KR100449171B1 - Recombinant vector having MJ1 gene and production method of integrase MJ1 using the same - Google Patents

Abstract

The present invention relates to a recombinant vector comprising the MJ1 gene and a method for producing integrase MJ1 using the same, integrase MJ1 produced using MJ1 gene derived from enterococcus temperate bacteriophage φFC1. Since the enzyme alone is active without any other factor and is also active in E. coli , it can be usefully used in a vector system for inserting a specific gene into the chromosome of E. coli , or even higher chromosomes.

Description

Recombinant vector having MJ1 gene and production method of integrase MJ1 using the same}

The present invention provides an integrase MJ1 using a recombinant vector comprising the MJ1 gene and a method for preparing integrase MJ1 using the same, more specifically, MJ1 gene derived from Enterococcus temperate bacteriophage φFC1. It is about how to produce.

Enterococcus temperate bacteriophage φFC1 (enterococcus temperate bacteriophage φFC1) was found through the culture of lysogenic strains induced by UV (ultraviolet). φFC1 forms stable lysogen through site-specific recombination on the chromosome of bacteria. Site-specific recomnbination occurs between attP, a phage attachment site, and attB, a bacterium junction, where homology of short DNA sequences occurs between attP and attB. Also called, it is also the site where the actual exchange of strands occurs (Fig. 1).

We found an open reading frame (ORF) that is supposed to encode a site-specific recombinase near attP, the recombination site of phage, and named it MJ1, and expressed the gene in E. coli . (Kim et al., J. Biochem. Mol. Biol. 29: 448-454), but formation of insoluble proteins in the form of inclusion bodies (IBs) despite the high levels of MJ1 expression. As a result, it was impossible to measure the activity of the enzyme that is assumed to be site-specific recombinase. For this reason, the catalytic properties and recombination activity of MJ1 have not been reported, and further studies of recombination of genes using MJ1 enzyme have not been studied.

In the present invention, in order to solve the above problems, by constructing a recombinant vector to tagging thioredoxin (integrase MJ1) when integrase MJ1 is expressed in the expression vector inserted MJ1 gene, the MJ1 in the form of a soluble protein E. In addition to overexpressing and purifying in coli , in vitro recomnination assays confirmed the intermolecular integrative recombination and its activity in other hosts, as well as MJ1 catalyzed recombination alone without the help of other co-factors. At this time, the substrate involved is not only a circular form (linear), but also a linear form (linear form), and completed the present invention by first revealing that the activity is maintained in E. coli .

An object of the present invention is to provide a recombinant vector and transformant comprising the MJ1 gene. Still another object of the present invention is to provide a method for producing integrase MJ1 using the transformant.

Figure 1 is a schematic diagram showing the site of site-specific recombination occurs at the junction of the FC1 bacteriophage (attP) and the junction of the bacterial chromosome (attB) and the primers used in the present invention.

2 is a schematic diagram of a recombinant vector PTMJ1 comprising the MJ1 gene of the present invention.

Figure 3 is a result of SDS-PAGE purification of integrase MJ1 produced by the production method of the present invention (A) and Western blotting (B).

4 is Integrase MJ1in vitroThe results show that recombination between attP and attB in the phase.

FIG. 5 shows that the integrase MJ1 recombines DNA in a linear form as well as in a linear form.

6 is a result of investigating whether integrase MJ1 requires an energy source or a divalent cation during the reaction.

7 is a result of confirming that integrase MJ1 binds to attP (A), attB (B), attL (C), and attR (D) through gel shift assay (C: MJ1 enzyme). Complex of probes, F: probe).

8 is a result of examining the site where integrase MJ1 binds to attP (A), attB (B), attL (C) and attR (D) by DNA foot printing.

Figure 9 shows the nucleotide sequence of the site where the integrase MJ1 binds to attP, attB, attL, attR DNA (underlined AGT represents a site that crossover between attachment sites).

10 shows site-specific recombination in E. coli when co-transformed the plasmid containing the MJ1 gene and the attP site (pTMJ1) and the plasmid containing the attB site (pATTB1) together with E. coli JM109. The site-specific recombination occurred and the chimeric plasmid (pREC1) was formed.

The present invention provides an expression vector, a transformant comprising the MJ1 gene, and a method for preparing integrase MJ1 using the transformant.

PET32a (+) vector (Novagen, USA) used as a preferred embodiment in the present invention is an expression vector for trx-taggingd encoding a thioredoxin protein consisting of 109 amino acids.

Therefore, the integrase MJ1 enzyme of the present invention produced using the vector is characterized in that it is fused with thioredoxin, and has a molecular weight of about 70 kDa, which is linear as well as linear in a closed circular form. form) It also catalyzes the recombination of DNA, does not require an energy source and divalent cations, and exhibits activity as an enzyme alone. It has an optimum reaction pH of 7.6, an optimum reaction temperature of 37 ° C, as well as Enterocuccus.faecalis . It is also active in the coli system.

In the present invention, attP refers to the attachment site of phage (738bp), attB refers to the attachment site of bacteria (290bp), attL and attR are site-specific recombination by each strand exchange of the attP and attB (at site-specific recombination) means attL (404bp), attR (624bp) DNA (hereinafter abbreviated as 'attP', 'attB', 'attL', 'attR').

In order to clone the attB, Enterococcus faccalis KBL 707 strain (Accession No. KFCC 12177), an indicator strain of phage φFC, was distributed from KCCM and used as a template for PCR, and attL and attR were inserted into the chromosome. ) Was cloned using Enterococcus faccalis KBL 703 strain (Kim et al., Mol. Cells 4; 155-158), and attP was a vector containing 7.7 kb of φFC1 DNA, pFE1 (Kim, YW 1999. Genetic studies of bacteriophage FC1 from Enterococcus faecalis. Ph.D. thesis.Korea University.Korea) was used as a template.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

Experimental Example 1: Bacteria Strain and Plasmid Construction

The MJ1 gene, which is supposed to encode site-specific recombinase, was inserted near pt14b (Novagene) with lacUV5 promoter and transformed into E. coli by molecular weight of about 53 kDa. Protein was expressed. MJ1, however, caused the formation of insoluble proteins in the form of inclusion bodies (IBs), which showed no activity, which caused the MJ1 enzyme to undergo site-specific recombinase activity. Not only could it be confirmed that it had activity, but there was also difficulty in protein purification (Kim et al., J. Biochem. Mol. Biol. 29: 448-454).

Therefore, the present inventors attempted to express a fusion protein tagged with thioredoxin in the MJ1 gene.

First, pFE1 (Kim, YW 1999. Genetic studies of bacteriophage FC1 from Enterococcus faecalis. Ph. D. thesis. Korea University. (MJ1 forward, reverse) was used to amplify the MJ1 gene by PCR. The amplified MJ1 gene (SEQ ID NO: 3)BamHI andEcoAfter treatment with RI restriction enzyme, the vector was inserted into pET32a (+) plasmid, which is an expression vector for trx-taggingd, to construct a vector PTMJ1 (FIG. 2).E.coliLineage A transformant was prepared by transforming BL21 (DE3) pLysS, which was named BL21 (DE3) pLysS / PTMJ1.

Primer used in the present invention Oligonucleotide Sequence MJ 1 forward 5'-cgGGATCCatgaaacgtgcagcattg-3 'Uppercase indicates Bam HI. (SEQ ID NO: 1) MJ 1 reverse 5'-cgGAATTCaccgaatgcatgttcgta-3 'Capital letters indicate Eco RI. (SEQ ID NO: 2) ON-1 cggccattgaattagggtgtcgaat (SEQ ID NO: 5) ON-2 cggattgccagatggatgat (SEQ ID NO: 6) Phy2 gaagatcttgttctcgagcatagtctcc (SEQ ID NO: 7) Phy3 gcgttaactgccaatatagc (SEQ ID NO: 8)

Meanwhile, attP (739bp) and attB (290bp) were amplified by PCR and pT7 blue vector

PATTP and pATTB recombinant vectors were constructed by inserting them into Novagen Co., and attL (404 bp) and attR (624 bp) were inserted into pGEM T-Easy (Promega Co.) to prepare pATTL and pATTR (Table 2).

PCR conditions for amplifying attP, attB, attL, attR primer Template attP (738 bp) phy2phy3 Vector PEF1 with 7.7 kb of φFC1 DNA attB (290 bp) on-1on-2 Genomic DNA of Enterococcus faecallis KBL 707 attL (404bp) on-1phy3 Genomic DNA of Enterococcus faecallis KBL 703 attR (624 bp) phy2on-2 Genomic DNA of Enterococcus faecallis KBL 703

Experimental Example 2: Purification of Recombinant Enzyme MJ1

The transformant BL21 (DE3) pLysS / PTMJ1 was incubated at 15 ° C. after addition of 0.5 mM isopropyl-1-thio-β-D-falactoside (IPTG). After 500 ml of the culture solution was frozen at -70 ° C, it was dissolved, left in 15 ml of lysis buffer (50 mM NaH ₂ PO ₄ (pH 8.0), 300 mM NaCl, 10 mM imidasole), and then sonicated (sonicaton) to crush the cells. The supernatant was taken by centrifugation of the extract, followed by binding the protein by adding Ni-NTA resin, followed by washing several times, and extracting the protein with elution buffer (20mM Tris-Cl, 0.5M NaCl, 1M inidazole). .

SDS-PAGE (A) of the purified thioredoxin-fusion protein confirmed that the molecular weight was about 70 kDa (FIG. 3A).

On the other hand, in order to determine whether the expressed recombinant enzyme is expressed in the form of a soluble protein (insoluble protein) rather than an insoluble protein (insoluble protein) sonicated to crush the cells and then centrifuged to precipitate (insoluble fraction) and its As a result of Western blotting of the soluble fraction, it was found that the expressed recombinant enzyme MJ1 was a soluble protein without reacting with the precipitated fraction but with the soluble fraction (FIG. 3B).

Experimental Example 3: Site-specific Recombination Analysis

100 μl of the recombinant enzyme MJ1 purified by affinity chromatography was mixed with 1 μg of linear attP DNA and attB DNA. Optimal reaction conditions 30mM Tris, pH7.6, 15mM NaCl, 80mM KCl, 0.7mM EDTA, 7% glycerol, and reaction at 37 ℃. The reaction was terminated by phenol extracton and ethanol precipitated. After the restriction enzyme treatment, electrophoresis on 1.2% agarose gel was followed by staining with Et-Br to observe band patterns on UV.

As a result, 6.8 Kbp of recombinant DNA appeared, indicating that MJ1 alone catalyzed the integration of phage into att B, the bacterial attachment site (FIG. 4). It also appears to catalyze the recombination between linear junctions as well as closed circular forms, which does not seem to require a particular form of substrate (FIG. 5).

On the other hand, 10mM MgCl ₂ and 2mM ATP were added to the reaction mixture to determine whether integrase MJ1 requires an energy source or a divalent cation. As a result, integrase MJ1 did not require an energy source and a divalent cation, as shown in FIG. 6.

Experimental Example 4 Determination of Recombinant Activity of Enzyme MJ1 by Gel Shift Assay

Spin-column using BioGel P6 (Bio-rad) after labeling [λ- ³² P] ATP to oligonucleotides of ON1, ON-2, Phy2, Phy3, MJ1 reverse using T4 polynucleotide kinase The oligonucleotides labeled by chromatography were purified and attP (287bp; mj1 reverse, using phy3 as primers), attB (290bp), attL (404bp), attR (172bp) were prepared using the labeled primers under the following PCR conditions. ; Mj1 reverse, using ON2 as a primer) (Fig. 1).

AttP (287 bp), attB labeled with radioisotopes in 1 × binding buffer (30 mM Tris, pH 7.6, 15 mM NaCl, 80 mM KCl, 0.1 mM EDTA, 0.3 mg / ml calf thymus DNA, 0.3 mg / ml bovine serum albumin) (290 bp), attL (404 bp), attR (172 bp) and purified MJ1 enzyme was mixed and reacted at room temperature for 20 minutes, followed by electrophoresis on a 5% polyacrylamide gel, and then subjected to film film analysis.

As a result, the purified MJ1 enzyme binds to the four recombinant sites attP (287bp; A), attB (290bp; B), attL (404bp; C), and attR (172bp; D). It could be confirmed (complex of C: MJ1 enzyme and probe, F: means probe).

Experimental Example 5: Investigation of binding site of MJ1 enzyme by DNase I footprinting

DNase I footprinting was performed to determine the binding site of MJ1.

A DNA labeled with the ³² P integrase azepin MJ1 and 5mM MgCl _2, 1mM CaCl ₂ is added to the by-ding buffer (binding buffer) and one was reacted DNAse Ⅰ was treated, phenol treatment and ethanol precipitation and then 7M urea, 8% sequencing Electrophoresis was performed on polyacrylamide gels. As a result, purified MJ1 binds to about 44-52 bp of attP, attB, attL, and attR DNA, and binds to the site where attP and attB cross and recombine (FIG. 8, FIG. 9).

As described above, the φFC1 integrase MJ1 of the present invention binds to a site where attP and attB cross and recombine, and also exhibits activity as an enzyme alone, requiring conventional accessory proteins and binding to multiple binding sites. Λintegrase (landy, 1989; Annu. Rev, Biochem . 58 : 913-949) was significantly different.

Experimental Example 6: E.coli Intermolecular integration assay of MJ1 enzyme in the system

PATTB11 was prepared by PCR amplification of a 290 bp DNA fragment containing attB, the attachment site of bacteria, from E. faecalis KBL 707 genomic DNA and ligating to the Ava I site of pACYC184. MJ1 expression plasmid PTMJ1, ie, plasmid with integrase MJ1 and attP sites, and pATTB11 were co-transformed into E. coli JM109.

The restriction-enzyme digestion pattern of the plasmid DNA isolated from the transformed cells is an intermolecular integration reaction between the attB site of pATTB11 and the attP site of PTMJ1, as well as the original plasmid, resulting in a chimeric plasmid (pREC1). ) Was formed (Fig. 10). To more precisely identify site-specific recomnination between pATTB11 and PTMJ1, plasmid DNA was extracted from E.coli JM 109, which cotransformed pATTB1 and PTMJ1, resulting in junction amplification and sequencing. Was carried out.

As a result, it was confirmed that site-specific recombination occurred to form chimeric plasmid (FIG. 10). The results show that plasmids pATTB1 and PTMJ1 have functional attB and attP sites, respectively, and that phage φFC1 intease MJ1 functions in the E. coli system as well as Enterocuccus.faecalis .

As described above, the recombinant integrase MJ1 produced using the MJ1 gene derived from Enterococcus temperate bacteriophage φFC1 ( Enterococcus temperate bacteriophage φFC1) of the present invention, as evident from the above examples, is active even without the enzyme alone. Since it is active in E. coli , it can be used to insert a specific gene into the chromosome of E. coli , or even higher chromosome, so it is a very useful invention in gene therapy and pharmaceutical industry. .

<110> KOREA CHUNGANG EDUCATIONAL FOUNDATION <120> Recombinant vector having MJ1 gene and production method of integrase MJ1 using the same <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer for amplification of mj1 gene (forward) <400> 1 cgggatccat gaaacgtgca gcattg 26 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer for amplification of mj1 gene (reverse) <400> 2 cggaattcac cgaatgcatg ttcgta 26 <210> 3 <211> 1493 <212> DNA <213> Bacteriophage FC1 <220> <221> CDS <222> (6) .. (1397) <223 > mj1 open reading frame <400> 3 gatcc atg aaa cgt gca gca ttg tat ata cgt gta tcc aca atg gaa 47 Met Lys Arg Ala Ala Leu Tyr Ile Arg Val Ser Thr Met Glu 1 5 10 caa gcc aag gaa gga t ac agc att ccc gca caa aca gat aaa cta aaa 95 Gln Ala Lys Glu Gly Tyr Ser Ile Pro Ala Gln Thr Asp Lys Leu Lys 15 20 25 30 gct ttt gca aaa gca aaa gat atg gca gtt gca aaa gta tat act gat 143 Ala Phe Ala Lys Ala Lys Asp Met Ala Val Ala Lys Val Tyr Thr Asp 35 40 45 cca ggg ttt tca gga gca aaa atg gag cgc cct gca tta caa gaa atg 191 Pro Gly Phe Ser Gly Ala Lys Met Glu Arg Pro Ala Leu Gln Glu Met 50 55 60 ata tct gat att caa aat aaa aaa att gat gtg gtt cta gtc tac aaa 239 Ile Ser Asp Ile Gln Asn Lys Lys Ile Asp Val Val Leu Val Tyr Lys 65 70 75 tta gac agg ctt tca cgt tca caa aag aat aca ttg tat tta att gaa 287 Leu Asp Arg Leu Ser Arg Ser Gln Lys Asn Thr Leu Tyr Leu Ile Glu 80 85 90 gat gta ttt cta aaa aat aat gta gac ttt atc agc atg caa gaa agc 335 Asp Val Phe Leu Lys Asn Asn Val Asp Phe Ile Ser Met Gln Glu Ser 95 100 105 110 ttt gac aca tca aca cct ttt ggc cgt gcg acg ata gga atg tta tcc 383 Phe Asp Thr Ser Thr Pro Phe Gly Arg Ala Thr Ile Gly Met Leu Ser 115 120 125 gtt ttt gca caa tta gag cga gac aca att aca gaa aga atg cac atg 431 Val Phe Ala Gln Leu Glu Arg Asp Thr Ile Thr Glu Arg Met His Met 130 135 140 gga aga aca gaa cgt gca aaa caa gga tac tat cac gga agt ggc att 479 Gly Arg Thr Glu Arg Ala Lys Gln Gly Tyr Tyr His Gly Ser Gly Ile 145 150 155 gtt ccc tta ggt tac gat tat gtg cat gga gaa tta att atc aat gat 527 Val Pro Leu Gly Tyr Asp Tyr Val His Gly Glu L eu Ile Ile Asn Asp 160 165 170 tac gag gcg caa att att caa gaa atc tat gat tta tat gtg aac caa 575 Tyr Glu Ala Gln Ile Ile Gln Glu Ile Tyr Asp Leu Tyr Val Asn Gln 175 180 185 190 ggt aaa gga cag caa tat ata aca aaa cgt atg gtt gca aaa tac cca 623 Gly Lys Gly Gln Gln Tyr Ile Thr Lys Arg Met Val Ala Lys Tyr Pro 195 200 205 gat aag gta aaa aca tta acc ata gta aag tat gcc tta acc aat cca 671 Asp Lys Val Lys Thr Leu Thr Ile Val Lys Tyr Ala Leu Thr Asn Pro 210 215 220 tta tat att ggc aaa ata agt tgg gac ggc aaa gtg tat gat ggc cat 719 Leu Tyr Ile Gly Lys Ile Ser Trp Asp Gly Lys Val Tyr Asp Gly His 225 230 235 cac tca cct ata att gat aaa tct atg tac gat aaa gct caa gaa att 767 His Ser Pro Ile Ile Asp Lys Ser Met Tyr Asp Lys Ala Gln Glu Ile 240 245 250 att gcc aga atg gct caa aaa ggt ggc gaa cag cat gga aat caa tta 815 Ile Ala Arg Met Ala Gln Lys Gly Gly Glu Gln His Gly Asn Gln Leu 255 260 265 270 ggg ctt tta tta ggg att act tat tgt ggt aaa tgc gga gct gaa gta 863 Gly Leu Leu Leu Gly Ile Thr Tyr Cys Gly Lys Cys Gly Ala Glu Val 275 280 285 ttt cgt tat gta tca gga aaa aaa tat cga tat aat tat tat atg 911 Phe Arg Tyr Val Ser Gly Gly Lys Lys Tyr Arg Tyr Asn Tyr Tyr Met 290 295 300 tgt aga tca gta aag aaa atg cta cct tcg cta gta aaa gat tgg aac 959 Cys Arg Ser Val Lys Lys Met Leu Pro Ser Leu Val Lys Asp Trp Asn 305 310 315 tgc aaa caa cct agt ctc aga caa gaa gta gtt gaa aag aaa gta ata 1007 Cys Lys Gln Pro Ser Leu Arg Gln Glu Val Val Glu Lys Lys Val Ile 320 325 330 gat tca ctt aaa tca ttg gac ttc aaa aaa atc gaa cgt gaa tta aaa 1055 Asp Ser Leu Lys Ser Leu Asp Phe Lys Lys Ile Glu Arg Glu Leu Lys 335 340 345 350 caa gtt gaa aat aaa aca aaa tca aaa atc acc act att aat aac caa 1103 Gln Val Glu Asn Lys Thr Lys Ser Lys Ile Thr Thr Ile Asn Asn Gln 355 360 365 att tcc aag aag cat aac gaa aaa caa aaa att cta gat ttg tat caa 1151 Ile Ser Lys Lys His Asn Glu Lys Gln Lys Ile Leu Asp Leu Tyr Gln 370 375 380 tat ggt aca ttt gat gtc aca atg ctt aat gaa cgt atg aaa aaa att 1199 Tyr Gly Thr Phe Asp Val Thr Met Leu Asn Glu Arg Met Lys Lys Ile 385 390 395 gat aat gaa ata aat gcg tta act gcc aat ata gca aac tta gaa ggt 1247 Asp Asn Glu Ile Asn Ala Leu Thr Ala Asn Ile Ala Asn Leu Glu Gly 400 405 410 acc aaa agt gag tca tta att aat aag ctt gaa acg tta aaa act ttt 1295 Thr Lys Ser Glu Ser Leu Ile Asn Lys Leu Glu Thr Leu Lys Thr Phe 415 420 425 430 aat tgg gaa act gaa act aca gaa aat aaa atc ctt atc atc aaa gag 1343 Asn Trp Glu Thr Glu Thr Thr Glu Asn Lys Ile Leu Ile Ile Lys Glu 435 440 445 ttt gtt gaa cgt ata gaa cta ttt gat gat gag gta att att aaa tat 1391 Phe Val Glu Arg Ile Glu Leu Phe Asp Asp Glu Val Ile Ile Lys Tyr 450 455 460 aaa ttt tag gtacatagtg ttatttacac taataaacaa aatcatatac 1440 Lys Phe ctaaaatatt acatttatac aaacctatag acaatacgaa catgcattcg gtg 1493 <210> 4 <211> 464 <212> PRT <213> Bacteriophage FC1 <400> 4 Met Lys Arg Ala Ala Leu Tyr Ile Arg Val Ser Thr Met Glu Gln Ala 1 5 10 15 Lys Glu Gly Tyr Ser Ile Pro Ala Gln Thr Asp Lys Leu Lys Ala Phe 20 25 30 Ala Lys Ala Lys Asp Met Ala Val Ala Lys Val Tyr Thr Asp Pro Gly 35 40 45 Phe Ser Gly Ala Lys Met Glu Arg Pro Ala Leu Gln Glu Met Ile Ser 50 55 60 Asp Ile Gln Asn Lys Lys Ile Asp Val Val Leu Val Tyr Lys Leu Asp 65 70 75 80 Arg Leu Ser Arg Ser Gln Lys Asn Thr Leu Tyr Leu Ile Glu Asp Val 85 90 95 Phe Leu Lys Asn Asn Val Asp Phe Ile Ser Met Gln Glu Ser Phe Asp 100 1 05 110 Thr Ser Thr Pro Phe Gly Arg Ala Thr Ile Gly Met Leu Ser Val Phe 115 120 125 Ala Gln Leu Glu Arg Asp Thr Ile Thr Glu Arg Met His Met Gly Arg 130 135 140 Thr Glu Arg Ala Lys Gln Gly Tyr Tyr His Gly Ser Gly Ile Val Pro 145 150 155 160 Leu Gly Tyr Asp Tyr Val His Gly Glu Leu Ile Ile Asn Asp Tyr Glu 165 170 175 Ala Gln Ile Ile Gln Glu Ile Tyr Asp Leu Tyr Val Asn Gln Gly Lys 180 185 190 Gly Gln Gln Tyr Ile Thr Lys Arg Met Val Ala Lys Tyr Pro Asp Lys 195 200 205 Val Lys Thr Leu Thr Ile Val Lys Tyr Ala Leu Thr Asn Pro Leu Tyr 210 215 220 Ile Gly Lys Ile Ser Trp Asp Gly Lys Val Tyr Asp Gly His His Ser 225 230 235 240 Pro Ile Ile Asp Lys Ser Met Tyr Asp Lys Ala Gln Glu Ile Ile Ala 245 250 255 Arg Met Ala Gln Lys Gly Gly Glu Gln His Gly Asn Gln Leu Gly Leu 260 265 270 Leu Leu Gly Ile Thr Tyr Cys Gly Lys Cys Gly Ala Glu Val Phe Arg 275 280 285 Tyr Val Ser Gly Gly Lys Lys Tyr Arg Tyr Asn Tyr Tyr Met Cys Arg 290 295 300 Ser Val Lys Lys Met Leu Pro Ser Leu Val Lys Asp Trp Asn Cys Lys 305 310 315 320 Gln Pro Ser Leu Arg Gln Glu Val Val Glu Lys Lys Val Ile Asp Ser 325 330 335 Leu Lys Ser Leu Asp Phe Lys Lys Ile Glu Arg Glu Leu Lys Gln Val 340 345 350 Glu Asn Lys Thr Lys Ser Lys Ile Thr Thr Ile Asn Asn Gln Ile Ser 355 360 365 Lys Lys His Asn Glu Lys Gln Lys Ile Leu Asp Leu Tyr Gln Tyr Gly 370 375 380 Thr Phe Asp Val Thr Met Leu Asn Glu Arg Met Lys Lys Ile Asp Asn 385 390 395 400 Glu Ile Asn Ala Leu Thr Ala Asn Ile Ala Asn Leu Glu Gly Thr Lys 405 410 415 Ser Glu Ser Leu Ile Asn Lys Leu Glu Thr Leu Lys Thr Phe Asn Trp 420 425 430 Glu Thr Glu Thr Thr Glu Asn Lys Ile Leu Ile Ile Lys Glu Phe Val 435 440 445 Glu Arg Ile Glu Leu Phe Asp Asp Glu Val Ile Ile Lys Tyr Lys Phe 450 455 460 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> on-1 primer for cloning of attB, attL <400> 5 cggccattga attagggtgt cgaat 25 <210> 6 < 211> 20 <212> DNA <213> Artificial Sequence <220> <223> on-2 primer for cloning of attB, attR <4 00> 6 cggattgcca gatggatgat 20 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> phy2 primer for cloning of attP, attR <400> 7 gaagatcttg ttctcgagca tagtctcc 28 <210> 8 < 211> 20 <212> DNA <213> Artificial Sequence <220> <223> phy3 primer for cloning of attL, attP <400> 8 gcgttaactg ccaatatagc 20

Claims (5)

A recombinant vector PTMJ1 comprising the MJ 1 gene of SEQ ID NO: 3 and represented by the cleavage map of FIG. 2. The transformant E. coli BL21 (DE3) pLysS / PTMJ1 into which the vector of claim 1 was introduced. Culturing the transformant of claim 2 by induction at 15 ° C. after addition of 0.5 mM IPTG (isopropyl-1-thio-β-D-falactoside); After 500 mL of the culture solution was frozen at -70 ° C, it was dissolved and left in 15 mL of lysis buffer (50mM NaH ₂ PO ₄ (pH 8.0), 300mM NaCl, 10mM imidazole), and then sonicated. Doing; And After centrifugation of the extract to take the supernatant, binding with Ni-NTA resin, binding and washing, washing and extracting the protein with elution butter (20mM Tris-Cl, 0.5M NaCl, 1M imidazole) Method for producing an integrase (integrase) MJ1 enzyme, characterized in that consisting of. An integrase MJ1 enzyme, prepared by the method of claim 3, having the following characteristics and fused with thiorredoxin. (a) Enterococcus temperate bacteriophage φFC1 derived from enterococci lysogenic phage. (b) Molecular weight: 70kDa (c) Substrate specificity: Recombinant activity on DNA in linear form as well as in circular form. (d) Optimum reaction pH: pH 7.6 (e) Optimum reaction temperature: 37 ℃ delete