KR100446148B1 - Novel Lactobacillus paracasei CLW-011 strain for probiotics and specific DNA sequence of the same - Google Patents

Abstract

In the present invention, in the production of probiotics having high organic acid generating ability and excellent acid resistance and juice resistance, live bacteria produced by separating and culturing a novel Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain in pig intestine are livestock It is effective in maintaining the intestinal flora of the intestine, preventing digestive diseases, reducing antibiotic use and improving productivity, and the specific sequence present in the endogenous plasmid of Lactobacillus paracasei CLW-011 is the present invention. Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain has an excellent effect on the rapid and accurate detection.

Description

Novel Lactobacillus paracasei CLW-011 strain for probiotics and specific DNA sequence of the same}

The present invention relates to a novel Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain and the specific sequence of the strain. More specifically, the present invention relates to the isolation and identification of Lactobacillus paracasei strains in the pig intestine and culturing them to produce probiotics, to identify specific strains of the strains and to detect these strains using the sequences. .

In the context of increasing public health and safety interest in food at home and abroad, the persistent and resistant bacteria problem of antimicrobial feed additives added for the purpose of promoting livestock growth and improving feed efficiency has been the subject of debate. Therefore, it is urgent to develop useful resources to replace these antimicrobial feed additives, and to this end, research on probiotics, prebiotics, acid fires, enzymes, oligosaccharides, and the like is being actively conducted.

Since the intestinal flora of livestock is closely related to the productivity of livestock, maintaining normal intestinal flora is directly related to the prevention of livestock disease, the reduction of antibiotic use and the improvement of productivity. Therefore, the development of probiotics continues to be the subject of research.

Probiotic means a microbial agent that functions usefully in the digestive tract of livestock, and the broad concept includes microorganisms used before feeding to livestock, such as silage addition and additives for fermented feed. However, since these microorganisms mainly work in vitro, livestock probiotics generally refer to microorganisms that feed directly to livestock.

The term probiotics, meaning probiotics, was invented by Lilly and Stilwell in 1965 and has been generalized and used worldwide since 1975. Probiotics originate from the Greek meaning of symbiosis and, unlike antibiotics, mean a beneficial relationship between living organisms.

As a strain used as a probiotic, lactobacillus, lactobacillus, enterococci, bifidus and the like, such as lactic acid bacteria, Bacillus, fungi and yeast are used. Particularly, among the probiotic strains, lactic acid bacteria which inhabit the intestines of livestock and produce organic acids include Lactobacillus, Luconos stock, Pediococcus, Enterococcus and Bifidobacterium. Known effects of lactic acid bacteria that produce organic acids include improving feed efficiency and gain rate in livestock, normalizing the intestinal microflora, suppressing digestive diseases of harmful bacteria through organic acid production, and replacing some antibiotics.

In the case of lactic acid bacteria, although there are many useful points as described above, most of the lactic acid bacteria currently used as probiotics have not been evaluated as accurate probiotic, and in particular, there is no reality in developing a system that can suppress the use of other lactic acid bacteria. . In addition, livestock probiotics are most ideally developed separately in the intestines of livestock, but not many strains used as probiotics.

In view of the above, the present inventors have isolated and identified a novel Lactobacillus strain that effectively produces organic acids in the pig intestine, and the acid and bile resistance of the Lactobacillus paracasei CLW-011 strain isolated and identified. The present invention was completed by evaluating that it can be used as a probiotic.

Accordingly, an object of the present invention is to provide a novel Lactobacillus paracasei strain, which can be used as a probiotic, having high organic acid generating ability, excellent acid resistance and bile resistance, and is isolated and identified from pig intestine. Another object of the present invention is to determine the total nucleotide sequence of the endogenous plasmid of the novel Lactobacillus paracasei strain isolated and identified from the pig intestine, and using this to identify specific nucleotide sequences with excellent selectivity in detecting the present strain. In providing.

The object of the present invention is to isolate a large number of lactic acid bacteria from the pig intestine and to select a strain having high organic acid production ability to investigate the bacteriological characteristics, acid resistance, and bile resistance of the selected strain, and to analyze the sequencing of the selected strain It was achieved by securing and confirming specific nucleotide sequences of only selected strains.

1 is a graph showing the organic acid production ability of the present invention Lactobacillus paracasei ( Lactobacillus paracasei ) CLW-011 (KCTC 10278BP) strain.

Figure 2 is a diagram showing the restriction map of the recombinant plasmid pTCP6 of the Lactobacillus paracasei ( Lactobacillus paracasei ) CLW-011 (KCTC 10278BP) strain cloned into the E. coli gene carrier pUC19.

Figure 3 shows the results of performing a polymerase chain reaction using pCLPr-4 and pCLPr-5 which are specific sequences of the endogenous plasmid of the Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain of the present invention. Bacillus paracasei ( Lactobacillus paracasei ) CLW-011 (KCTC 10278BP) is a photograph showing a gene specifically detected in the strain.

4 is a result of performing a polymerase chain reaction using primers pCLPr-6 and pCLPr-7 of the present invention Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain Lactobacillus paracasei ( Lactobacillus paracasei ) It is a photograph showing a gene specifically detected in CLW-011 (KCTC10278BP) strain.

The present invention is to isolate the novel lactic acid strain in the pig intestine and culture in the lactic acid bacteria separation medium and selecting only the strains confirmed acid resistance and bile resistance; Finally reselecting only the lactic acid bacteria having high organic acid production ability among the identified lactic acid bacteria; Identification of the strain through the morphological, biochemical properties and fatty acid analysis for the strain selected in the step; Separating the internal plasmid from the identified isolate and analyzing the total nucleotide sequence and determining the nucleotide sequence specifically present only in the isolated lactic acid strain among the analyzed nucleotide sequences; It consists of preparing a primer using a specific base sequence and examining the specific reaction of the isolated lactic acid strain of the prepared primer.

Hereinafter, the present invention will be described in detail.

As a medium for separating lactic acid bacteria from pig intestine, MRS agar medium, which is a medium for separating lactic acid bacteria, is used. In order to culture the lactic acid bacteria, the same components as the above-mentioned medium were used, and a liquid medium without agar was used.

Lactobacillus strain identification is based on the buggy's manual of determinative bacteriology, using the API 50 CHB kit to assess the carbohydrate availability of the strain along with fatty acid analysis using a MIDI system.

In order to isolate the lactic acid bacteria of the present invention, pig fecal samples are suspended in physiological saline, and the appropriate amount of the suspension is plated in lactic acid bacteria separation agar medium (MRS) and incubated at 37 ° C for 24 hours. Colonies determined to be lactic acid bacteria among the colonies formed in the agar medium are separated from each other purely, and microscopic observation is performed to evaluate carbohydrate resolution to finally determine whether lactic acid bacteria are present.

In order to confirm the acid resistance and bile resistance of the selected lactic acid bacteria strain isolated from the pig intestine, lactic acid bacteria selected in phosphate buffer adjusted to pH 3, pH 4, pH 5, pH 7 for 10 minutes, 20 Leave on minutes, 30 minutes, 120 minutes, smear on MRS agar medium, incubate at 37 ° C and check the acid resistance by checking the viability, and add 0.3% (w / v) bail salt to the MRS liquid medium. After inoculation with the selected lactic acid strains, the samples were left for 2 hours at 37 ° C., and the bile resistance was examined by checking the survival rate in MRS agar medium. In addition, inoculating the selected strains in MRS liquid medium to check the organic acid production capacity of the selected strains, and then culture at 37 ℃ to measure the growth of lactic acid strains and the production of organic acids. Based on the comprehensive results, the lactic acid bacteria with high acid and bile resistance and high organic acid production capacity are selected. The morphological and physiological characteristics of the strains selected as lactic acid bacteria having acid and bile resistance are investigated and identified. As a result, the morphological, biochemical and fatty acid constituent properties of the selected lactic acid strains are shown in Tables 3, 4 and 5, which are catalase negative. The selected lactic acid strain of the present invention was named as Lactobacillus paracasei CLW-011 strain, and it was deposited with KCTC 10278BP, deposited on June 17, 2002, at the Gene Bank in Korea Research Institute of Biotechnology. It was.

The selected Lactobacillus paracasei ( Lactobacillus paracasei ) CLW-011 (KCTC 10278BP) was grown in an MRS liquid medium to which 0.5% glycine was added, followed by alkaline decomposition method (Birnboim, HC and J. Doly, Nucleic Acid Res. 7, 1513-1523 (19979)) to isolate the endogenous plasmid. As a result, there was one kind of plasmid, which was named pCL6. As a result of processing and examining various restriction enzymes, pCL6 was found to be cleaved at one position by the restriction enzyme PstI, and the size of the cleavage was about 8.8 kb.

The restriction enzyme map of the endogenous plasmid pCL6 obtained from the cells of the Lactobacillus paracasei CLW-011 (KCTC 10278BP) is prepared, and the base sequence is determined. To this end, pCL6 and pUC19 of Escherichia coli were digested with restriction enzymes and treated with ligase to prepare a recombinant plasmid pTCP6, transformed into E. coli, mass-produced by culturing the transformant, and then separated from pTCP6 to obtain a large amount of pTCP6. do. pTCP6 was digested with restriction enzymes to generate a restriction enzyme map of pTCP6, which is shown in FIG. 2. In addition, to determine the nucleotide sequence of the endogenous plasmid pCL6 cloned into the recombinant plasmid pTCP6, pTCP6 obtained from mass-produced E. coli is treated with PstI to obtain a large amount of pCL6. A large amount of pCL6 was digested with various restriction enzymes, cut into small pieces of DNA fragments, and then inserted into pUC19 to determine a total of 8,772 bp sequences by a dideoxynucleotide sequencing method. The entire nucleotide sequence of the endogenous plasmid pCL6 isolated from the Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain of the present invention is shown in SEQ ID NO: 1.

Similarity search results of the gene sequence of the endogenous plasmid pCL6 of Lactobacillus paracasei CLW-011 (KCTC 10278BP), according to the present invention, Lactobacillus paracasei CLW-011 (KCTC 10278BP) The base sequences of four regions with high specificity of the strain can be identified. It can be used to detect the Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain of the present invention. Four types of high specificity fragments pCLPr-4, pCLPr-5, pCLPr-6 and pCLPr-7 are shown in Table 6. In addition, the polymerase chain reaction (PCR) is performed using the nucleotide sequence fragment as a primer to confirm the selective detection capability of the searched nucleotide sequence fragment. As a result, the nucleotide sequence fragment can be confirmed that the Lactobacillus paracasei ( Lactobacillus paracasei ) CLW-011 (KCTC 10278BP) strain selectively specific sequence. Therefore, the PCR reaction using primers pCLPr-4 and pCLPr-5 and pCLPr-6 and pCLPr-7 selectively detects the Lactobacillus paracasei CLW-011 strain (KCTC 10278BP) of the present invention. It is possible. In addition, pCLPr-4, pCLPr-5, pCLPr-6, pCLPr-7 can be used as a probe for detecting the Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain of the present invention.

Hereinafter, the specific method of the present invention will be described in detail with reference to Examples, but the scope of the present invention is not limited only to these Examples.

Example 1 Isolation and Selection of Lactic Acid Bacteria from Pig Intestine

In order to isolate the lactic acid bacteria of the present invention, 1 g of pig fecal sample was suspended in 10 mL of physiological saline, and an appropriate amount of the suspension was smeared on agar medium for separating lactic acid bacteria (MRS) and incubated at 37 ° C. for 24 hours. Colonies determined to be lactic acid bacteria were isolated from the colonies formed in the agar medium, and the lactic acid bacteria were finally confirmed by evaluating carbohydrate resolution through microscopic observation.

Example 2 Identification of Acid, Bile and Organic Acid Production Capacity of Selected Lactic Acid Bacteria

In order to confirm the acid resistance and bile resistance of the lactic acid bacteria strain isolated from the pig intestine in Example 1 was carried out as follows. Acid resistance was maintained for 10 minutes, 20 minutes, 30 minutes and 120 minutes in lactic acid bacteria selected in phosphate buffer adjusted to pH 3, pH 4, pH 5, pH 7, and plated on MRS agar medium, and then 37 ° C. After cultivation at the survival rate was confirmed, and the bile resistance was added to 0.3% (w / v) Bil salt in MRS liquid medium and inoculated with the selected lactic acid strain and left for 2 hours at 37 ℃ by hour After sampling, the survival rate was confirmed in MRS agar medium. Acid resistance and bile resistance of the selected lactic acid bacteria strains are shown in Table 1 and Table 2.

In addition, in order to confirm the organic acid production capacity of this strain was inoculated with 5% of the initial inoculum in 5L MRS liquid medium, and then cultured at 37 ℃ growth and production of lactic acid bacteria strain was measured.

Based on the measured results, the lactic acid bacteria were selected for their excellent acid and bile resistance and high organic acid production capacity. The organic acid production capacity of the Lactobacillus paracasei CLW-011 strain of the present invention is as shown in FIG.

Acid Resistance of the Novel Lactobacillus paracasei CLW-011 (KCTC 10278BP) Strain Response time (minutes) CLW-011 Survival Rate for Acid Resistance (%) pH3 pH4 pH5 pH7 10 100 100 100 100 20 100 100 100 100 30 100 100 100 100 120 100 100 100 100

Bile Resistance of the Novel Lactobacillus paracasei CLW-011 (KCTC 10278BP) Strain CLW-011 0.3% bile salt Treatment Time (min) Remarks 0 15 30 60 120 Survival + + + + + +; survival-; Non-survival

Example 3 Identification and Characterization of the Novel Lactobacillus Paracasei CLW-011 Strains of the Invention

In Example 2, the morphological and physiological characteristics of the strain selected as lactic acid bacteria having acid resistance, bile resistance, and excellent organic acid generating ability were investigated and identified. As a result, the morphological, biochemical and fatty acid constituent properties of the selected lactic acid strains are shown in Tables 3, 4 and 5, which are catalase negative.

Accordingly, the selected lactic acid strain of the present invention was named Lactobacillus paracasei CLW-011, which was deposited with the accession number KCTC 10278BP dated June 17, 2002 to the Gene Bank in the Korea Research Institute of Biotechnology.

Morphological Characteristics of the Novel Lactobacillus paracasei CLW-011 (KCTC 10278BP) Strain Item Colony Cell size Color transparency Surface altitude Viscosity Gram Dyeing shape Property 2-3 mm White opacity Convex lowness positivity rod

Biochemical Properties of Carbohydrate Availability of Novel Lactobacillus paracasei CLW-011 (KCTC 10278BP) Strains carbohydrate Usability carbohydrate Usability carbohydrate Usability Glycerol - Mannitol + D-raffinose - Erythritol - Sorbitol + Amidon - D-arabinose - α-methyl-D-mannoside - Glycogene - L-arabinose - α-methyl-D-glucosamin ± Xylitol - Ribose + N-acetyl-glucosamin + β-gentiobiose ± D-xylose - Amygdaline + D-turanose + L-xylose - Arbutine + D-lyxose - Adonitol - Esculine + D-tagatose + β-methyl-xyloside - Salicine + D-fucose - Galactose + Cellobiose + L-fucose - D-glucose + Maltose ± D-arabitol - D-fructose + Lactose - L-arabitol + D-mannose + Melibiose - Gluconate ± L-sorbose - Saccharose ± 2-ceto-gluconate - Rhamnose - Trehalose + 5-ceto-gluconate - Dulcitol - Inuline - Inositol - Melezitose +

Fatty Acid Composition of the Novel Lactobacillus paracasei CLW-011 (KCTC 10278BP) Strain Fat mountain Furtherance (%) nC _{14: 0} 5.68 nC _{16: 1} / Iso-C _as 2OH 4.73 Iso-C _{15: 0} 2) H / nC _{16: 1} ω7c 3.64 nC _{16: 0} 8.51 nC _{18: 1} ω9c 53.97 nC _{18: 1} ω9c / ω12t / ω7c 6.69 Cyclo-C _{19: 0} ω10c / unknwon 16.78

Example 4 Novel Lactobacilli Paracasei Lactobacillus paracasei ) Isolation and Gene Sequencing of Endogenous Plasmids of CLW-011 (KCTC 10278BP)

Lactobacillus paracasei ( Lactobacillus paracasei ) CLW-011 (KCTC 10278BP) of the present invention selected in Example 3 was grown in MRS liquid medium to which 0.5% glycine was added, followed by alkaline decomposition method (Birnboim, HC and J. Doly, Nucleic Acid Res. 7, 1513-1523 (19979)) isolated and examined the endogenous plasmid, and there was one type of plasmid, which was named pCL6. As a result of processing and examining various restriction enzymes, pCL6 was found to be cleaved at one position by the restriction enzyme PstI, and the size of the cleavage was about 8.8 kb.

Since the amount of the endogenous plasmid pCL6 obtained from the cells of the Lactobacillus paracasei CLW-011 (KCTC 10278BP) of the present invention is very small, the complete cleavage of pCL6 with PstI is first performed in order to prepare its base sequence and restriction enzyme map. The same enzyme was digested with E. coli gene carrier pUC19 digested with the same enzyme and treated with T4 DNA ligase for 15 hours at 14 ° C to prepare a recombinant plasmid, which was named pTCP6. E. coli was transformed and cultured with pTCP6 to produce a large amount of transformed E. coli, and then pTCP6 was isolated to obtain a large amount of pTCP6. pTCP6 was digested with restriction enzymes to generate a restriction enzyme map of pTCP6, which is shown in FIG. 2.

In order to determine the nucleotide sequence of the endogenous plasmid pCL6 cloned in the recombinant plasmid pTCP6 of the present invention, pTCP6 obtained from mass-produced Escherichia coli was treated with PstI to obtain a large amount of pCL6. A large amount of pCL6 was digested with various restriction enzymes, cut into small pieces of DNA fragments, and then inserted into pUC19 to determine a total of 8,772 bp sequences by the dideoxynucleotide sequencing method. The entire nucleotide sequence of the endogenous plasmid pCL6 isolated from the Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain of the present invention is shown in SEQ ID NO: 1.

Example 5 Novel Lactobacilli Paracasei of the Present Invention Using Specific Sequences of the Intrinsic Plasmid of the Present Invention Lactobacillus paracasei ) Detection of CLW-011 (KCTC 10278BP) Strain

As a result of similarity search of the gene sequence of the endogenous plasmid pCL6 of Lactobacillus paracasei CLW-011 (KCTC 10278BP) analyzed in Example 4, the present invention Lactobacillus paracasei ( Lactobacillus paracasei ) CLW- The base sequence of 4 regions with high specificity of 011 (KCTC 10278BP) strain was confirmed. It can be used to detect the Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain of the present invention. Four types of high specificity fragments pCLPr-4, pCLPr-5, pCLPr-6 and pCLPr-7 are shown in Table 6.

In order to confirm the selective detection ability of the nucleotide sequence fragment searched above, the above-described nucleotide sequence was used as a primer to perform a polymerase chain reaction (PCR). Amplified DNA fragments were subjected to agarose gel electrophoresis after PCR reactions on 8 strains of lactic acid bacteria and Lactobacillus paracasei CLW-011 (KCTC 10278BP) strains of the present invention. Investigate. For PCR reaction, add 15 pmol of primer pCLPr-4 and pCLPr-5 to Taq PCR premix (Bioneer), prepare a reaction solution so that the final 20 μL with sterile water, and take an appropriate amount of lactic acid colonies cultured in MRS agar medium. After suspending in the reaction solution, the reaction was allowed to stand once at 95 ° C. for 5 minutes, and then allowed to stand for 30 seconds at 95 ° C., 30 seconds at 57 ° C., and 30 times at 72 ° C. for 30 minutes in succession. As a result, the amplified DNA fragments are as shown in Figure 3, it was confirmed that only 1.4 kb in size of DNA fragments amplified from the Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain of the present invention. The amplified DNA fragments were not observed in the other 8 lactic acid bacteria.

The base sequence fragments of pCLPr-4 and pCLPr-5 used as primers in the PCR reaction are as follows.

pCLPr-5 (forward primer); 5´- CACTTCCCTTCTAAGTGGAATTGTAAC-3´

pCLPr-4 (reverse primer); 5´- GCTTGGTGTGCTTGGATTCACAGTG-3´

In addition, after performing the same reaction as described above using the primers pCLPr-6 and pCLPr-7 shown in Figure 4, the results of the amplification of the DNA is shown, as a result of the present invention only Lactobacillus paracasei ( Lactobacillus paracasei ) CLW-011 (KCTC 10278BP) strain of 1.8 kb in size was confirmed that the amplified DNA was not observed in the other eight lactic acid bacteria amplified.

The base sequence fragments of pCLPr-6 and pCLPr-7 used as primers in the PCR reaction are as follows.

pCLPr-6 (forward primer); 5´- GGTAAAGGGGAAAGACGGTG-3´

pCLPr-7 (reverse primer); 5´- GTACCCGTCAGACCCAGAGC-3´

The same experiment was performed on 8 kinds of lactic acid bacteria isolated from pig feces. As a result, it was confirmed that amplified DNA was not observed in any other isolate except the Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain of the present invention.

Therefore, by performing PCR reaction using primers pCLPr-4 and pCLPr-5 and pCLPr-6 and pCLPr-7, it is possible to selectively detect the Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain of the present invention. Do.

Specific sequence fragments present in endogenous plasmid pCL6 of the novel Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain primer Sequence (5 '→ 3') Size (bp) Sequence position pCLPr-4 CACTGTGAATCCAAGCACACCAAGC 25 8381 ~ 8405 pCLPr-5 CACTTCCCTTCTAAGTGGAATTGTAAC 27 6991 ~ 7017 pCLPr-6 GGTAAAGGGGAAAGACGGTG 20 389-408 pCLPr-7 GCTCTGGGTCTGACGGGTAC 20 2180 ~ 2199

As described above, the present invention, the novel Lactobacillus paracasei ( Lactobacillus paracasei ) CLW-011 (KCTC 10278BP) strain is excellent in organic acid generating ability and acid resistance and bile resistance, so the present invention Lactobacillus paraca By using the Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain as a live strain, it has an excellent effect to maintain the intestinal flora and prevent digestive diseases, and to use it as a probiotic suitable for reducing antibiotic use and improving productivity. A highly selective specific sequence fragment which is part of the endogenous plasmid pCL6 sequence of the Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain is the present invention Lactobacillus paracasei CLW-011 ( Lactobacillus paracasei ). KCTC 10278BP) can be used for rapid and accurate detection of animal medicine industry It is a useful invention in the feed industry.

<110> CTC bio LTD. <120> Novel Lactobacillus paracasei CLW-011 strain for probiotics and specific DNA sequences of the same <160> 5 <170> KopatentIn 1.71 <210> 1 <211> 8772 <212> DNA <213> Lactobacillus paracasei CLW-011 <400 > 1 ctgcaggaga gaaacgctgg attctcagca agatactgtt aatgattggg acggcgatat 60 tgacaacatg gctacagctt gtggctcaat gattactaac tgataaactt tcaaaaattg 120 atccgttaga ttgtacccta acggatcgtc cagaaacatc ttgaaataag gcttaaaatt 180 cgattcaaat aagtgacccg aaacgatttc taagatcgtt tcgggtattt ttatgggtag 240 tcgtgtgtag ccattgctat aattgacatt agattgcacg agatgaggac agccatatga 300 gcaaaacagt caaagagctt gcggatgagc taggtgttag taagcaaacc atcagatatc 360 attaccgcaa tataccggct aaatatgtgg taaaggggaa agacggtgta atccgaattg 420 atcctatagc agaagggatt atacgcaata aggtggtaaa taaccgccac aagaataccg 480 gtaaatatac cgataaagat agcaaattta ccggtaaaga aaaatatgat gatcagagaa 540 atatcttggt tgaacaatta gcgaaaaaag atgaagaaat aaagaggctt cattcttta c 600 tggaacaggc tcagaaaatt gcagatcaat cacagcagtt acaactaatg gcggagaaca 660 agctaaaaaa gttgtcagtg ccccaaaatg agcctgatag tgaatctaaa cctgtggaca 720 gccaaataca cgaacaagat tcagaatttc ccagaaggtc cgaaaacagt ccagaaaata 780 aaggatcttt ttggcatcga ttgtttggtg ttggaaaata agaaatagcc accgttggaa 840 cgatggctat ttcactatgg gttaggttat ttttaacttg cgtctccagt aaaatcaatt 900 tcgacttctg aaattgttcg accacttttt cgagcagcat agtgtacctt aattccagtt 960 ttttgattga tttcatcaat ggctggttgt aagtaacgac cattaaattg ccaccatttc 1020 atgttggtgt gaccaaaaaa ctctagaaac tcatcgggtg ttccattaac tcccatggag 1080 ccacgccaac tcatcagtag ttgatataac attaggctgt atttactacg caaagccacg 1140 atgtcagata aactgtattg tgctcttgaa ccaaccagtt tcaaaagcca gggtgctaat 1200 ttctcgtcaa gctctagagt agcagaacca tcctttttga tttccgctgt ttgaagccag 1260 cgagcaattg tgatcgtatc ttcatccttt tgaaaccaaa agcccttatt acttaagcta 1320 agcaaggatt ttgatgtttc ggttaaactt tttgttcctc gaccaaactc cattacct ga 1380 ttaatttctt tgatcgttgt ttgtaaagga cggaaaccag aatcatcgcg tcttacttta 1440 gacaccatga agtcaataag cttaagttct ttggctgtca attggtgtct tgctttttgc 1500 actaattgac ttgctttaat cacgggatag ccctgttgtt tgtcaatgct gtcttgacta 1560 attaacagat cagttccaat tggattaaaa atgatgcgtc ctccagattt cataagcaac 1620 ctcactattc atataccatt ttaagcaatc tagcacaaaa atagtatatt acatttttgt 1680 gagtttgcgg aatttttagt atgcatctgc ggaattttta gtatgcatct gcggaatttt 1740 tagtatgcat ctgcggaatt tttagtatgc atctgctctg aatcccttgg cagagtaagg 1800 cccaaaatcc tttatagtat tgatagtatt gataatatag aaattaaacc gcacgcgaaa 1860 cctttgggga gaccctctcc ccaaacccca taccaacccc tggtcgcttc gctccctaaa 1920 aaggtgtggc tttgccacat ttaactccgg cttcgcctgc gcgcctttgg cttgccctag 1980 cgcgcttcgc ttgcgtggct cagaagagcc tcagctgaag cttcggtggg gctatcgcca 2040 ttcaccaaca aaagcacgtt gcctaaattt gatcaatcat taaagctttt catttgtgcc 2100 atgaacatag gccaataaaa acggcttaga acgcttatat ttgcgttcta agccgtt tta 2160 gttgtagaaa gcattaattg tacccgtcag acccagagcc gttaaaatgg cccctttagc 2220 gctttttaaa agctactgct tcgataacca atcctcaaca atatttgatt tggtcacttt 2280 aacatgatac ttagccaggt ccggattttg attcacttcc tgctgctttt tcgctaccag 2340 ctgattcaat tttgcaatcg cctgatcggt caaggtgaac atgatccggt gagtttcggc 2400 ttgcttcgtc atctcaaaaa cctcctaaat ggtgatgatg aaaggtcgcc tggcaaacca 2460 acacgacgtt aaaactgtgt cacgttgccg gacgattttt ggtaaacagt tgcgactacc 2520 ctggtcaaaa cgtgcacgct tttctccagg taaagatcaa aataaattga gttgcgatcc 2580 aatccatctc aaaaatcggt tcgactggat cgaccacttt ttgaggccgt ttggaacgct 2640 cctaaaatca agcaagagca taaggcaaaa ctgaccccac aattggggta aaccgcagtg 2700 cggtttggtt tgtcgtgata gcacgctggg gtcacaatgt tgaatattga cgcgaaatcc 2760 aacattagca aaataggcaa tgttgaattt tagaaggaaa ttcaacattt gacgacaggc 2820 catattcctt agggacagtt gacttacaga gatcagtgtt ggattttttt gcaatattca 2880 acatttagtc aaaatggcac ttgtctgatc gaatgagcac gtttttggcg ttgcag cgta 2940 cgcaactcta tagtggcttg tttgcaacat gagatgcgta tagcaagtta ctccaattga 3000 agcatacgtg ttgctttaac agaaactatt gaggtgctta taacgcaaaa aaaattgaat 3060 taactgtagc tttaaagttg cacaaatagc gacttagatg ttcctcgaat gcaactcata 3120 tattacatga tgttcaactt gaacgaaact ccaaatacaa gaatatgtca acaccatgtg 3180 taacatcatg caaaggtcat tgaaaagatg tcgtcaggta ctgtttgaat tttggctttg 3240 aaggggcgac tcgcccctct tcaaaataac agggggattg ggggggtgcc cccaaacaaa 3300 attgacgatc agcgcagctg agattctgtc aattcatcgc aagtggacgt ccacttgcaa 3360 atctcgcgac agtagaaaat cgtcaaaaaa gcaaaatcgg tgaatggttg atcttgcttt 3420 ttgtttaggt cgcgactgca aaatcgtggc gctaaaacat aacgatttta taaaacatgg 3480 tgcgagcaac ttattgcttt gggtgccaat tgtttctgag ttgtttgagc acgtcttgct 3540 cggctcattt gaagactttt tcgtcgtgtt ctttttgttt ttgtgtgagg tgttcttgct 3600 cagttgtgcc gagtttgacg ctacgaactt tgtcgagtgc atgccatttt tcttttagaa 3660 ggtatagtgc tgtgctttct gttaaaatcg aaacgatgct aagtggcttt tcaaa aatta 3720 ctcgtggaga atttgattga tgaatgcaga acaacatgtg cctccgttta ggtttaaagg 3780 tttttctgat ttttgggaac agcgtaagct atcagacctt gctatgttca accctaggtt 3840 ggagctgcct gattcattcc aatacgttga tcttgaatct gtaagtggaa cggaattgat 3900 taaccatcga actgaaacca agtcatctgc tccatctagg gcgcaaaggc tggcaaaaaa 3960 aggcgatatc ttctatcaaa cagttcgtcc atatcagaag aataactatc tctatgagaa 4020 atcggatgat gattatgtat tctcaaccgg gtatgcgcag cttcggcctt atgaggatgg 4080 atattttctc tttagtcgac tgcaagaaaa cggctttgtc tccacagtgt tggaccatag 4140 tacgggtacc agctatccag ctataaactc caatgacctc gcaaagctag agatcatggt 4200 tcctcttaat ctgaacgaac agcaagcaat tggaaaacta tttcgccaca ttgacaacgc 4260 tatcgctctt catcagcata agctagctaa gcttaaagaa cttaaaaagg gctatttgca 4320 gaaattattc cctcaaaatg gtgagacggt gcctgagttt agatttaagg gatattctga 4380 cgcttgggaa aagcgtaagt ttgttcagat gctaaataat tcagatggtt taagaagagg 4440 gccatttggg agtgctttaa aaaaagcttt ttttgttaaa gaaagttctt ttgt tgtcta 4500 tgagcagcaa aacgcaattt acgatcggtt taatacaaga tatcgaattt cagagaagaa 4560 gtttgcagaa cttcataatt ttgaggtgct tcccggagat tttttattaa gtggagctgg 4620 aacgattgga agaattgcaa gagttccgaa ggggattgaa caaggagttt ttaatcaggc 4680 attaatccga ctcaggatta atgaaagtat gacggattcc gagttttttt tacaattcat 4740 tcgatcagac ttcatgcaaa aaaatctaac agaaactaat cctggttctg cgattcaaaa 4800 tttagttcct atgtcagaat taaaaaattg gacagttaga acacctgtag ttaatgaaca 4860 acggaaaatt ggttctcttc tcaaaaaaat tgacagcctt atcgctgcaa ctcagtgtaa 4920 gttagatttg ttgaagaaac tcaaaaaggg ctatttgcaa aagatgtttt gctgatcaat 4980 tctgagtaaa ttgatcagtt aacttagggc aatttttgaa atcaaaaaat tgatggaggg 5040 taaatgatgg tgaattctaa atcaaaaaag aagaccttaa cagcgttgag taacaaaggg 5100 ctgggagtat ttggtgaggt attaaatact ttgcactctg tagcagacac cgttaataaa 5160 gtcactccta agattgttga cgagggagtg aaggtgattg actctcacct agaaaaacat 5220 aaagacgatt ttaaaatgcc tggcttatct caaataagtg ttgctgaagc caa gcggata 5280 ttggcacttt atccaattaa cttttctcta gtcctagtta cacctgatat taagcttgca 5340 cagcagcgcc ctaatgttat tatcaaaact tcccccaagg agaatacaaa agttactcct 5400 ggatcattta ttcgtgtctt ttacgcagat gataatgtga ttgcgataag caggcagcta 5460 gcagatgatc aagcatcaaa aaaacagggc atgagaagca gaacgcgggt ggataatcaa 5520 gatcgcataa tccctgttat gaaaggaatc aaattagttt cgtctggagt gaacaccttc 5580 gctggaaagc ttacttttaa taaaaagatc aaaaattctt tgagtaaaga gccacttgat 5640 ccatctgatc cggtaattac tcaagagact aaaaaaactc gaaccagtag ttaagtttta 5700 caatgcagtt agtattctgg ttctggtgca aattttcctc gctgacttga ttttagtata 5760 ctgggtgcca agaaacgagg gattgcgcgc atgaatcact ttaaggacgc cactttcaaa 5820 aggacatcat cttagtagcc gttggctact atttcagatt cagtctcagc tatcgtgaca 5880 tcgttgaatt gcttcgggat cggggtatca ctgttcatca caccacggtc atgcgttggg 5940 ttcatcacta tggccccatc tttaaggctc tatggcgtcg gcatcaaaca gctcacgcta 6000 aaagttggcg aatcgatgag acctatattc gagttaaagg ccgttgggcc ta tttgtatc 6060 gcgctattga cagtaacggt ttgaccatgg attttgagct acgaaaacac cgcgattata 6120 ccgcatccta tcactttttg aagcgtctct tgacgaccaa tggtcgtcct gatcgattag 6180 tcactgatca atatcgggca acactgaaag cagtgaagca cctgataaag caagactatt 6240 tgagcaaatc agcccaccaa tgttccaaat atcgaaataa tttgattgaa caggaccacc 6300 gattcattaa acgtcatcgt gtccgctcag caagctttca aagcattcga accgctagtg 6360 caacgttgag cggtgtggaa attgttcacg caatacgcaa aagaacccga cgagagttaa 6420 gtctcatcgg gttctcagtc gtggacgaat tagaagcatt gttagctgca taaccttcaa 6480 cataggatca attagttctt gacataaatc atatcttttg ataaataatt tgtcttattc 6540 accagtaccc tccagagggc cctcctgctt aattgcatcg gctttagtgg cttcattagt 6600 tcctttttgg tgcttgaccg gtgaataaat agagaagacc ttcatggtct gttttccagc 6660 gttgatcacg ttatgccaag tgttatcagg aacaactaca gcctctcccg gatgaatttc 6720 ctgatcaact gttaaatgat ctttatcttt ccccatttta acgtggccaa taccggctac 6780 taagtaaata agttgatcat taccatgatg aatttccata ccaatatcac c acctccggc 6840 tgggatagcc attaatgtga tttgaaaatg atccccggtc cacaaagtag ttcgataatt 6900 ttcattttcc aaagcagccg attttaaatc aggtgcaaag ggtgctggac cgtagtctcc 6960 taaatctgcg cttttttcta acataataaa cacttccctt ctaagtggaa ttgtaacatg 7020 gttctggtgc aaattttcct cactgacttg attttagtat actgggtgcc aagaaacgag 7080 ggattgcgcg catgaatcac tttaagggac gccactttca aaaggacatc atcttagtag 7140 ccgttggcta ctatttcaga ttcagtctca gctatcgtga catcgttgaa ttgcttcggg 7200 atcggggtat cactgttcat cacaccacgg tcatgcgttg ggttcatcac tatggcccca 7260 tctttaaggc tctatggcgt cggcatcaaa cagctcacgc taaaagttgg cgaatcgatg 7320 agacctatat tcgagttaaa ggccgttggg cctatttgta tcgcgctatt gacagtaacg 7380 gtttgaccat ggattttgag ctacgaaaac accgcgatta taccgcatcc tatcactttt 7440 tgaagcgtct cttgacgacc aatggtcgtc ctgatcgatt agtcactgat caatatcggg 7500 caacactgaa agcagtgaag cacctgataa agcaagacta tttgagcaaa tcaacccacc 7560 aatgttccaa atatcgaaat aatttgattg aacaggacca ccgattcatt aaacgtcatc 7620 gtgtccgctc agcaagcttt caaagcattc gaaccgctag tgcaacgttg agcggtgtgg 7680 aaattgttca cgcaatacgc aaaagaaccc gacgagagtt aagtctcatc gggttctcag 7740 tcgtggacaa attagaagca ttgttagctg cataaccttc aacataggat caatagctgg 7800 ttagatggtc atctctcaca ctgtttgcac cagatccttt gcgagcaacg acagtggggc 7860 tccactaggt tttacaattt ctgatggcaa attaggcact caagtacaag ctgaaatcaa 7920 taaattcaaa gaggcgcacg aagctgcaag gaattttgac tttacggctt tgcttggtac 7980 actagggcca atgattggca atggaaatct aaaggttgga atgtcaacta aaaatggaat 8040 gttggggttt aaagtggtct gtgagtctac aacaacagtt gttactaacg gccaacagga 8100 aaatgttaca acctcattga gtattgagat atacactaaa ccaaatggat tggggatccc 8160 agctgaggat tataaaccaa tttatgttcc cgtttctgaa catgaaccaa acctggagtg 8220 gattccttgg gcggcaggag ctgttgtatt aatagcaaca attattatgg ctccagaagt 8280 agcggctacg cttgttggaa cggctgctaa actattacca gcgacattca ttgctgctta 8340 gcttttaagg aggcgattaa ttggggttgt tacaattaat gcttggtgtg cttggattca 8400 cagtgttatt aagttctctt tttttgacaa tattggtacg gcgacaagct gcgcatcaaa 8460 agcgtagtga agcctatata gaagtagcta aatatctggg tgaaaatcca actttattta 8520 agaaggtgaa ccaattagtc aaattggaaa gcacaacaaa gattttatca ttggtgtttt 8580 tcttaagtgg ctggatagtc tattcaataa acgattttct gataatttct ttggacgata 8640 gtgtccgtgt aatgattttg tggacatcaa ttgtcttgtt tgttatctta accattgtgc 8700 agatgatgct agaatttcgg cacaaaaaat tgttggcttt tcctctgtct aatatttctc 8760 cagtagagaa ta 8772 <210> 2 <211> 25 <212> DNA <213> Lactobacillus paracasei CLW-011 <400> 2 cactgtgaat ccaagcacac caagc 25 <210> 3 <211> 27 <212> DNA <213> Lactobacillus paracasei CLW-011 <400> 3 cacttccctt ctaagtggaa ttgtaac 27 <210> 4 <211> 20 <212> DNA <213> Lactobacillus paracasei CLW-011 <400> 4 ggtaaagggg aaagacggt g 20 <210> 5 <211> 20 <212> DNA <213> Lactobacillus paracasei CLW-011 <400> 5 gctctgggtc tgacgggtac 20

Claims (9)

Lactobacillus paracasei CLW-011 (KCTC 10278BP) strain derived from pig feces having organic acid production ability and having acid and bile resistance. Probiotic for livestock feed containing the strain of claim 1. The base sequence of SEQ ID NO: 1 of endogenous plasmid pCL6 of the strain of claim 1. The base sequence fragment probe pCLPr-4 of claim 1 described in SEQ ID NO: 2. The base sequence fragment fragment pCLPr-5 of claim 1 described in SEQ ID NO: 3. The base sequence fragment fragment pCLPr-6 for a strain probe according to claim 1 described in SEQ ID NO: 4. The base sequence fragment strain pCLPr-7 of claim 1 described in SEQ ID NO: 5. A method of probing the strain of claim 1 by performing PCR using the following nucleotide sequence fragment as a primer. pCLPr-5 (forward primer); 5´- CACTTCCCTTCTAAGTGGAATTGTAAC-3´ pCLPr-4 (reverse primer); 5´- GCTTGGTGTGCTTGGATTCACAGTG-3´ A method of probing the strain of claim 1 by performing PCR using the following nucleotide sequence fragment as a primer. pCLPr-6 (forward primer); 5´- GGTAAAGGGGAAAGACGGTG-3´ pCLPr-7 (reverse primer); 5´- GTACCCGTCAGACCCAGAGC-3´