activity in the soil of tomato crops.

20 is a photograph taken by sampling at 3 weeks after the formulation in kale.

Figure 21 is a photograph taken by sampling three weeks after the formulation in agave.

Claims (5)

delete delete delete Extracting the soil from the soil rich in crab shells and smearing on chitin medium; Separating the strains forming the zona pellucida on the colloidal chitin (colloidal chitin) medium containing the colloidal chitin into a single colony; Mixing the isolated strains and culturing again in a large amount of chitin liquid medium; Inoculating the cultured strains with a mixture of crab shell and agricultural by-products to form a microbial agent; Plant disease control using chitin-decomposing microorganisms, comprising the step of culturing the microbial agent until maturity index of 2. The plant disease control method according to claim 4, wherein the plant disease control agent is used for any one selected from pepper blight, cucumber mozzarella disease, tomato wilting disease, soil mold, and nematode.