KR100484124B1 - DNA Polymerases Having Modified Nucleotide Binding Site for DNA Sequencing - Google Patents

Abstract

The present invention relates to a modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates 20 times or more of the dideoxynucleotide relative to the corresponding deoxynucleotide relative to the corresponding naturally occurring DNA polymerase. will be.

Description

DNA Polymerases Having Modified Nucleotide Binding Site for DNA Sequencing

The present invention has been carried out with government assistance, including grant from the US Department of Energy, arrangement number DE-FG02-88ER 60688. The US government may have certain rights in the invention.

The present invention relates to DNA polymerases suitable for DNA sequencing and methods of automatic and manual DNA sequencing.

Hereinafter, related techniques for DNA sequencing techniques will be briefly described. It is provided only as a general guide to the understanding of the present invention, and does not admit that the specific technology recited herein, cited exemplarily or implicitly, is a prior art to the appended claims.

DNA sequencing generally involves the generation of four populations of single stranded DNA fragments having one defined end and one variable end. The variable termini generally terminate at a specific nucleotide base (any of guanine (G), adenine (A), thymine (T) or cytosine (C)). Four different sets of fragments are each separated based on their length, one process being performed on a high resolution polyacrylamide gel; Each band on the gel corresponds linearly to a specific nucleotide of the DNA sequence, thus identifying the location of the sequence of a given nucleotide base. See US Pat. Nos. 4,942,130 and 4,962,020 to Taber and Richardson.

There are two general methods of DNA sequencing. One method (macsam and Gilbert sequencing) involves chemical degradation of isolated DNA fragments, each labeled with a single radiolabel at its defined termini, and each reaction comprises four bases (G, A, T, C). Cause specifically defined degradation in one or more of Another method (dideoxy or chain termination sequencing) involves enzymatic synthesis of DNA strands. Sanger et al., Proc. Natl. Acad. Sci. USA 74: 5463, 1977). Four separate syntheses are generally performed and each reaction is caused to terminate at a particular base (G, A, T, or C) through incorporation of appropriate chain terminating nucleotides such as dideoxynucleotides. The latter method is preferred because the DNA fragments can be homogeneously labeled (instead of the terminal label) by the inclusion of radiolabeled nucleoside triphosphate and thus larger DNA fragments can contain more radioactivity in proportion to it. Do. In addition, ³⁵ S-labeled nucleotides are used in place of ³² P-labeled nucleotides, resulting in more sharp resolution; The reaction product is easy to interpret because each lane corresponds to only one of G, A, T, or C. Most enzymes used for dideoxy sequencing include T7 DNA polymerase and DNA polymerase isolated from thermophilic organisms such as Taq, Vent, Tth and the like. Other less used polymerases include AMV reverse transcriptase and Klenow fragment of E. coli DNA polymerase I.

In dideoxy chain termination, short single stranded primers are annealed to the single stranded template. This primer is extended at its 3'-end by incorporation of deoxynucleotides (dNMPs) until the incorporation of the dideoxynucleotides (ddNMP). When ddNMP is incorporated the kidneys are stopped at that base. Other chain terminators can be used in place of ddNMP and ddNMP can be labeled as described below.

Using the methodology above, an automated system for DNA sequencing has been developed. One device utilizes conventional dideoxy chain termination reactions with radiolabeled nucleotides as prepared by EC & G. The resulting DNA product is isolated by gel electrophoresis (Toneguzzo et al., 6 Biotechniques 460, 1988). The detector reads for radioactivity as it passes through the bottom of the gel. Not only are four synthetic reactions required for each template to be sequenced, but four lanes on each gel are required, and individual lanes are used for the product terminated by each specific chain terminator.

Kambara et al., 6 Biotechnology 816, 1988 used fluorescently labeled primers. The resulting fluorescently labeled product is laser excited at the bottom of the gel and fluorescence detected using a CRT monitor. This process also requires four synthetic reactions and four lanes for each template to be sequenced.

Applied Biosystems used four different primers, each producing a device labeled with a different fluorescent marker. Smith et al., 13 Nuc. Acid. Res. 2399, 1985; and 321 Nature 674, 1986. Each primer is used for a separate reaction containing one of four dideoxy nucleotides. After four reactions are performed, the mixtures are combined and the DNA fragments are fractionated in a single lane on the gel. A laser is used at the bottom of the gel to detect fluorescent products after they are electrophoresed through the gel. This system requires four separate annealing reactions and four separate synthetic reactions for each template, but requires only a single lane on the gel.

DuPont has provided a device in which a different fluorescent marker is attached to each of the four dideoxynucleoside triphosphates. (Prober et al., 238 Science 336, 1987). A single anneal step, a single polymerase reaction (including four labeled dideoxynucleoside triphosphates) and a single lane in the sequencing gel are required. Four different fluorescent markers in the DNA product are detected individually as they are electrophoresed through the gel.

Engert et al., US Pat. No. 4,707,235 (1987), detect labeled DNA products as they move through detector means in four separate lanes to identify the channel or lane where the sample is located. A multichannel electrophoretic device with detection means arranged substantially across the entire width of the gel is described. Preferably radioisotopes are used.

Essential to the processes currently used for DNA sequencing is the separation of DNA products labeled either radioactively or by fluorescence by gel permeation processes such as polyacrylamide gel electrophoresis and then to other axes along the axis of motion through the gel. There is a need to detect their location relative to the. The accuracy of this process is determined, in part, by the uniformity of the signal in the band, which passes approximately the same distance through the gel. Deviation or variability in signal strength between adjacent bands creates some problems. First, they lower the sensitivity of the method, which is limited by the ability to detect the band containing the weakest signal. Second, they cause difficulties in determining whether the band with the weak signal is a real signal by the incorporation of chain terminators or whether the polymerase is artificial due to a stop site in dissociated DNA. Third, they reduce the accuracy in determining DNA sequences between bands in adjacent space because a strong signal of one band shields its neighboring weak signal. See Taber and Richardson, supra.

Variability in band intensity results from the inherent properties of most DNA polymerases. Most DNA polymerases identify for chain termination dideoxynucleotides used in DNA sequencing. T4 DNA polymerase identifies for ddNTPs such that it cannot be used for DNA sequencing. E. coli DNA polymerase I, Taq, and Vent DNA polymerase also strongly identify ddNTP, each incorporating ddNMP 1000 times slower than the corresponding dNTP. Taber and Richardson, both of which are incorporated herein by reference, indicate that the T7 DNA polymerase is located at the other end of the spectrum to identify only a few fold ddNTPs. If DNA polymerase has identified ddNTP to the same extent in all sequences, this problem can be solved simply by changing the ratio of ddNTP to dNTP. Such an approach was made using E. coli DNA polymerase I and Taq DNA polymerase. However, the degree of identification varied with neighboring DNA sequences, which caused widespread variability in the intensity of adjacent radioactive fragments. The intensity of certain fragments varied 50-fold for E. coli DNA polymerase, but only several times for T7 DNA polymerase. As a result, the intensities of the bands on the DNA sequencing gels produced by T7 DNA polymerase have similar intensities to facilitate their detection and analysis by automated processes. It is also described how to further reduce the identification of dideoxynucleotides by T7 DNA polymerase so that it incorporates not only dideoxynucleotides but also deoxynucleotides. These methods and conditions likewise reduce but do not eliminate identification by other DNA polymerases such as Klenow and Taq DNA polymerases. For example, the use of manganese in place of or in addition to magnesium in the reaction mixture reduces or eliminates the identification for dideoxynucleotides. Under these conditions, T7 DNA polymerase cannot identify two molecules, while other DNA polymerases such as Klenow fragments, Taq and Vent still to some extent. Klenow, for example, identifies four times as many ddNTPs as the presence of manganese. Even though the overall degree of identification by enzymes such as Klenow and Taq DNA polymerases has been reduced, more importantly, the intensity of a particular fragment varies more than four times due to the high discrimination power of a particular sequence in the DNA. These polymerases and processes are now almost universally used for manual DNA sequencing (ie, without the aid of sequencers as described above), and are also widely used in automated methods. The use of manganese and lack of discrimination for ddNTP at all sites results in a band of uniform intensity, thus facilitating reading of the sequencing gel by either manual or automated processes. Moreover, the lack of identification allows the use of new methods for sequence analysis (see Taber and Richardson above). A method based on this finding is provided for determining DNA sequences in a single reaction containing all four ddNTPs at different rates by measuring the relative intensity of each peak after gel electrophoresis. The authors point out:

The DNA polymerase of the present invention does not significantly distinguish between dideoxynucleotide analogs and normal nucleotides. That is, the opportunity for incorporation of the analogues incorporates the analogues at approximately the same efficiency as that of the normal nucleotides or at least one tenth of that of the normal analogues. The polymerases of the present invention also do not significantly identify some other analogs. In addition to the four normal deoxynucleoside triphosphates (dGTP, dATP, dTTP and dCTP), this sequencing reaction is typically used for labeling strands synthesized using ³⁵ S, ³² P or other chemical agents. This is important because it requires the incorporation of other types of nucleotides such as radioactive or fluorescently labeled nucleoside triphosphates. When DNA polymerase does not identify analogs, the same possibility exists for the incorporation of analogs as for normal nucleotides. For labeled nucleoside triphosphates this is important for efficiently labeling DNA strands synthesized using minimal radioactivity. [4,942,130, COL 5: 5]

They also state that:

The ability to generate contiguous bands with approximately the same intensity is useful because it allows the result of any sequencing reaction to be read more easily with greater certainty. Moreover, because the DNA product from the sequencing reaction with a particular chain terminator forms a band with approximately the same intensity as that of adjacent bands, the band strength itself provides a specific level for the line of bands thus formed. The number of DNA products of approximately equal molecular weight produced by a given chain terminator varies with the concentration of the chain terminator. Thus, DNA products incorporating one chain terminator by using different concentrations of each of the four chain terminators for synthesis are identified from DNA products of approximately the same molecular weight that incorporate different chain terminators in number or amount. As a result, bands of DNA product can be identified for chain terminators simply by their strength relative to that of adjacent bands. As a result, two or more rows of DNA products, each row having a different chain terminator, gel permeated in a single lane and are distinguished from each other by identification, i.e., the strength of each band compared to the strength of adjacent bands. Moreover, the synthesis of DNA products incorporating different chain terminators need not be performed separately in separate vessels, only all of which may be performed in a single reaction vessel at the same time and require the same label, radioisotopes, fluorescence, etc. The lower surface can be used for all chain terminators instead of different labels for each, thus simplifying the process. [4,962,020, COL 3: 1-35].

In addition, Taber and Richardson's Proc shows that the substitution of magnesium ions with manganese ions for catalysis by T7 DNA polymerase or E. coli DNA polymerase reduces the identification of these polymerases to ddNTP by 4-100 times. . Natl. Acad. Sci. USA 86, 4076-4080 (1989) and Taber and Richardson, describing the use of pyrophosphatase and manganese ions to generate uniform intensity dideoxy terminated fragments using T7 DNA polymerase [J] . Biol. Chem. 265, 8322-8328 (1990).

Summary of the Invention

Applicants believe that the use of some DNA polymerases less for dideoxy DNA sequencing is due in part to the reduced ability of these polymerases to incorporate ddNMP (or other nucleotide analogues) instead of dNMP. As noted above, the ability to not identify allows the use of lower concentrations of ddNTPs than the identifying enzymes, most importantly providing a banding pattern in sequencing gels of more uniform intensity along their length. All these results make auto sequencing with enzymes easier and more productive in that long DNA sequences can be crystallized with high reliability.

The present invention provides a method for altering a DNA polymerase that is otherwise identifiable to identify less ddNTPs than the corresponding naturally occurring enzyme. This method involves genetically modifying the polymerase to alter amino acid residues at important positions to increase the ability of the polymerase to incorporate analogs of dNMP. Applicants have shown that amino acids changed in certain regions of DNA polymerase have a dramatic effect on the ability of these DNA polymerases to incorporate dideoxynucleotides; It was concluded that the specific amino acid residue inserted determines whether the polymerase has some discrimination with respect to ddNTP. Applicants have determined that modifying DNA polymerases to incorporate dideoxynucleotides more efficiently has a tremendous effect on their availability in DNA sequencing. Such modified DNA polymerases are also useful for other common molecular biological processes, such as DNA amplification (eg, polymerase chain reaction), in vitro mutagenesis, and filling at the ends of DNA fragments. It is possible to prove. Combination and sequencing of this technique with existing knowledge for altering the 3'-5 'exonuclease activity of DNA polymerase (e.g., T7 DNA polymerase as described by Taber and Richardson, above) The use of manganese and pyrophosphatase in the reaction will allow the production of enzymes significantly superior to what is known to date. Modification of DNA polymerase is preferably by substitution of one or more amino acids, but also by insertion of one or more amino acids or deletion of one or more amino acids.

In one particular aspect, ie, in DNA sequencing, thermophilicity having the ability to catalyze the polymerization of nucleotides at temperatures above 50 ° C. and in particular at temperatures above 60 ° C., 70 ° C. or even 80 ° C. under the conditions used for DNA sequencing. Enzymes are well known in the art. Such enzymes are generally known to be present in living organisms growing at these temperatures. However, Applicants believe that many of these enzymes suffer from limitations, including limited ability to incorporate dideoxynucleotides. By modifying these enzymes using the methods described below, one skilled in the art will be able to modify any desired thermophilic DNA polymerase to incorporate the dideoxynucleotide more efficiently. Such enzymes will be superior to those present to date for DNA sequencing in automated mechanical and manual sequencing, particularly in processes known as cycle sequencing. In cycle sequencing, multiple rounds of DNA synthesis are performed from the same template and the synthesized strands are removed by thermal denaturation after each cycle; This allows a smaller amount of DNA template to be used for DNA sequencing.

Applicants have experimentally determined that the amino acid residue 526 provides this property for the relatively non-identifying enzyme T7 DNA polymerase. Applicants concluded that modification of residue 526 is capable of increasing the ability of T7 DNA polymerase to identify many times. Based on amino acid homology between T7 DNA polymerase and other DNA polymerases, Applicants determined that modifications of residues at homologous sites in other DNA polymerases likewise affect their ability to identify for dideoxynucleotides. It was. Examples of such homology sites are residue 762 of E. coli DNA polymerase I and residue 667 of Taq DNA polymerase. In all three examples Applicants have found that the residue at this site differs from phenylalanine (F), ie it may be important that it can be tyrosine (Y) as in T7 DNA polymerase. Surprisingly, the modification of this single amino acid residue provides a very large difference (250-8,000 times) in the level of identification, even by the addition of a single hydroxyl group. Those skilled in the art will recognize that changes in this one site do not limit the present invention, and that changes in other sites that reduce the polymerase's ability to identify can now be readily found by routine experimentation. For example, Applicants have found that modification of T7 DNA polymerase at 13 different sites also resulted in an increased ability of the enzyme to identify ddNTPs, but the effect of alteration at these sites was about 5-20 times less. Was found. By using similar methods, other sites that affect the identification of ddNTPs will be readily identified in other DNA polymerases, making them more useful for DNA sequencing. Such other sites include amino acid residues in highly homologous regions between E. coli DNA polymerase I and T7 DNA polymerase, because these regions appear to partially complement the binding domain for ddNTPs; In E. coli DNA polymerase I these regions are those of T7 DNA polymerase from regions 665-681 and 754-783, and possibly from amino acids conserved or unconserved in regions 709-734, 797-866 and 913-927 To amino acids of similar regions. Amino acid changes to provide the desired function may be equally selected for the corresponding amino acid of a non-identifying enzyme such as T7 DNA polymerase or other functionally equivalent amino acids that may be selected by routine experimentation. By altering non-conserved amino acids, more profound alterations in the ability to identify are obtained. Non-conserved amino acids are those that vary from one species of polymerase to the other (ie, found in up to 50% of the polymerase). The term “homology” is used in its normally accepted manner. Thus, analogs of Pol I polymerase have an amino acid sequence as described by Brightwaite and Ito described below, which is different from the Pol I family of polymerases as described herein as Spo2 DNA polymerase. It is desirable to be involved in a member. Such analysis can be performed using Felsenstein's PHYLIP program. OK wind.

Thus, in a first aspect the invention is characterized by a modified gene encoding a modified DNA polymerase. This gene is modified to produce a modified DNA polymerase with increased ability to incorporate dideoxynucleotides relative to deoxynucleotides as compared to the corresponding naturally occurring DNA polymerase or unmodified DNA polymerase.

The term "extended ability" means that DNA polymerase can better incorporate a dideoxynucleotide. That is, they are identified to a lesser extent than the corresponding naturally occurring DNA polymerase for dideoxynucleotides as compared to deoxynucleotides. Special methods for measuring such identification are described below. The term "increased" is meant to provide a measurable difference in the ability to incorporate such dideoxynucleotides. In a preferred embodiment, it is preferred that the level of identification for dideoxynucleotides is reduced by at least preferably 10 to 100 times, more preferably 100 to 500 times, but at least 10% or more increase compared to naturally occurring enzymes. . An example of such an enzyme is E. coli DNA polymerase I (as noted herein) which identifies approximately 140-1,100 times the incorporation of dideoxynucleotides relative to deoxynucleotides. By the method of the present invention, an enzyme can be induced (by changing only one or two amino acids) which in fact prefers ddNTP over dNTP, ie, the ability of the polymerase to incorporate dideoxynucleotides by an average 1,000-fold increase. .

The phrase “corresponding naturally occurring DNA polymerase” is well known in the art and means a polymerase found in nature, which preferably is unaltered by either in vitro or in vivo manipulation in the laboratory. Do. Likewise a corresponding nucleic acid refers to a nucleic acid encoding a DNA polymerase found in nature. It is simply used as a baseline for comparison to modified nucleic acids encoding such polymerases. Thus, the baseline for the DNA polymerase of Thermus aquaticus (also referred to as "Taq") is a nucleic acid that naturally encodes Taq DNA polymerase present in bacteria, Termus aquaticus. Applicants provide one or more sites that can be altered in such polymerases to alter the polymerase's ability to incorporate dideoxynucleotides. These sites are simple examples, and those skilled in the art with the knowledge that the ability of DNA polymers may beneficially alter this property now provide a methodology for modifying such enzymes at either of these specific sites or other equivalent sites. It is not intended to limit the present invention.

In an embodiment of the invention described herein, the modification of the DNA polymerase is by substitution of one or more amino acids. However, it may also be found that modifications may take the form of insertion of one or more additional amino acids or deletion of one or more amino acids.

The DNA polymerase of the present invention is also referred to as 3'-5 'exonuclease activity as described by Taber and Richardson described above or 5 at Taq as described by Barnes (WO 92/06188). It can be modified to remove or alter exonuclease domains such as '-3' exonuclease activity. Mutations that alter the ability of the DNA polymerases of the invention to identify ddNTPs preferably do not substantially affect exonuclease activity; This means that the mutation is in the polymerase region of the enzyme near the active site for polymerization and does not reduce identification by simply reducing the ability of the polymerase to remove the incorporated analogs through its exonuclease activity. Particularly suitable DNA polymerases of the present invention are Pol I type polymerases described by Braithwaite and Ito, 21 Nuc. Acid. Res. 787, 1993 and referred to as Population A by the present disclosure. And polymerase alpha or polymerase II type-type DNA polymerases described by Brycew et al. And referred to as population B. Other populations of polymerases mentioned by Brycewight can also be used in the present invention. In particular, Applicants have found that the presence of polar, hydroxyl containing amino acid residues at positions near the binding site for dNTP substrates is important for polymerases that can efficiently incorporate dideoxynucleotides. Without wishing to be bound by any theory, Applicants note that this finding indicates that the high identification of nucleotides without hydroxyl groups at the 3 ′ position of the ribose moiety (ie ddNTP) indicates the simultaneous absence of hydroxyl groups on amino acid residues at this critical site. It is believed that it is opposed to the expected result. In other words, gaps or holes formed by the absence of two hydroxyl groups result in the identification of analogs. Knowledge of these results provides an approach to discover important residues even in far-relevant DNA polymerases; The addition of residues having polar groups to nonpolar groups in the region where dNTPs bind is a possible amino acid change to reduce the polymerase's ability to identify for ddNTPs. For example, phenylalanine at position 272 of mouse DNA polymerase b, which is a DNA polymerase with little homology to population A or B polymerase, is a three-dimensional complex with primer-template in X-ray diffraction studies. At the 3 'position of the ddCTP residue at. (Pelletier et al., 264 Science 189, 1994). With the knowledge of the results described herein, the modification of this residue to tyrosine is logically selected for the screening of mutations in murine DNA polymerase that incorporate dideoxynucleotides more efficiently. Thus, it will be apparent to one skilled in the art that the information provided herein can be used to alter the discriminative phenotype of any DNA polymerase.

The ability of some polymerases of the invention to incorporate dideoxynucleotides more efficiently may be specific (ie, the effect on dideoxynucleotide analogs is greater than on other analogs). However, some of the polymerases also have other modified analogues (eg, deoxyinosine triphosphate (dITP) to decompress the band during electrophoresis, and 2′-deoxy-7-deazaguanosine 5′-). It may be useful to assist in the incorporation of triphosphate (dc ⁷ GTP) and fluorescently labeled deoxynucleotides and dideoxynucleotides for use in automated processes. In addition, such polymerases allow more efficient incorporation of ribonucleotides, thus allowing the synthesis of RNA without the need for a promoter. Specifically, the conserved motifs between a single subunit DNA dependent RNA polymerase such as T7 RNA polymerase and the DNA polymerase of population A (Pol I-type DNA polymerase) are defined in this region (E. coli DNA polymerase I). Mutations at residues 758 to 767) alter the specificity for rNTP. This allows the engineering of RNA polymerase to efficiently initiate synthesis from primers, which eliminates the requirement for promoters for the synthesis of RNA. Similarly, the data provided herein suggest that modifying residues 631-640 of T7 RNA polymerase will alter its specificity for dNTP. This initiates the neosynthesis of DNA from the promoter sequence and allows engineering of new DNA polymerases in which primers cannot be used.

In a preferred embodiment, the modified DNA polymerase is used with sufficient DNA polymerase activity (ie, at least for standard sequencing reactions) for use in DNA sequencing (in combination with any host factor required for DNA polymerase activity). And preferably at least 100 units / mg as defined in the art, and preferably the mutation in the polymerase does not alter the previous level by 5-10 fold or more); It is possible to use polymerase for DNA sequencing with sufficiently low exonuclease activity (ie less than 500 units / mg, see Taber and Richardson supra); DNA polymerase contains one or more amino acids (ie, selected from the group consisting of T7, T3, ØI, ØII, H, W31, gh-1, Y, A1122 and SP6) at the dideoxynucleotide binding site of the T7 DNA polymerase. Have Preferably, the modified DNA polymerase is thermus aquaticus, thermus thermophilis, thermus flavus, the Bacillus sterothermophilus and the vent. ) Modified from thermostable DNA polymerase such as DNA polymerase encoded by bacteria; The ability of the polymerase to incorporate dideoxynucleotides increases at least, 10 times, 50 times, or more preferably at least 100 times compared to the corresponding naturally occurring DNA polymerase by a change of only one amino acid.

In a second aspect, the invention features a method of producing a modified DNA polymerase that has an increased ability to incorporate dideoxynucleotides relative to the ability of a corresponding naturally occurring DNA polymerase. The method comprises providing a nucleic acid encoding a DNA polymerase, mutating or otherwise altering the nucleotide base sequence of the nucleic acid molecule to include one or more base changes in the base sequence at one or more sites to include the polymerase encoded by the nucleic acid. Significantly altering (ie, at least 10, 50, or most preferably 100-500-fold) the ability to incorporate a dideoxynucleotide of.

In a third aspect, the present invention provides a method for determining the nucleotide base sequence of a DNA molecule. The method comprises providing a DNA molecule annealed with a primer molecule that can hybridize to the DNA molecule; And a DNA polymerase with altered ability to incorporate an annealed molecule from one or more dideoxynucleoside triphosphates, naturally occurring DNA polymerase to incorporate a dideoxynucleotide as compared to a naturally occurring polymerase (the polymerase is a DNA sequencing Incubating in a vessel containing sufficient DNA polymerase activity and sufficiently low exonuclease activity to be used. Also provided are one or more DNA synthesis terminators that terminate DNA synthesis at a particular nucleotide base. The method further includes separating the DNA product of the incubation reaction according to size, so that at least a portion of the nucleotide sequence of the DNA molecule can be determined.

In a preferred embodiment, the DNA polymerase is a thermostable DNA polymerase, sequencing is performed at a temperature of at least 50, 60, or 70 ° C., and the DNA polymerase is Thermus aquaticus, Termus. Thermus thermophilis, Thermus flavus, Bacillus sterothermophilus, Thermococus litoralis [Vent], Pyrococcus furiosis furiosis, Pfu) or those encoded by Sulfobus solfataricus (ie have at least 50% identity to amino acid residues).

In another preferred embodiment, the DNA polymerase has an exonuclease activity of less than 1000, 250, 100, 50, 10 or even 2 units per mg of polymerase, and also contains only 4, 6 or 10 bases. It is possible to use primers having; The concentration of all four deoxynucleoside triphosphates at the start of the incubation step is sufficient to continue DNA synthesis until terminated by reagents such as ddNTP.

For cycle sequencing, it is now possible for the polymerases of the present invention to use significantly lower amounts of dideoxynucleotides as compared to other enzymes. That is, the method includes providing excess dideoxynucleotides for all four dideoxynucleotides in a cycle sequencing reaction, and performing a cycle sequencing reaction. For other enzymes, it was necessary to add an excess of one or more ddNTPs to these reaction solutions. For example, Sears et al., 13 BioTechniques 626, 1992 describe the use of an approximately 10-fold excess of ddNTP relative to dNTP using vent polymerase, see Carothers et al., 7 BioTechniques 494. , 1989 describes the use of an excess of about twice the amount of ddNTP relative to dNTP using Taq polymerase. In the present invention, such excess is not necessary. Preferably an excess of 2, 5 or more or even 10 times the dNTP is provided to the corresponding ddNTP. In a specific example, less than 10 M ddNTPs are used with the modified Taq of the present invention.

In a related aspect, the present invention comprises a reagent for sequencing selected from the group consisting of a modified DNA polymerase as described above, dITP, deaza-GTP, ddNTP and the like, and a manganese containing solution or powder. Characterized in kits or solutions for DNA sequencing.

In another aspect, the invention provides a corresponding naturally occurring DNA by providing a nucleic acid sequence encoding a modified DNA polymerase, expressing the nucleic acid in a host cell and purifying the DNA polymerase from the host cell. It is characterized by a method of providing a modified DNA polymerase that has an increased ability of incorporating dideoxynucleotides as compared to a polymerase.

In another aspect, the invention essentially comprises one or more (preferably two, three or four) deoxynucleoside triphosphates, DNA polymerases as described above, and Characterized by methods of sequencing using single chain terminators. This DNA polymerase causes the primer to elongate so that each first DNA product has a chain terminator at its extended end, and the number of molecules of each first DNA product differs only 20 bases in length from substantially all of the DNA. The lengths of the stretched primers, which are approximately the same for the product, cause the first rows of different first DNA to form. The method also allows the DNA polymerase to cause the production of a second family of second DNA products that differ in length of the stretched primer, with each second DNA having a second chain terminator at its extended end. It is characterized by providing a second chain terminator in the hybridization mixture at a different concentration than the first chain terminator. The number of molecules of each second DNA is about the same as in substantially all second DNA products that differ in length from 1 to 20 bases, all of which differ in length from only 20 bases from that of the second DNA product. The number of molecules of the first DNA is clearly different.

In a preferred embodiment, three or four of these chain terminators can be used to prepare different products as described in the Taber and Richardson literature; The sequencing reaction is provided with magnesium ions, or even manganese or iron ions (eg, at a concentration of 0.05-100 mM, preferably 1-10 mM); DNA products are separated according to molecular weight in less than four lanes of the gel.

In another related aspect, the invention relates to oligonucleotide primers, nucleic acids to be sequenced, 1 to 4 deoxynucleoside triphosphates, polymerases as described above, and different amounts of at least two chain terminators. A feature is a method of sequencing nucleic acids by combining under conditions that favor extension of the primers to form nucleic acid fragments that are complementary to the nucleic acid to be sequenced. The method further includes separating nucleic acid fragments by size and determining nucleic acid sequences. The reagents are distinguished from each other by the strength of the label in the primer extension product.

While it is common to separate DNA of DNA sequencing reactions using gel electrophoresis, one skilled in the art will recognize that other methods may be used. Thus, it is possible to detect each of the different fragments using methods such as time of light mass spectroscopy, electron microscopy and single molecule detection methods.

The invention also features an automated DNA sequencing device having a reactor comprising a reagent that provides a DNA product of at least two rows formed from a single primer and a DNA strand. Each row of DNA products has a different molecular weight and has a chain terminator at one end. The reagent contains the DNA polymerase as described above. The apparatus includes separation means for separating the DNA product along one axis of the separator to form a row of bands. It is also separated from the position and intensity of the band along the axis, not from the emission wavelength of the light from any label that may be present in the band decoding means and separation means for determining the position and intensity of each band. Computerized means for determining the DNA sequence of the DNA strand.

In another aspect, the invention provides (a) in vitro of cloned DNA fragments by providing the cloned fragments and DNA polymerases described above and contacting the cloned fragments with polymerase under conditions for synthesizing DNA strands from the fragments. Mutagenesis methods (this condition results in the formation of DNA strands by incorporation of a plurality of individual contiguous bases that may be base paired with fragments and by incorporation of nucleic acid bases that are not base paired with fragments); (b) providing an in vitro mutation of the template DNA fragment by providing a primer and a template having adjacent bases capable of base pairing with adjacent bases of the template except at least one base that the primer cannot base pair with the template Method (this method comprises stretching the primer with a DNA polymerase as described above); (c) A method of producing a blunt-ended, double-stranded DNA molecule from a linear DNA molecule having a 5 'end with a single-stranded region (the 3' end of the molecule is double stranded and has no 3 'overhanging end.) Incubating the DNA molecule with a DNA polymerase as described above acting on a single stranded region to form blunt-ended double stranded DNA molecules.); (d) labeled deoxynucleotides under conditions where a DNA fragment having a DNA polymerase as described above is labeled by adding a labeled deoxynucleotide to the DNA fragment by extension of the 3 ′ end of the DNA fragment to the polymerase. Labeling the 3 'end of the DNA fragment by incubating with the species; And (e) annealing the first and second primers to opposite strands of the double stranded DNA sequence and incubating the annealed mixture with the DNA polymerase as described above. The first and second primers are annealed to opposite strands of the DNA sequence and their 3 'ends are facing each other after annealing, and the DNA sequence to be amplified is located between the two annealed primers.

In another aspect, the invention provides a position similar to the Termus aquaticus DNA polymerase with tyrosine at residue 667, E. coli DNA polymerase I with tyrosine at residue 762, and E. coli DNA polymerase residue 762, For example any Pol I-type DNA polymerase having a tyrosine residue at the N ₄ position of KN ₁ N ₂ N ₃ N ₄ N ₅ N ₆ N ₇ YG (where each N is independently any amino acid); It is characterized by certain DNA polymerases. Moreover, the present invention relates to the sequence KN ₁ N ₂ N ₃ N ₄ N ₅ N ₆ YG / Q wherein each N is independently any amino acid and any one of N ₁ to N ₇ is mutated to ddNTP. Characteristic of a specific polymerase of the DNA polymerase alpha population with a reduced (preferably a polymerase with a discernment that is reduced by at least 20 times compared to nonmutated sequences). The invention is also characterized by nucleic acids encoding any of these DNA polymerases.

In a related aspect, the present invention identifies an incorporation of ddNMP as less than 100 times or uniquely added divalent compared to dNMP with an average processivity of less than 100 in the presence of magnesium as the only added divalent cation. It is characterized by DNA polymerases except reverse transcriptase which has an average degree of treatment of less than 50 in the presence of magnesium as a cation and identifies less than 50 times the incorporation of ddNMP as compared to dNMP. Those skilled in the art will appreciate that the throughput can be determined by any standard method indicating that the average throughput of T7 DNA polymerase is 500 or less, the Klenow fragment is about 4-40, and for reverse transcriptase this is about 150-100. Will recognize. Such measurements are described in Taber et al., J. Biol. Chem. 262: 16212, 1987). Under these conditions, the average degree of treatment of Taq DNA polymerase is expected to be less than 100.

In a particularly preferred aspect, the present invention identifies ddNMP in a ratio of less than 100 compared to dNMP, for example in the presence of magnesium, preferably with an average degree of treatment of less than 100 and at least once per 1 or even 10 seconds. It is characterized by thermophilic DNA polymerase having a cycle from primer-template to another. Such cycles can be measured by standard methods.

The present invention is also characterized by a method of cycle sequencing using DNA polymerase as described below, and also tyrosine instead of naturally occurring amino acids at positions that cause the polymerase not to identify ddNMP 50 times or more relative to dNMP. Cellular (as opposed to those of viruses or mitochondria) with DNA is characterized by DNA polymerase.

In another aspect, substitution of amino acids at the sites of interest will result in altering other properties of the corresponding natural polymerase. The polymerases of the present invention may also be combined with other polymerases in the methods described herein to take advantage of the superior properties of each polymerase in the mixture.

Other features of the present invention will become apparent from the following description and claims relating to its preferred embodiments.

First, the drawings will be briefly described.

<Drawing>

1 is a schematic diagram of the amino acids of DNA polymerase encoded by gene 5 of bacteriophage T7, showing the location of palm and finger domains and the location of various dideoxy resistant (DR) mutations, the region labeled with AE. Location and location of one site involved in ddNTP identification;

2 is a three-dimensional view of the structure of DNA polymerase I showing regions A-E;

FIG. 3 is a schematic diagram of riboselectivity regions of Pol I-type DNA polymerase having amino acids represented by a common single letter code. The initial amino acid number is shown on the left side of the figure, and the discernment amount for dideoxynucleotide compared to the deoxynucleotide is shown on the right side;

4, 5 and 6 are schematic diagrams showing modification of riboselective regions of E. coli DNA polymerase I, T7 DNA polymerase and Taq DNA polymerase, respectively.

Dideoxy resistant mutants

Some relevant publications are briefly described below. They do not recognize anything as prior art, but are provided to aid the understanding of the present invention.

Reha-Krantz et al., At a meeting under the title "The Fidelity of DNA Synthesis: Structural and Mechanistic Perspectives" held in Beaufort, North Carolina, September 24-29, 1989. C-terminal mutants with increased availability of ddNTPs are described in the Mutual Analysis of Bacteriophage T4 DNA Polymerases from the abstract of the presented poster presentation. However, Reha-Krantz et al., J. Virology 67, 60-66 (1993) found that Ki for ddGTP was 50-fold lower in mutant L412M compared to wild-type T4 DNA polymerase, whereas It was pointed out that no difference was found between mutant and wild type T4 DNA polymerase in incorporation efficiency. On page 63, it is stated that "despite the sensitivity of L412M DNA polymerase to ddGTP, no difference was found in the incorporation of ddNTP by wild type and L412M DNA polymerase." It also states that "any single region does not appear to be the binding site alone for either PPi mutant or nucleotide". See also Reha-Krantz and Nonay, J. Biol. Chem. 269, 5635-5643 (1994) provided a study on mutant L412M and other mutant T4 DNA polymerases.

Gibbs et al., Proc. Natl. Acad. Sci. USA 85, 6672-6676 (1988)] and Larder et al., The EMBO Journal 6, 169-175 (1987)] describe a number of nucleotide analogues: pyrophosphate, phosphonoacetic acid, vidarabine, gancyclovir and The mutation spectra obtained from herpes DNA polymerases when screening for resistance to bromovinyldeoxyuridine are described. It states that the majority of mutants resistant to one drug were also resistant to the other drug even when they were analogs to different regions of the substrate.

Durse et al., Derse et al., J. Biol. Chem. 257, 10251-10260 (1982) describe five mutants for herpes simplex DNA polymerase isolated by selection for growth in the presence of phosphonoformic acid, pyrophosphate inhibitors. For each type of mutant, they compare resistance to ddGTP (Table 10256, Table III). All had a 20 to 100-fold increase in Ki for ddGTP.

Prasad et al., Prasad et al., Proc. Natl. Acad. Sci. USA 88, 11363-11367 (1991), employs a direct screening method, and a single mutation (change of Glu 89 to Glycine) in HIV reverse transcriptase is more resistant to ddGTP (to obtain the same degree of inhibition). At least 10-fold ddGTP). This mutation provides a wide range of resistance to many analogs, including phosphono formic acid, pyrophosphate analogs. Mutants were equally resistant to ddTTP, ddCTP, ddGTP, while less resistant to ddATP.

Song et al., J. Virol. 66, 7568-7571 (1992) mutated Glu-89 of human immunodeficiency virus type I reverse transcriptase to nine different amino acid residues and measured the resistance of each mutant to ddGTP and phosphonopractic, pyrophosphate analogs. Doing. Mutations belonged to two classes; Substitution of Glu-89 with alanine, glycine, valine or threonine resulted in an enzyme that is highly resistant to both ddGTP and phosphonopric acid compared to wild-type enzymes, whereas mutations to serine, glutamine, asparagine, asparagine and lysine This resulted in an enzyme that was only suitable or not resistant to ddGTP. None of the mutants resulted in enzymes that were less resistant to ddGTP than wild type enzymes (Table I, page 7569). The authors speculate that the 89th and 90th residues of the reverse transcriptase form part of the dNTP binding pocket based on their results and the crystal structure of the reverse transcriptase.

Magazines relating to the properties of E. coli DNA polymerase I mutant proteins with mutations in the vicinity of the mutations that resulted in ddNTP selectivity include:

Carroll et al., Biochemistry 30, 804-813 (1991) describe two mutants; Tyr766Ser and Tyr766Phe are being studied for misincorporation of normal deoxynucleotides. Poleski et al., Polesky et al., J. Biol. Chemistry, 265, 14579-14591 (1990) characterize mutations with two different properties: (1) tyrosine 766, arginine 841 and asparagine 845; The authors suggested that these residues are in contact with the incoming dNTPs. (2) Glutamic Acid 849, Arginine 668, and Aspartic Acid 882, the authors suggest that it is involved in catalysis. Poleski et al., Polesky et al., J. Biol. Chemistry, 267, 8417 (1992) further characterizes mutations in arginine 668, glutamine 849, and aspartic acid 882 and mutations in aspartic acid 705 and glutamic acid 710 as well. In this study, the authors observed the incorporation of analogs in the alpha-thio substituted dNTP, ie phosphate moiety. Panday et al., J. Biol. Chem. 269, 13259-13265 (1994) observed two mutations in E. coli DNA polymerase I that transforms lysine 758 into alanine and arginine. The authors point out that Basu et al., Biochemistry, 26, 1704-1709 (1987) imply the same lysine 758 in dNTP binding. This has been found chemically; DNA polymerase I was modified using pyridoxal 5'-phosphate, nucleotide analogues and lysine 758 was said to be a modified residue.

Beads et al., Biochemistry, 321, 14095-14101 (1993) describe the structure of the cocrystal of the Klenau fragment of DNA polymerase I complexed with dNTP or pyrophosphate. The authors state that dNTPs bind adjacent to helix O. The authors make the following statement: (a) For the Mg-dCTP complex, cytosine interacts with His 881, while sugar interacts with Phe 764 (FIGS. 3 and 5). ) ". (b) "But I concluded that the location of at least the dNMP portion of dNTP in the two complexes would not be the same as in the catalytically relevant complex with the primer-template DNA". (c) "Because the entire binding site for the base of dNTP is formed by its Watson-Crick hydrogen bonding to its stacking on the 3 'base of the template strand and the primer strand, binding to the base in the two complexes The site does not seem to be entirely accidental, consistent with their observation that it is bound at several positions depending on the condition ". (d) "Binding sites for dNTPs observed in the determination of these binary complexes are as observed in the dissolution studies. However, estimation of the model for complexing dNTPs in the presence of primers and template DNA from the binary complexes. Requires careful attention. I speculate that the sugar and base portions of dNTPs require primer-template DNA to bind in the correct shape ”.

Joyce and Steitz, 63 Ann. Rev. Bioc. 777, 1994, not recognized as prior art for the present invention, discusses the relationship between various DNA and RNA polymerases. It points out three functions for the "palm" (rather than "finger") subdomain of DNA polymerase I-the catalytic center, the binding site to the 3 'end of the primer and the dNTP binding site. For HIV-1 reverse transcriptase, this indicates that mutations affecting the binding of DNA polymerase inhibitors are around residues 67-70. It also states that "although there was no useful conclusion from the location of the nucleotide base of the sugar, the crystalline binary complex is likely to be information in identifying the contact between the Klenau fragment and the dNTP phosphate group." In the preceding sentence, it states that "even though a polymerase-dNTP binary complex may be formed, such a composite is not catalytically qualified." The data also indicate that “deoxyribose is located proximate to Phe 762” and “mutations of Tyr 766 [in the Klenau fragment helix O] located in the finger domain in the vicinity of the model-assembled template strand are deoxy and dide Will affect the oxy nucleotide substrate. " However, this also indicates that in the Klenow fragment, mutations that have been found to affect the binding of dNTPs in the three-dimensional complex (reflected in K _{m (dNTP))} are in the polymerase cleft in or close to the finger domain. The identified positions are located at the N-terminus of Helix O (Arg 841 and Asn 845), the exposed surface of Helix O (Tyr 766, Phe 762, and Arg 754) and the residues in the vicinity of the catalytic center. (Asp 705 and Glu 710) The advantage of the kinetic approach is that it demonstrates a three-dimensional complex; however, as described above, mediated via template interaction in the absence of other structural evidence. It is impossible to distinguish the direct effects from these, moreover, the side chains listed above cover a much larger area than dNTP molecules and therefore not all can be in direct contact with them. Since believed that a broad range of contact with the region of the implicit Klenow fragment template strand, a reasonable interpretation is that, while a subset of the residues are in direct contact with the dNTP, template DNA combined with the rest ".

Conversely, Pelletier et al., 264 Science 1891 and Sawaya et al. (Sawaya et al., 264 Science 1930, 1994, which are not recognized as prior art to the appended claims) are described by Polβ. Residues 271-274 in helix MN (similar to helix JK of Polna's Polβ) point out that "perform a common function, nucleotide identification".

Sosa et al. (Sausa et al., 364 Nature 593, 1993, these are not recognized as prior art to the appended claims) describe the three-dimensional structure of T7 DNA polymerase and its image for E. coli DNA polymerase I. Describes same sex. These observations indicate that "the C-terminal elements of the KF [Klenau fragment] (b-strands [residues 916-928] and C-terminal) contact the deoxyribose portion of dNTP during polymerization to identify rNTP and dNTP substrates. Ham ".

Dideoxynucleosides, such as dideoxythymidine, are potent inhibitors of T7 phage growth. Experiments indicate that inhibition of DNA synthesis is the result of incorporation of dideoxynucleotides into T7 DNA. Dideoxynucleotides do not have inhibition against uninfected E. coli. I do not know the reason for the lack of E. coli DNA synthesis, but this can be explained by the high level or efficient elimination of the uptake of cells, their identification by E. coli DNA polymerase III. In any case, we find that T7 mutant phage occur at a frequency of approximately 10 ⁻³ that can produce normal plaques on agar plates containing dideoxynucleotides. The location of the majority of these mutations is shown in FIG. 1. They are present in gene 5 protein. Mutant gene 5 proteins are more (multiple) identifiable for ddNTPs than native gene 5 proteins. The circles of some of this class of mutants can depict regions of the polymerase that are important for the recognition of the ribose portion of dNTP.

It is important to note that the mutations obtained by this selection using dideoxynucleotides are based on alteration of the region of gene 5 protein that recognizes the ribose moiety. However, such mutations can also have dramatic effects on other nucleotide analogues. It is also possible to use the same method to select other T7 mutants that strongly identify other nucleotide analogues based on phage growth in the presence of other analogues.

Regarding Table 1, various DR mutants with amino acid substitutions reported in the table are shown. This amino acid substitution is further characterized on the right hand side of the table. The locations of these mutations are shown in FIG. 1 across the palm and finger regions of T7 DNA polymerase. The tum region is an elastic region that interacts with the minor grooves of the product duplex DNA; The palm region is the catalytic center, the binding site to the 3 'end of the primer and contributes to dNTP binding; Finger regions interact with the ss template proximal to the synthesis site and contribute to dNTP binding. These mutations are highly scattered throughout the polymerase and all have a relatively small impact on incorporation of the dideoxynucleotides, which reduces the ability to incorporate the dideoxynucleotides by about 5-20 fold. In addition, some of these mutations are located in regions that are relatively heterologous to DNA polymerase I. Thus, they do not provide an indication of the location of the site in other Pol I enzymes involved in ddNTP identification.

Mutation Isolate number             transform DR1 One Ala 425 Thr Hydrophobic Polarity DR2 One Phe 434 Ser Hydrophobic Polarity Gly 442 Ser Hydrophobic Polarity DR3 One Val 443 Ile Hydrophobic Hydrophobic DR4 2 Arg 444 His Strongly Inflammatory DR5 One Arg 444 Cys Strong Base Neutral, Polar DR6 8 Ser 477 Phe polar hydrophobic DR7 4 Asp 504 Asn Basic Neutral DR8 2 Ala 513 Thr Hydrophobic Polarity DR9 2 Thr 517 Ile polar hydrophobic DR10 One Ala 532 Ser Hydrophobic Polarity DR11 One Arg 566 Cys Strong Base Neutral, Polar DR12 One Ala 619 Thr Hydrophobic Polarity DR13 3 Ala 700 Thr Hydrophobic Polarity Summary 7 Hydrophobic Polarity3 Strong Basic Neutral, Polar or Weak Basic2 Polarity Hydrophobic1 Hydrophobic Hydrophobicity

Mutagenesis in vitro

 In vitro mutagenesis of cloned gene 5 of T7 was used to construct Gene 5 protein in which different regions of E. coli DNA polymerase I were replaced with similar or homologous regions of T7 gene 5 protein. As discussed, they were particularly interested in determining the ability of these enzymes to incorporate nucleotide analogs and the extent to which they identify these analogs. With reference to FIG. 2, the region where a hybrid between T7 DNA polymerase and E. coli DNA polymerase I was made is represented by regions A-E.

In connection with FIG. 3, we have determined that region C provides a riboselective region with a significantly greater effect than other regions in the polymerase.

4-6 (and Table 2), substitution of amino acids in this region was determined to allow for the conversion of riboselectivity of the polymerase from E. coli DNA Pol I type to T7 DNA polymerase type and vice versa. Thus, targeted mutations of this region of the Pol I-type polymerase can significantly alter the riboselectivity of the polymerase. The level of this effect is at least 50-100 times and usually 500 times.

DNA polymerase

DNA polymerases useful in the present invention include those belonging to the class of homologous polymerases designated "Pol I-type DNA polymerases" comprising T7 type DNA polymerases, large fragments of E. coli DNA polymerase I and Taq polymerases. Include.

DNA polymerases usable in the present invention include those belonging to the class of homologous polymerases including T7 type DNA polymerases (eg, T7, T3, ØI, ØII, H W31, gh-1, Y, A1122 or SP6). Include. Homologous polymerase means an enzyme as described in Delarue., Protein Eingineering 3, 461-467 (1990), which shows the arrangement of Pol I populations of DNA polymerase. It also shows the arrangement of Table 2. Table 2 shows the effect on the identification of ddNTPs of domain exchanges between E. coli DNA polymerase I, T7 DNA polymerase and Taq DNA polymerase in Helix O. The sequence of three polymerases appears at the top and the number of the first residue is shown. Just below the consensus sequence of these three polymerases, a characteristic mutation was shown in T7 DNA polymerase (T7), E. coli DNA polymerase I (Pol I) and Taq DNA polymerase (Taq), underlining the mutated residues. I did. Each mutant was tested for relative incorporation of ddNMP to dNMP by SDS active gel analysis as described in Example 2 and shown on the right. Mutants T7 C-T8, Pol I C-K6 and Taq C-Q5 were further analyzed by purification with wild type protein.

ddNTP

Enzyme Sequence Identification

Pol I 754 R R S A K A I N F G L I Y G High

Taq 658 R R A A K T I N F G V L Y G High

T7 517 R D N A K T F I Y G F L Y G low

Common R A K G Y G

T7 WT R D N A K T F I Y G F L Y G Low

T7 C-T2 R RS AK AINF G LI YG High

T7 C-T3 R RS AKTFIYGFLYG Low

T7 C-T4 RDNAK AINF GFLYG High

T7 C-T5 RDNAK AI IYGFLYG Low

T7 C-T6 RDNAKTF NF GFLYG High

T7 C-T7 RDNAKTF N YGFLYG Low

T7 C-T8 RDNAKTFI F GFLYG High

Pol I WT R R S A K A I N F G L I Y G High

Pol I C-K1 R DN AK TFIY G FL YG low

Pol I C-K2 RRSAK TFIY GLIYG Low

Pol I C-K3 RRSAK TF NFGLIYG High

Pol I C-K4 RRSAKAI IY GLIYG Low

Pol I C-K5 RRSAKAI I FGLIYG High

Pol I C-K6 RRSAKAIN Y GLIYG Low

Taq WT R R A A K T I N F G V L Y G High

Taq C-Q1 R DN AKTINFGVLYG High

Taq C-Q2 RRAAKT FIY G F LYG LOW

Taq C-Q3 RRAAKTI IY GVLYG Low

Taq C-Q4 RRAAKTI I FGVLYG High

Tqa C-Q5 RRAAKTIN Y GVLYG LOW

Specific residues

Six populations of polymerase: DNA polymerase I, Pol alpha and Pol beta populations, test results for conserved sequence motifs from DNA dependent RNA polymerase, reverse transcriptase, RNA dependent RNA polymerase showed that all residues It is conserved among polymerases. According to their arrangement (Fig. 3, page 463), the selective residues identified here (phenylalanine 762 in E. coli DNA polymerase I) are in "motif B". In addition to the Pol I population of DNA polymerase I, motif B is found in the Pol alpha of DNA polymerase and the T7 population of DNA-dependent RNA polymerase; This arrangement suggests that one residue must be mutated in these other populations of polymerases including T4 DNA polymerase, herpes DNA polymerase, Ø29 DNA polymerase, vent DNA polymerase and Pfu DNA polymerase.

In addition, Joyce, Current Opinion in Structural Biology 1, 123-129 (1991) compares DNA sequences from a number of polymerases and suggests that few major active site residues have been conserved. In particular, there is a discussion of the similarity between the polymerases of the Pol I population (T7, Pol I, Taq) and the Pol alpha population (T4, Ø29, herpes). In Figure 1 (page 124), Joyce finds that portions of five constant residues are found in these two populations; These include lysine 758, tyrosine 766 and glycine 767; All of these point to a very close relationship to the selective moiety, phenylalanine 762, defined herein.

These polymerases are used in DNA sequencing reactions under conditions in which when they move the DNA product of the sequencing reaction on a gel, they preferably generate contiguous bands of approximately uniform intensity (with variability of about 1.5-2.0 fold in strength). do. The term contiguous is meant to include bands representing DNA products (ie, 20 bases) with molecular weight differences as high as 6000. The exact value of this strength will decrease with the length of the gel as described in Taber and Richardson, above. Band intensities reflect the number of DNA products in a particular band. Labels such as phosphors or radioisotopes are used to create easily detectable bands of intensity that reflect the number of such DNA products. Thus, in the present invention, adjacent bands derived from one sequencing reaction with one chain terminator have approximately the same number of DNA products and thus uniform band intensities. Sequencing conditions include specific divalent or trivalent cations such as manganese (II and III), first and second iron ions; Polymerase in the presence of a monovalent cation that has no detectable effect or is not detrimental to DNA synthesis and comprises K, Na, Ba, Be, Ca, Cc, Cr, Co, Cu, Ni, Si and Zn. Incubation. Anions are not critical, for example chlorides, acetates and sulfates are suitable. Under these conditions, the requirements for chain terminators such as dideoxynucleotides may be relaxed several times for the enzymes of the invention. Chelaters may also be provided in this solution to control the concentration of available divalent metal ions. For example, citrate or isocitrate can be provided. These chelates are believed to maintain, for example, the concentration of free manganese ions at a concentration of 10 to 100 mM over a wide range of manganese concentrations. In other words, the chelator acts as a buffer.

The DNA polymerase of the present invention does not significantly distinguish between dideoxynucleotide analogues and deoxynucleotides along the length of the template of DNA. That is, these polymerases cannot significantly identify nucleotides with 3 'hydroxyl groups versus those without (ie, with two hydrogens at the 3' position of ribose). However, these polymerases can identify for modifications at other positions on the nucleoside, even in the presence of manganese or iron. For example, polymerases can identify some dideoxynucleotide analogues with attached fluorescent groups as compared to deoxynucleotides. However, polymerases do not identify different degrees in adjacent or neighboring nucleotides on the basis of the presence or absence of modifications to dideoxynucleotides. Thus, they strongly identify these analogs and require higher concentrations for DNA sequencing reactions as compared to unmodified dideoxynucleotides, while the intensity of adjacent bands will still be uneven.

Thus, the polymerases of the present invention provide a uniform efficacy of incorporation of chain terminators even if their incorporation in their entirety is identified. In addition, other polymerases of the invention will produce more uniform bands with fluorescent ddNTPs than the corresponding naturally occurring enzymes, although not as uniform as unlabeled or radiolabeled ddNTPs.

Chain terminators useful in the present invention include dideoxynucleotides having 2 ', 3' dideoxy structures. Other reagents useful in the present invention are those that can specifically terminate the DNA sequencing reaction at a particular base and are not identified by the polymerase under these conditions.

Determining whether any particular DNA polymerase is combined with any particular chain terminator, or other components of the sequencing reaction mixture are used in the present invention, or whether standard sequencing reactions are performed as described by Taber and Richardson described above To do this, the degree of band formation and the uniformity of adjacent bands in the sequencing gel were examined. Adjacent band uniformity within the range of 2 times or less is useful in the present invention, and the degree of uniformity is preferably within the range of 1.0 to 1.5 times. Likewise, the concentration of optimal cations or other likely cations usable in the present invention was determined by the use of this sequencing reaction under various conditions. For example, cations were tested in the range of 0.005-100 mM. An example of such an experiment is as follows:

The ability to incorporate a given ddNMP relative to the corresponding dNMP for any one enzyme is measured as the ratio of ddNTP to dNTP necessary to allow DNA synthesis to terminate in a given range detected by generating a band no greater than a fixed molecular weight. . That is, a band was generated at the end of the reaction within a certain range in the sequencing gel. Thus, if one enzyme identifies more than 1000 times for a given ddNTP over another, a ratio of ddNTPs to 1000 times higher dNTPs is necessary to obtain a band ending at the same range of corresponding sites in the gel.

Exonuclease activity

DNA polymerases of the invention preferably have an exonuclease at normal or naturally related levels (amount of activity per polymerase molecule) of less than 50%, preferably less than 1% and most preferably less than 0.1% Have activity. Normal or naturally related levels refer to, for example, the exonuclease activity of the unmodified T7 type polymerase. Normally related activities are described by Chase et al., 249 J. Biol. Chem. 4545, 1974, which is about 5,000 units of exonuclease activity per mg of polymerase, measured as described below. Exonucleases increase the fidelity of DNA synthesis by excision of any newly synthesized base that is incorrectly paired to the template. Such related exonuclease activity can be detrimental to the quality of the DNA sequencing reaction. When the nucleotide concentrations drop, the polymerase activity drops at a slow rate comparable to the exonuclease activity, resulting in no resulting DNA synthesis or even degradation of the synthesized DNA, so that they have the least amount of nucleotide precursors that must be added to the reaction. Raise the required concentration.

More importantly, the related exonuclease activity causes the DNA polymerase to lazy in the region of the template with secondary structural obstacles. If the polymerase is close to such a structure, its synthesis rate decreases as it attempts to pass. Related exonucleases cleave newly synthesized DNA when the polymerase is retarded. As a result, numerous cycles of synthesis and cleavage will occur. This results in polymerases which are ultimately synthesized beyond the hairpin (which is not detrimental to the quality of the sequencing reaction); Or dissociates from the strand from which the polymerase is synthesized (resulting in an artificial band of the same position in all four sequencing reactions); Or chain terminators can be incorporated at high frequencies to generate a wide variety in the strength of different fragments in the sequencing gel. This occurs because the frequency of incorporation of the chain terminator at any given site increases with the number of chances so that the polymerase incorporates the nucleotides that terminate the chain.

An ideal sequencing reaction would produce fragments that exhibit bands of uniform intensity across the gel. This is essential to obtain optimal exposure of the X-ray film to all radioactive fragments. If there are various intensities of radioactive fragments, faint bands may not be detected. In order to obtain uniform radiological intensity of all fragments, DNA polymerases should exhibit the same time interval at each location on the DNA without showing preference for the addition or removal of nucleotides at any given site. This occurs when the DNA polymerase is deficient in any related exonuclease, so it will have only one chance to incorporate the chain terminator at each position along the template.

Short primer

The DNA polymerases of the present invention can preferably use longer than 10 base primers as well as longer ones, most preferably 4-20 bases, such as 6 bases (which are used in three groups to form an equivalent of 18-mer). Can be used). The ability to use short primers offers a number of advantages to DNA sequencing. Short primers are cheaper and easier to synthesize than conventional 17-mer primers. They also anneal quickly to complementary sites on the DNA template, thus making the sequencing reaction more rapid. In addition, the ability to use small (eg, 6 or 7 base) oligonucleotide primers for DNA synthesis allows a strategy that is not otherwise possible for sequencing long DNA fragments. For example, a kit can be generated containing 80-4000 random hexamers, none of which are complementary to any site of the cloning vector. Methodologically, one of the 80 hexamer sequences will occur on average every 50 bases along the DNA fragment being sequenced. Determination of the sequence of 3000 bases would require only five sequencing cycles. First, a "universal" primer (eg New England Biolabs # 1211, SEQ ID NO: 5'GTAAAACGAACGGCCAGT 3 ') will be used to sequence about 600 bases at one end of the insert. Using the results of this sequencing reaction, new primers will be selected from the kit complementary to the region near the end of the determined sequence. In the second cycle, the next 600 base sequences will be determined using this primer. Repeating this process five times will crystallize the complete sequence of 3000 bases without the need for any subcloning and chemical synthesis of any new oligonucleotide primers. The use of such short primers can be enhanced by including the gene 2.5 and gene 4 protein of T7 in the sequencing reaction.

Mutagenesis in vitro

Mutagenesis of the polymerase was performed using standard PCR techniques (see below).

Identification to ddNTP

In the presence of magnesium as the only divalent cation, T7 DNA polymerase identifies about 3-4 fold for ddNTP, less than any other known polymerase. The next closest is reverse transcriptase, which identifies about 10-50 fold (more than 3-10 fold over T7 DNA polymerase) for ddNTP. Following these two, any other known DNA polymerase characterized in the literature is identified at least 100 times and sometimes 10,000 times relative to ddNTP.

Identification by T7 DNA polymerase and E. coli DNA polymerase I in the presence of manganese is reduced; This decreases from 3.7 to 1 when using T7 DNA polymerase and from 550 to 3.9 (for ddATP) when using E. coli DNA polymerase I. Applicant is defined as a process length of less than 100 in the presence of magnesium ions as the only divalent cation (average elongation length from a given primer before dissociating from the primer-template; Having a treatment degree of 200, T7 DNA polymerase has a treatment degree greater than this), and for the first time provide a DNA polymerase that identifies less than 100 times the incorporation of ddNMP. In contrast, most known DNA polymerases, such as Taq and others, having a treatment degree of less than 100, identify at least 100 times the incorporation of ddNMP.

Previously, high-throughput polymerases, such as T7 DNA polymerase, remained bound to the primer-template for up to several minutes, while low-through polymerases, such as E. coli DNA polymerase I, were used in one primer template. It was believed to circulate every few seconds (or more than a hundred times the frequency). See Tabor et al., J. Biol. Chem. 262, 16212-16223 (1987). The throughput is advantageous for DNA sequencing, such as in reducing background due to termination but not from dideoxy incorporation, while slow cycling time is disadvantageous. For example, if the polymerase dissociates at a particular sequence, a strong artificial band will result on the sequencing gel if no excess polymerase is present. Conversely, in rapidly circulating polymerases, a single enzyme molecule will elongate a number of different primers during the course of the sequencing reaction, and any given primer end will have the opportunity to elongate by a number of different polymerase molecules, resulting in strong specificity. Much less polymerase can be used because it will reduce the chance of stopping.

However, it is better to incorporate ddNMP efficiently, in order to provide a cyclical strength band and to make less use of ddNMP. It is also more desirable to add pyrophosphatase to such polymerases with or without low exonuclease activity and to prevent degradation of the band by pyrophosphorosis.

It is also preferred to carry out the sequencing reaction using magnesium as the only divalent cation (ie in the absence of manganese). First, polymerases tend to be less active in manganese than magnesium [eg, Tabor and Richardson. Proc. Natl. Acad. Sci. USA 86, 4076-4080 (1989). Second, because polymerases tend to be active over a wide range of magnesium concentrations, in most cases there is a very sharp, low optimal manganese concentration for optimal activity (need to be identified). There is also much less effect on the reduction in the identification of ddNTPs, as at higher concentrations where the polymerase is less active at the optimal manganese concentration. Third, manganese is not a convenient metal ion to have in the kit, which easily forms precipitates, especially at high pH. Fourth, manganese will be effective as a metal ion to reduce the identification for ddNTP using any thermophilic polymerase (ie, at high temperatures).

Prior to the present invention, I have stated that there is a correlation between identification and throughput. Tabor and Richardson, Proc. Natl. Acad. Sci. USA 86, 4076-4080 (1989)]:

"DNA polymerase I has low throughput and dissociates after incorporation of less than 10 nucleotides. The frequency of enzyme dissociation at one site during DNA synthesis in the absence of ddNTP and the identification of the detrimental to the incorporation of ddNMP at that site. There is a strong correlation to the extent (unpublished results), which suggests that DNA polymerase I incorporates dNMP and ddNMP at similar rates during continuous synthesis; when synthesis is discontinuous, dNMP is selectively incorporated compared to ddNMP. This model can account for greater variability in ddNMP incorporation by DNA polymerase I compared to T7 DNA polymerase, since the latter has greater throughput than the former two ”(quotation omitted).

Thus, the results of the present invention using E. coli DNA polymerase I and Taq polymerase are surprising because no evidence was found that the mutants described herein increase the throughput of mutant enzymes.

Thermophilic polymerase

Thermophilic polymerases that identify ddNTPs at a ratio of less than 100 are particularly useful in the present invention. Also useful are those which identify for ddNTPs in a ratio of less than 100 in the presence of magnesium as the only divalent cation, preferably circulating from one primer-template to another at least once per second. Thermophilic polymerase is defined as a polymerase having optimal DNA polymerase activity at a temperature of about 60 ° C. or more in a 15 minute reaction.

Uniform band strength

Although manganese reduces the identification of the Klenow fragments for ddATP from 550 to 3.9, Taber and Richardson, Proc. Natl. Acad. Sci. USA 86, 4076-4080 (1989) shows that there is still a wide variation in the intensity of the individual bands (see FIG. 2 above). Thus, apart from the T7 DNA polymerase, even in the presence of magnesium as the only divalent cation, which is rapidly circulating and derived from thermophilic organisms such as the Klenow fragment, which is a desirable condition for the activity of most polymerases. A polymerase is provided for the first time which produces a band with uniform band strength (see above). Rapidly circulating enzymes can be determined by methods known in the art, as described below.

Specific polymerase

From the information above it is possible to quickly construct the following polymerases with the desirable properties discussed above. Each of these polymerases can be used in the sequencing process if the concentration of exonuclease is low enough and the activity of the polymerase is sufficient (all of which are well known in the art). See Brightwaite and Ito et al., Supra, as references for each amino acid.

Pol I group

E. coli DNA polymerase I with a modified Phe 762 ("modified" means replaced by a corresponding amino acid resulting in, for example, Tyr, or non-identifying properties).

Streptococcus pneumoniae DNA Polymerase with Modified Phe711 I.

Termus Aquatis DNA Polymerase with Modified Phe667 I.

Thermus flavus DNA polymerase with modified Phe666 I.

Bacteriophage T5 DNA Polymerase with Modified Phe570.

Bacteriophage Spo 1 DNA polymerase with modified Leu526.

Bacteriophage Spo 2 DNA polymerase with modified Phe690.

Mitochondrial DNA polymerase modified at this site without a decrease in native Tyr753 or non-identifying activity. Such polymerases have not previously been used for DNA sequencing. Applicants believe that due to the predicted low level of their ddNTP identification this will be useful for such a process. If desired, it can be modified to reduce exonuclease activity related to polymerase activity.

2. Polymerase Alpha Population (also known as Polymerase II Population)

Delarue et al., Protein Engineering 3, 461-467 (1990) show that two groups of polymerases (polymerase I group and polymerase alpha group) share three common motifs. The region of "motif B" which they refer to includes residues which they have identified as involved in the specificity of the dideoxyribose moiety. This region is highly distinctive when the sequence KN ₁ N ₂ N ₃ N ₄ N ₅ N ₆ N ₇ YG in the polymerase I population, where each N is a specific residue: N ₄ is phenylalanine, and N ₄ is tyrosine In which case it is low discrimination). In the polymerase alpha population, the sequence is KN ₁ N ₂ N ₃ N ₄ N ₅ N ₆ YG (there is one less amino acid between conserved residues). Therefore, we predict that changes to residue (s) in this motif (between lysine (K) and tyrosine (Y)), as in polymerase type I enzymes, will reduce the identification of these polymerases for ddNTP. . These residues are as follows:

Escherichia Coli DNA Polymerase II Ile494-Phe499

PRD1 DNA polymerase Leu341-Ser346

Ø 29 DNA polymerase Leu384-Leu389

M2 DNA polymerase Leu381-Leu386

T4 DNA Polymerase Ile558-Leu563

Thermuococcus litoralis

DNA polymerase (Vent) Leu492-Tyr497

Pyrococcus furiosus

DNA polymerase Lue489-Phe494

Sulphobus solfataricus

DNA polymerase Val604-Thr609

Human DNA Polymerase Alpha Leu951-His956

s. Cerebisia DNA polymerase I (alpha) Leu945-His950

s. S. pombe DNA polymerase (alpha) Leu931-His936

Drosophila melanogaster DNA polymerase (alpha) Leu960-His965

Trypanosoma brucei DNA polymerase

Alpha Leu845-His850

Human DNA Polymerase Delta Val695-Val700

Bovine DNA polymerase delta Val694-Val699

s. Cerevisiae DNA Polymerase III (Delta) Ile702-Val707

s. S. pombe DNA polymerase III (delta) Val681-Val686

Plasmodium falciparum DNA

Polymerase Delta Ile692-Val697

s. Cerebisia DNA polymerase II (epsilon) Val825-Phe830

s. Cerevisiae DNA Polymerase Rev3 Leu1087-Thr1092

Herpes Simplex Virus Type 1 DNA Polymerase Val812-Val817

Equine Herpes Virus Type 1 DNA Polymerase Val813-Val818

Varicella-Zoster virus DNA polymerase

Val776-Val781

Epstein-Barr Virus DNA Polymerase Cys682-Val687

Herpesvirus saimiri DNA

Polymerase Val671-Val676

Human cytomegalovirus DNA polymerase Val811-Phe816

Rat Cytomegalovirus DNA Polymerase Val717-Phe722

Human Herpes Virus Type 6 DNA Polymerase Ile667-Val672

River Catfish Virus DNA Polymerase Ile750-His755

Chlorella virus DNA polymerase Ile586-Val591

Fowlpox Virus DNA Polymerase Ile648-Val653

Basinia Virus DNA Polymerase Ile637-Leu642

Choristoneura biennis DNA

Polymerase Ile669-Leu674

Autographa californica nuclear polyhedrosis

Virus (AcMNPV) DNA Polymerase Arg606-Ile611

Lymanthria dispar nuclear polyhedrosis

Viral DNA Polymerase Arg624-Ile629

Adenovirus-2 DNA Polymerase Leu696-Leu701

Adenovirus-7 DNA Polymerase Leu762-Leu767

Adenovirus-12 DNA Polymerase Leu694-Leu699

S-1 Corn DNA Polymerase Leu618-Leu623

Kalilo neurospora intermedia DNA

Polymerase Leu776-Leu777

pA12 Ascobolus immersus

DNA polymerase Leu951-Leu956

pCLK1 Claviceps purpurea DNA

Polymerase Leu831-Leu836

Maranhar neurospora crassa

DNA polymerase Leu752-Leu757

pEM Agaricus bitorquis DNA

Polymerase Leu573-Leu578

pGKL1 Kluyveromyces lactis DNA

Polymerase Ile785-Leu790

pGKL2 Kluyveromyces lactis DNA polymerase Ile770-Gly776

pSKL Saccaromyces kluyveri DNA

Polymerase Ile775-Gly781

The following is an example of a method for determining the degree of treatment and cycle time for various polymerases. Also provided are examples for determining the level of identification by polymerases and other methods useful in the present invention.

Example 1. Mutagenesis of DNA Polymerase Gene and Overproduction of Mutant DNA Polymerase

Cloning was performed using standard techniques and expression of mutant DNA polymerase genes was performed. Gene and Taq DNA polymerase for large fragments of E. coli DNA polymerase I (KlenTaq or Taq DNA polymerase, see Barnes 112 Gene 29, 1992 or Stoffel fragment, Lawyer et al., 2 PCR Methods Appl 275) , 1993)], starting materials for the generation of mutations in E. coli DNA polymerase I and Taq DNA polymerase were expressed under the control of the T7 DNA polymerase promoter. Gene for the 28 amino acid deletion of T7 DNA polymerase (Tabor and Richardson, 264, J. Biol. Chem. 6447, 1989), the starting material for the development of mutants in T7 DNA polymerase is to T7 DNA polymerase. Is expressed under the control of the lac promoter in strains producing Escherichia coli thioredoxin, a necessary factor for advanced DNA synthesis (see Taber and Richardson supra). The gene for Taq DNA polymerase mutant F667Y was transferred from the gene producing Taq DNA polymerase to a gene producing full length Taq DNA polymerase by standard techniques using PCR and restriction enzyme digestion and subsequent ligation.

Mutagenesis for constructing mutant DNA polymerases is performed using standard mutagenesis techniques by PCR similar to the methods described in Sarkar and Sommer, 8 BioTechniques 404, 1990. To prepare hybrids in which four or more amino acid residues were exchanged, two hybrids were constructed by first performing PCR on donor DNA and then using this product for PCR on receptor DNA and generating hybrid molecules. In order to construct hybrids in which the exchange of domains is 4 amino acid residues or less, a single PCR primer containing the flanking sequence of the receptor as well as the entire region to be transcribed was synthesized and the primers used directly to construct the hybrid molecule. .

Overproduction of mutant DNA was performed using standard techniques (see, for example, Current Protocols in Molecular Biology, Ausubel et al., Eds., Chapter 16, 1994). Mutant proteins were purified by procedures including ion exchange chromatography. To purify E. coli DNA polymerase I mutants, see, for example, Joyce and Grindley 80 Proc. Natl. Acad. Sci. USA 1830, 1983. For purification of Taq DNA polymerase mutants, see, eg, Engelke et al., 191 Analytical Biochemistry 396, 1990. To purify T7 DNA polymerase mutants, see, eg, Tabor and Richardson 264, J. Biol. Chem. 6447, 1989. Each polymerase specific activity of the purified mutant proteins was determined by standard procedures described in these references.

Example 2 Rapid Screening of DNA Polymerases for Mutants with Improved Efficiency of Incorporating Dideoxynucleotides Compared to Deoxynucleotides

Mutant DNA polymerases were screened for their ability to incorporate dideoxynucleotides by SDS active gel analysis. This process is a modification of that described in Spanos and Hbsbs91 91 Methods in Enzymology 263, 1983 and Karawya et al., 135 Analytical Biochemistry 318, 1983. Briefly, 10 ml of cells were induced for 4-6 hours and then pelleted. Cell pellets were suspended in 0.3 ml 25 mM Tris-HCl, pH 7.0, 5 mM EDTA. 20 L of suspended cells were mixed with 40 L of a solution of 1% SDS (sodium dodecyl sulfate), 2% mercaptoethanol, 30% glycerol, 0.04% bromophenol blue and 100 mM Tris-HCl, pH 6.8. This mixture was incubated at 37 ° C. for 5 minutes, and then 20 L of purified water was loaded in duplicate onto two SDS polyacrylamide gels. This SDS polyacrylamide gel is a 5% poly and degradation gel comprising 8% polyacrylamide, 0.27% bisacrylamide, 190 mM Tris-HCl, pH 8.8, 0.05% SDS, and 25 g / ml modified salmon sperm DNA. It consists of a stacking gel comprising acrylamide, 0.17% bisacrylamide, 150 mM Tris-HCl, pH 6.8 and 1% SDS. Both gels were electrophoresed for 13 hours at 100 V at a constant temperature of 13 ° C. in an electrophoretic buffer consisting of 190 mM Tris-HCl, pH 8.8 and 0.05% SDS.

After electrophoresis, the gels were subjected to respective regeneration buffers (50 mM Tris-HCl, pH 7.5, 5 mM magnesium acetate, 1 mM dithiothreitol, 40 mM KCl, 400 g / ml bovine serum albumin, 16% glycerol and 0.95 mM). EDTA) was exchanged four times with 500 ml and washed for 8 hours at 4 ° C.

The regenerated protein was incubated by incubating each of two gels in 6 ml of regeneration buffer, 1.5 M 4dNTP, [a- ³² P] dATP (80 Ci / mmol, 10 mCi / ml) and 80 g of purified thioredoxin. The polymerase activity was analyzed One of the mixtures also included 30 M ddTTP (20 molar excess for dTTP) This mixture was 4 hours at 37 ° C. (2 hours at 70 ° C. for thermophilic DNA polymerase). During incubation.

After incubation the gel was washed for 8 hours with four exchanges of 5% trichloroacetic acid and 1% sodium pyrophosphate. The gel was then dried and autoradiographed.

To determine if the mutant DNA polymerase is somewhat different for ddTTP, the intensity of the radioactive bands was compared on two incubated gels with and without ddTTP and the signal ratio in each of the two bands for unmodified DNA polymerase was mutated. The ratio of the signals in the two bands to the sieve was compared. If the mutation results in a less identifiable DNA polymerase for ddTTP, the percentage reduction in radioactivity will be greater in the bands present for the mutant DNA polymerase compared to the unmodified DNA polymerase. For example, the observed radio bands for cells containing E. coli DNA polymerase I or T7 DNA polymerase mutant Y526F induced under these conditions have approximately the same intensity (in both elements) in the response performed in the presence versus absence of ddTTP. Will have). Conversely, for cells containing E. coli DNA polymerase I mutant F762Y or T7 DNA polymerase induced, the band on the gel in which the reaction was performed in the presence of ddTTP is equivalent to the intensity of the band corresponding to the reaction performed in the absence of ddTTP. Less than 5%.

This assay represents a rapid method for screening large numbers of DNA polymerase mutations for their ability to identify for dideoxynucleotides. At least five times a change in the relative ratio of the identification rate can be detected. However, this assay involves the purification of potentially mutant DNA polymerases of interest, and in order to accurately determine the effect of each mutation on the identification for dideoxynucleotides, further analysis of purified proteins similar to those described below Rigorous analysis should be performed.

The following examples determine the degree of treatment and cycle time for various polymerases, determine the level of identification for ddNTPs by polymerases, and the uniformity of bands generated by dideoxy terminated fragments on DNA sequencing gels. And methods of using the DNA polymerase of the present invention for DNA sequencing.

Example 3. Single Strand M13 DNA-5 ′ ³² Preparation and Purification of P-labeled 40-mer Primer Complex

The template is M13-mGP1-2 single stranded DNA having a length of 9950 nucleotides as described in US Pat. No. 4,795,699 (FIG. 9). Phage M13-mGP1-2 has been deposited with ATCC as 40303. M13-mGP1-2 single stranded DNA is described by Tabor et al., J. Biol. Chem. 16212, 1987]. Briefly, phage is purified through two CsCl gradient centrifugation, CsCl is removed by dialysis, DNA is extracted from phage by extraction with phenol and chloroform in the presence of 0.1% sodium dodecyl sulfate, and extracted DNA Was dialyzed extensively against 20 mM Tris-HCl, pH 7.5, 2 mM EDTA and stored at 4 ° C. The concentration of M13-mGP1-2 single stranded DNA was measured on the spectrometer using an extinction coefficient of 8.1 A ₂₆₀ units = 1 mg / ml or 0.3 mmol of M13-mGP1-2 template molecule per microtiter.

The primer was synthetic 40-mer with sequence 5'd (TTTTCCCAGTCACGACG TTGTAAAACGACGGCCAGTGCCA) 3 'synthesized by standard procedures. This is complementary to M13-mGP1-2 at nucleotides 9031 to 8992 (see sequence '699 patent for sequence). This primer was purified by denaturing polyacrylamide gel electrophoresis before ion exchange chromatography or end labeling.

Primers were labeled and annealed to the template described essentially by Taber et al., Supra. This primer was prepared using 40 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 5 mM dithiothreitol, 100 mM NaCl, 50 mM g / ml BSA, 50 Ci [g- ³² P] dATP, 6000 Ci / mmol , 5 'end labeling in a reaction mixture (15 L) comprising 10 mmoles of T4 polynucleotide kinase prepared from PseTl mutant lacking 5 mmol of primer and phosphatase activity. The mixture was incubated at 37 ° C. for 15 minutes and then at 70 ° C. for 15 minutes to inactivate the kinase. 60 L of single stranded M13-mGP1-2 DNA (0.25 mg / mL), 6 L of 1M NaCl and 0.2 M MgCl ₂ , were added and the mixture was heated at 70 ° C. to room temperature (about 20-25 ° C.) over a period of 20 minutes. Cool slowly. The mixture was then extracted once with a 1: 1 mixture of phenol and chloroform, centrifuged for 30 seconds in a small centrifuge, and then the aqueous layer (70 L) was washed with 20 mM Tris-HCl, pH 7.5, 2 mM EDTA and 100 mM NaCl. Place in equilibrated 1 ml column of Sepharose CL-6B. The labeled primer-template complex is eluted using the same buffer used for equilibration; The labeled mixture elutes to empty volume. After elution, the complex is at a concentration of approximately 50 g / ml (0.015 pmol of molecule per liter) with a specific activity of 200,00 cpm / l.

Example 4 Determination of Treatment Degree of DNA Polymerase by Dilution Test

The degree of treatment is described in Taber et al., Supra and in Tabor and Richardson. 84 Proc. Natl. Acad. Sci. USA 4767 (1987), which is essentially determined by enzymatic dilution. This reaction is the same conditions as in the stretch / termination reaction used for DNA sequencing, except that ddNTP was omitted and the polymerase concentration was reduced to have an excess of primer-template molecule relative to the polymerase molecule in part of the reaction. Was performed under. The primer-template consists of a single 5 'terminal labeled primer linked to a single stranded M13 DNA molecule as described in Example 3.

The elongation reaction mixture is prepared substantially as described in Taber et al., Supra. Each reaction mixture (18 L) was annealed ³² P-labeled primer-M13 DNA (˜0.015 mmol, ˜200,000 cpm), 40 mM Tris-HCl, pH 8.0, 5 mM MgCl as described in Example 3. ₂ , 5 mM dithiothreitol and 300 M 4dNTP. The mixture was incubated at 37 ° C. for 1 minute (70 ° C. for thermophilic DNA polymerase). The reaction was initiated by adding 2 L purified water of the DNA polymerase to be analyzed diluted in 20 mM Tris-HCl, pH 7.5, 10 mM 2-mercaptoethanol and 0.05% bovine serum albumin. The reaction mixture was further incubated at 37 ° C. (70 ° C. for thermophilic DNA polymerase) for 30 seconds or 3 minutes. At the indicated time, 8 l purified water was removed and 90% formamide for modified polyacrylamide gel electrophoresis 8 l, 20 mM EDTA, 0.05% bromophenol blue or 100 mM EDTA for alkaline agarose gel electrophoresis, 2 To either 2 liters of% sodium dodecyl sulfate.

Samples were analyzed by either modified polyacrylamide gel electrophoresis or alkaline agarose gel electrophoresis strains. Denatured polyacrylamide gel electrophoresis is best suited for analyzing polymerases having an average throughput of less than 500 nucleotides, while alkaline agarose gel electrophoresis is more sensitive to the throughput of DNA polymerases having an average throughput of at least 500 nucleotides. Provide measurement; However, either method can be used successfully to determine the average throughput of any DNA polymerase.

To determine the degree of treatment by modified polyacrylamide gel electrophoresis, purified water in formamide was added to 6 liters of each sample in 100 mM tris-borate, pH 8.3, 8% polyacrylamide in 1 mM EDTA, 0.4% N, N'- Heated at 90 ° C. for 2 minutes immediately before loading onto a gel of methylenebisacrylamide, 7M urea. Electrophoresis was performed at 2000 volts for 90 minutes (just before the bromophenol blue cow reached the bottom of the gel). Suitable 5 ′ ³² P-terminal labeled molecular weight markers were also loaded onto a gel allowing determination of fraction size of 100 to 500 nucleotides in length. One example of such a suitable marker is dephosphorylation with alkaline phosphatase followed by [ ³² gP] ATP and T4 polynucleotide kinases and standard methods [Sambrook et al., 1989, Molecular Cloning A Laboratory Manual, Cold Spring Harbor]. Laboratory, NY pp. 6.20-6.21 and Ausubel et al., 1989 , a terminal ³² P- labeled T7 HpaI fragments by Current Protocols in Molecular Biology, Greene Publishing Associate and Wiley Interscience, NY]. After electrophoresis, the gel was dried under vacuum and autoradiography was taken. After autoradiography, the distribution of radioactive photographs was determined by phospho-imager analysis (Phosphorimager, manufactured by Molecular Dynamics).

The product was prepared from (1) Villani et al., 256 J. Biol. Chem. 8202, 1981, (2) Sabatino et al., 27 Biochemistry 2998, 1988 and (3) by alkaline agarose gel electrophoresis as described by Sambrook et al., Supra. To prepare an agarose gel, 250 ml of a 1.5% akaros solution in 2 mM EDTA, pH 8.0 was heated in a microwave oven to dissolve the agarose and then cooled to 60 ° C. 8.75 mL 1 N NaOH (final concentration 35 mM NaOH) was added and the gel was poured into an agarose gel electrophoresis mold. The gel was left to coagulate 2 hours before use. Electrophoretic buffers were 35 mM NaOH and 2 mM EDTA. Samples were prepared by taking 10 L of the purified water (in 20 mM EDTA, 0.4% sodium dodecyl sulfate), modifying by adding 1 L of 1N NaOH and heating at 60 ° C. for 10 minutes. 7 L of 75% glycerol, 0.2% bromocresol green was added to each sample and the samples were then loaded onto an alkaline agarose gel. Electrophoresis was performed at 4 ° C. for 15 hours (until Bromocresol green moved about 14 cm) at a constant current of 150 mA. The electrophoretic chamber had dimensions of 26 cm (length) x 20 cm (width) with a height of 2 cm. After electrophoresis, the gel was immersed in 10% trichloroacetic acid for 2 hours, dried under vacuum and autoradiated. After autoradiography, the distribution of radioactive photographs was determined by phospho-imager analysis (Phosphorimager, manufactured by Molecular Dynamics).

To determine the degree of treatment of a given DNA polymerase, the concentration of polymerase in the reaction mixture may be increased by only a fraction of the primer (ie 25%) and the majority (ie 75%) remaining unchanged to 40 nucleotides in length. Diluted by about 2-fold increase until Under these conditions, a two-fold increase or decrease in DNA polymerase concentration should result in about a two-fold increase or decrease in the fraction of elongated primers, respectively. The average length of elongated labeled fragments was determined by either visual observation of automated radiographs or quantification using a phosphoimizer. For example, an exonuclease-deficient T7 DNA polymerase complexed with its treatment factor thioredoxin (e.g., SEQUENASE® Version 2.0, United States Biochemical Corporation), for use in this test, is 500 nucleotides. The Klenow fragment of E. coli DNA polymerase I has an average throughput of less than 50 nucleotides, while having an average throughput of above.

Example 5 Determination of Circulation Rate of DNA Polymerase

The circulation rate is essentially determined as described in Taber et al., Supra. This reaction was carried out under the same conditions as in the stretch / termination reaction used for DNA sequencing, except that ddNTP was reduced in order to reduce the polymerase concentration to have an excess of primer-template molecule relative to the polymerase molecule. The primer-template consists of a single 5 '[ ³² P] terminal labeled primer linked to a single stranded M13 DNA molecule as described in Example 3.

First tests were performed to determine the organoleptic ratio of primer-template molecules to polymerase molecules using, for example, large fragments of E. coli DNA polymerase I (Klenow fragments). Dilution experiments were performed as described in Example 4 to determine the concentration of polymerase molecules required to stretch 20% of the labeled primer-template at 10 seconds. The ratio of polymerase to primer-template was defined as less than 1:% or equivalent and was used to determine the maximum circulation rate of the polymerase as described below.

Elongation reactions were performed as described in Example 4 using a ratio of polymerase to primer-template less than 1: 5 or equivalent as described in the paragraph above. The reaction was performed under optimal conditions (ie buffer, pH, salt, temperature) for the polymerase tested. Purified water was removed at 10 seconds, 20 seconds, 40 seconds and 80 seconds and the reaction was terminated before the product was analyzed as described in Example 4. For DNA polymerases with low throughput (less than 100 nucleotides), such as large fragments of E. coli DNA polymerase I, samples were preferably analyzed by denaturing polyacrylamide gel electrophoresis. For DNA polymerases with a high degree of treatment (more than 100 nucleotides), such as T7 DNA polymerase, samples were preferably analyzed by alkaline agarose gel electrophoresis. After electrophoresis, the gels were dried in vacuo and analyzed by either autoradiography or phosphoimizer.

When the reaction was performed with a very slow circulating polymerase, such as T7 DNA polymerase, there was no significant decrease in the number of primers not elongated between 10 and 80 seconds (ie, a coefficient less than 2). Thus, the number of unextended labeled primers circulates slower than once per 70 seconds unless the number of times between 10 and 80 seconds decreases by more than two times. For rapidly circulating polymerases, the number of unextended primers will be reduced by a significant fraction (ie, two or more times) at time points between 10 and 80 seconds. To determine the circulation rate for these polymerases the following equation is used:

R = N ₁ x L (t ₂ ) / {L (t ₁ ) x (t ₂ -t ₁ )}

Where R is the minimum circulation rate in circulation per second and N ₁ is the ratio of the primer-template molecule to the functional DNA polymerase molecule (N ₁ is 5 in the example above).

L (t ₁ ) is the maximum degree of treatment of DNA polymerase irradiated at nucleotides. This is defined as the maximum number of nucleotides stretched from the labeled primers under conditions limiting DNA polymerase as described in Example 3 (only when 20% of the primers are stretched at the 10 second time point).

L (t ₂ ) is the maximum number (as nucleotides) of elongation of the labeled primer at time t ₂ , which in this example is 80 seconds.

t ₁ is the shortest time for which purified water is taken, or 10 seconds in this embodiment.

t ₂ is the longest reaction time that precedes the removal of purified water or in this example is 80 seconds.

When this test is performed on a large fragment of E. coli DNA polymerase I, a value of at least 0.2 per second is obtained.

Examples 6 and 7 are tests and gel electrophoresis to determine the efficiency of incorporation of dideoxynucleotides into an unknown DNA polymerase using a 5 ′ ³² P-labeled 40-mer primer annealed to a single stranded M13 DNA template. Provide an analysis based on Example 6 is the best DNA polymerase that efficiently incorporates dideoxynucleotides (ie, wild type T7 DNA polymerase and Taq DNA polymerase F667Y), while Example 7 is the best DNA that strongly identifies for incorporation of dideoxynucleotides. Polymerases (ie, T7 DNA polymerase Y526F and wild type Taq DNA polymerase).

Example 6. Determination based on gel electrophoresis of incorporation rate of dideoxynucleotide to deoxynucleotide using a 1: 1 ratio of dNTP to ddNTP

The main application of this test is the absolute incorporation ratio of dNTPs to ddNTPs for DNA polymerases that efficiently incorporate dideoxynucleotides such as T7 DNA polymerase, E. coli DNA polymerase I mutant F762Y or Taq DNA polymerase mutant F667Y. To determine. It also indicates the level of identification for ddNTPs of any DNA polymerase; However, for DNA polymerases that strongly identify ddNTPs, such as T7 DNA polymerase Y526F, E. coli DNA polymerase I, and wild-type Taq DNA polymerase, a high ratio of ddNTPs to dNTPs is needed to accurately determine their level of identification. This is described in detail in Example 7.

DNA synthesis reactions were performed on a ³² P-terminal labeled 40-mer M13 mGP1-2 DNA template prepared as described in Example 3. Optimal reaction conditions were used for the DNA polymerase tested for buffer, pH, salt and reaction temperature. The concentration of DNA polymerase was chosen by allowing most primers to elongate in a 10 minute reaction and terminate by incorporation of dideoxynucleotides. The reaction mixture contains 100 M each of 100 M 4dNTP and four ddNTPs.

We used this test to compare the ability of six DNA polymerases to incorporate each of the four ddNMPs. The DNA polymerase tested (1) T7 DNA polymerase (Tabor and Richardson 264 J. Biol. Chem. 6447, 1989), one-to-one mixed with thioredoxin with 28 amino acid deletions in the exonuclease domain ( Hereinafter, referred to as "T7 DNA polymerase"), (2) a large fragment of E. coli DNA polymerase I, commonly referred to as Klenow fragment (hereinafter referred to as "E. coli DNA polymerase I"), (3) Termus Aqua Unmodified DNA polymerase from thycus (hereinafter referred to as "Taq DNA polymerase"), (4) T7 DNA polymerase as described above, wherein 526 residues of tyrosine are changed to phenylalanine (hereinafter "T7 DNA polymerase" Y526F "), (5) E. coli DNA polymerase I (hereinafter referred to as" E. coli DNA polymerase I F762Y "), wherein phenylalanine is changed to tyrosine at 762 residues, and (6) phenylalanine at residue 667. Taq D as described above changed to tyrosine It was NA polymerase (henceforth "Taq DNA polymerase F667Y").

To determine the relative usage of each of the four ddNTPs relative to the dNTPs compared for each of the DNA polymerases shown above, the reaction mixture (8 L) was annealed ³² P-labeled primers as described in Example 3. -M13 DNA (˜0.015 mmol, ˜200,000 cpm), 40 mM Tris-HCl, pH 8.0, 5 mM MgCl ₂ , 5 mM dithiothreitol, 50 mM NaCl, 100 M 4dNTP and 100 M ddCTP. The reaction mixture also contained 10 ng of yeast inorganic pyrophosphatase, which inhibited pyrophosphoresis, which could otherwise increase clear identification by DNA polymerases. Tabor and Richardson 265 J. Biol. Chem. 8322, 1990]. The reaction was initiated by adding 2 liters of each DNA polymerase diluted in 20 mM Tris-HCl, pH 7.5, 10 mM mecaptoethanol and 0.05% bovine serum albumin at a concentration of approximately 0.025 units / liter. The concentration of each DNA polymerase was sufficient to elongate most of the labeled primers at least 500 nucleotides in the absence of ddNTP in 15 minutes of reaction. The reaction mixture was 15 minutes at 37 ° C. (T7 DNA polymerase, T7 DNA polymerase Y526F, E. coli DNA polymerase I, and E. coli DNA polymerase I F762Y) or 70 ° C. (Taq DNA polymerase and Taq DNA polymerase F667Y). Incubate at one of the temperatures. The reaction was terminated by addition of 8 L of 90% formamide, 20 mM EDTA, and 10 L of 0.05% bromophenol blue. 6 L of each sample was added at 90 ° C. immediately before loading onto a gel of 100 mM tris-borate, pH 8.3, 8% polyacrylamide, 0.4% N, N'-methylenebisacrylamide, 7M urea in 1 mM EDTA. Heated for minutes. Electrophoresis was performed at 2000 volts for 90 minutes (just before the bromophenol blue cow reached the bottom of the gel). After electrophoresis, the gel was dried under vacuum and autoradiography was taken. After autoradiography, the distribution of radioactive photographs was determined by phospho-imager analysis (Phosphorimager, manufactured by Molecular Dynamics). Alternatively, the relative intensity of the dideoxy terminated band can be determined by scanning autoradiography using a device such as a SciScan 5000 Image Density Meter (Unite States Biochemical Corp).

When four reaction sets (each containing a single ddNTP in equimolar concentrations with dNTPs) were performed with each of the six DNA polymerases described above, reaction with three DNA polymerases (T7 DNA polymerase Y526F, Escherichia coli DNA polymerase I and Taq DNA polymerase) resulted in the majority of the radioactivity (> 50%) of elongated primers moving on top of the gel, corresponding to fragments of at least 300 bases in length. Based on the predicted exponential decrease in signal by increasing the fragment size, this corresponds to identification by these three DNA polymerases at least 100-fold for all four ddNTPs. Identification of ddNTPs by these three DNA polymerases is obtained using the test in Example 7 below.

For three other DNA polymerases (T7 DNA polymerase, E. coli DNA polymerase I F762Y and Taq DNA polymerase F667Y), autoradiography showed a row of dideoxy-terminated fragments in all reactants. In general, the average length of the labeled synthetic fragments was the lowest in Taq DNA polymerase F667Y, and about 6 radiolabeled dideoxy terminated fragments were only visible after exposure of the film for several days. The average length of the labeled fragments of E. coli DNA polymerase I F762Y was slightly longer than Taq DNA polymerase F667Y, while the average length was slightly longer than T7 DNA polymerase. The fragments were more uniform in strength when synthesized by E. coli DNA polymerase I F762Y and Taq DNA polymerase F667Y than T7 DNA polymerase.

The radioactive distribution in the fragments was quantified by phospho imager analysis (Phosphorimager, manufactured by Molecular Dynamics). The total amount of labeled primers in each lane was determined by moving three control reactions free of DNA polymerase and the radioactivity in each of the corresponding radio bands on the gel at the location of the unstretched primers. For some preparations of radiolabeled primers, a certain proportion (<10%) was not stretched by any of the DNA polymerases regardless of the concentration of DNA polymerase used; This background level is determined by measuring the percentage of radioactivity remaining in the position of the unextended primer for the four reactants in a row containing ddNTP and subtracting these four values from the total number of previously determined coefficients. This value is defined as the total number of coefficients of the primer that can be stretched by the DNA polymerase.

The total number of counts (ie radioactivity) in the first three dideoxy terminated fragments was determined for T7 DNA polymerase, E. coli DNA polymerase I F762Y and Taq DNA polymerase F667Y for each of the four ddNTP reactants. This value is presented in the following table as a percentage of the count of the first three dideoxy terminated fragments relative to the total number of counts of primers that can be stretched by DNA polymerase.

      Polymerase Reactant ddGTP ddATP ddTTP ddCTP T7 DNA Polymerase  67% 66% 76% 61% Escherichia coli DNA polymerase I F762Y 95% 92% 96% 92% Taq DNA Polymerase F667Y 97% 95% 95% 99%

To further test the ability of incorporating the dideoxynucleotides of each DNA polymerase, the number of coefficients in each fragment with important signals was determined for each reaction, and the data was converted to Kaleidograph version 3.0 (Synergy Software), a Macintosh program. Plotted as a function of the number of fragments. Plots of results were applied to exponential decay curves using the Kaleidograph library routine for this function. The decay curve is given by the following equation:

Y = e ^{M * X}

(In the meal:

Y is 1- (fragment of primers labeled in fragments 1 to X relative to the total number of primers that can be extended),

X is the number of fragments (the first dideoxy terminated fragment is 1),

M is the exponential decay curve calculated on the data by the Kaleidograph library routine.

In the following table, the following data were provided for each of the four ddNTP reactions using T7 DNA polymerase, E. coli DNA polymerase I F762Y and Taq DNA polymerase F667Y.

N, number of fragments used to fit each exponential curve.

M, calculated exponential decay curve as above.

D, an identification factor given as the ratio of use of a particular dNTP to the use of ddNTP compared when two nucleotides are present at the same concentration. D is calculated from the above equation using the calculated value of M to determine Y when X is 1, determine D, and determine the ratio of dNTP's preference to ddNTP as Y / (1-Y).

R ² , the correlation coefficient for the data calculated by the Kaleidograph library routines. This is a measure of variability in band intensity, or specific variability in the ability to incorporate specific dideoxynucleotides of DNA polymerase.

-------------------------------------------------- ------------------------

Polymerase ddNTP N M D R ²

-------------------------------------------------- ------------------------

T7 DNA ddGTP 8 -0.375 2.2 0.813

Polymerase

ddATP 6 -0.356 2.3 0.996

ddTTP 5 -0.450 1.8 0.997

ddCTP 8 -0.317 2.7 0.889

ddGTP 5 -1.03 0.56 0.999

Escherichia coli DNA

Polymerase I F762Y

ddATP 5 -0.860 0.72 0.998

ddTTP 5 -1.06 0.54 1.000

ddCTP 6 -0.842 0.75 1.000

ddGTP 5 -1.18 0.45 0.995

Taq DNA

Polymerase F667Y

ddATP 6 -0.997 0.59 0.997

ddTTP 6 -1.01 0.56 0.996

ddCTP 4 -1.44 0.32 0.996

Average:

T7 DNA 4 ddNTP 2.3 .924

Polymerase

E. coli DAN 4 ddNTP 0.64 .999

Polymerase I F762Y

Taq DNA 4 ddNTP 0.48 .996

Polymerase F667Y

-------------------------------------------------- ------------------------

In summary, T7 DNA polymerase identifies 2.3 times on average for ddNTP, whereas E. coli DNA polymerase I F762Y and Taq DNA polymerase F667Y actually average 1.6 times (1 / 0.64) and 2.1 times (1 / 0.48), respectively. ddNTP is preferred over dNTP. Comparison of R ² showed that the strength of adjacent fragments was more uniform in E. coli DNA polymerase I F762Y and Taq DNA polymerase F667Y than in T7 DNA polymerase. To more accurately measure uniformity, a larger number of fragments can be included in the analysis by reducing the concentration of ddNTP of each reaction (eg 5 times) and reducing the collapse of intensity at each location (see Example 13). ).

To determine the amount of identification for ddNTP by the novel DNA polymerase, a reaction similar to that described above was carried out, and the same reaction was performed using T7 DNA polymerase (SEQUENASE® Version 2.0, United States Biochemical Corporation). Side by side with all reactants analyzed on the same gel. An initial comparison of the distribution of dideoxy terminated bands obtained in novel DNA polymerases compared to those obtained in T7 DNA polymerases indicated that the new DNA polymerases were somewhat more identifiable for ddNTPs than T7 DNA polymerases. For example, such a visual inspection using E. coli DNA polymerase I F762Y shows that the number of visible fragments on the gel in the reaction using E. coli DNA polymerase I F762Y for the reaction with each of 4 ddNTPs was T7 DNA polymerase. Clearly (less in average size). Then, to calculate the variability of the exponential decay factor (M), the average relative utilization of dNTP relative to dNTP (D) and the intensity (R ² ) for the novel DNA polymerase as described above, a more quantitative analysis was described above. Similar to that of the bar.

One problem that may arise in this test is that the DNA polymerase has 5'-3 'exonuclease activity associated with Taq DNA polymerase and E. coli DNA polymerase I and native T7 DNA polymerase (28 T7 DNA used in the above experiments). And related exonuclease activity, such as 3'-5 'exonuclease activity related to the polymerase deletion mutant). 5'-3 'exonuclease activity is detrimental because it can remove the label on the 5' end of the primer, reducing the radioactive signal detected. This problem can be avoided in particular by reducing the amount of DNA polymerase in the reaction mixture. In the above example, 0.025 units of Taq DNA polymerase ultimately until all primers are terminated by incorporation of dideoxynucleotides, without the perceived loss of radioactivity due to 5'-3 'exonuclease activity. While elongated, a 40-fold increase in Taq DNA polymerase activity or 1 unit per reaction resulted in the loss of ultimately all ³² P from the 5 'end of the primer. An alternative approach to measuring the degree of identification for DNA polymerases with 5'-3 'exonuclease activity is to use different assays such as those described in Examples 8-10.

3'-5 'exonuclease activity can complicate the above assay by making the DNA polymer appear to be more discriminating against ddNTP than it actually does [eg, Tabor and Richardson. Proc. Natl. Acad. Sci. USA 86, 4076 (1987). This is because once the dideoxynucleotides have been incorporated, the exonuclease activity can selectively remove the dideoxynucleotides and continue DNA synthesis resulting in an increase in the length of the fragment. Preferably the enzyme analyzed in the above test is deficient in 3′-5 ′ exonuclease activity; Examples include modified T7 DNA polymerase (SEQUENASE®, United States Biochemical Corporation), Taq DNA polymerase, exonuclease-deficient vent (Thermococcus litoralis) DNA polymerase (New England Bolabs Catalog No. 257), exo Nuclease-Deficient Deep Vent (Pyrococcus GB-1) DNA Polymerase (New England Bolabs Catalog No. 259), Exonuclease-Deficient Pfu (Pyrococcus furiosus) DNA Polymerase (Stratagene Catalog No. 600163) And exonuclease-deficient Klenow fragments (E. coli DNA polymerase I, United States Biochemical Corporation, Cat. No. 70057). In some cases, 3'-5 'exonuclease activity is weak and does not interfere much with this assay, such as with E. coli DNA polymerase I (Klenau fragment) (eg, Tabor and Richardson. 264 J. Biol. Chem. 6447, 1988). One method for determining whether the novel DNA polymerase tested has 3'-5 'exonuclease activity that prevents accurate measurement of fractionation for ddNTPs was performed by performing the experiments described above, at different time points up to 60 minutes. To remove the purified water. If the size distribution of the dieoxy terminated fragments increases with time, such 3'-5 'exonuclease activity interferes with the assay, whereas if the distribution of the fragments is constant over time, such activity has a sufficient effect. Would not be. If the average fragment length increases over time, shorter incubation times should be used and / or the concentration of DNA polymerase should be reduced to a range where fraction size remains constant over time.

Reversal of pyrophosphoresis or polymerase reactions has a similar effect as 3'-5 'exonuclease activity, allowing DNA polymerase to remove chain terminating dideoxynucleotides and also increase the length of the fragment ( See Tabor and Richardson. 265 J. Biol. Chem. 8322, 1990). This activity can be easily avoided by including pyrophosphatase in the reaction mixture to remove pyrophosphate, which accumulates during DNA synthesis and is a necessary substrate for pyrophosphorosis.

Example 7. Measurement based on gel electrophoresis of incorporation rate of dideoxynucleotide relative to deoxynucleotide by changing the ratio of dNTP to ddNTP

This embodiment is similar to that described in Example 6. This is a preferred test for DNA polymerase (eg, T7 DNA polymerase Y526F, E. coli DNA polymerase I and Taq DNA polymerase) that strongly identifies the incorporation of dideoxynucleotides, while it is also a DNA that efficiently incorporates ddNTPs. It works equally well for polymerases (eg T7 DNA polymerase, E. coli DNA polymerase I mutant F762Y and Taq DNA polymerase mutant F667Y). In this test, the ratio of ddNTP to dNTP was varied in the two different DNA polymerase preparations and the two were tested by comparing batches of dideoxy terminated radiolabeled fragments, keeping all other aspects of the reactant the same. The ratio required for DNA polymerase is determined to obtain fragments of average length for comparison.

The average length of a line of fragments is determined in one of two ways. First, the most effective for DNA polymerase incorporating ddNMP as effective, scanning autoradiography, and given exposure to a series of reactants containing a ddNTP: dNTP ratio that has been changed to be doubled using one DNA polymerase. Determine the location of large fragments that are visually visible, compare them to similar rows using a second DNA polymerase, and determine the ratio needed to generate fragments of comparable size for the two DNA polymerases. Positions that indicate the appearance of visible radioactive bands are usually relatively sharp and are easily observed by the naked eye. However, it is also possible to more accurately determine such a location using a phosphoimator to find the location in each lane where a specific threshold of radioactivity per unit area, starting at the top of the gel and descending the gel, occurs.

Some DNA polymerases are very strongly identified for incorporation of dideoxynucleotides, in which case it is difficult to add sufficient ddNTP to the reaction to clearly detect the location of the largest dideoxy terminated fragment on the modified polyacrylamide gel. For such DNA polymerases, alkaline agarose gel electrophoresis can be used to compare the length of dideoxy terminated fragments in different families. A separate method of determining the ratio of ddNTP: dNTPs required for two DNA polymerases to generate average length of dideoxy terminated fragments when using modified polyacrylamide gels is focused on one or several bands. To determine the ratio of ddNTP to dNTP required to obtain a specific level of radioactivity for these fragments, as analyzed by a phosphoimator for the two DNA polymerases tested.

These tests were performed using the six DNA polymerases described in Example 6. Reaction conditions were the same as described in Example 6 except for the concentrations of dNTP and ddNTP. All reactions contained 10 M 4dNTP. Each of the four ddNTP concentrations was varied by doubling to the following ranges for the following six DNA polymerases: T7 DNA polymerase, E. coli DNA polymerase I F762Y and Taq DNA polymerase F667Y, 0.02M to 1M and T7 DNA polymerase Y526F, E. coli DNA polymerase I, and Taq DNA polymerase, 100-200M. The reaction was carried out and samples were analyzed by modified polyacrylamide gel electrophoresis as described in Example 6. The gel was dried and autoradiography and phosphoimizer analysis was performed as described in Example 6. The following table summarizes the results from this experiment; The values shown for T7 DNA polymerase, E. coli DNA polymerase I F762Y, and Taq DNA polymerase F667Y are obtained by comparing the ratio of exponential decay in the strength of dideoxy terminated fragments obtained using a 1: 1 ratio of dNTP to ddNTP. Absolute ratio obtained in Example 6 by statistical analysis. The values obtained for T7 DNA polymerase Y526F, E. coli DNA polymerase I, and Taq DNA polymerase were compared for the series generated using T7 DNA polymerase, E. coli DNA polymerase I F762Y and Taq DNA polymerase F667Y, respectively. By determining the ratio of ddNTP to dNTP required to generate a row of dideoxy terminated fragments of average length of; That is, it was obtained by measuring the ratio of ddNTP: dNTP which represents a comparative distribution of dideoxy terminated fragments for each pair of wild type and mutant DNA polymerases.

Strongly identifying enzymes divided by ddNTP: dNTP used to obtain comparable distributions of dideoxy terminated fragments with relatively non-identifying enzymes (ie, containing tyrosine at critical positions) (ie, containing phenylalanine at significant positions) The ratio of ddNTP: dNTP used in the reaction with) yields a factor corresponding to the difference in efficiency between the two DNA polymerases in their use of ddNTP to their comparable dNTPs.

This factor was multiplied by the absolute ratio obtained for the T7 DNA polymerase, E. coli DNA polymerase I F762Y and Taq DNA polymerase F667Y of Example 6, respectively, for the T7 DNA polymerase Y526F, E. coli DNA polymerase I, and Taq DNA polymerase, respectively. The values shown below were obtained.

Polymerase Content Ratio

dG / ddG dA / ddA dT / ddT dC / ddC

T7 DNA

Polymerase 3.2 3.3 2.8 3.7

T7 DNA

Polymerase Y526F 6,400 7,300 8,400 11,000

Escherichia coli DNA

Polymerase I 140 720 1,100 250

Escherichia coli DNA

Polymerase I

F762Y 0.56 0.72 0.54 0.75

Taq DNA

Polymerase 1,400 4,700 4,500 2,600

Taq DNA

Polymerase F667Y 0.45 0.59 0.56 0.32

The table below summarizes the effect of using tyrosine instead of phenylalanine on the important select moieties of T7 DNA polymerase, E. coli DNA polymerase I, and Taq DNA polymerase when using ddNTP over dNTP.

    Residue     Average ratio increase in dN / ddN Use of ddNTP T7 DNA Polymerase Tyrosine (WT)  3.0  3,000 X Phenylalanine  8,000 E. coli DNA polymerase I Phenylalanine (WT)  600 Tyrosine  0.6  1000 X Taq DNA Polymerase Phenylalanine (WT)  3,000 Tyrosine  0.5  6,000 X

To use this test to determine the degree of identification of new DNA polymerase, the reaction was initially performed as described above using a ratio of ddNTP to a wide range of dNTPs, and was standard (ie, T7 DNA polymer). The distribution of dideoxy terminated fragments on the modified polyacrylamide gel for Laze) was compared. Identification of ddNTP by new DNA polymerase to T7 DNA polymerase by matching lanes with comparative average lengths of DNA fragments and dividing the ratio of ddNTP: dNTP of new DNA polymerase by the ratio using T7 DNA polymerase. Got level.

This test can be used to determine if modification of DNA polymerase reduces its ability to identify (ie, more efficiently incorporate dideoxynucleotides) with respect to ddNTP. Units were used for a series of reactions including varying ratios of ddNTP to dNTP as described above. The average length of dideoxy terminated fragments was compared at the same ratio of ddNTP to dNTP for both enzymes. If the modification resulted in a DNA polymerase that incorporates the dideoxynucleotide more efficiently, the average length of the dideoxy terminated fragment was modified DNA compared to the use of an unmodified DNA polymerase at the same freezing rate of ddNTP relative to dNTP. While shorter in reactions with polymerases, the average length will be longer in reactions with modified DNA polymerases if the modification resulted in a more distinct DNA polymerase for ddNTPs.

This test can be used to determine if the modification of DNA polymerase results in a decrease in its ability to identify analogs of ddNTP, eg, ddNTP of fluorescent tails. This is possible even if the concentration of the analog being tested is unknown. As an example of this, we compared Taq DNA polymerase and Taq DNA polymerase F667Y using each of four diedeoxy terminators (Part No. 401150) manufactured by Applied Biosystems. These dideoxy terminators have different fluorescent moieties covalently bound to each of the four ddNTPs (see Example 12 for more details). The ratio of dNTP to dideoxy terminator for each dideoxy terminator varied from 16,000 times in the range of 2 times, and the pattern of dideoxy terminated fragments was compared on autoradiography to didideoxy for each of the two enzymes The ratio required to obtain the same average length of the terminated fragments was determined. The results are summarized in the following table. For each terminator, the column labeled "ratio" represents the ratio of ddNTP to dNTP necessary to obtain fragments of the same average length for Taq DNA polymerase to Taq DNA polymerase F667Y. When using normal ddNTPs, Taq DNA polymerase F667Y incorporates fluorescent ddNTP derivatives more efficiently at a ratio of 400 or more than unmodified Taq DNA polymerase.

Dideoxy Terminator B

G terminator> 400

A terminator> 2,000

T terminator> 2,000

C terminator> 2,000

As already discussed, one problem that may arise when using this test is when the DNA polymerase has associated exonuclease activity. Problems in which 5'-3 'and 3'-5' exonuclease activity are induced and methods of minimizing their effects when present are discussed in Example 6. When tested to determine if modification of the polymerase reduces the ability to incorporate dideoxynucleotides, one type of mutation that may have this effect normally inactivates the highly active 3'-5 'exonuclease activity. (See, eg, Tabor and Richardson 84, Proc. Natl. Acad. 4767, 1987). Mutants of this class are not claimed in this patent. If you have a modified DNA polymerase that results in a clear increase in the ability of the DNA polymerase to incorporate dideoxynucleotides, and you want to determine if it is in the polymerase domain or the exonuclease domain, then the modified and unmodified enzyme There is a need to perform exonuclease analysis for the form; Mutations that primarily affect the exonuclease activity of the enzyme will have a greater impact on the exonuclease activity of the enzyme than to the polymerase activity. Preferably, the exonuclease activity on the DNA substrate labeled at its 3 'end with ³² P-ddAMP will be measured (see Example 21). As in Example 6, it is important to inhibit pyrophosphorosis in these reactions to prevent increasing the apparent identification of ddNTPs by DNA polymerase. This is readily accomplished by including pyrophosphatase in the reaction.

Example 8. Determination of the efficiency of incorporation of dideoxynucleotides by inhibition of DNA synthesis on single stranded M13 DNA-labeled 40-mer primer complex

The susceptibility of DNA polymerase to ddNTP in this example was determined by measuring the ability of ddNTP at various concentrations to inhibit standard DNA synthesis reactions. DNA synthesis assays are described in Tabor and Richardson J. Biol. Chem. 6447, 1989]. 40-mer primer and M13 mGP1-2 template were as described in Example 3. Primer was a reaction mixture containing ₂ g of M13 mGP1-2 DNA, 6 pmol primer (10-fold excess to template), 40 mM Tris-HCl, pH 6.0, 10 mM MgCl ₂ , and 100 mM NaCl (1 × = 25 L) Annealed to M13 mGP1-2 single stranded DNA template. The mixture was incubated at 65 ° C. for 2 minutes and then cooled to room temperature over 30 minutes. Standard reaction mixture (45 L) contained 22 mM Tris-HCl, pH 8.0, 5.5 mM MgCl ₂ , 55 mM NaCl, 300 M dGTP, dATP, dCTP and [ ³ H] TTP (30 cpm / pmol) The concentration of one or all four ddNTPs was varied. The reaction mixture also contained 10 ng of yeast inorganic pyrophosphatase, which inhibited pyrophosphoresis, which could otherwise increase clear identification by DNA polymerases. Tabor and Richardson 265 J. Biol. Chem. 8322, 1990]. The mixture was incubated at 37 ° C. for 1 minute (70 ° C. for thermophilic DNA polymerase) and the reaction diluted in 20 mM Tris-HCl, pH 7.5, 10 mM 2-mecaptoethanol and 0.05% bovine serum albumin. It was initiated by adding 5 liters of purified water of each dilution (0.01 to 1 unit) of each DNA polymerase to be made. The reaction was terminated by addition of 5 L of 100 mM EDTA and spotted on a 45 L Whatman DE81 filter disc. The disks were washed with 150 ml of 0.3 M ammonium formate, pH 8.0 four exchanges followed by 150 ml of 90% ethanol twice exchange and each was run for 5-10 minutes. The disks were then dried under a heat lamp and counted in a scintillation counter in the presence of 5 ml of fluorine (Opti-Fluor O, Packard). From the amount of radioactivity on each disk, the total amount of DNA synthesis was calculated.

The particular DNA polymerase tested may have optimal buffers, pH, salts and reaction conditions that differ from those set forth above. Each DNA polymerase should be tested under conditions that result in an optimal specific polymerase for that enzyme.

 In order to determine if a modification of a given DNA polymerase results in a decrease in its ability to discriminate against dideoxynucleotides, a series of reactions are first performed by varying the concentration of DNA polymerase in the absence of ddNTP to modify the enzyme. And ranges that varied approximately linearly in enzyme concentration for both and unmodified forms. For both forms of enzymes, enzyme concentrations present in this linear range were selected; That is, enzyme concentrations where about 30% of the template replicates in a 10 minute reaction are likely to fall within such a linear range.

Once a suitable enzyme concentration is selected, a series of reactions are performed by varying the amount of one ddNTP or preferably all four ddNTPs in the mixture to determine the concentration required to inhibit 50% DNA synthesis. For example, under the conditions described above (300 M 4dNTP), the next concentration of a mixture of 4 ddNTPs is needed to inhibit DNA synthesis 50% for the next 6 DNA polymerases.

      Polymerase  [4ddNTP] for 50% Inhibition  T7 DNA Polymerase   0.1 μM  T7 DNA Polymerase Y526F   300 μM  E. coli DNA polymerase I   20 μM  Escherichia coli DNA polymerase I F762Y   0.04 μM  Taq DNA Polymerase   150 μM  Taq DNA Polymerase F667Y   0.4 μM

This test can be used to determine if modifications in novel DNA polymerases reduce their ability to identify ddNTPs; If this mutation had this effect, higher concentrations of 4 ddNTPs would be needed to inhibit 50% of DNA synthesis in the assay described above.

Example 9. [a- ³² Measurement of the efficiency of incorporation of dideoxynucleotides by measurement of incorporation of P] dAMP into the synthetic primer-template complex

In this example the competition between dNTP and ddNTP was analyzed for use at a single site in the synthetic primer-template. This analysis differs from others in that it limits the use of two substrates for a single site and avoids the problem of sequence specificity variability in identification.

While this relatively simple assay is suitable for the primary screening of DNA polymerases for their ability to identify ddNTPs, it should not be used for the exclusion of the assays presented in Examples 6-8, in which the identification for ddNTPs sometimes occurs in adjacent sequences. It is strongly influenced by, which is an important issue for DNA sequencing [Tabor and Richardson, 265 J. Biol. Chem. 8322, 1990].

The two primer-templates shown below were used in this example. The first was used to determine the distinction between dATP to ddATP, while the second was used to determine the distinction between dCTP to ddCTP, dTTP to ddTTP and dGTP to ddGTP.

Primer-Template A:

5 'GGCGACGTTGTAAAACGACGGCCAGTGCCA 3'

3 'GCTGCAACATTTTGCTGCCGGTCACGGTTCCCC 5'

Primer-Template B

5 'GGCGACGTTGTAAAACGACGGCCAGTGCCA 3'

3 'GCTGCAACATTTTGCTGCCGGTCACGGTCAGTTTT 5'

Each reaction mixture contains 25 pmol of each primer and template. Primers and templates were mixed together and annealed in a reaction mixture containing 40 mM Tris-HCl, pH 8.0, 10 mM MgCl ₂ , and 100 mM NaCl. The mixture was incubated at 65 ° C. for 2 minutes and then cooled to room temperature over 30 minutes. Standard reaction mixture (45 L) for the reaction was 22 mM Tris-HCl, pH 8.0, 5.5 mM MgCl ₂ , 55 mM NaCl, Primer-Template A Complex 25 pmol, 5 M [a- ³² P] dGTP (4000 cpm / pmol) And the concentrations of dATP and ddATP were varied. The reaction mixture also contained 10 ng of yeast inorganic pyrophosphatase, which inhibited pyrophosphoresis, which could otherwise increase the apparent identification by DNA polymerase. Tabor and Richardson 265 J. Biol. Chem. 8322, 1990]. The mixture was incubated at 37 ° C. for 1 minute (70 ° C. for thermophilic DNA polymerase) and the reaction diluted in 20 mM Tris-HCl, pH 7.5, 10 mM 2-mecaptoethanol and 0.05% bovine serum albumin. It was initiated by adding 5 liters of purified water of each dilution (0.01 to 1 unit) of each DNA polymerase to be made. The reaction was terminated by addition of 5 L of 100 mM EDTA and 45 L spotted on Whatman DE81 filter discs. The disks were washed by four exchanges with 150 mL of 0.3 M ammonium formate, pH 8.0 followed by two exchanges with 150 mL of 90% ethanol and each for 5-10 minutes. The disks were then dried under a heat lamp and counted in a scintillation counter in the presence of 5 ml of fluorine (Opti-Fluor O, Packard). From the amount of radioactivity on each disk, the amount of [ ³² P] dGTP incorporated was determined. Assuming that a single dAMP residue is incorporated to remove the block for incorporation of the dGMP residue, four [ ³² P] dGMP will incorporate each primer, so the number of dAMPs incorporated is 1 of the number of dGMPs incorporated. / 4.

All reactions used a certain amount of DNA polymerase to be analyzed; The amount of DNA polymerase should be sufficient to replicate 50% of the total dCMP residues of the single stranded region of the template in the presence of 10 M dATP and in the absence of ddATP for 10 minutes. The particular DNA polymerase tested may have optimal buffers, pH, salts and reaction conditions that differ from those set forth above. Each DNA polymerase should be tested under conditions that result in an optimal specific polymerase for that enzyme. Control reactions in which neither dATP nor ddATP are present should also be performed; This is defined as the background DNA synthesis that should be subtracted from each sample. Generally less than 10% of the DNA synthesis obtained when ddATP is present.

The reaction was then performed with 10 M dATP and various concentrations of ddATP to determine the amount of ddATP needed to inhibit 50% DNA synthesis. The following table shows an example of the concentration of ddATP required to inhibit 50% DNA synthesis in the presence of 10 M dATP.

      Polymerase  [DdATP] for 50% Inhibition  T7 DNA Polymerase   30 μM  T7 DNA Polymerase Y526F   > 500 μM  E. coli DNA polymerase I   > 500 μM  Escherichia coli DNA polymerase I F762Y   6 μM  Taq DNA Polymerase   > 500 μM  Taq DNA Polymerase F667Y   5 μM

To perform a similar test to determine the identification for ddGTP, ddTTP or ddCTP, the reaction was used with primer-template B instead of primer-template A, 10 M dGTP, dTTP and dCTP and 5 M [a- ³² P] The same procedure was performed as above except that dATP (4,000 cpm / pmol) and one of various concentrations of ddGTP, ddGTP or ddCTP were used.

As with other examples, DNA polymerases with 3'-5 'exonuclease activity may interfere with this assay, which allows for more identification for ddNTPs than due to identification at the incorporation concentrations of analogs. In addition, enzymes with high levels of exonuclease activity consume all of the dNTP in the reaction mixture (especially with relatively low concentrations of dNTP present in these reactions), resulting in pure DNA synthesis (eg, native T7 DNA polymerase). , See, eg, Tabor and Richardson. 264 J. Biol. Chem. 6447, 1989). In these cases, the concentration of DNA polymerase and the incubation time of the reaction are adjusted to obtain the optimal concentration of DNA synthesis in the absence of ddNTP.

Example 10. [a- ³² Measurement of incorporation efficiency of P] ddNMP into synthetic primer-template complex

In this example the competition between dNMP and ddNMP was analyzed for incorporation at a single site of the synthetic primer-template. This analysis differs from Example 9 in that the label is [a- ³² P] ddATP and therefore measures the incorporation of ddATP. This assay also tests whether ddNTPs inhibit DNA polymerase by acting as a chain terminator that is incorporated into the 3 'end of the primer or simply binds to the DNA polymerase and does not actually incorporate into the primer and interfere with further DNA synthesis. It can also be used.

In the following example the incorporation of ddAMP was measured using [a- ³² P] ddATP and primer-template A (Example 9).

Primer-Template A:

5 'GGCGACGTTGTAAAACGACGGCCAGTGCCA 3'

3 'GCTGCAACATTTTGCTGCCGGTCACGGTTCCCC 5'

The incorporation of [a- ³² P] ddGMP, [a- ³² P] ddCMP and [a- ³² P] ddTMP can be tested similarly on appropriate templates (eg, primer-template B in Example 9).

Each reaction mixture contains 25 pmol of each primer and template (primer-template A, see above). Primers and templates were mixed together and annealed in a reaction mixture (1 × = 10 L) containing 40 mM Tris-HCl, pH 8.0, 10 mM MgCl ₂ , and 100 mM NaCl. The mixture was incubated at 65 ° C. for 2 minutes and then cooled to room temperature over 30 minutes. The standard reaction mixture for reaction (45 L) was 2.5M diluted with enzymatic activity of 4,000 cpm / pmol with 22 mM Tris-HCl, pH 8.0, 5.5 mM MgCl ₂ , 55 mM NaCl, 25 pmol primer-template A complex, cold ddATP [a- ³² P] ddATP (Amersham PB10235,> 5000 Ci / mmol) was contained and the concentration of dATP was varied. The reaction mixture also contained 10 ng of yeast inorganic pyrophosphatase, which inhibited pyrophosphoresis, which could otherwise increase clear identification by DNA polymerases. Tabor and Richardson 265 J. Biol. Chem. 8322, 1990]. The mixture was incubated at 37 ° C. for 1 minute (70 ° C. for thermophilic DNA polymerase) and the reaction diluted in 20 mM Tris-HCl, pH 7.5, 10 mM 2-mecaptoethanol and 0.05% bovine serum albumin. It was initiated by adding 5 liters of purified water of each dilution (0.01 to 1 unit) of each DNA polymerase to be made. The mixture was further incubated at 37 ° C. for 10 minutes (70 ° C. for thermophilic DNA polymerase). The reaction was terminated by addition of 5 L of 100 mM EDTA and 45 L spotted on Whatman DE81 filter discs. The disks were washed by four exchanges with 150 mL of 0.3 M ammonium formate, pH 8.0 followed by two exchanges with 150 mL of 90% ethanol and each for 5-10 minutes. The disks were then dried under a heat lamp and counted in a scintillation counter in the presence of 5 ml of fluorine (Opti-Fluor O, Packard). From the amount of radioactivity on each disk, the amount of [ ³² P] ddAMP incorporated was determined.

All reactions used a certain amount of DNA polymerase to be analyzed; The amount of DNA polymerase should be at a concentration that represents the highest level of incorporation into primer-template A in a 10 minute reaction in the absence of dATP. The particular DNA polymerase tested may have optimal buffers, pH, salts and reaction conditions that differ from those set forth above. Each DNA polymerase should be tested under conditions that result in an optimal specific polymerase for that enzyme.

For use in determining the level of the identification of the analysis to the ddNTP, and carried out with dATP in the presence or absence 2.5M under constant amount of the DNA polymerase and ^[32 P] ddATP of the ^([32 P] equimolar concentration for ddATP), The effect of the presence of dATP on the incorporation of [ ³² P] ddATP was determined. If the DNA polymerase does not discriminate between the incorporation of ddAMP and dAMP, and it does not have 3'-5 'exonuclease activity, the addition of dATP will inhibit 50% incorporation of [ ³² P] ddATP.

This test is the best for DNA polymerase that efficiently incorporates ddNMP, such as Taq DNA polymerase F667Y. For DNA polymerases that strongly incorporate ddNMP, the above analysis is preferred, wherein the label is in dNTP other than that used in competition with ddNTP, in which case higher concentrations of ddNTP can be used. However, if you have a DNA polymerase that strongly identifies ddNMP and are interested in testing whether a given mutation reduces the level of identification, this assay analyzes the unmodified DNA polymerase on this substrate in the absence of dATP (DNA polymer). By measuring the incorporation of [ ³² P] ddAMP as a function of lase concentration), the incorporation ratio for that of the mutant enzyme can be compared. If the mutation reduces the incorporation for ddAMP, the mutant enzyme should have higher specific activity for incorporation of [ ³² P] ddAMP.

As with other examples, DNA polymerases with 3'-5 'exonuclease activity may interfere with this assay, which allows for more identification for ddNTPs than due to identification at the incorporation concentrations of analogs. In addition, as in Example 9, enzymes with high levels of exonuclease activity can consume all of dNTP resulting in no incorporation of pure [ ³² P] ddAMP. In these cases, the concentration of DNA polymerase and the incubation time of the reaction are adjusted to obtain the optimal level of incorporation of [ ³² P] ddAMP by the DNA polymerase tested.

All of the above methods detect either the length of elongated primer or the amount of DNA synthesis on the primer based on radioactivity. The incorporation efficiency of dideoxynucleotides by DNA polymerase can also be measured using nonradioactivity. The two examples presented below use fluorescent primers or fluorescent dideoxy terminators detected on an Applied Biosystems Model 373A DNA sequencing system.

Example 11. Determination of the incorporation efficiency of dideoxynucleotides using fluorescent primers annealed to single strands and gel electrophoresis

In this example, fluorescently labeled primers were linked to single stranded DNA and DNA synthesis reactions were performed using various ratios of dNTP to ddNTP. Samples were loaded on an Applied Biosystems Model 373A DNA sequencing system and the length of each fluorescent fragment was determined by direct fluorescence detector during gel electrophoresis. The reaction is described in Tabor and Richardson 265 J. Biol. Chem. 8332, 1990]. The fluorescent primer used was a "Fam" primer (Applied Biosystems). The DNA used is single stranded M13 mGP1-2 DNA as described in Example 3. The primers were M13 mGP1-2 single stranded DNA template in a reaction mixture (1 × = 10 L) containing ₂ g of M13 mGP1-2 DNA, 5 ng of primer, 40 mM Tris-HCl, pH 8.0, 10 mM MgCl ₂ , and 100 mM NaCl. Annealed. The mixture was incubated at 65 ° C. for 2 minutes and then cooled to room temperature over 30 minutes. The standard reaction mixture (45 L) contained 22 mM Tris-HCl, pH 8.0, 5.5 mM MgCl ₂ , 55 mM NaCl and varied the concentration of one or all four ddNTPs. The reaction mixture also contained 10 ng of yeast inorganic pyrophosphatase, which inhibited pyrophosphoresis, which could otherwise increase clear identification by DNA polymerases. Tabor and Richardson 265 J. Biol. Chem. 8322, 1990]. The mixture was incubated at 37 ° C. for 1 minute (70 ° C. for thermophilic DNA polymerase) and the reaction diluted in 20 mM Tris-HCl, pH 7.5, 10 mM 2-mecaptoethanol and 0.05% bovine serum albumin. It was initiated by adding 2 liters of purified water of each dilution (0.01 to 1 unit) of each DNA polymerase to be made. The reaction mixture was further incubated at 37 ° C. for 10 minutes (70 ° C. for thermophilic DNA polymerase). The reaction was terminated by addition of 8 L 20 mM EDTA, 1 M potassium acetate, pH 5.0 and 60 L ethanol. After centrifugation, the DNA is suspended in 80% formamide, suspended in 6 l of 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, and loaded onto a polyacrylamide gel on an Applied Biosystems Model 373A DNA sequencing system according to the manufacturer's procedures. Heated at 80 ° C. for 2 minutes immediately before the following.

The particular DNA polymerase tested may have optimal buffers, pH, salts and reaction conditions that differ from those set forth above. Each DNA polymerase should be tested under conditions that result in an optimal specific polymerase for that enzyme. The concentration of DNA polymerase should be sufficient until most primers are stretched to at least several hundred nucleotides or incorporating dideoxynucleotides in a 10 minute reaction.

Adjust the ratio of dNTP to ddNTP to obtain an optimal peak intensity for approximately 300 bases. For example, approximately 10 M 4 dNTP and 200-600 M ddNTP are optimal for Taq DNA polymerase, while approximately 300 M 4 dNTP and 0.5-5 M ddNTP are optimal for Taq DNA polymerase F667Y.

 To determine whether a modification of a given DNA polymerase results in a decrease in its ability to identify for dideoxynucleotides, the reaction must be performed by varying the concentration of dNTP to ddNTP for both modified and unmodified forms, and The intensity of the dideoxy terminated fragments of length is compared to determine if modification of DNA polymerase uses ddNTP more efficiently than unmodified enzyme.

Example 12 Determination of the Incorporation Efficiency of Fluorescent Dideoxynucleotides by Gel Electrophoresis

In this example, non-fluorescent primers were linked to single stranded DNA and DNA synthesis reactions were performed using various ratios of dNTPs to single fluorescently labeled ddNTPs. Samples were loaded on an Applied Biosystems Model 373A DNA sequencing system and the length of each fluorescent fragment was determined by direct fluorescence detection during gel electrophoresis. The primer used in this example is 40-mer as described in Example 3, and the template is single stranded M13 mGP1-2 DNA as described in Example 3. Primer was a reaction mixture containing ₂ g of M13 mGP1-2 DNA, 6 pmol of primer (10-fold excess to template), 40 mM Tris-HCl, pH 8.0, 10 mM MgCl ₂ , and 100 mM NaCl (1 × = 10 L) Annealed to M13 mGP1-2 single stranded DNA template. The mixture was incubated at 65 ° C. for 2 minutes and then cooled to room temperature over 30 minutes. The standard reaction mixture (18 L) contained 22 mM Tris-HCl, pH 8.0, 5.5 mM MgCl ₂ , 55 mM NaCl, changing the concentration of 4dNTP + 4 fluorescently labeled ddNTPs.

Four fluorescently labeled ddNTPs were purchased from Applied Biosystems (Taq Dideoxy Terminator Cycle Sequencing Kit, Part No. 401150) and are referred to as G, A, T or C "dideoxy Terminators" (Taq Dideoxy Terminator Cycle sequencing kit, part number 901497, Rev. E). The reaction mixture also contained 10 ng of yeast inorganic pyrophosphatase, which inhibited pyrophosphoresis, which could otherwise increase clear identification by DNA polymerases. Tabor and Richardson 265 J. Biol. Chem. 8322, 1990]. The mixture was incubated at 37 ° C. for 1 minute (70 ° C. for thermophilic DNA polymerase) and the reaction diluted in 20 mM Tris-HCl, pH 7.5, 10 mM 2-mecaptoethanol and 0.05% bovine serum albumin. It was initiated by adding 2 liters of purified water of each dilution (0.01 to 1 unit) of each DNA polymerase to be made. The reaction mixture was further incubated at 37 ° C. for 10 minutes (70 ° C. for thermophilic DNA polymerase). The reaction was terminated by addition of 8 L 20 mM EDTA, 1 M potassium acetate, pH 5.0 and 60 L ethanol. After centrifugation, the DNA was suspended in 6 L of 80% formamide, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, and immediately prior to loading on the polyacrylamide gel on the Applied Biosystems Model 373A DNA sequencing system according to the manufacturer's procedure. Heated at 80 ° C. for 2 min.

The particular DNA polymerase tested may have optimal buffers, pH, salts and reaction conditions that differ from those set forth above. Each DNA polymerase should be tested under conditions that result in an optimal specific polymerase for that enzyme. The concentration of DNA polymerase should be sufficient until most primers are stretched to at least several hundred nucleotides or incorporating dideoxynucleotides in a 10 minute reaction. For DNA polymerases with 5'-3 'exonuclease activity such as Taq DNA polymerase and the like, the DNA polymerase concentration should be kept low enough to avoid this activity which degrades the critical proportion of the 5' end of the fragment. .

To determine if the DNA polymerase strongly or weakly identifies for fluorescence ddNTP, the reaction was performed using 20 M 4dNTP and 0.01 L of each dideoxy terminator provided by Applied Biosystems (part number 401150). When Taq DNA polymerase was used under these conditions, most of the fluorescence was present in the unincorporated dye-ddNTP on the front of the gel or in fragments of several hundred bases or more in length. In contrast, when using Taq DNA polymerase mutant F667Y, most of the fluorescence was present in fragments of several hundred bases in length under these conditions, with a significantly lower percentage of total fluorescence unincorporated dye-ddNTP at the front of the gel. Existed at

To determine whether a modification of a given DNA polymerase results in a decrease in its ability to identify for dideoxynucleotides, the reaction can be varied by varying the concentration of dNTPs for the dideoxy terminator for both unmodified and modified DNA polymerases. The average lengths of the resulting fluorescent fragments were compared to determine if the modified DNA polymerase uses the dideoxy terminator more efficiently than the unmodified enzyme.

The following provides a test to determine the uniformity of band intensities generated from dideoxy terminated fragments synthesized by different DNA polymerases.

Example 13. M13 DNA 5 ' ³² P] Measurement of uniformity of incorporation of dideoxynucleotides using labeled 40-mer primers and gel electrophoresis

In this embodiment, a single uniform dideoxy nucleotide incorporation was measured on a strand of 5 ^'32 P] labeled 40-mer M13 primer extension on a template DNA. Three activities can cause variability in band strength of dideoxy terminated fragments. One with exonuclease activity, which may be selective in some sequence; This can be avoided by selectively removing the activity by either chemical or genetic means [see, eg, Tabor and Richardson, 264, J. Biol. Chem. 6447, 1989].

The second is pyrophosphorolysis; This can be easily avoided by degrading pyrophosphate that accumulates during DNA synthesis and including the necessary substrates for pyrophosphorosis in the reaction mixture. Third is sequence specificity variation in incorporation of dideoxynucleotides. Variability in band intensity is detrimental to DNA synthesis analysis and reduces the accuracy of the DNA sequence measured. This test was designed to compare the degree of variability in band intensities for fragments synthesized by different DNA polymerases, including mutant DNA polymerases that incorporate more efficiently dideoxynucleotides.

The primers, templates and reaction conditions used in this example are the same as described in Examples 6 and 7. The template is a single stranded M13 mGP1-2 DNA as described in Example 3 and the primer is also a 40-mer as described in Example 3. Reaction conditions were used that were optimal for the DNA polymerase tested in relation to buffer, pH, salt and reaction temperature. It is preferred that magnesium is the only metal ion present in the reaction mixture (ie the reaction is carried out without addition of manganese ions). The concentration of DNA polymerase is chosen such that most primers are elongated in a 10 minute reaction and terminated by incorporation of dideoxynucleotides. The ratio of dNTPs to ddNTPs is adjusted for the particular DNA polymerase tested to give an average fragment length of approximately 100-300 nucleotides. ddCTP is the preferred ddNTP used for testing of uniformity because fragments terminated with these dideoxynucleotides tend to have the strongest variability in strength [eg, Tabor and Richardson, Proc. Natl. Acad. Sci. USA. 4076, 1989]. Analysis of band intensities by either gel electrophoresis, autoradiography and gel injection or phosphoimator analysis was performed as described in Example 6. Electrophoresis is performed until fragments of approximately 55 nucleotides in length reach the bottom of the gel (dye bromo phenol blue cow is off the bottom of the gel and dye xylene cyanool is approximately 8 cm from the bottom of the gel).

For a given row of ddNMP terminated fragments, such as a row of ddCMP terminated fragments, the strength of the first 20 fragments from the bottom of the gel is preferably determined by phosphoimizer analysis. Alternatively, autoradiography is scanned with an image density meter to determine the relative intensity of the first 20 fragments. These intensities are then statistically analyzed as described in Example 6 to determine their variability. For example, the value can be plotted using the Macintosh program Kaleidograph version 3.0 (Synergy Software). The plot of the result fits the exponential decay curve using the Kaleidograph library routine for this function. R ² , the correlation index for the data is calculated by the Kaleidograph library routines. This is a measure of variability in band intensity. The values obtained for R ² using the novel DNA polymerase are determined by 28 T7 DNA polymerase (SEQUENASE version 2.0, United States Biochemical Corporation), E. coli DNA polymerase in the presence of known DNA polymerases, eg magnesium or manganese. Compare to I (Klenau fragment or Klenau fragment with mutant F762Y) or Taq DNA polymerase (wild type or mutant F667Y). Tabor and Richardson, 265, J. Biol. Chem. 8332, 1990]. The R ² values obtained for these known DNA polymerases are used as a standard to compare new DNA polymerases to their uniformity.

Example 14. Single stranded M13 DNA DNA-labeled primer complex and gel electrophoresis [a- ³² Measurement of uniformity of incorporation of P] ddNMP

In this example, homogenization of dideoxynucleotide incorporation was measured using unlabeled primers stretched on a single stranded M13 DNA template and DNA synthesis was performed in the presence of [a- ³² P] ddNTPs. The test described in Example 13 is preferred over this in determining the uniformity of dideoxynucleotide terminated fragments, which is more suitable for the use of high concentrations of ddNTP, E. coli DNA polymerase I, Taq DNA polymerase and T7. This is because they are necessary for use in enzymes that strongly identify ddNTP such as DNA polymerase Y526F. The test in this Example is most suitable for use with enzymes that efficiently incorporate dideoxynucleotides such as T7 DNA polymerase, E. coli DNA polymerase I F762Y and Taq DNA polymerase F667Y.

The primers, templates and general reaction conditions used in this example are similar to those described in Example 8 except for the following. The template is a single stranded M13 mGP1-2 DNA as described in Example 3 and the primer is also a 40-mer as described in Example 3. Reaction conditions were used that were optimal for the DNA polymerase tested in relation to buffer, pH, salt and reaction temperature. It is preferred that magnesium is the only metal ion present in the reaction mixture (ie the reaction is carried out without addition of manganese ions). The reaction was performed with 50M dGTP, dCTP and dTTP and varying concentrations of dATP and [a- ³² P] ddATP. The concentrations of dATP and [a- ³² P] ddATP are chosen to minimize the amount of radioactivity for fragments of approximately 100 nucleotides in length. All other aspects of gel electrophoresis and analysis of radioactive fragments are as described in Example 13.

Example 15 Determination of Uniformity of Incorporation of Dideoxynucleotides Using Single Strand M13 DNA DNA-Fluorescent Labeled Primer Complex and Gel Electrophoresis

In this example, the reaction was carried out as described in Example 11. The template is a single stranded M13 mGP1-2 DNA as described in Example 3 and the primer is also a 40-mer as described in Example 3. Reaction conditions were used that were optimal for the DNA polymerase tested in relation to buffer, pH, salt and reaction temperature. It is preferred that magnesium is the only metal ion present in the reaction mixture (ie the reaction is carried out without addition of manganese ions). The concentration of DNA polymerase is chosen such that most primers are elongated in a 10 minute reaction and terminated by incorporation of dideoxynucleotides. The ratio of dNTPs to ddNTPs is adjusted for the particular DNA polymerase being tested so that the average fragment length is approximately 100-200 nucleotides. ddCTP is the preferred ddNTP used for testing of uniformity because fragments terminated with these dideoxynucleotides tend to have the strongest variability in strength [eg, Tabor and Richardson, Proc. Natl. Acad. Sci. USA. 4076, 1989]. Intensities from primers (approximately 200 nucleotides) to the first 50 dideoxy terminated fragments were measured and these were analyzed statistically as described in Example 13. The correlation index R ² is determined for the DNA polymerase tested and compared to that obtained with the known DNA polymerase as described in Example 13. Alternatively, the height of the first 50 bands is measured and the ratio of the heights of adjacent bands is calculated and used as a measure of variability; The maximum and average of these ratios obtained from the reactions performed with the DNA polymerase tested are compared with the values obtained from the reactions performed using known DNA polymerases as described in Example 13.

Example 16 Determination of Uniformization of Incorporation of Fluorescent Dideoxynucleotides by Gel Electrophoresis

In this example, the reaction was carried out as described in Example 12. To determine the uniformity of incorporation of the dideoxy terminator for the particular DNA polymerase, the concentrations of dNTP and the particular dideoxy terminator were chosen to obtain fluorescently labeled fragments with an average of 100-200 nucleotides in length. The intensity of fluorescence was determined for 10 to 40 fragments from primers (ignoring the first 10 fragments near the primers labeled by fluorescence). The fragments were analyzed statistically as described in Example 13, and the mean variability is defined by R ² , the correlation index for the data fitted to the exponential decay curve. The values obtained for R ² were compared to those obtained using known DNA polymerases as described in Example 13. To determine if a particular mutation in the DNA polymerase results in the DNA polymerase producing a band with less variability, the R ² values obtained for the mutant DNA polymerase are compared to those obtained for the unmodified DNA polymerase.

Example 17 DNA Sequence Analysis Using DNA Polymerase Efficiently Incorporating Dideoxynucleotides

DNA sequencing using the DNA polymerases of the present invention was performed using standard methods by adjusting the ratio of dNTPs to ddNTPs adjusted to obtain average length of dideoxy terminated fragments suitable for separation by electrophoresis. For large fragments of Escherichia coli DNA polymerase I (“Clenau fragment F862Y), reactions were carried out using essentially modified T7 DNA polymerases, see Tabor and Richardson, US Pat. No. 4,795,699 and Tabor and Richardson. , 84, Proc. Natl. Acad. Sci. USA 4647, 1987 and SEQUANSE Manual, "Step-By-Step Protocols for DNA Sequencing With SEQUANSE" 3rd Edition, United States Biochemical Corporation. Because fragment F762Y incorporates about 5 times more efficiently than dideoxynucleotide than modified T7 DNA polymerase, the concentration of ddNTP in the kidney-termination mixture is 5 times compared to the standard response recommended for modified T7 DNA polymerase. You should subtract the factor of (see above, see SEQUANSE manual).

DNA sequencing using thermostable DNA polymerases, such as Taq DNA polymerase F667Y, is described in Innis et al., Proc. Natl. Acad. Sci. USA 9436, 1988]. Innis et al. Recommend a ratio of dNTP / ddNTP of 1: 6 dGTP: ddGTP, 1:32 dATP: ddATP, 1:48 dTTP: ddTTP, and 1:16 dCTP: ddCTP, while these ratios represent wild type Taq DNA polymerase. Must be adjusted to account for 3,000-8,000 times more efficient use of 4 ddNTPs by Taq DNA polymerase F667Y as compared to. Thus, the extension-termination reaction with Taq DNA polymerase F667Y should include 0.1-5M of each of 100M 4dNTP and 4 ddNTPs; The exact amount of each ddNTP should be adjusted based on the desired average fragment size for optimal determination of the DNA sequence. All other aspects regarding DNA sequencing reactions and denaturation gel electrophoresis are as described by Innis et al., Supra.

Example 18 DNA Sequence Analysis Using Thermostable DNA Polymerase Efficiently Incorporating Dideoxynucleotides

Cyclic DNA sequencing with thermostable DNA polymerases such as Taq DNA polymerase F667Y was performed as described in Carers et al., 7 BioTechniques 494, 1980, except: (1) four The deoxy / dideoxy NTP mixture contains all four dNTP 250 M and any one of ddGTP, ddATP, ddTTP and ddCTP 0.1-10 M, the exact amount of each ddNTP based on the average fragment size for optimal determination of DNA sequence Empirically adjusted. (2) Instead of Taq DNA polymerase, Taq DNA polymerase F667Y was used, and the same number as the units of DNA polymerase recommended by Carrotus et al. Were used. (3) The reaction mixture contains 10 ng of yeast inorganic pyrophosphatase, which may otherwise increase the apparent distinction by DNA polymerase in a particular DNA sequence, thereby reducing the uniformity of band intensities. (Tabor and Richardson 265 J. Biol. Chem. 8322, 1990]. Preferably, this pyrophosphatase is purified from thermophilic organisms, such as Thermus thermophilus, Hohne et al., 47 Biomed. Biochem. Acta. 941, 1988.

Example 19. Automated Cycle DNA Sequencing Using Modified Taq DNA Polymerase and Fluorescent Primers

Cyclic DNA sequencing and Applied Biosystems Dye primers using thermostable DNA polymerases such as Taq DNA polymerase F667Y modified the Applied Biosystems Manual (part no. 901482, Rev. B). The process is as described in the manual except for the following modifications: (1) The dNTP / ddNTP mixture should be modified to allow for more efficient use of ddNTP by Taq DNA polymerase F667Y as compared to Taq DNA polymerase. New mixtures that should be used instead of those listed in the Applied Biosystems Manual include:

dG / ddG mixing = 100 Mc ⁷ dGTP, dATP, dTTP and dCTP, and 0.05M ddGTP

dA / ddT mixing = 100 Mc ⁷ dGTP, dATP, dTTP and dCTP, and 0.3M ddATP

dG / ddG mixing = 100 Mc ⁷ dGTP, dATP, dTTP and dCTP, and 0.25M ddTTP

dG / ddG mixing = 100 Mc ⁷ dGTP, dATP, dTTP and dCTP, and 0.15M ddCTP

The concentration for ddNTP should be modified to optimize the intensity of the fluorescence in the particular size range of fragments as applied. For example, increasing the concentration of ddNTP will increase the fluorescence of shorter fragments. (2) Taq DNA polymerase F667Y was used instead of Taq DNA polymerase. The same number of enzyme units were used in all cases when used under standard DNA polymerase assay conditions. Alternatively, the same number of DNA polymerases can be used. (3) The reaction mixture contains 10 ng of yeast inorganic pyrophosphatase, which increases the apparent distinction by DNA polymerase in a particular DNA sequence, thereby reducing the fatigue uniformity of the band intensity. Inhibited. Tabor and Richardson 265 J. Biol. Chem. 8322, 1990]. Preferably, the pyrophosphatase is purified from thermophilic organisms, such as Thermus thermophilus, Hohne et al., 47 Biomed. Biochem. Acta. 941, 1988. Other Processes All aspects are as described in the Applied Biosystems Manual above.

Example 20. Automated Cycle DNA Sequencing Using Modified Taq DNA Polymerase and Fluorescent Die Terminator

Cyclic DNA sequencing and Applied Biosystems Di Primer using a thermostable DNA polymerase such as Taq DNA Polymerase F667Y modified the Applied Biosystems Manual (Part No. 901482, Rev. B). The process is as described in the manual above except for the following modifications: (1) The manual requires the use of 1 l of each of the 4 dideoxy terminators not diluted in each sequencing reaction (20 l). In this example, the terminators should be diluted prior to addition to the sequencing reaction because they are incorporated several hundred times more efficiently in Taq DNA polymerase F667Y than Taq DNA polymerase. 1 L of each of the following dilutions is added to each sequencing reaction instead of 1 L of the undiluted terminator solution:

Dideoxy G Terminator, 1 to 500 in H ₂ O

Dideoxy A terminator, 1 to 1,500 in H ₂ O

Dideoxy T terminator, 1 to 1,500 in H ₂ O

Dideoxy C Terminator, 1 to 1,000 in H ₂ O

These dilutions are only approximate; The exact dilution of each dideoxy terminator should be determined empirically depending on the number of bases in the DNA sequence determined from the primers. (2) Taq DNA polymerase F667Y was used instead of Taq DNA polymerase. The same number of enzyme units were used in all cases when used under standard DNA polymerase assay conditions. Alternatively, the same number of DNA polymerases can be used. (3) The reaction mixture contains 10 ng of yeast inorganic pyrophosphatase, which increases the apparent distinction by DNA polymerase in a particular DNA sequence, thereby reducing the fatigue uniformity of the band intensity. Inhibited. Tabor and Richardson 265 J. Biol. Chem. 8322, 1990]. Preferably, this pyrophosphatase is purified from thermophilic organisms, such as Thermus thermophilus, Hohne et al., 47 Biomed. Biochem. Acta. 941, 1988.

Since this process uses less than 500 times the dideoxy terminator than the above process, the problem of unincorporated dideoxy terminator is much less after the reaction is completed. Thus, there is no need to remove the unincorporated dideoxy terminator by passing the sample on a spin column as recommended in the Applied Biosystems Manual (supra). Furthermore, samples were precipitated with ethanol, dissolved in 5 L deionized formamide and 50 mM EDTA, pH 8.0, 1 L, heated at 90 ° C. for 2 minutes, and followed by the instructions of the Applied Biosystems 373A DNA sequence according to the instructions in the 373A User's Manual. You can load the system. When using a DNA polymerase that efficiently incorporates a dideoxy terminator (such as Taq DNA polymerase F667Y), it is possible that a concentration of DNA sequencing reaction by ethanol precipitation is not required; The DNA cycle sequencing process, preferably performed using high concentrations of primers and dNTPs (see below), is terminated by the addition of deionization equal volume of formamide, heated at 90 ° C. for 2 minutes, and immediately followed by Applied Biosystems The 373A DNA sequencing system can be loaded. This saves the preparation time of the researchers' samples for DNA sequencing identification.

The process initially uses relatively low concentrations of dNTP (7.5M dATP, dTTP and dCTP and 37.5 M dITP). The concentration of dNTPs decreases during cycle DNA sequencing reactions as dNTPs are used. The concentration of this dNTP (less than 7.5M) is less than optimal for maximum DNA polymerase activity for most DNA enzymes. This low concentration is necessary because the DNA polymerase used strongly identifies ddNTP, requiring a high ratio of ddNTP to dNTP. The use of the DNA polymerase of the invention, which is less discriminating against dideoxy terminator, now allows the use of higher concentrations of dNTP. For example, in the above-described protocol, 10 times higher concentrations of dNTP and dideoxy terminators can be used: for example following each of 75M dATP, dTTP and dCTP, 375 M dITP and four dideoxy terminators. Dilution of: dideoxy G terminator, 1-50 in H ₂ O; Dideoxy A terminator, 1 to 150 in H ₂ O; Dideoxy T terminator, 1 to 100 in H ₂ O; 1-100 in didideoxy C terminator, H ₂ O. Thus, the diedeoxy terminator concentration in this example is still at least 50 times lower than in the above described protocol.

Example 21. ³² Exonuclease activity using P] ddAMP terminated DNA substrate

3 '[ ³² P] ddAMP terminated DNA substrate was double stranded bovine thymus DNA, 40 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 5 mM dithiothreitol, 50 mM NaCl, 50 g / ml BSA, 10 Natural bovine thymic DNA was prepared by digesting with Hind III in a reaction mixture (50 L) containing unit Hind III. After incubation at 37 ° C. for 60 minutes, [a- ³² P] ddATP (Amersham PB10235,> 5000 Ci / mmol) and 5 units of SEQUENASE Version 2.0, United States Biochemical Corporation, Catalog No. 70775) were added and the mixture was added. Incubate at 20 ° C. for 15 minutes. The reaction mixture was extracted once with an equal volume of phenol: chloroform: isoamyl alcohol (24: 24: 1) and the reaction mixture was extracted with Sephadex G100 (Pharmacia) in 20 mM Tris-HCl, pH 7.5, 100 mM NaCl. Fractionation on 1 ml column. 3 ^'32 P- labeled DNA eluting with a blank volume has an approximate specific activity of 500 cpm / ng of total DNA.

Response to the exonuclease activity mixture (90ℓ) is containing 40 mM Tris-HCl, pH 7.5 , 10 mM MgCl 2, 10 mM dithiothreitol, 50 mM KCl, 1 nmol 3 '32 P- labeled DNA do. The reaction mixture also contained 10 ng of yeast inorganic pyrophosphatase, which inhibited pyrophosphoresis, which could otherwise increase clear identification by DNA polymerases. Tabor and Richardson 265 J. Biol. Chem. 8322, 1990]. The reaction mixture was preincubated at 20 ° C. for 1 minute, then 10 L of the appropriate enzyme dilution was added. After incubation at 37 ° C. for the indicated time, the reaction was stopped by adding 30 L bovine serum albumin (mg / mL) and 30 L trichloroacetic acid (100% w / v). Precipitated DNA was incubated at 0 ° C. for 15 minutes and then pelleted by centrifugation at 12,000 g for 30 minutes. Acid-soluble spinning was measured in 100 l of supernatant. One unit of 3 '[ ³² P] ddAMP-DNA exonuclease activity catalyzes 1 pmol of acid solubility of [ ³² P] ddAMP at 15 minutes.

Other embodiments are within the scope of the appended claims.

Sequence list

(1) General Information:

     (i) Applicant:

(A) Name: President & Fellows of Harvard College

       (B) Street: 17 Quincy Street

       (C) City: Cambridge

       (D) Note: Massachusetts

(E) Country: United States

       (F) ZIP Code (ZIP): 02138

    (ii) Communications Information:

(A) Recipient: Richard J. Warburg

Ryan & Ryan

       (B) Street: West 5th Street 633

       (C) City: Los Angeles, CA 90071

       (D) Country: United States

 (E) ZIP code (ZIP): 90071

       (A) Phone number: (213) 955-0440

       (B) Telefax: (213) 489-1600

(C) Telex number: 67-3510

     (iii) number of sequences: 24

     (iv) Name of the Invention: DNA polymerase for DNA sequencing with modified nucleotide binding sites

     (v) computer readable form:

(A) Medium type: 3.5 "diskette, 1.44 MB storage

(B) Computer: IBM PS / 2 Model 50Z or 55SX

(C) Operating System: IBM P.C. DOS (version 3.30)

(D) Software: WordPerfect (Version 5.0)

     (vi) Current application data:

(A) Application number: further grant

(B) filing date:

     (vii) Preliminary application data:

2 full-line applications, including the applications listed below

(A) Application number: 08 / 324,437

(B) Application date: October 17, 1994

(A) Application number: further grant

(B) Application date: November 10, 1994

(2) Information about SEQ ID NO: 1

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 1

Arg Arg Ser Ala Lys Ala Ile Asn Phe Gly Leu Ile Tyr Gly

                  5 10

(2) Information about SEQ ID NO:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: SEQ ID NO: 2

Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly

                  5 10

(2) information about SEQ ID NO:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) sequence description: SEQ ID NO: 3

Arg Asp Asn Ala Lys Thr Phe Ile Thr Gly Phe Leu Tyr Gly

                  5 10

(2) information about SEQ ID NO:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 4

Arg Asp Asn Ala Lys Thr Phe Ile Tyr Gly Phe Leu Tyr Gly

                  5 10

(2) information about SEQ ID NO:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) sequence description: SEQ ID NO: 5

Arg Arg Ser Ala Lys Ala Ile Asn Phe Gly Leu Ile Tyr Gly

                  5 10

(2) Information about SEQ ID NO:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 6

Arg Arg Ser Ala Lys Thr Phe Ile Tyr Gly Phe Leu Tyr Gly

                  5 10

(2) information for SEQ ID NO: 7

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 7

Arg Asp Asn Ala Lys Ala Ile Asn Phe Gly Phe Leu Tyr Gly

                  5 10

(2) information for SEQ ID NO: 8:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 8

Arg Asp Asn Ala Lys Ala Ile Ile Tyr Gly Phe Leu Tyr Gly

                  5 10

(2) information for SEQ ID NO: 9:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 9

Arg Asp Asn Ala Lys Thr Phe Asn Phe Gly Phe Leu Tyr Gly

                  5 10

(2) Information about SEQ ID NO: 10:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 10

Arg Asp Asn Ala Lys Thr Phe Asn Tyr Gly Phe Leu Tyr Gly

                  5 10

(2) information about SEQ ID NO:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 11

Arg Asp Asn Ala Lys Thr Phe Ile Phe Gly Phe Leu Tyr Gly

                  5 10

(2) information for SEQ ID NO: 12:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) sequence description: SEQ ID NO: 12

Arg Arg Ser Ala Lys Ala Ile Asn Phe Gly Leu Ile Tyr Gly

                  5 10

(2) information about SEQ ID NO:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 13

Arg Asp Asn Ala Lys Thr Phe Ile Tyr Gly Phe Leu Tyr Gly

                  5 10

(2) information about SEQ ID NO: 14:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) sequence description: SEQ ID NO: 14

Arg Arg Ser Ala Lys Thr Phe Ile Tyr Gly Leu Ile Tyr Gly

                  5 10

(2) Information about SEQ ID NO: 15:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 15

Arg Arg Ser Ala Lys Thr Phe Asn Phe Gly Leu Ile Tyr Gly

                  5 10

(2) information for SEQ ID NO: 16:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 16

Arg Arg Ser Ala Lys Ala Ile Ile Tyr Gly Leu Ile Tyr Gly

                  5 10

(2) information for SEQ ID NO: 17:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) sequence description: SEQ ID NO: 17

Arg Arg Ser Ala Lys Ala Ile Ile Phe Gly Leu Ile Tyr Gly

                  5 10

(2) information for SEQ ID NO: 18:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) sequence description: SEQ ID NO: 18

Arg Arg Ser Ala Lys Ala Ile Asn Tyr Gly Leu Ile Tyr Gly

                  5 10

(2) information for SEQ ID NO: 19:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 19

Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly

                  5 10

(2) information about SEQ ID NO: 20:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) sequence description: SEQ ID NO: 20

Arg Asp Asn Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly

                  5 10

(2) information about SEQ ID NO: 21:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) SEQ ID NO: 21

Arg Arg Ala Ala Lys Thr Phe Ile Tyr Gly Phe Leu Tyr Gly

                  5 10

(2) information for SEQ ID NO: 22:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) sequence description: SEQ ID NO: 22

Arg Arg Ala Ala Lys Thr Ile Ile Tyr Gly Val Leu Tyr Gly

                  5 10

(2) information for SEQ ID NO: 23:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) sequence description: SEQ ID NO: 23

Arg Arg Ala Ala Lys Thr Ile Ile Phe Gly Val Leu Tyr Gly

                  5 10

(2) information for SEQ ID NO: 24:

     (i) sequence properties:

(A) Length: 14

(B) type: amino acid

(C) Helix structure: single

(D) topology: linear

      (ii) sequence description: SEQ ID NO: 24

Arg Arg Ala Ala Lys Thr Ile Asn Tyr Gly Val Leu Tyr Gly

                  5 10

<Related Application Status>

This application is part of the ongoing application of Tabor and Richardson, entitled “DNA Polymerase for DNA Sequencing with Modified Nucleotide Binding Sites,” filed Oct. 17, 1994, the entirety of which is shown in FIG. Inc.) is incorporated herein by reference.

Claims (116)

T7 DNA polymerase residues within the dNMP binding site such that the ability of DNA polymerase to incorporate dideoxynucleotide relative to the corresponding deoxynucleotide is increased by more than 20 times compared to the ability of the corresponding naturally occurring unmodified DNA polymerase. A modified gene encoding a Pol I type DNA polymerase modified to encode a tyrosine residue at an amino acid position corresponding to 526 or an amino acid position corresponding to E. coli DNA polymerase residue 762. The modified gene of claim 1, wherein said modified DNA polymerase has sufficient DNA polymerase activity for use in DNA sequencing when combined with elements necessary for said DNA polymerase activity. The modified gene of claim 1 or 2, wherein the modified DNA polymerase has less than 500 units of exonuclease activity per mg of polymerase. The modified polymerase of claim 1 or 2, wherein said polymerase is a T7 type DNA polymerase selected from the group consisting of T7, T3, ØI, ØII, H, W31, gh-1, Y, A1122 and SP6. gene. A modified DNA polymerase encoded by the modified gene of claim 1. 6. The Pol of claim 5 wherein said polymerase is modified at an amino acid site of a region selected from that corresponding to DNA polymerase I of E. coli in regions 666-682, 710-755, 755-784, 798-867 and 914-928 Modified DNA polymerase, which is type I polymerase. The modified gene of claim 1 or 2, wherein the modified DNA polymerase is a thermostable enzyme. 8. The thermostable enzyme of claim 7, wherein the thermostable enzyme is activated by Termus aquaticus, Thermus thermophilis, Thermus flavus, and Bacillus sterothermophilus. The modified gene selected from the group consisting of DNA polymerase to be encoded.        3. The method of claim 1, wherein the ability of the polymerase to incorporate dideoxynucleotides relative to the corresponding deoxynucleotides is increased by at least 25 times compared to the corresponding naturally occurring unmodified DNA polymerase. Modified genes. 10. The modified gene of claim 9, wherein said ability has been increased by at least 50 fold. 10. The modified gene of claim 9, wherein said capacity is increased by at least 100 fold. 10. The modified gene of claim 9, wherein said ability has been increased by at least 500 fold. Providing a nucleic acid molecule encoding a DNA polymerase, wherein said nucleic acid molecule is at the amino acid position corresponding to T7 DNA polymerase residue 526 in the dNMP binding site or at the amino acid position corresponding to E. coli DNA polymerase residue 762 Introducing at least one base change into the nucleotide sequence of the region encoding the dNMP binding site to encode a mutant to alter the ability to incorporate the dideoxynucleotide of the polymerase encoded by the nucleic acid by at least 20-fold. A method of producing a modified Pol I type DNA polymerase, wherein the ability to incorporate dideoxynucleotides is increased compared to the corresponding deoxynucleotides as compared to that of a corresponding naturally occurring DNA polymerase. At least one deoxynucleoside triphosphate, an amino acid position corresponding to T7 DNA polymerase residue 526 in the dNMP binding site from a naturally-occurring unmodified DNA polymerase or an amino acid position corresponding to E. coli DNA polymerase residue 762 Pol I type DNA polymerase modified to have tyrosine residues and at least 20 times more capable of incorporating dideoxynucleotides as compared to the corresponding deoxynucleotides as compared to naturally occurring unmodified polymerases. Hybridized to DNA molecules in a vessel containing sufficient DNA polymerase activity and less than 1000 units of exonuclease activity per mg of DNA polymerase) and one or more DNA synthesis terminators that terminate DNA synthesis at a particular nucleotide base. Incubating the annealed DNA molecule with a primer molecule Comprising Orientation; And wherein at least a portion of the nucleotide base sequence of the DNA molecule can be determined by separating the DNA product of the incubation reaction according to size. The method of claim 14, wherein said DNA polymerase is a thermostable DNA polymerase and said sequencing is performed at a temperature of at least 50 ° C. 16. The method of claim 15, wherein said DNA polymerase is a thermostable DNA polymerase and said sequencing is performed at a temperature of 60 ° C. or higher. 17. The method of claim 16, wherein the thermostable enzyme is activated by Termus aquaticus, Thermus thermophilis, Thermus flavus, and Bacillus sterothermophilus. The DNA polymerase to be encoded. The method of claim 14, wherein the DNA polymerase identifies deoxynucleotides and dideoxynucleotides at a ratio of less than 100. 18. The method of claim 14, wherein the DNA polymerase identifies deoxynucleotides and dideoxynucleotides in a ratio of less than 50. 17. 18. The method of any one of claims 14-17, wherein the DNA polymerase has less than 500 units of exonuclease activity per mg of polymerase. T7 DNA polymerase residues 526 in the dNMP binding site such that the ability of the DNA polymerase to incorporate a dideoxynucleotide relative to the corresponding deoxynucleotide increases more than 20 times compared to the ability of the corresponding naturally occurring unmodified DNA polymerase. A modified Pol I type DNA polymerase modified to contain a tyrosine residue at an amino acid position corresponding to or an amino acid position corresponding to E. coli DNA polymerase residue 762; And a reagent necessary for sequencing selected from the group consisting of dITP, chain terminator, deaza-GTP, and manganese-containing compound. Providing a hybridized DNA strand with a primer capable of hybridizing to a DNA strand to obtain a hybridized mixture, wherein the hybridized mixture comprises one or more deoxyribonucleoside triphosphates, corresponding to dedeoxynucleotides. Amino acid position or E. coli DNA polymer corresponding to T7 DNA polymerase residue 526 in the dNMP binding site such that the ability of the incorporating DNA polymerase to increase 20 times more than the ability of the corresponding naturally occurring unmodified DNA polymerase. Incubating the modified Pol I type DNA polymerase, and the first chain terminator, wherein the DNA polymerase is modified to have a tyrosine residue at the amino acid position corresponding to the lase residue 762, wherein the DNA polymerase causes the primer to elongate. To form a first DNA product of a first row of different lengths of the extended primer. In general, each of the first DNA products has a chain terminator at its extended end, and the number of molecules of each of the first DNA products differs by only 20 bases or less in length and is substantially the same for substantially all DNA products. ) And providing a second chain terminator in the hybridized mixture at a concentration different from the first chain terminator, wherein the DNA polymerase produces a second row of second DNA products of differing lengths of elongated primers. Wherein each said second DNA product has a second chain terminator at the end of its elongated primer, and the number of molecules of each said second DNA product is substantially different from each other by 1 to 20 bases in length Approximately the same for all second DNA products, molecules of all of said first DNA products having lengths that differ from those of said second DNA product only 20 bases or less Sequencing method of DNA strands containing different from it is clearly different). Oligonucleotide primers, sequenced nucleic acid sequences, 1 to 4 deoxynucleoside triphosphates, and the ability of DNA polymerase to incorporate dideoxynucleotides relative to corresponding deoxynucleotides have been shown to affect the corresponding naturally occurring unmodified DNA polymerases. A modification that has been modified to have a tyrosine residue at an amino acid position corresponding to T7 DNA polymerase residue 526 or an amino acid position corresponding to E. coli DNA polymerase residue 762 within the dNMP binding site to increase at least 20-fold relative to capacity. Combining a Pol I type DNA polymerase, and a different amount of two or more chain terminators under extension conditions advantageous to form nucleic acid fragments complementary to the nucleic acid to which said oligonucleotide primers are sequenced; Separating nucleic acid fragments according to size; And the reagents determining the nucleic acid sequences that are distinguished from each other by the strength of the label in the primer extension product. A reactor comprising a reagent that provides at least two rows of DNA products formed from a single primer and a DNA strand, wherein the reagent has a corresponding naturally occurring ratio corresponding to the ability of the DNA polymerase to incorporate dideoxynucleotides relative to the corresponding deoxynucleotides. To have a tyrosine residue at the amino acid position corresponding to T7 DNA polymerase residue 526 or the amino acid position corresponding to E. coli DNA polymerase residue 762 within the dNMP binding site so that it is increased 20 times compared to the ability of the modified DNA polymerase. Containing the modified Pol I type DNA polymerase, each of said DNA products of said rows having a different molecular weight and having a chain terminator at one end), separating said DNA product along one axis of the separator Separating means for forming a band, wherein substantially all phosphorus in one row The intensity of the bands is approximately the same, and in any one row substantially all of the adjacent bands are different from those in the other columns), and after separation along the axis, band decoding to determine the location and intensity of each of the bands Automatic DNA sequencing device comprising means for determining the DNA sequence of the DNA strand alone from the position and intensity of the band along the axis, but not from the emission wavelength of light from any label that may be present in the means and separation means. . T7 DNA within the dNMP binding site such that the ability of the DNA polymerase to incorporate dideoxynucleotides relative to the cloned fragment and the corresponding deoxynucleotide is increased more than 20-fold compared to the ability of the corresponding naturally occurring unmodified DNA polymerase. Providing a modified Pol I type DNA polymerase that is modified to have a tyrosine residue at an amino acid position corresponding to polymerase residue 526 or an amino acid position corresponding to E. coli DNA polymerase residue 762 and the cloned fragment Contacting the polymerase under conditions for synthesizing DNA strands from the fragment, wherein the conditions include incorporation of a plurality of individual contiguous bases that can base pair with the fragment and incorporation of nucleotide bases that cannot base pair with the fragment. To cause the formation of the DNA strands), Method in vitro mutagenesis of a DNA fragment roning. Providing a primer and a template having adjacent bases capable of base pairing with adjacent bases of the template except for at least one base where the primers cannot base pair with the template; And T7 DNA in the dNMP binding site such that the ability of the DNA polymerase to incorporate the dideoxynucleotide relative to the corresponding deoxynucleotide is increased by at least 20-fold compared to the ability of the corresponding naturally occurring unmodified DNA polymerase. Template DNA fragment comprising stretching with a modified Pol I type DNA polymerase that is modified to have a tyrosine residue at an amino acid position corresponding to polymerase residue 526 or an amino acid position corresponding to E. coli DNA polymerase residue 762 In vitro mutagenesis. T7 DNA polymers within dNMP binding sites such that the ability of DNA polymerase to incorporate a DNA molecule to a dideoxynucleotide relative to the corresponding deoxynucleotide increases more than 20 times compared to the ability of the corresponding naturally occurring unmodified DNA polymerase. Incubating with a Pol I type DNA polymerase modified to have a tyrosine residue at an amino acid position corresponding to lase residue 526 or an amino acid position corresponding to E. coli DNA polymerase residue 762, wherein the polymerase is smoothed. The 3 'end is double stranded from a linear DNA molecule having a 5' end comprising a single stranded region, which acts on a single stranded region of the 5 'end of the linear DNA molecule to produce a terminal double stranded DNA molecule, A method of producing blunt-ended, double stranded DNA having no 3 'overhanging ends. T7 DNA polymerase residues 526 in the dNMP binding site such that the ability of DNA polymerase to incorporate a dideoxynucleotide relative to the corresponding deoxynucleotide is increased at least 20-fold compared to the ability of the corresponding naturally occurring unmodified DNA polymerase. A modified Pol I type DNA polymerase and a DNA fragment modified to have a tyrosine residue at an amino acid position corresponding to or an amino acid position corresponding to E. coli DNA polymerase residue 762, wherein the 3 'end of the DNA fragment is A method of labeling the 3 'end of a DNA fragment, the method comprising incubating with a labeled deoxynucleotide species under conditions such that a labeled deoxynucleotide is added to the DNA fragment and labeled by stretching with a polymerase. Annealing the first and second primers to opposite strands of the double stranded DNA sequence yields an annealed mixture, and the ability of the DNA polymerase to incorporate the annealed mixture to the dideoxynucleotide relative to the corresponding deoxynucleotide corresponds to Tyrosine residues at amino acid positions corresponding to T7 DNA polymerase residues 526 in the dNMP binding site or amino acid positions corresponding to E. coli DNA polymerase residues 762 such that there is a 20-fold increase over the ability of naturally occurring unmodified DNA polymerases. Incubating with a Pol I type DNA polymerase modified to have wherein the first and second primers are annealed to opposite strands of the DNA sequence and their 3 ′ ends are directed against each other after annealing and amplified The DNA sequence being positioned between the two annealed primers Method of width.  Thermus aquaticus DNA polymerase with tyrosine at residue 667. E. coli DNA polymerase with tyrosine at residue 762 I. A purified Pol I type DNA polymerase having a tyrosine residue at an amino acid position corresponding to E. coli DNA polymerase residue 762 within a dNMP binding site and not a T7 type DNA polymerase or a mitochondrial DNA polymerase. The method of claim 32, wherein the dNMP binding site is the amino acid sequence KN ₁ N ₂ N ₃ N ₄ N ₅ N ₆ N ₇ YG / Q, wherein each N is independently any amino acid and K is E. coli DNA polymerase I Corresponding to amino acid residue 758 of wherein the N ₄ position is tyrosine). the sequence KN ₁ N ₂ N ₃ N ₄ N ₅ N ₆ YG in the dNMP binding site, wherein each N is independently any amino acid, and one such N corresponds to the T7 DNA polymerase residue 526 within the dNMP binding site A mutant having a tyrosine residue at an amino acid position or an amino acid position corresponding to E. coli DNA polymerase I residue 762 to provide a polymerase that identifies 50 times or less for ddNMP incorporation than the corresponding dNMP incorporation). Alpha type DNA polymerase. 35. A recombinant nucleic acid encoding the DNA polymerase of any one of claims 30-34. The only divalent cation added has an average processivity of less than 100 in the presence of magnesium and is identified as less than 100 times for the incorporation of ddNMP relative to the corresponding deoxynucleotide, and the polymerase is not a reverse transcriptase recombination. A DNA polymerase comprising a recombinant DNA polymerase containing a tyrosine residue at an amino acid position corresponding to a T7 DNA polymerase residue 526 in a dNMP binding site or an amino acid position corresponding to an E. coli DNA polymerase residue 762. A recombinant DNA polymerase that has an average degree of treatment of less than 50 in the presence of magnesium as the only divalent cation and identifies less than 50 times the incorporation of ddNMP relative to the corresponding deoxynucleotide, the T7 DNA polymerase in the dNMP binding site A recombinant DNA polymerase containing a tyrosine residue at an amino acid position corresponding to residue 526 or an amino acid position corresponding to E. coli DNA polymerase residue 762. T7 DNA polymer in the dNMP binding site, as a recombinant DNA polymerase having an average degree of treatment of less than 50 in the presence of magnesium as the only divalent cation and less than five times the incorporation of ddNMP relative to the corresponding deoxynucleotide. A recombinant DNA polymerase containing a tyrosine residue at an amino acid position corresponding to lase residue 526 or an amino acid position corresponding to E. coli DNA polymerase residue 762. A recombinant thermophilic DNA polymerase that identifies less than 100 ddNMPs relative to the corresponding deoxynucleotide, the amino acid position corresponding to the T7 DNA polymerase residue 526 or the E. coli DNA polymerase residue 762 within the dNMP binding site. A recombinant thermophilic DNA polymerase containing a tyrosine residue at the corresponding amino acid position. A recombinant thermophilic DNA polymerase that identifies ddNMP in a proportion of less than 100 relative to the corresponding deoxynucleotide in the presence of magnesium as the only divalent cation, the amino acid position corresponding to the T7 DNA polymerase residue 526 within the dNMP binding site or A recombinant thermophilic DNA polymerase containing a tyrosine residue at an amino acid position corresponding to E. coli DNA polymerase residue 762. 41. The DNA polymerase of claim 40, wherein said DNA polymerase has an average degree of treatment of less than 100. 42. The DNA polymerase of claim 41, wherein said polymerase has a cycle from one primer-template to more than once every 5 seconds. 43. A recombinant nucleic acid encoding the polymerase of any one of claims 36-42. The DNA polymerase of any one of claims 30 to 34 and 36 to 42 and a DNA molecule, primer, dNTPs and at least one chain terminator to determine the sequence are mixed to form a mixture, extension of the primer and primer And cycling the temperature of the mixture such that denaturation of the DNA molecules occurs alternately. Amino acid position corresponding to T7 DNA polymerase residue 526 or E. coli DNA polymerase residue 762 within the dNMP binding site so that the polymerase does not identify more than 50-fold for ddNMP relative to the corresponding deoxynucleotide Purified cellular DNA polymerase having tyrosine in place of naturally occurring amino acids. 35. The DNA polymerase alpha of claim 34, which incorporates ddNMP more efficiently than the corresponding deoxynucleotide than the corresponding naturally occurring unmodified polymerase. E. coli DNA polymerase residue 762 or amino acid position corresponding to T7 DNA polymerase residue 526 in the dNMP binding site that provides all four dNTPs in excess or equivalent to each of the four ddNTPs in the cycle sequencing reaction Performing a cycle sequencing reaction using a DNA polymerase having a tyrosine residue at an amino acid position corresponding to and identifying 50 times or less for incorporation of ddNMP relative to the corresponding deoxynucleotide. E. Amino acid position corresponding to T7 DNA polymerase residue 526 in the dNMP binding site which provides all four fluorescently labeled dideoxynucleotides in an amount of less than 10 times the corresponding deoxynucleotide in the cycle sequencing reaction. performing a cycle sequencing reaction using a DNA polymerase having a tyrosine residue at the amino acid position corresponding to coli DNA polymerase residue 762 and identifying no more than 50 times the incorporation of ddNMP relative to the corresponding deoxynucleotide. Cycle sequencing method. The modified gene corresponds to the T7 DNA polymerase residue 526 in the dNMP binding site such that the ability to incorporate dideoxynucleotides relative to the corresponding deoxynucleotides is increased compared to the ability of the corresponding naturally occurring unmodified DNA polymerase. A modified gene encoding a modified Pol II type DNA polymerase, which is modified to encode a tyrosine residue at an amino acid position or an amino acid position corresponding to E. coli DNA polymerase residue 762. By having a tyrosine residue at the amino acid position corresponding to T7 DNA polymerase residue 526 or the amino acid position corresponding to E. coli DNA polymerase residue 762 within the dNMP binding site, the ability of the corresponding naturally occurring unmodified DNA polymerase is compared. Purified Pol II type DNA polymerase with increased dideoxynucleotide incorporation capacity relative to the corresponding deoxynucleotide. The modified gene of claim 3, wherein the polymerase is a T7 type DNA polymerase selected from the group consisting of T7, T3, ØI, ØII, H, W31, gh-1, Y, A1122 and SP6. The modified gene of claim 3, wherein the modified DNA polymerase is a thermostable enzyme. 4. The modified gene of claim 3, wherein said polymerase's ability to incorporate dideoxynucleotides relative to the corresponding deoxynucleotides is increased at least 25-fold compared to the corresponding naturally occurring DNA polymerase. Modified DNA polymerase encoded by the modified gene of claim 3. The method of claim 19, wherein said DNA polymerase has less than 1000 units of exonuclease activity per mg of polymerase. The sequence KN ₁ N ₂ N ₃ N ₄ N ₅ N ₆ N ₇ YG / Q, wherein each of N ₁ -N ₃ and N ₅ -N ₇ are independently any amino acid and N ₄ is the tyrosine at the amino acid position corresponding to the T7 DNA polymerase residue 526 or at the amino acid position corresponding to the E. coli DNA polymerase residue 762 within the dNMP binding site). Purified thermostable DNA polymerase having a deoxynucleotide binding site. The purified thermostable DNA polymerase of claim 56, wherein the DNA polymerase is not a naturally occurring DNA polymerase. 58. The method of claim 57, wherein said thermostable DNA polymerase is selected from the group consisting of DNA polymerases from Thermus thermophilis, Thermus flavus, and Bacillus sterothermophilus. Purified thermostable DNA polymerase modified from the DNA polymerase. 58. The tablet of claim 57, wherein the polymerase is modified to have tyrosine at the amino acid position corresponding to residue 667 of the corresponding naturally occurring unmodified polymerase from Thermus aquaticus DNA polymerase. Thermostable DNA polymerase. 58. The purified row of claim 57, wherein said polymerase has an average degree of treatment of less than 50 in the presence of magnesium as the only divalent cation and identifies less than 50 times the incorporation of ddNMP relative to the corresponding deoxynucleotide. Stability DNA Polymerase. 58. The purified thermostable DNA polymerase of claim 57, wherein said polymerase has an average degree of treatment of less than 100. 58. The purified thermostable DNA polymerase of claim 57, wherein said polymerase has a cycle from one primer-template to more than once every 5 seconds. 58. The purified thermostable DNA polymerase of claim 57, wherein said polymerase is modified to remove or reduce by 50% exonuclease activity associated with a corresponding naturally occurring unmodified DNA polymerase. 60. The purified thermostable DNA polymerase of claim 59, wherein said polymerase is further modified to remove or reduce 5'-3 'exonuclease activity. 58. A purified nucleic acid encoding a DNA polymerase according to claim 57. 60. A purified nucleic acid encoding a DNA polymerase according to claim 59. 58. A DNA sequencing kit comprising a DNA polymerase according to claim 57 and a reagent selected from the group consisting of dITP, chain terminator and deaza-GTP. 60. A DNA sequencing kit comprising a DNA polymerase according to claim 59 and a reagent selected from the group consisting of dITP, chain terminator and deaza-GTP. 58. A kit for DNA sequencing comprising a DNA polymerase and a pyrophosphatase according to claim 57. A DNA sequencing kit comprising a DNA polymerase and a pyrophosphatase according to claim 59. 58. A solution comprising the DNA polymerase and pyrophosphatase according to claim 57. 60. A solution comprising the DNA polymerase and pyrophosphatase according to claim 59. a nucleic acid molecule encoding a thermostable DNA polymerase comprising a sequence KN ₁ N ₂ N ₃ N ₄ N ₅ N ₆ N ₇ YG / Q (where each N is independently any amino acid) at the dNMP binding site; Wherein said nucleic acid is introduced to introduce one or more base changes into the nucleotide sequence to encode a tyrosine residue at the N ₄ position corresponding to T7 DNA polymerase residue 526 or E. coli DNA polymerase residue 762 within the dNMP binding site. A method of producing a modified DNA polymerase comprising mutating a molecule. By having a tyroic acid residue at the amino acid position corresponding to the T7 DNA polymerase residue 526 or the amino acid position corresponding to the E. coli DNA polymerase residue 762 in the dNMP binding site, the dideoxynucleotide is incorporated as compared to the corresponding deoxynucleotide. Purified Pol I type DNA polymerase, wherein the ability of the DNA polymerase to be increased 20 times or more compared to that of the corresponding naturally occurring unmodified DNA polymerase. 75. The method of claim 74, wherein the DNA polymerase is a Pol I type DNA polymerase and the dNMP binding site is the amino acid residue sequence KN ₁ N ₂ N ₃ N ₄ N ₅ N ₆ N ₇ YG / Q, wherein each N is independent Optionally amino acid and N ₄ is tyrosine). 75. The Pol I type DNA polymer of claim 74, wherein the DNA polymerase has a tyrosine at an amino acid position corresponding to residue 762 of E. coli DNA polymerase I or a residue 762 of E. coli DNA polymerase I. Lazein purified Pol I type DNA polymerase. 75. The purified Pol I type DNA polymerase according to claim 74, having an at least 20-fold increase in the ability to incorporate dideoxynucleotide relative to the corresponding deoxynucleotide as compared to the corresponding naturally occurring unmodified DNA polymerase. 75. The purified Pol I type DNA polymerase of claim 74, wherein said polymerase is modified to remove or reduce exonuclease activity associated with a corresponding naturally occurring unmodified DNA polymerase. 75. A purified nucleic acid encoding a DNA polymerase according to claim 74. DNA to introduce one or more base changes in the nucleotide sequence to cause the tyrosine residue to be encoded at the amino acid position corresponding to T7 DNA polymerase residue 526 or the amino acid position corresponding to E. coli DNA polymerase residue 762 within the dNMP binding site. Modified DNA polymerase production with increased ability to incorporate dideoxynucleotides relative to corresponding deoxynucleotides as compared to corresponding naturally occurring unmodified DNA polymerases, comprising modifying nucleic acid molecules encoding polymerases. Way. Less than 100-fold identification of incorporation of ddNMP relative to the corresponding deoxynucleotide in the presence of magnesium, the only divalent cation added, is not reverse transcriptase or T7 type DNA polymerase and is present in the dNMP binding site. Having a tyroic acid residue at an amino acid position corresponding to T7 DNA polymerase residue 526 or an amino acid position corresponding to E. coli DNA polymerase residue 762, having sufficient DNA polymerase activity for use in DNA sequencing, a DNA polymerase in a container containing a DNA polymerase having less than 1000 units of exonuclease activity per mg and at least one deoxynucleoside triphosphate and at least one DNA synthesis terminator that terminates DNA synthesis at a particular nucleotide base in an incubation reaction Annealed with a primer molecule that can hybridize to a DNA molecule Incubating the DNA molecule; And at least a portion of the nucleotide nucleotide sequence of the DNA molecule can be determined by separating the DNA product of the incubation reaction according to size. Providing a hybridized DNA strand with a primer capable of hybridizing to the DNA strand to obtain a hybridized mixture; The hybridized mixture is identified at less than 100-fold for incorporation of ddNMP relative to the corresponding deoxynucleotide in the presence of one or more deoxyribonucleoside triphosphates and magnesium, the only divalent cation added, and reverse transcriptase. transcriptase) or DNA polymerase having a tyrosine residue at the amino acid position corresponding to T7 DNA polymerase residue 526 or at the amino acid position corresponding to E. coli DNA polymerase residue 762 within the dNMP binding site and not a T7 type DNA polymerase, and Incubating the first chain terminator, wherein the DNA polymerase causes the primer to elongate to form a first DNA product of a first row of differing lengths of the elongated primer, each of the first DNA products being Having a chain terminator at its extended end, each of said first DNA products Atoms is substantially equal to the substantially all DNA product was only 20 bases in length or less different); And providing a second chain terminator in the hybridized mixture at a concentration different from the first chain terminator, wherein the DNA polymerase is capable of producing a second row of second DNA product of differing lengths of the elongated primer. Each second DNA product has a second chain terminator at the end of its elongated primer, and the number of molecules of each said second DNA product differs from each other by 1 to 20 bases in length substantially all Approximately identical to the second DNA product, distinctly different from the number of molecules of all the first DNA products having a length that differs only by 20 bases from that of the second DNA product). Identify less than 100-fold for incorporation of ddNMP relative to the corresponding deoxynucleotide in the presence of oligonucleotide primers, sequencing nucleic acid sequences, 1-4 deoxynucleoside triphosphates and magnesium, the only divalent cation added; DNA having a tyrosine residue at the amino acid position corresponding to T7 DNA polymerase residue 526 or at the amino acid position corresponding to E. coli DNA polymerase residue 762 and not a reverse transcriptase or T7 type DNA polymerase A method of sequencing a nucleic acid comprising combining a polymerase. One or more deoxynucleoside triphosphates, sufficient DNA polymerase activity and low exonuclease activity of less than 1000 units, having tyrosine residues at amino acid positions corresponding to E. coli DNA polymerase I residue 762 and useful for DNA sequencing Incubating the annealed DNA molecule with a primer molecule capable of hybridizing to the DNA molecule, in a container containing a DNA polymerase having a protein and one or more DNA synthesis terminators that terminate DNA synthesis at a particular nucleotide base during the incubation reaction; And wherein at least a portion of the nucleotide base sequence of the DNA molecule can be determined by separating the DNA product of the incubation reaction according to size, wherein the DNA polymerase is not a T7 type DNA polymerase. How to determine the sequence. DNA polymer having a tyrosine residue at the amino acid position corresponding to E. coli DNA polymerase I residue 762 and having sufficient DNA polymerase activity useful for DNA sequencing reactions and low exonuclease activity of less than 1000 units per mg of DNA polymerase. Laze; And a reagent necessary for sequencing selected from the group consisting of dITP, chain terminator and deaza-GTP, wherein the DNA polymerase is not a T7 type DNA polymerase. Pyrophosphatase; And less than 100-fold identification of incorporation of ddNMP relative to the corresponding deoxynucleotide in the presence of magnesium, the only divalent cation added, and not in reverse transcriptase or T7 type DNA polymerase, but in the TN in the dNMP binding site. A kit for DNA sequencing comprising a DNA polymerase having a tyrosine residue at an amino acid position corresponding to a DNA polymerase residue 526 or an amino acid position corresponding to an E. coli DNA polymerase residue 762. A DNA sequencing kit comprising DNA polymerase and pyrophosphatase having a tyrosine residue at an amino acid position corresponding to E. coli DNA polymerase I residue 762, wherein the DNA polymerase is not T7 type DNA polymerase. 88. The kit of claim 87, wherein said DNA polymerase is modified to remove or reduce exonuclease activity associated with a corresponding naturally occurring unmodified DNA polymerase. 88. The DNA sequencing kit of claim 87, wherein said pyrophosphatase is thermostable. 90. The kit of claim 85, wherein said DNA polymerase is a Pol I type DNA polymerase. 90. The kit of claim 85, wherein said DNA polymerase is a Pol II type DNA polymerase. 85. The method of claim 84, wherein said DNA polymerase is a Pol II type DNA polymerase. The modified gene of claim 49, wherein said modified DNA polymerase has sufficient DNA polymerase activity for use in DNA sequencing when combined with elements necessary for said DNA polymerase activity. The modified gene of claim 49, wherein the modified DNA polymerase has less than 500 units of exonuclease activity per mg of polymerase. 95. A modified DNA polymerase encoded by the modified gene of any one of claims 49, 93 and 94. The modified gene of claim 49, wherein the modified DNA polymerase is a thermostable enzyme. 97. The modified gene of claim 96, wherein said thermostable enzyme is selected from the group consisting of DNA polymerase encoded by Thermococcus litoralis and Pyrococcus furiosis. Providing a nucleic acid molecule encoding a DNA polymerase; At an amino acid position corresponding to T7 DNA polymerase residue 526 or an E. coli DNA polymerase residue 762 within the dNMP binding site to increase the dideoxynucleotide incorporation capacity of the polymerase encoded by the nucleic acid. Correspondingly compared to the corresponding naturally occurring unmodified DNA polymerase, comprising mutating the nucleic acid molecule to introduce one or more base changes in the nucleotide base sequence of the region encoding the dNMP binding site to allow for tyrosine residues to be encoded. A method of producing a modified Pol II type DNA polymerase with increased ability to incorporate dideoxynucleotides relative to deoxynucleotides. T7 DNA polymerase residues 526 within the dNMP binding site to increase the ability to incorporate one or more deoxynucleoside triphosphates, dideoxynucleotides relative to the corresponding deoxynucleotides as compared to the corresponding naturally occurring unmodified DNA polymerase. Sufficient DNA polymerase activity and low exonuclease per mg DNA polymerase, modified to have a tyrosine residue at the amino acid position corresponding to E. coli DNA polymerase I residue 762 and useful for DNA sequencing. DNA molecule annealed with a primer molecule capable of hybridizing to the DNA molecule, in a container containing a Pol II type DNA polymerase with active activity and at least one DNA synthesis terminator that terminates DNA synthesis at a specific nucleotide base during the incubation reaction. Incubating the solution; And at least a portion of the nucleotide base sequence of the DNA molecule can be determined by isolating the DNA product of the incubation reaction according to size. 107. The method of claim 99, wherein said DNA polymerase is a thermostable DNA polymerase and said sequencing is performed at a temperature of at least 50 ° C. 101. The method of claim 100, wherein said DNA polymerase is a thermostable DNA polymerase and said sequencing is performed at a temperature of at least 60 ° C. 102. The method of claim 101, wherein said thermostable enzyme is selected from the group consisting of DNA polymerases encoded by Thermococcus litoralis and Pyrococcus furiosis. 107. The method of claim 99, wherein said DNA polymerase identifies deoxynucleotides and dideoxynucleotides in a ratio of less than 100. 105. The method of claim 99, wherein said DNA polymerase identifies deoxynucleotides and dideoxynucleotides in a ratio of less than 50. 105. The method of claim 99, wherein said DNA polymerase has less than 500 units of exonuclease activity per mg of polymerase. Amino acid position or E. coli corresponding to T7 DNA polymerase residue 526 within the dNMP binding site to increase the ability to incorporate dideoxynucleotides relative to the corresponding deoxynucleotides as compared to the corresponding naturally occurring unmodified DNA polymerase. Pol II type DNA polymerase modified to contain a tyrosine residue at the amino acid position corresponding to DNA polymerase I residue 762; And a reagent necessary for sequencing selected from the group consisting of dITP, chain terminator, deaza-GTP, and manganese-containing compound. Providing a hybridized DNA strand with a primer capable of hybridizing to a DNA strand to obtain a hybridized mixture, wherein the hybridized mixture is added to at least one deoxyribonucleoside triphosphate and a corresponding naturally occurring unmodified DNA polymerase. Amino acid position corresponding to T7 DNA polymerase residue 526 or E. coli DNA polymerase residue 762 in the dNMP binding site to increase the ability to incorporate a dideoxynucleotide relative to the corresponding deoxynucleotide in comparison. Incubating the modified Pol II type DNA polymerase modified to have an tyrosine residue, and the first chain terminator, wherein the DNA polymerase causes the primer to elongate so that the first stretched primer has a different length Form a first DNA product in a row, wherein said first DNA generation Each has a chain terminator at its extended end, and the number of molecules of each of the first DNA products differs by only 20 bases or less in length and is substantially the same for all DNA products) and the first chain terminator Providing a second chain terminator in said hybridized mixture at different concentrations, wherein said DNA polymerase causes the production of a second row of second DNA products of differing lengths of elongated primers, each of said second The DNA product has a second chain terminator at the end of its elongated primer, and the number of molecules of each said second DNA product is approximately the same for all second DNA products, with 1 to 20 bases different in length from each other. And clearly different from the number of molecules of all the first DNA products having a length different from that of the second DNA product only 20 bases or less). Sequencing method of DNA strands. To increase the ability to incorporate dideoxynucleotides relative to the corresponding deoxynucleotides as compared to oligonucleotide primers, sequenced nucleic acid sequences, 1 to 4 deoxynucleoside triphosphates and corresponding naturally occurring unmodified DNA polymerases. Pol II type DNA and a different amount of two or more chain species modified to have a tyrosine residue at the amino acid position corresponding to T7 DNA polymerase residue 526 or the amino acid position corresponding to E. coli DNA polymerase residue 762 within the dNMP binding site. Combining payment in an extension condition favorable for forming said nucleic acid fragment complementary to the nucleic acid to which said oligonucleotide primer is to be sequenced; Separating nucleic acid fragments according to size; And the reagents determining the nucleic acid sequences that are distinguished from each other by the strength of the label in the primer extension product. T7 DNA polymerase residues within dNMP binding sites such that the ability of the DNA polymerase to incorporate the dideoxynucleotide relative to the cloned fragment and the corresponding deoxynucleotide is increased compared to the ability of the corresponding naturally occurring unmodified DNA polymerase. Providing a modified Pol II type DNA polymerase that is modified to have a tyrosine residue at an amino acid position corresponding to 526 or an amino acid position corresponding to E. coli DNA polymerase residue 762 and the cloned fragment from the fragment Contacting with the polymerase under conditions for synthesizing a DNA strand (the condition is achieved by incorporation of a plurality of individual contiguous bases that can base pair with the fragment and by incorporation of nucleotide bases that cannot base pair with the fragment Cloned DNA, causing the formation of DNA strands) In vitro mutagenesis of fragments. Providing a primer and a template having adjacent bases capable of base pairing with adjacent bases of the template except for at least one base where the primers cannot base pair with the template; And a T7 DNA polymerase residue in the dNMP binding site such that the ability of the DNA polymerase to incorporate the dideoxynucleotide relative to the corresponding deoxynucleotide is increased compared to the ability of the corresponding naturally occurring unmodified DNA polymerase. In vitro stretching of a template DNA fragment comprising stretching with a modified Pol II type DNA polymerase that is modified to have a tyrosine residue at an amino acid position corresponding to 526 or an amino acid position corresponding to E. coli DNA polymerase residue 762 Mutagenesis method. T7 DNA polymerase residues 526 in the dNMP binding site such that the ability of the DNA polymerase to incorporate the DNA molecule to the dideoxynucleotide relative to the corresponding deoxynucleotide is increased compared to the ability of the corresponding naturally occurring unmodified DNA polymerase. Incubating with a Pol II type DNA polymerase modified to have a tyrosine residue at an amino acid position corresponding to E. coli DNA polymerase residue 762 or wherein the polymerase is a blunt-ended double strand. The 3 'end is double stranded and 3' overhangs from a linear DNA molecule having a 5 'end comprising a single stranded region, which acts on the single stranded region of the 5' end of the linear DNA molecule to produce a DNA molecule. A method of producing blunt-ended, double-stranded DNA molecules having no ends. Corresponding to the T7 DNA polymerase residue 526 in the dNMP binding site such that the ability of the DNA polymerase to incorporate a dideoxynucleotide relative to the corresponding deoxynucleotide is increased compared to the ability of the corresponding naturally occurring unmodified DNA polymerase. A modified Pol II type DNA polymerase and a DNA fragment modified to have a tyrosine residue at an amino acid position or an amino acid position corresponding to E. coli DNA polymerase residue 762, wherein the 3 'end of the DNA fragment is And incubating with the labeled deoxynucleotide species under conditions such that a labeled deoxynucleotide is added to the DNA fragment and labeled by elongation. The ability of the DNA polymerase to anneal the first and second primers to opposite strands of the double stranded DNA sequence yields an annealed mixture, and to incorporate the dedeoxynucleotides relative to the corresponding deoxynucleotides. Modified to have a tyrosine residue at the amino acid position corresponding to T7 DNA polymerase residue 526 or the amino acid position corresponding to E. coli DNA polymerase residue 762 within the dNMP binding site to increase compared to the capacity of naturally occurring unmodified DNA polymerase. Incubating with the Pol II type DNA polymerase, wherein the first and second primers are annealed to opposite strands of the DNA sequence and their 3 'ends are directed against each other after annealing and are amplified. Amplifies the DNA sequence located between the two annealed primers Law. 51. The method of claim 50, wherein the DNA polymerase is a Pol II type DNA polymerase and the deoxynucleotide binding site is the amino acid sequence KN ₁ N ₂ N ₃ N ₄ N ₅ N ₆ YG, wherein each N is independently any Amino acid and N ₄ is tyrosine). 119. The purified Pol II type DNA polymerase of claim 114, wherein the DNA polymerase is a thermostable DNA polymerase. 51. A purified nucleic acid encoding a DNA polymerase according to claim 50.

Images