KR100468321B1 - Polypeptides for treatment of cancers and AIDS - Google Patents

Abstract

The present invention relates to a polypeptide for treating tumors and AIDS, and more particularly, to a polypeptide having specificity to a human 4-1BB molecule effective for treating a tumor, and a gene encoding the same, for humanization of the present invention. One polypeptide has an excellent effect on tumors and AIDS due to reduction of antigenicity and the like.

Description

Polypeptides for treatment of cancers and AIDS

The present invention relates to a polypeptide for treating tumors and AIDS, and more particularly, to a polypeptide specific for human 4-1BB molecules effective for treating tumors and AIDS and genes encoding the polypeptide. .

Mammal immune systems, including humans, involve B and T lymphocytes and macrophages, and have several methods for removing foreign antigens. They are generally divided into two groups: B lymphocytes and helper T lymphocytes are involved and divided into humoral immunity, which is carried out by antibodies, and cellular immunity, which involves killer T cells. Helper T cells play a role in killing T cell-involved target cells or assisting in B-cell-involved antigen-antibody reactions, and killer T cells lyse the infected target cells. In order for the T cell receptor to be recognized as an antigen, the antigen must be associated with a histocompatibility complex (MHC) of antigen presenting cells (antigen presenting cells). Antigens bound to MHC class II are recognized by CD4 surface proteins and receptors of helper T cells to undergo an immune response, and antigens bound to MHC class I are recognized by CD8 proteins and receptors of killer T cells. Initiate an unusual immune response. After this process, T cells and antigen-presenting cells enter the initial stage of activation to express new molecules on the cell surface, and the expressed molecules bind to each other to promote the activation of T cells and antigen-expressing cells to promote various immune responses. Let's go. In this process, molecules newly expressed on the surface of T cells and antigen-expressing cells are called accessory molecules, and examples thereof include B7-1, B7-2, CD28, CTLA4, 4-1BB and 4-1BB ligand molecules. Goodwin et al., Eur. J. Immnol., 23: 2631 (1993).

Cancer is the largest incurable disease of mankind and it is more difficult to cure if cancer has already spread to other tissues. Cancer drugs currently used in the clinic are designed to kill or inhibit cancer cells by interfering with DNA synthesis and inhibiting cell division because cancer cells have a much faster growth rate than normal cells and a slow recovery rate when damaged. It became. Chemotherapy is used to prevent the recurrence of cancer cells that may remain after surgery or radiotherapy to remove tumor tissues, or when the cancer site is extensive and surgery or radiotherapy is difficult. However, the existing anticancer drugs act on normal cells, which can cause serious damage to hair cells, mucous membranes, and hematopoietic cells, which have rapid cell division, resulting in side effects such as nausea, vomiting, diarrhea, and hair loss.

Recently, when tumors injected with anti-4-1BB antibodies that stimulate 4-1BB, an immune co-stimulatory molecule, were injected into mice transplanted with tumors, necrosis of existing tumor tissues could be eliminated without surgical intervention. Shows the potential for costimulatory molecules to be used (Melero, I., et al., Nature Med. 3, 682-685, 1997). Liping Chen of the Bristol-Myers Squibb Institute used mice to implant poorly immunogenic Ag104A sarcoma tumors and highly tumorigenic P815 mastocytoma tumors, waiting for the tumor to grow to about 5 mm, and then injecting anti-4-1BB antibodies to produce the tumor. Reported disappearing. If a tumor weighing 20 mm in a mouse weighing 20 g is equivalent to a human tumor weighing 70 kg, it corresponds to a tumor of 1,750 mm in diameter. Ag104A sarcoma, in particular, was a cancer cell whose immune cells were very difficult to recognize even when transfected with B7-1 (CD28) to make co-stimulatory molecule CD28. Therefore, eliminating Ag104A sarcoma that has already grown demonstrates that 4-1BB is a costimulatory molecule with very potent tumor removal. P815 mastocytoma is a metastatic tumor that penetrates the surrounding tissue. Survival for more than 32 weeks was completed in 13 of 15 cases, which were completely healed or injected with anti-4-1BB antibody.

Tumors have also been treated by injection of anti-CD3, anti-CD28, anti-CTLA-4 monoclonal antibodies (Ellenhorn. JDI, et al., Science 242, 569-571, 1988; Townsend. SE, et. al., Science 259, 368-370, 1993; Leach DR, et al., Science 271, 1734-1736, 1996). However, anti-4-1BB antibody showed a stronger effect than these and CD4, CD8 cells were involved (Melero, I., W. W. Shuford, et al., Nature Med. 3, 682-685, 1997).

In addition, when the same tumor was transplanted to the mouse from which the tumor cells were removed three months later, the same tumor was immediately rejected, but not at all. Therefore, the anti-4-1BB antibody activates immune cells specific for the tumor cells. Memory shows that it persists for a long time without tumors (Melero, I., WW Shuford, et al., Nature Med. 3, 682-685, 1997). NK cells complement the CTL cells and are known to protect our bodies from tumors. NK cells kill tumors that do not express MHC molecules, and tumors that express CTL. When treating tumors by injection of anti-4-1BB monoclonal antibody, injection of antibodies against anti-NK cell surface antigens, NK1.1 or AsialoGM1, has been reported to eliminate tumor elimination ability (Melero, I., et al., Cells / Immunol. 190, 167-172, 1998). Resting NK cells do not express 4-1BB, but when activated by IL-2, 4-1BB is expressed (Melero, I., et al., Cell / Immunol. 190, 167-172, 1998).

Monoclonal antibodies that stimulate 4-1BB can prevent these side effects because they do not act directly on cancer cells but destroy T cells by activating T cells. In addition, existing anticancer drugs have a limited amount due to side effects or toxicity and recur frequently because the location of cancer cells cannot be determined. However, activating T cells through the stimulation of 4-1BB can kill even a small amount of cancer cells, allowing complete recovery without recurrence.

The present invention solves the above problems, and the object of the present invention is to provide a protein having an excellent effect on the treatment of tumors and AIDS.

1 is a diagram comparing the amino acid sequence of BBK4-H and the amino acid sequence of the human template obtained according to the law of humanization design of Table 1 in Table 1, mBBK-4-H and human VH1- in FIG. 46 / J4 and HBBK-4-H represent the H chain of the mouse antibody, the H chain of the human antibody, and the H chain of the antibody expected when humanized, respectively.

FIG. 2 is a diagram comparing the amino acid sequence of BBK-4-L and the amino acid sequence of the human template obtained according to the law of the design of humanization of Table 1. In FIG. 2, mBBK-4-L and human A14 / J2 and HBBK-4 -L represents the L chain of a mouse antibody, the L chain of a human antibody, and the L chain of an antibody anticipated when humanized, respectively. In Figures 1 and 2, underlines indicate residues (mouses) in contact with the antigen, * common residues (mouses) important for structural determination, # indicates residues (mouses) of the interface domain, and @ indicates another sequence (human), Residues exposed to solvents in humans are 11-18, 68-859 (Kabat sequence) in the heavy chain and 15-20, 71-85 (Kabat sequence) in the light chain.

Figure 3 is a diagram showing the sequence of Humanized BBK-4 VH, VL PCR.

Figure 4 shows the sequence of the PCR product of Humanized BBK-4 VH.

Figure 5 shows the sequence of the PCR product of Humanized BBK-4 VL.

In order to achieve the above object, the present invention provides a polypeptide having specificity to 4-1BB described in SEQ ID NOS: 1-14.

Moreover, this invention provides the DNA sequence of sequence information 15-28 which codes each said polypeptide.

In another aspect, the present invention provides a composition for treating tumors and AIDS comprising the polypeptide.

Hereinafter, the present invention will be described in detail through non-limiting examples.

Example 1: Specific method of obtaining 4-1BB

<Hamibridoma cell line manufacturing method>

A pGEX3 expression vector (Pharmacia LKB Biotechnology) was prepared by combining a DNA (Pharmacia LKB Biotechnology) encoding a site where glutathione binds to a cDNA encoding a human 4-1BB molecule and a glutathione S transferase (GST). E. coli was transformed with this vector and cultured under appropriate conditions to induce the expression of the 4-1BB-GST fusion protein. GST fusion protein was obtained.

(immune)

20 ug of 4-1BB-GST was mixed with 0.1 ml of Freund complete adjuvant and injected into the abdominal cavity of Balb / c mice 4-8 weeks old to minimize immunity. Afterwards, 20 ug of 4-1BB-GST was immunized with 0.1 ml of incomplete adjuvant and injected twice intraperitoneally at three week intervals. After 3 days from the last day of immunization, a small amount of blood was collected from the tail, and the titer of the desired antibody was measured by enzyme-immunoassay. When the immunity was above a certain level, spleens were extracted from the mice and splenocytes were used for fusion.

<Cell Fusion>

Splenocytes from immunized mice were mixed 1: 2 with SP2 / 0-Ag14 myeloma cells (ATCC CRL 1581) and fused using 50% polyethyleneglycol 4000 (Gibco). The posture protocol regarding this was performed according to well-known methods (Mishell and SHiigi, Seledted Methods in cellular Immunology. W. H. Freeman Company. 1980).

To screen for hybridoma cell lines, the fused cell mixture was resuspended in HAT medium (RPI 1640 medium supplemented with 15% calf fetal serum, 0.1 mM Hypoxanthine, 0.4 uM Aminopterin, 16 uM Thymidine) and then 3 × 10 ⁷ cells. The cells were put in a 96-well micro culture tray at a concentration of / ml and cultured in a 37 ° C. cell culture medium containing 5% CO ₂ . Since myeloma cells and unfused splenocytes cannot grow well in HAT medium, the cells growing in the medium can be considered to be cells which have been fused. After 6, 7, 8 days half of the cell culture was replaced with fresh cell culture. The cell proliferation was observed using an inverted microscope and when the cells were fully grown, the supernatant containing the antibody was taken from the 96-well micro culture tray and subjected to ELISA.

Hybridoma Cell Line Selection

4-1BB-GST was diluted in phosphate buffer (PBS, pH 7.2) to 200ng / 0.1ml and coated on ELISA plate. After the coated plate was washed several times with phosphate buffer, phosphate buffer containing 1% bovine serum albumin was added to the plate and left for 1 hour, washed several times with phosphate buffer, and then the cell supernatant obtained above was added and reacted for 2 hours. I was. After completion of the reaction, the plate was washed several times with phosphate buffer, and 0.1 ml of an alkaline phosphatase-bound combustion sulfur-mouse immunoglobulin (Southern Biotech) was diluted 1000-fold. After standing for 2 hours, the mixture was washed several times with phosphate buffer, and 0.1 ml of the substrate (p-nitrophenyl disodium salt in 1 mg / ml dissolved in monobasic buffer, pH 9.6) was added and stored at room temperature for 10 minutes. The reaction was then measured with an automatic micro plate recorder.

The hybridoma cell line producing antibodies that specifically act on 4-1BB molecules was named and named BBK-4.

<Preparation of antibody using hybridoma cell line>

1 × 10 ⁷ BBK-4 cell lines prepared above were grown in culture and injected into the peritoneum of Balb / c mice previously treated with 0.5 ml of prestane (2.6.10.14-tetramethylpentadedecane. Sigma). After 10 days, ascites fluid was collected. This multiply liquid was subjected to affinity chromatography using a Protein-A Sepharose column (Pharmacia) to separate the monoclonal antibody of the present invention. The antibody production rate at this time was 1mg / 1ml ascites fluid.

As measured using an antibody assay kit, the monoclonal antibody of the present invention was shown to be IgG1 and had an isotype of kappa light chain.

Example 2: Monoclonal Antibody Gene Cloning in Mice

<MRNA extraction of BBK-4 clone>

Total RNA was extracted from 2 × ^{10 8} cells of BBK-4 clone. The method was treated with TriPure Isolation Reagent (SIGMA) on the cell pellet and phenol / chloroform extraction was performed once. The supernatant was treated with isopropanol to precipitate RNA, washed twice with 75% EtOH, and then dissolved in depc'd water to obtain total RNA. mRNA extraction was performed using the Dynalbeads mRNA purification kit (DYNAL).

<Create cDNA Library of BBK-4 Clones>

ZAP-cDNA Synthesis Kit and ZAP-cDNA Gigapack III Gold Cloning Kit (STRATAGENE) were used for cDNA library production.

① 1st strand synthesis

1st strand is synthesized using the extracted mRNA. 5 ㎍ mRNA is used for 1 hour at 37 ℃ using linker primer, RNase H ^- reverse transcriptase, methyl nucleotide mixture, RNase inhibitor.

The linker primer has an XhoI site and the sequence is 5'-CTCGAGTTTTTTTTTTTT-3 '(SEQ ID NO: 29).

② secondary strand synthesis

2nd strand is synthesized using RNase H and DNA polymerase I and reacted at 16 ^o C for 2 hours 30 minutes. After the reaction, phenol-chloroform extraction is performed and concentrated using ethanol. After washing with 70% ethanol, the precipitate is dissolved in water and the protein is removed using an Ultrafree-Probind filter (SIGMA).

③ brute cDNA ends

Klenow fragment and dNTP are used to make the 3 'and 5' ends blunt ends. Proteins are removed using Ultrafree-Probind.

④ EcoRI Adapter Ligation

rATP and T4 DNA ligase are added and reacted at 4 ^o C for 12 hours. Heat at 70 ^° C. for 30 minutes to inactivate the enzyme.

⑤ Kindizing at the end of EcoRI

Add rATP and T4 polynucleotide kinase and react at 37 ^o C for 30 minutes. Inactivate at 70 ^o C for 30 min.

⑥ Xho I treatment

Digestion is performed using Xho I. Remove protein using Utrafree-Probind.

⑦ Licensing cDNA to Uni-ZAP XR Vector Arms

Ethidium bromide plate assay is used to determine the amount of cDNA produced. 125 μg of Uni-ZAP XR vector was reacted at 12 ^o C for 12 hours using rATP and T4 DNA ligase.

⑧ Packaging

Remove the packaging extract stored at -80 ^o C and start to dissolve. Immediately add 2 μl of ligated DNA and be careful not to create bubbles and mix using pipet. This is reacted for 2 hours at room temperature. Add 500 μl of SM buffer (100mM NaCl, 10mM MgSO ₄ 7H ₂ O, 50mM Tris-HCl pH 7.5, 0.01% gelatin) and 20μl of chloroform. Centrifuge for a while and transfer the supernatant to a new tube.

⑨ Library titering

XL-1 Blue MRF 'was used as a host cell. Single colonies obtained by streaking on LB / tetracycline (50ug / ml) plates are inoculated in LB media containing 10mM MgSO ₄ and 0.2% maltose. This is grown by shaking at OD ₆₀₀ at 200 ^° C at 37 ^° C and not exceeding 1.0. The culture is centrifuged at 500 X g for 10 minutes to remove the medium, and dilution is carried out until the OD ₆₀₀ is 0.5 by adding 10 mM MgSO ₄ to the cell pellet. This prepared host cell is stored at 4 ^o C and can be used for 48 hours.

1 μl of a 1/10 dilution of the pakaged reaction was added to 200 μl of host cells and attached at 37 ^° C. for 15 minutes. Add 3 ml of top agar cooled to 48 ^o C, vortex and pour immediately onto a prewarmed LB agar plate. After 10 hours at 37 ^o C, count the plaques and calculate the pfu per ml. As a result, 1.9 X 10 ⁵ pfu was obtained.

<Screening of Heavy and Kapa Chain Genes>

Plate about 100-300 plaques each on a 100mm plate, transfer it to a nylon membrane and UV cross link. Hybridization is performed using this membrane. At this time, a fragment of each constant region cloned by PCR was used as a probe for screening heavy and kapa chains. Hybridization was performed using an ECL direct nucleic acid labeling and detection kit. The clones obtained were converted into plasmids through in vivo excision using the Exassit / SOLR system and sequenced by sequencing.

Example 3: Humanization of VH and VL of BBK-4

a. Screening of human homologue of VH and VL of BBK-4

Among the human antibody genes, the most similar to the nucleotide sequence of the V region of clone BBK-4, which encodes a mouse protein, was selected through a data base search, and the combinatorial antibody library was prepared by comparing the nucleotide sequence with the nucleotide sequence of BBK-4. PCR templates and primers required for the preparation were used.

b. Design for Humanization of the BBK-4 Gene

In order to determine the positions of the CDRs and FRs of the H and L chains of BBK-4, and to replace human amino acid residues or mouse residues, the rules of Table 1 were followed.

The CDR region, which is a portion directly binding to the antigen, among the variable region sequences of the H and L chains was set as the sequence of the mouse. Canonical residues were also placed in the mouse sequence, and even in the FR region, the residues in the H and L chains were located in the mouse sequence, the unusual sequence in the human sequence, and the solvent exposed residues in the mouse sequence.

Based on this, the humanized nucleotide sequence of BBK-4 was determined, and the amino acid sequence obtained according to the law and the amino acid sequence of the human template were compared (see FIGS. 1 and 2).

c. Primer Fabrication for Combinatorial Antibody Library

To prepare an insert for building a combinatorial antibody library, the BBK-4 clone

the amino acid sequence obtained by comparing the heavy and light chain sequences with the human template.

Based on the combinatorial primer was produced. The sequence of the prepared primer is shown below.

The BBK-4 VH combinatorial primer sequence is as follows.

HuBBK-4H-1U (SEQ ID NO: 30): 5'-caggtgmagctgswgsaatctggggctgaagtaaagaagcctggggcttc agtgaagstttcctgcaagg -3 '

HuBBK-4H-1D (SEQ ID NO: 31): 5'-assctgcytcacccagtgcatccagtagctgctgaaggtgtagccagaagccttgcaggaaascttcact -3 '

HuBBK-4H-2U (SEQ ID NO: 32): 5'-tgcactgggtgargcagsstcctggacaaggccttgagtggattggagagattaatcctggcaacggtca -3 '

HuBBK-4H-2D (SEQ ID NO: 33): 5'-tgtcccgagtcatagttrccytgctcttgaacttctcattgtagttagtatgaccgttgccaggattaat -3 '

HuBBK-4H-3U (SEQ ID NO: 34): 5'-ggyaactatgactcgggacacctctacaagcacagtatacatggagctcagcagcctgcggtctgaggac -3 '

HuBBK-4H-3D (SEQ ID NO: 35): 5'-gcaaacgcccgtgccgtagtaaaagatcttgcacagtaatagaccgcggwgtcctcagaccgcaggctgc -3 '

HuBBK-4H-4D (SEQ ID NO: 36): 5'-tgaggagacggtcacgagggtcccttggccccagtaagcaaacgcccgtgccgtagt -3 '

The BBK-4 VL combinatorial primer sequence is as follows.

HuBBK-4L-1U (SEQ ID NO: 37): 5'- gacrttswgatgactcagtctccagccwycttatctgtgactccaggaga gaaagtgactmttwcttgca -3 '

HuBBK-4L-1D (SEQ ID NO: 38): 5'- agrtttttgttgataccagtgtaagtagtcgctaatagtctggctggccctgcaagwaakagtcactttc -3 '

HuBBK-4L-2U (SEQ ID NO: 39): 5'- actggtatcaacaaaaayctgatsaakctcccargcttctcatcaaatat gcttcccaatccatctctgg -3 '

HuBBK-4L-2D (SEQ ID NO: 40): 5'- taaaagtgaaatcagwccctgatccactgccactgaacctggagggaaycccagagatggattgggaagc -3 '

HuBBK-4L-3U (SEQ ID NO: 41): 5'- agggwctgatttcacttttactatctcgtcgctcgaggcagaagatgcag caacttattactgtcaagat -3 '

HuBBK-4L-3D (SEQ ID NO: 42): 5'- tttgatctcgagtttagttcccysaccgaaagttgggggaaagctgtgaccatcttgacagtaataagttg -3 '

Using the primer prepared as described above as a template and primer, PCR of the VH region and PCR of the VL region were performed in the following order (see FIG. 3). PCR reaction was performed 35 cycles with pre-denaturation 94 ^o C, 5 min., 94 ^o C, 1 min., 55 ^o C, 1 min., 72 ^o C, 2 min., Post-elongation 72 ^o C, 7 min. It was. The PCR product thus obtained was isolated by QIAGEN gel extraction kit.

d. Sequence identification of humanized VH and VL fragments obtained by PCR using combinatorial primers

The PCR product of humanized VH and VL was obtained by the above method, and the sequence was confirmed by sequencing. The results are shown in the figure below (see Figures 4 and 5).

e. Association of Combinatorial VH with combinatorial VL and addition of restriction enzyme site

The PCR VH and VL are linked by single chain using linker DNA, and enzymes are 5'- and 3'-

Site addition was performed by PCR.

The PCR product thus obtained was isolated by QIAGEN gel extraction kit. The sequence of the primer is as follows.

The primers for adding the BBK-4 enzyme site and linker are as follows.

BBK-4 VH SfiI-U (SEQ ID NO: 43); 5'- actgc ggcccagccggcc atggcc caggtgmagctgswgsaatctggggc-3 '

BBK-4 VL NotI-D (SEQ ID NO: 44); 5'- gagtcattctcgactt gcggccgc tttgatctcgagtttagttcccys-3 '

BBK-4 VH-Linker-VL (SEQ ID NO: 45);

5'-ccctcgtgaccgtctcctca ggcggcggcggctcaggcggcggcggctcaggcggcggcggctca gacrttswgatgactcagtc-3 '

Insert the following components into the microcentrifuge tube.

heavy chain product (50ng) X ul, light chain product (50ng) X ul, linker primer 2 ul, BBK-4 VH-Sfi-U (5uM) 1 ul, BBK-4 VL-NotI-D (5uM) 1 ul , 10 X PCR buffer 5 ul, dNTP mix 2.5 ul, 25mM MgCl ₂ 5 ul, Ex Tag (5U) 1 ul, TDW X ul total volume was 50 ul.

PCR reaction was performed 35 cycles with pre-denaturation 94 ^o C, 5 min., 94 ^o C, 1 min., 55 ^o C, 1 min., 72 ^o C, 2 min., Post-elongation 72 ^o C, 7 min. It was.

The PCR product thus obtained was isolated by QIAGEN gel extraction kit.

f. Restriction Enzyme Treatment and Purification of Inserts

Sfi I digestion reaction; Purified ScFv product (1ug) X ul, 10X Buffer (Roche) 8.5 ul, Sfi I (10U / ul, Roche) 2 ul, T.D.W. X ul, total volume 85 ul.

Mix the above components well, add 85ul of mineral oil, and react at 50 ^o C for 4 hours.

Not I digestion reaction; 3 M NaCl 3.6 ul, 10 × Buffer (Roche) 1.5 ul, Not I (10 U / ul, Roche) 4 ul, T.D.W. The total volume was 15 ul with X ul.

Mix the above components well and react at 37 ^o C for 4 hours. Phenol / chloroform extraction was performed and separated by spin-column purification.

g. Quantification of ScFv and Ligation to pCANTAB 5 E Vectors

The 12.5 ng and 25 ng ScFv markers were quantified by electrophoresis with isolatedScFv on 1% agarose gel 0.75 cm thick.

This insert was used for ligation, and the ligation mixture is as follows.

BBK-4 ScFv gene fragment (150ng) X ul, 10X OPA buffer 5 ul, pCANTAB 5 E (50ng / ul) 5 ul, 10 mM ATP 5 ul, T4 DNA ligase (4U / ul) 2 ul, TDW Made 50 ul.

-React the above mixture at 16 ^o C for 1 hour and heat inactivation of ligase at 70 ^o C for 10 min.

-Cool for 5 minutes on ice.

h. Competent Cell Preparation

-Streaking glycerol stock of TG1 cells on minimal media plate and incubate o / n at 37 ^o C.

Inoculate and incubate single colonies of Minimal medium plates in 5ml 2X YT medium.

-Inoculate 1ml of overnight culture in 100ml of 2X YT media and shake at 250rpm until A ₆₀₀ reaches 0.4-0.5.

- 4 ^o C, centrifuged at 2500xg for 15 minutes in order to precipitate the cells.

Resuspend the cell ppt in 10 ml ice cold TSS and store on ice.

i. Transformation and library size check

Add ligation reaction to 1 ml of competent TG1 cells prepared as above and leave for 45 minutes on ice.

Incubate this mixture at 42 ^o C for 2 minutes and chill on ice.

-Add 900ul of LBG to 100ul of this and incubation while shaking at 250rpm.

The transformed cells were diluted at various ratios and plated on SOBAG plates to confirm cfu. As a result, a library of 6 X 10 ⁶ cfu was obtained.

j. Conversion to BBK-4 Recombinant Phage Antibody Library

Add 900 mL of 9.1 ml 2X YT-G medium to 900 ul of the bacterial library obtained above, Incubate at 37 ^o C for 1 hour while shaking at 250 rpm.

-Centrifugation at 1000xg for 10 minutes to settle cells and remove sup.

Add 10ml 2 X YT-AK medium to ppt. and incubate at 37 ^o C with shaking at 250 rpm.

-Centrifugate at 1000xg for 20 minutes to precipitate the cells and transfer the sup. To sterile 50ml conical tubes.

-Pass through a 0.45um filter and store until panning at 4 ^o C.

k. PEG precipitation of recombinant phage

Add 2 ml PEG / NaCl to the BBK-4 recombinant phage antibody library, mix well and incubate on ice for 60 minutes.

-Centrifugate for 20 min at 10000xg at 4 ^o C and remove the sup.

-Mix well by adding 16 ml of 2 X YT medium to ppt.

-Pan through 0.45um filter.

l. Panning for the Selection of Antigen-Positive Recombinant Phage Antibodies

Dilute 4-1 BB to 10ug / ml in 0.05M carbonate buffer (pH9.6) and coat 25 flasks at room temperature for 1-2 hours.

Wash the flask three times with PBS.

Fill the flask with blocking buffer.

-Incubate at room temperature for 1 hour.

Wash three times with PBS.

-16 ml PEG precipitated recombinant phage is diluted in 14 ml blocking buffer containing 0.01% sodium azide and reacted at room temperature for 15 minutes.

Add 20 ml of diluted recombinant phage into the flask and react at 37 ^o C for 2 hours.

Wash flask 20 times with 50 ml of PBS and 20 times with 50 ml of 0.1% PBS-T.

Add 10 ml of 10 ml log-phase TG1 cells into the flask and incubate at 37 ^o C for 1 hour.

Dilute 100ul of this culture to 1:10, 1: 100, 1: 1000 with 2X YT medium d and plate 100ul each on SOBAG plate.

^O Incubate this plate at 30 ^o C.

-The cfu of the upper plate was calculated and the library size was estimated to obtain 9 X 10 ⁴ cfu.

m. Single clone rescue for screening

-800 colonies obtained after panning were inoculated in 96 well plates containing 200ul of 2X YT-AG medium, shaken at 250rpm and incubated at 37 ^° C.

Prepare 50 ml of 2X YT-AG medium containing M13KO7, 2.5 × 10 ¹⁰ pfu, and dispense 200ul each into new 96 well plates.

Inoculate 40ul of o / n culture onto these plates.

-Incubate the plate inoculated for 2 hours at 37 ^o C while shaking at 150 rpm.

The plate is centrifuged at 1500xg for 20 minutes at room temperature.

Remove Sup. And add 200 ul 2X YT-AK medium to each well.

Incubate at 37 ^o C with shaking at 250 rpm.

Centrifugate at 1500xg for 20 minutes at room temperature.

-Perform ELISA screening for this sup.

n. Screening with ELISA

Dilute 4-1 BB to 10ug / ml in 0.05M carbonate buffer (pH9.6), and coat 200ul of ELISA plate at room temperature for 1-2 hours.

Wash the plate three times with PBS.

-Add 200ul of blocking buffer to each well and let it react at room temperature for 1 hour.

Wash the plate three times with 0.01% PBS-T.

Recombinant phage antibody sup. Obtained above on a preblocked microtitre plate. Add 100ul, and mix the same amount of blocking buffer to react for 30 minutes at room temperature.

Diluted recombinant phage antibody sup. Put 200ul into the antigen coated well, and react for 1 hour at room temperature.

Wash the plate 5 times with 0.01% PBS-T.

Dilute HRP / anti-M13 monoclonal conjugate in a blocking buffer at 1: 5000, add 200ul to each well, and react at room temperature for 1 hour.

Wash the plate 6 times with 0.01% PBS-T.

Add 21 ml of 1X ABTS stock solution with 36ul of 30% H2O2 to each 96 well plate, 200ul per well, and react at room temperature for 20 minutes.

-Absorbance is measured at 410nm and clones with absorbance of 0.2 or more are designated as positive clones.

Screening resulted in 14 positive clones. The absorbance of each clone obtained through ELISA is shown.

TABLE 2 Absorbance of each clone obtained through ELISA

# A8-1 A12-1 C12-3 D4-2 D4-3-1 E4-1 A-B7 A405-1 ⁰ 0.530 0.583 0.114 0.459 0.506 0.117 0.250 A405-2 ⁰ 0.803 # A-D2 A-E5 A-G7 A-H3 B-A5 B-E3 B-G2 A405-1 ⁰ 0.193 0.314 0.204 0.543 0.488 0.803 1.198 A405-2 ⁰ 0.856 2.495 1.833 2.487 2.485 0.149 2.505

-Full sequencing of all 14 clones was confirmed.

These sequences were compared and identified as duplicates, and divided into nine groups.

Shown in the table is as follows.

Table 3 shows the results of comparing the sequences of 14 clones

Group 1 HuBBK-4 A8-1 Group 2 HuBBK-4 A12-1 Group 3 HuBBK-4 C12-3 Group 4 HuBBK-4 D4-2, HuBBK-4 D4-3-1 Group 5 HuBBK-4 E4-1 Group 6 HuBBK-4 A-B7 Group 7 HuBBK-4 A-D2 Group 8 HuBBK-4 A-E5 Group 9 HuBBK-4 A-G7 Group 10 HuBBK-4 A-H3 Group 11 HuBBK-4 B-A5 Group 12 HuBBK-4 B-E3 Group 13 HuBBK-4 B-G2

The nucleotide sequence of each group is as follows.

Hu-A8-1 (SEQ ID NO: 15), Hu-A12-1 (SEQ ID NO: 16), Hu-C12-3 (SEQ ID NO: 17), Hu-D4-2 (SEQ ID NO: 18), Hu-D4-3- 1 (SEQ ID NO: 19), Hu-E4-1 (SEQ ID NO: 20), Hu-A-B7 (SEQ ID NO: 21), Hu-A-D2 (SEQ ID NO: 22), Hu-A-E5 (SEQ ID NO: 23) , Hu-A-G7 (SEQ ID NO: 24), Hu-A-H3 (SEQ ID NO: 25), Hu-B-A5 (SEQ ID NO: 26), Hu-B-E3 (SEQ ID NO: 27), Hu-B-G2 (SEQ ID NO 28)

-The amino acid sequence of each group is as follows.

Hu-A8-1 (SEQ ID NO: 1), Hu-A12-1 (SEQ ID NO: 2), Hu-C12-3 (SEQ ID NO: 3), Hu-D4-2 (SEQ ID NO: 4), Hu-D4-3 -1 (SEQ ID NO: 5), Hu-E4-1 (SEQ ID NO: 6), Hu-A-B7 (SEQ ID NO: 7), Hu-A-D2 (SEQ ID NO: 8), Hu-A-E5 (SEQ ID NO: 9 ), Hu-A-G7 (SEQ ID NO: 10), Hu-A-H3 (SEQ ID NO: 11), Hu-B-A5 (SEQ ID NO: 12), Hu-B-E3 (SEQ ID NO: 13), Hu-B- G2 (SEQ ID NO: 14)

The present invention having the above-described configuration is a humanized antibody that binds to 4-1BB of human CD8 T lymphocytes and activates CD8 T cells, and thus the present invention can be used to treat human cancer, viral diseases such as AIDS, or endogenous tuberculosis. When applied, it has a function as a therapeutic agent for treating these diseases.

<110> IMMUNOMICS CO., LTD. <120> Polypeptides for treatment of cancers <150> KR20010006212 <151> 2001-02-08 <160> 45 <170> KopatentIn 1.71 <210> 1 <211> 236 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-A8-1 clone <400> 1 Gln Val Lys Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Asp Val Val Met T hr Gln Ser Pro Ala Phe Leu Ser Val Thr Pro 130 135 140 Gly Glu Lys Val Thr Leu Ser Cys Arg Ala Ser Gln Thr Ile Ser Asn 145 150 155 160 Tyr Leu His Trp Tyr Gln Gln Lys Pro Asn Glu Ser Pro Arg Leu Leu 165 170 175 Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser 180 185 190 Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Glu 195 200 205 Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp Gly His Ser Phe Pro 210 215 220 Pro Thr Phe Gly Arg Gly Thr Lys Leu Glu Ile Lys 225 230 235 <210> 2 <211> 236 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-A12-1 clone <400> 2 Gln Val Lys Leu Leu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Arg Ala Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Asp Ile Val Met T hr Gln Ser Pro Ala Ile Leu Ser Val Thr Pro 130 135 140 Gly Glu Lys Val Thr Leu Thr Cys Arg Ala Ser Gln Thr Ile Ser Asp 145 150 155 160 Tyr Leu His Trp Tyr Gln Gln Lys Ser Asp Glu Ser Pro Lys Leu Leu 165 170 175 Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Val Pro Ser Arg Phe Ser 180 185 190 Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Glu 195 200 205 Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp Gly Arg Ser Phe Pro 210 215 220 Pro Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 225 230 235 <210> 3 <211> 238 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-C12-3 clone <400> 3 Gln Val Lys Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Ser Phe Thr Phe Ser Ser Tyr Trp Met His 20 25 30 Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Glu Ile 35 40 45 Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe Lys Ser Lys 50 55 60 Ala Thr Met Thr Arg Asn Thr Ser Thr Ser Thr Val Tyr Met Glu Leu 65 70 75 80 Ser Ser Leu Arg Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Ser 85 90 95 Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val 100 105 110 Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser Asp Ile G lu Met Thr Gln Ser Pro Ala Thr Leu Ser Val 130 135 140 Thr Pro Gly Glu Lys Val Thr Ile Ser Cys Arg Ala Ser Lys Thr Ile 145 150 155 160 Ser Asp Tyr Leu His Trp His Gln Gln Lys Pro Asp Gln Ala Pro Lys 165 170 175 Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile Pro Ser Arg 180 185 190 Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser 195 200 205 Leu Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp Gly His Ser 210 215 220 Phe Pro Pro Thr Phe Gly Glu Gly Thr Lys Leu Glu Ile Lys 225 230 235 <210> 4 <211> 236 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-D4-2 <400> 4 Gln Val Lys Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Asp Val Val Met T hr Gln Ser Pro Ala Thr Leu Ser Val Thr Pro 130 135 140 Gly Glu Lys Val Thr Leu Ser Cys Arg Ala Ser Gln Thr Ile Ser Asp 145 150 155 160 Tyr Leu His Trp Tyr Gln Gln Lys Ser Asp Glu Ser Pro Lys Leu Leu 165 170 175 Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser 180 185 190 Gly Ser Gly Ser Gly Ser Asp Phe Thr Phe Thr Ile Ser Ser Leu Glu 195 200 205 Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp Gly His Ser Phe Pro 210 215 220 Pro Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 225 230 235 <210> 5 <211> 236 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-D4-3-1 <400> 5 Gln Val Lys Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Asp Val Val Met T hr Gln Ser Pro Ala Thr Leu Ser Val Thr Pro 130 135 140 Gly Glu Lys Val Thr Leu Ser Cys Arg Ala Ser Gln Thr Ile Ser Asp 145 150 155 160 Tyr Leu His Trp Tyr Gln Gln Lys Ser Asp Glu Ser Pro Lys Leu Leu 165 170 175 Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser 180 185 190 Gly Ser Gly Ser Gly Ser Asp Phe Thr Phe Thr Ile Ser Ser Leu Glu 195 200 205 Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp Gly His Ser Phe Pro 210 215 220 Pro Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 225 230 235 <210> 6 <211> 241 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence fo Hu-E4-1 clone <400> 6 Gln Val Gln Leu Leu Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gln Pro Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Arg Ala Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly S er Asp Val Val Met Thr Gln Ser Pro Ala Phe 130 135 140 Leu Ser Val Thr Pro Gly Glu Lys Val Thr Ile Thr Cys Arg Ala Ser 145 150 155 160 Gln Thr Ile Ser Asp Tyr Leu His Trp Tyr Gln Gln Lys Pro Asp Gln 165 170 175 Ala Pro Arg Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Val 180 185 190 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr 195 200 205 Ile Ser Ser Leu Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp 210 215 220 Gly His Ser Phe Pro Pro Thr Phe Gly Glu Gly Thr Lys Leu Glu Ile 225 230 235 240 Lys <210> 7 <211> 241 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-A-B7 clone <400> 7 Gln Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Asn Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Ly Lys Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly S er Asp Ile Gln Met Thr Gln Ser Pro Ala Thr 130 135 140 Leu Ser Val Thr Pro Gly Glu Lys Val Thr Ile Ser Cys Arg Ala Ser 145 150 155 160 Gln Thr Ile Ser Asp Tyr Leu His Trp Tyr Gln Gln Lys Pro Asp Gln 165 170 175 Ser Pro Lys Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile 180 185 190 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr 195 200 205 Ile Ser Ser Leu Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp 210 215 220 Gly His Ser Phe Pro Pro Thr Phe Gly Arg Gly Thr Lys Leu Glu Ile 225 230 235 240 Lys <210> 8 <211> 241 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-A-D2 clone <400> 8 Gln Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gln Gly Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Lys Ala Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly S er Asp Val Val Met Thr Gln Ser Pro Ala Ile 130 135 140 Leu Ser Val Thr Pro Gly Glu Lys Val Thr Ile Ser Cys Arg Ala Ser 145 150 155 160 Gln Thr Ile Ser Asp Tyr Leu His Trp Tyr Gln Gln Lys Pro Asp Gln 165 170 175 Ala Pro Arg Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile 180 185 190 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Ser Asp Phe Thr Phe Thr 195 200 205 Ile Ser Ser Leu Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp 210 215 220 Gly His Ser Phe Pro Pro Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile 225 230 235 240 Lys <210> 9 <211> 241 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-A-E5 clone <400> 9 Gln Val Lys Leu Glu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gln Gly Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Arg Ala Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly S er Asp Val Glu Met Thr Gln Ser Pro Ala Ile 130 135 140 Leu Ser Val Thr Pro Gly Glu Lys Val Thr Leu Ser Cys Arg Ala Ser 145 150 155 160 Gln Thr Ile Ser Asp Tyr Leu His Trp Tyr Gln Gln Lys Pro Asp Glu 165 170 175 Ala Pro Lys Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Val 180 185 190 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr 195 200 205 Ile Ser Ser Leu Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp 210 215 220 Gly His Ser Phe Pro Pro Thr Phe Gly Arg Gly Thr Lys Leu Glu Ile 225 230 235 240 Lys <210> 10 <211> 241 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-A-G7 clone <400> 10 Gln Val Lys Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Ly Lys Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly Ser Asp Val Leu Met Thr Gln Ser Pro Ala Ser 130 135 140 Leu Ser Val Thr Pro Gly Glu Lys Val Thr Leu Ser Cys Arg Ala Ser 145 150 155 160 Gln Thr Ile Ser Asp Tyr Leu His Trp Tyr Gln Arg Lys Ser Asp Glu 165 170 175 Ser Pro Lys Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Val 180 185 190 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Ser Asp Phe Thr Phe Thr 195 200 205 Ile Ser Ser Leu Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp 210 215 220 Gly His Ser Phe Pro Pro Thr Phe Gly Glu Gly Thr Lys Leu Glu Ile 225 230 235 240 Lys <210> 11 <211> 236 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-A-H3 clone <400> 11 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Lys Gln Gly Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Arg Ala Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Gln Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Asp Val Glu Met Thr Gln Ser Pro Ala Phe Leu Ser Val Thr Pro 130 135 140 Gly Glu Lys Val Thr Leu Thr Cys Arg Ala Ser Gln Thr Ile Ser Asp 145 150 155 160 Tyr Leu His Trp Tyr Gln Gln Lys Pro Asp Glu Ser Pro Arg Leu Leu 165 170 175 Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Val Pro Ser Arg Phe Ser 180 185 190 Gly Ser Gly Ser Gly Ser Asp Phe Thr Phe Thr Ile Ser Ser Leu Glu 195 200 205 Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp Gly His Ser Phe Pro 210 215 220 Pro Thr Phe Gly Gly Thr Lys Leu Glu Ile Lys 225 230 235 <210> 12 <211> 241 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-B-A5 clone <400> 12 Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ala Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Ly Lys Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Val Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly Ser Asp Val Val Met Thr Gln Ser Pro Ala Ile 130 135 140 Leu Ser Val Thr Pro Gly Glu Lys Val Thr Leu Thr Cys Arg Ala Ser 145 150 155 160 Gln Thr Ile Ser Asp Tyr Leu His Trp Tyr Gln Gln Lys Pro Asp Glu 165 170 175 Ala Pro Arg Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile 180 185 190 Pro Ser Arg Phe Asn Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr 195 200 205 Ile Ser Ser Leu Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Asp 210 215 220 Gly His Ser Phe Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile 225 230 235 240 Lys <210> 13 <211> 240 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-B-E3 clone <400> 13 Gln Val Lys Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Ly Lys Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Ser Ser Gly Gly Gly Ser 115 120 125 Ser Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro Ala Ser Leu 130 135 140 Ser Val Thr Pro Gly Glu Lys Val Thr Ile Ser Cys Arg Ala Ser Gln 145 150 155 160 Thr Ile Ser Asp Tyr Leu His Trp Tyr Gln Gln Lys Pro Asp Gln Ser 165 170 175 Pro Arg Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Val Pro 180 185 190 Ser Arg Phe Ser Gly Ser Gly Ser Gly Ser Asp Phe Thr Phe Thr Ile 195 200 205 Ser Ser Leu Glu Ala Glu Asp Ala Ala Thr Tyr Asp Cys Gln Asp Gly 210 215 220 His Ser Phe Pro Pro Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 225 230 235 240 <210> 14 <211> 240 <212> PRT <213> Artificial Sequence <220> <223> The amino acid sequence of Hu-B-G2 clone <400> 14 Gln Val Lys Leu Glu Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 20 25 30 Trp Met His Trp Val Lys Gln Pro Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asn Pro Gly Asn Gly His Thr Asn Tyr Asn Glu Lys Phe 50 55 60 Lys Ser Lys Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ser Phe Thr Thr Ala Arg Ala Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly Ser Asp Val Val Met Thr Gln Ser Pro Ala Ser 130 135 140 Leu Ser Val Thr Pro Gly Glu Lys Val Thr Leu Thr Trp Arg Ala Ala 145 150 155 160 Arg Leu Ala Thr Thr Tyr Thr Gly Ile Asn Lys Asn Leu Ile Lys 165 170 175 Leu Pro Ser Phe Ser Ser Asn Met Leu Pro Asn Pro Ser Leu Gly Phe 180 185 190 Pro Pro Gly Ser Val Ala Val Asp Gln Gly Leu Ile Ser Leu Leu Leu 195 200 205 Ser Arg Arg Ser Arg Gln Lys Met Gln Gln Leu Ile Thr Val Lys Met 210 215 220 Val Thr Ala Phe Pro Gln Leu Ser Val Gly Glu Leu Asn Ser Arg Ser 225 230 235 240 <210> 15 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-A8-1 clone <400> 15 caggtgaagc tgcagcaatc tggggctgaa gtaaagaagc ctggggcttc agtgaaggtt 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gaggcaggct 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcag ggtaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgcg gtctgaggac accgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcagac gttgtgatga ctcagtctcc agccttctta 420 tctgtgactc caggagagaa agtgactctt tcttgcaggg ccagccagac tattagcaac 480 tacttacact ggtatcaaca aaaacctaat gaatctccca ggcttctcat caaatatgct 540 tcccaatcca tctctgggat tccctccagg ttcagtggca gtggatcagg gactgatttc 600 acttttacta tctcgtcgct cgaggcagaa gatgcagcaa cttattactg tcaagatggt 660 cacagctttc ccccaacttt cggtcgggga actaaactcg agatcaaa 708 <210> 16 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-A12-1 clone <400> 16 caggtgaagc tgctgcaatc tggggctgaa gtaaagaagc ctggggcttc agtgaagctt 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gaagcagcgt 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcag ggcaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgcg gtctgaggac tccgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcagac attgtgatga ctcagtctcc agccatctta 420 tctgtgactc caggagagaa agtgactctt acttgcaggg ccagccagac tattagcgac 480 tacttacact ggtatcaaca aaaatctgat gaatctccca agcttctcat caaatatgct 540 tcccaatcca tctctggggt tccctccagg ttcagtggca gtggatcagg gactgatttc 600 acttttacta tctcgtcgct cgaggcagaa gatgcagcaa cttattactg tcaagatggt 660 cgcagctttc ccccaacttt cggtcaggga actaaactcg agatcaaa 708 <210> 17 <211> 714 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-C12-3 clone <400> 17 caggtgaagc tggtggaatc tggggctgaa gtaaagaagc ctggggcttc agtgaaggtt 60 tcctgcagct tcaccttcag cagctactgg atgcactggg tgaggcagcg tcctggacaa 120 ggccttgagt ggattggaga gattaatcct ggcaacggtc atactaacta caatgagaag 180 ttcaagagca aggcaactat gactcggaac acctctacaa gcacagtata catggagctc 240 agcagcctgc ggtctgagga ctccgcggtc tattactgtg caagatcgtt tactacggca 300 cgggcgtttg cttactgggg ccaagggacc ctcgtgaccg tctcctcagg cggcggcggc 360 tcaggcggcg gcggctcagg cggcggcggc tcagacattg agatgactca gtctccagcc 420 accttatctg tgactccagg agagaaagtg actatttctt gcagggccag caagactatt 480 agcgactact tacactggca tcaacaaaaa cctgatcaag ctcccaagct tctcatcaaa 540 tatgcttccc aatccatctc tgggattccc tccaggttca gcggcagtgg atcggggact 600 gatttcactt ttactatctc gtcgctcgag gcagaagatg cagcaactta ttactgtcaa 660 gatggtcaca gctttccccc aactttcggt gagggaacta aactcgagat caaa 714 <210> 18 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-D4-2 clone <400> 18 caggtgaagc tgcagcaatc tggggctgaa gtaaagaagc ctggggcttc agtgaaggtt 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gaagcagcgt 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcag ggtaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgcg gtctgaggac accgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcagac gttgtgatga ctcagtctcc agccacctta 420 tctgtgactc caggagagaa agtgactctt tcttgcaggg ccagccagac tattagcgac 480 tacttacact ggtatcaaca aaaatctgat gaatctccca agcttctcat caaatatgct 540 tcccaatcca tctctgggat tccctccagg ttcagtggca gtggatcagg gtctgatttc 600 acttttacta tctcgtcgct cgaggcagaa gatgcagcaa cttattactg tcaagatggt 660 cacagctttc ccccaacttt cggtcaggga actaaactcg agatcaaa 708 <210> 19 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-D4-3-1 clone <400> 19 caggtgaagc tgcagcaatc tggggctgaa gtaaagaagc ctggggcttc agtgaaggtt 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gaagcagcgt 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcag ggtaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgcg gtctgaggac accgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcagac gttgtgatga ctcagtctcc agccacctta 420 tctgtgactc caggagagaa agtgactctt tcttgcaggg ccagccagac tattagcgac 480 tacttacact ggtatcaaca aaaatctgat gaatctccca agcttctcat caaatatgct 540 tcccaatcca tctctgggat tccctccagg ttcagtggca gtggatcagg gtctgatttc 600 acttttacta tctcgtcgct cgaggcagaa gatgcagcaa cttattactg tcaagatggt 660 cacagctttc ccccaacttt cggtcaggga actaaactcg agatcaaa 708 <210> 20 <211> 723 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-E4-1 clone <400> 20 caggtgcagc tgctggaatc tggggctgaa gtaaagaagc ctggggcttc agtgaagctt 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gaggcagcct 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcag ggcaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgcg gtctgaggac accgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcaggc ggcggcggct cagacgttgt gatgactcag 420 tctccagcct tcttatctgt gactccagga gagaaagtga ctattacttg cagggccagc 480 cagactatta gcgactactt acactggtat caacaaaaac ctgatcaagc tcccaggctt 540 ctcatcaaat atgcttccca atccatctct ggggttccct ccaggttcag tggcagtgga 600 tcagggactg atttcacttt tactatctcg tcgctcgagg cagaagatgc agcaacttat 660 tactgtcaag atggtcacag cttcccccca actttcggtg agggaactaa actcgagatc 720 aaa 723 <210> 21 <211> 723 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-A-B7 clone <400> 21 caggtgcagc tggtggaatc tggggctgaa gtaaagaagc ctggggcttc agtgaagctt 60 tcctgcaagg cttctggcta caccttcaac agctactgga tgcactgggt gaggcagcgt 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcaa ggtaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgcg gtctgaggac accgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcaggc ggcggcggct cagacattca gatgactcag 420 tctccagcca ccttatctgt gactccagga gagaaagtga ctatttcttg cagggccagc 480 cagactatta gcgactactt acactggtat caacaaaaac ctgatcaatc tcccaagctt 540 ctcatcaaat atgcttccca atccatctct gggattccct ccaggttcag tggcagtgga 600 tcagggactg atttcacttt tactatctcg tcgctcgagg cagaagatgc agcaacttat 660 tactgtcaag atggtcacag ctttccccca actttcggtc ggggaactaa actcgagatc 720 aaa 723 <210> 22 <211> 723 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-A-D2 clone <400> 22 caggtgcagc tggtggaatc tggggctgaa gtaaagaagc ctggggcttc agtgaagctt 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gaggcagggt 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcaa ggcaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgcg gtctgaggac accgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcaggc ggcggcggct cagacgttgt gatgactcag 420 tctccagcca tcttatctgt gactccagga gagaaagtga ctatttcttg cagggccagc 480 cagactatta gcgactactt acactggtat caacaaaaac ctgatcaagc tcccaggctt 540 ctcatcaaat atgcttccca atccatctct gggattccct ccaggttcag tggcagtgga 600 tcagggtctg atttcacttt tactatctcg tcgctagagg cagaagatgc agcaacttat 660 tactgtcaag atggtcacag ctttccccca actttcggtc agggaactaa actcgagatc 720 aaa 723 <210> 23 <211> 723 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-A-E5 clone <400> 23 caggtgaagc tggagcaatc tggggctgaa gtaaagaagc ctggggcttc agtgaaggtt 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gaggcagggt 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcag ggcaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcttgcg gtctgaggac tccgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caggggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcaggc ggcggcggct cagacgttga gatgactcag 420 tctccagcca tcttatctgt gactccagga gagaaagtga ctctttcttg cagagccagc 480 cagactatta gcgactactt acactggtat caacaaaaac ctgatgaagc tcccaagctt 540 ctcatcaaat atgcttccca atccatctct ggggttccct ccaggttcag tggcagtgga 600 tcagggactg atttcacttt cactatctcg tcgctcgagg cagaagatgc agcaacttat 660 tactgtcaag atggtcacag ctttccccca actttcggtc ggggaactaa actcgagatc 720 aaa 723 <210> 24 <211> 723 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-A-G7 clone <400> 24 caggtgaagc tggtggaatc tggggctgaa gtaaagaagc ctggggcttc agtgaagctt 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gaagcaggct 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcaa ggtaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgcg gtctgaggac tccgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcaggc ggcggcggct cagacgttct gatgactcag 420 tctccagcct ccttatctgt gactccagga gagaaagtga ctctttcttg cagggccagc 480 cagactatta gcgactactt acactggtat caacgaaaat ctgatgaatc tcccaagctt 540 ctcatcaaat atgcttccca atccatctct ggggttccct ccaggttcag tggcagtgga 600 tcagggtctg atttcacttt tactatctcg tcgctcgagg cagaagatgc agcaacttat 660 tactgtcaag atggtcacag ctttccccca actttcggtg agggaactaa actcgagatc 720 aaa 723 <210> 25 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-A-H3 clone <400> 25 caggtccaac tggtgcagtc tggggctgaa gtaaagaagc ctggggcttc agtgaagctt 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gaagcagggt 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcag ggcaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgca gtctgaggac accgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcagac gttgagatga ctcagtctcc agccttctta 420 tctgtgactc caggagagaa agtgactctt acttgcaggg ccagccagac tattagcgac 480 tacttacact ggtatcaaca aaaacctgat gaatctccca ggcttctcat caaatatgct 540 tcccaatcca tctctggggt tccctccagg ttcagtggca gtggatcagg gtctgatttc 600 acttttacta tctcgtcgct cgaggcagaa gatgcagcaa cttattactg tcaagatggt 660 cacagctttc ccccaacttt cggtggggga actaaactcg agatcaaa 708 <210> 26 <211> 723 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-B-A5 clone <400> 26 caggtgcagc tgcagcaatc tggggctgaa gtaaagaagc ctggggcttc agtgaaggtt 60 tcctgcaagg cttctggcta cgccttcagc agctactgga tgcactgggt gaggcagcgt 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcaa ggtaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgcg gtctgtggac accgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcaggc ggcggcggct cagacgttgt gatgacccag 420 tctccagcca tcttatctgt gactccagga gagaaagtga ctcttacttg cagggccagc 480 cagactatta gcgactactt acactggtat caacaaaaac ctgatgaagc tcccaggctt 540 ctcatcaaat atgcttccca atccatctct gggattccct ccaggttcaa tggcagtgga 600 tcagggactg atttcacttt tactatctcg tcgctcgagg cagaagatgc agcaacttat 660 tactgtcaag atggtcacag ctttccccca actttcggtg ggggaactaa actcgagatc 720 aaa 723 <210> 27 <211> 720 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-B-E3 clone <400> 27 caggtgaagc tggtggaatc tggggctgaa gtaaagaagc ctggggcttc agtgaagctt 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gaggcaggct 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca tactaactac 180 aatgagaagt tcaagagcaa ggtaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgcg gtctgaggac tccgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggctcat caggcggcgg ctcatcaggc ggcggctcag acattgtgat gactcagtct 420 ccagcctcct tatctgtgac tccaggagag aaagtgacta tttcttgcag ggccagccag 480 actattagcg actacttaca ctggtatcaa caaaaacctg atcaatctcc caggcttctc 540 atcaaatatg cttcccaatc catctctggg gttccctcca ggttcagtgg cagtggatca 600 gggtctgatt tcacttttac tatctcgtcg ctcgaggcag aagatgcagc aacttatgac 660 tgtcaagatg gtcacagctt tcccccaact ttcggtcagg gaactaaact cgagatcaaa 720 720 <210> 28 <211> 722 <212> DNA <213> Artificial Sequence <220> <223> The base sequence of Hu-B-G2 clone <400> 28 caggtgaagc tggagcaatc tggggctgaa gtaaagaagc ctggggcttc agtgaagctt 60 tcctgcaagg cttctggcta caccttcagc agctactgga tgcactgggt gaagcagcct 120 cctggacaag gccttgagtg gattggagag attaatcctg gcaacggtca taccaactac 180 aatgagaagt tcaagagcaa ggtaactatg actcgggaca cctctacaag cacagtatac 240 atggagctca gcagcctgcg gtctgaggac accgcggtct attactgtgc aagatctttt 300 actacggcac gggcgtttgc ttactggggc caagggaccc tcgtgaccgt ctcctcaggc 360 ggcggcggct caggcggcgg cggctcaggc ggcggcggct cagacgttgt gatgactcag 420 tctccagcct ccttatctgt gactccagga gagaaagtga ctcttacttg gagggccgcc 480 agactattag cgactactta cactggtatc aacaaaaacc tgatcaagct cccaagcttc 540 tcatcaaata tgcttcccaa tccatctctg ggattccctc caggttcagt ggcagtggat 600 cagggtctga tttcactttt actatctcgt cgctcgaggc agaagatgca gcaacttatt 660 actgtcaaga tggtcacagc tttcccccaa ctttcggtgg gggaactaaa ctcgagatca 720 aa 722 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Linker primer sequence for 4B4 clone cDNA library <400> 29 ctcgagtttt tttttttt 18 <210> 30 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4H-1U Combinatorial primer sequence <400> 30 caggtgmagc tgswgsaatc tggggctgaa gtaaagaagc ctggggcttc agtgaagstt 60 tcctgcaagg 70 <210> 31 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4H-1D Combinatorial primer sequence <400> 31 assctgcytc acccagtgca tccagtagct gctgaaggtg tagccagaag ccttgcagga 60 aascttcact 70 <210> 32 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4H-2U Combinatorial primer sequence <400> 32 tgcactgggt gargcagsst cctggacaag gccttgagtg gattggagag attaatcctg 60 gcaacggtca 70 <210> 33 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-H-2D Combinatorial primer sequence <400> 33 tgtcccgagt catagttrcc ytgctcttga acttctcatt gtagttagta tgaccgttgc 60 caggattaat 70 <210> 34 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4H-3U Combinatorial primer sequence <400> 34 ggyaactatg actcgggaca cctctacaag cacagtatac atggagctca gcagcctgcg 60 gtctgaggac 70 <210> 35 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4H-3D Combinatorial primer sequence <400> 35 gcaaacgccc gtgccgtagt aaaagatctt gcacagtaat agaccgcggw gtcctcagac 60 cgcaggctgc 70 <210> 36 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4H-4D Combinatorial primer sequence <400> 36 tgaggagacg gtcacgaggg tcccttggcc ccagtaagca aacgcccgtg ccgtagt 57 <210> 37 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4L-1U Combinatorial primer sequence <400> 37 gacrttswga tgactcagtc tccagccwyc ttatctgtga ctccaggaga gaaagtgact 60 mttwcttgca 70 <210> 38 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4L-1D Combinatorial primer sequence <400> 38 agrtttttgt tgataccagt gtaagtagtc gctaatagtc tggctggccc tgcaagwaak 60 agtcactttc 70 <210> 39 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4L-2U Combinatorial primer sequence <400> 39 actggtatca acaaaaayct gatsaakctc ccargcttct catcaaatat gcttcccaat 60 ccatctctgg 70 <210> 40 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4L-2D Combinatorial primer sequence <400> 40 taaaagtgaa atcagwccct gatccactgc cactgaacct ggagggaayc ccagagatgg 60 attgggaagc 70 <210> 41 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4L-3U Combinatorial primer sequence <400> 41 agggwctgat ttcactttta ctatctcgtc gctcgaggca gaagatgcag caacttatta 60 ctgtcaagat 70 <210> 42 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> HuBBK-4L-3D Combinatorial primer sequence <400> 42 tttgatctcg agtttagttc ccysaccgaa agttggggga aagctgtgac catcttgaca 60 gtaataagtt g 71 <210> 43 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> BBK-4 VH SfiI-U Primer sequence <400> 43 actgcggccc agccggccat ggcccaggtg magctgswgs aatctggggc 50 <210> 44 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> BBK-4 VL NotI-D Primer sequence <400> 44 gagtcattct cgacttgcgg ccgctttgat ctcgagttta gttcccys 48 <210> 45 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> BBK-4 VH-Linker-VL Primer sequence <400> 45 ccctcgtgac cgtctcctca ggcggcggcg gctcaggcgg cggcggctca ggcggcggcg 60 gctcagacrt tswgatgact cagtc 85

Claims (3)

A polypeptide specifically binding to the 4-1BB protein and selected from the group consisting of peptides having an amino acid sequence set forth in SEQ ID NO: 1 to SEQ ID NO: 14. A gene selected from the group consisting of nucleotide sequences set forth in SEQ ID NO: 15 to SEQ ID NO: 28 encoding each of the polypeptides of claim 1. delete