KR100438887B1 - Gene ORE4 which regulates leaf longevity in Arabidopsis thaliana and mutant genes thereof - Google Patents

Abstract

The present invention relates to a leaf life regulation gene ORE4 isolated from Arabidopsis thaliana , a mutant gene ore4 that extends plant life by inhibiting various physiological and biochemical changes associated with aging of the plant as a mutant type of the gene, and these It is about the use of genes.

According to the present invention, the leaf life control gene of the present invention and its mutant genes can be used to increase the productivity and storage efficiency of the plant through prolongation of life, and to control genes or plant aging inhibitors related to plant life control. The genes can be used to develop biomarkers for screening.

Description

ORE4 which regulates leaf longevity in Arabidopsis thaliana and mutant genes

The invention variant gene reduces the various physiological and biochemical changes associated with aging of the plant as a mutant type of leaf longevity regulatory genes ORE4, the genes isolated from Arabidopsis (Arabidopsis thaliana) extends the plant life ore4 and their It is about the use of genes.

The suppression of aging of plants is of great industrial importance, not only because of their academic importance, but also because of the possibility of improvement in crop productivity or post-harvest storage efficiency. Accordingly, genetic, molecular, biological, physiological and biochemical studies for identifying the aging of plants have been actively conducted. In particular, studies of gene discovery and function using life-long mutations not only reveal signal transduction pathways that affect the rate of aging progress, but also provide important clues to solving practical problems such as improving plant productivity and increasing the storage efficiency of fruits before and after harvest. do.

Senescence is the last step in a plant's lifespan. The onset of aging is a radical turning point in the plant development phase, during which cells undergo dramatic changes in metabolism and cell structure. Representative phenomena that appear in the vegetation change is the foliage that appears as chlorophyll is destroyed and other pigments are produced. Chlorophyll disruption that occurs during the foliage period occurs with chloroplast disruption and a decrease in anabolic activity such as photosynthesis or protein production. In contrast, during this period, a large number of hydrolase is induced to activate catabolism such as nucleic acid breakdown or proteolysis (Matile P. et al., In Crop Photosynthesis: Spatial and temporal Determinant, Elservier 413-440, 1992; Nooden LD et al., Senescence and aging in Plant, Academic press, 1988; Thiman KV et al., The senescence of leaves, CRC press, 85-115, 1980). However, plant aging is thought to be a genetic trait actively acquired to adapt to the environment during the evolutionary process, such as the process of cell degeneration and the transfer of nutrients from growth organs to the reproductive organs in winter.

Aging leads to a series of successive biochemical physiological phenomena that eventually lead to death of cells, organs, and entire organisms (Matile P. et al., In Crop Photosynthesis: Spatial and temporal Determinant, Elservier 413-440, 1992; Nooden LD et al., Senescence and aging in Plant, Academic press, 1988; Thiman KV et al., The senescence of leaves, CRC press, 85-115, 1980; Thomas H. et. Al., Annu. Rev. Plant Physiol. 123: 193-219, 1993). The causes of aging are largely divided into the theory of genes that proceed according to a program scheduled by genes, and the accumulation of errors that occur due to repetitive information transmission errors or accumulation of errors in protein synthesis in vivo. The theory of genes determined by genes is gaining convincing power. Therefore, cloning of genes related to aging and exploring gene function in plant aging can be a very important means for the study of aging process and its regulation. However, despite this academic and practical significance, much is not known about plant aging. Until now, research related to aging of plants has mainly been reported mainly on plant hormones, and molecular biology research has recently started.

Plant growth hormone (Cytokinin) is known as a hormone that can delay aging physiologically, and research has been conducted to delay aging by controlling the secretion of cytokinin through aging-related gene regulation. There was a problem affecting other physiological actions of the plant. Recently, by solving this problem, by connecting the IPT gene to the aging-specific SAG12 gene promoter to regulate the growth of plant growth hormone at a certain aging stage, delaying the progression of aging, while achieving a productivity increase of more than 50%, It has been successful in the flowering period and little change (Gan S. et al., Science 22: 1986-1988, 1995). In addition, the development of delayed aging plants has been attempted to inhibit the synthesis of ethylene, a chemical that plays an important role in aging, or to reduce the amount of ethylene in cells, mainly targeting the ripening of tomatoes. klee et al., Plant Cell, 3 (11): 1187-93,1991; Oeller et al., Science, 18; 254 (5030): 437-9, 1991; Piction et al., Plant Physiol. 103 (4) : 1471-1472, 1993).

Molecular biological research aimed at delaying aging is mainly focused on the manipulation of related genes that have activity related to biochemical changes occurring in the aging process or are involved in signaling systems. In the case of tomato, antisense DNA has been reported to prevent tomato softening by preventing gene expression associated with cell wall degradation, thereby increasing tomato transport and storage (Giovannoni et al., Plant Cell 1 ( 1): 53-63, 1989). Inhibition of expression of phospholipase D, which is involved in lipid degradation, with antisense DNA has been reported to delay aging by plant hormones (Fan et al., Plant). Cell 9 (12): 2183-96,1997).

However, more direct control of plant aging can be achieved through molecular biology studies through genetic analysis of expression changes with aging and genetic studies to isolate and analyze aging-related mutations.

Previous reports have shown that the expression of ethylene receptors is regulated during aging of fruit ripening stages and flowers of Arabidopsis (Payton S. et al., Plant Mol. Biol. 31 (6): 1227-1231, 1996). Clp gene expression is regulated during aging (Nakabayashi K. et al., Plant Cell Physiol. 40 (5): 504-514, 1999). Recently, gene search related to leaf aging process using Arabidopsis mutants (Oh SA et al., Plant Mol. Biol. 30 (4): 739-54, 1996) and three related loci (Oh SA et al. , The Plant Journal. 12 (3): 527-535, 1997), sen1 promoter activity (Oh SA et al., Journal of Plant Physiol. 151: 339-345, 1997), etc., have been reported. However, the molecular biological researches on genes and roles that directly control aging are insufficient.

Therefore, the inventors of the present invention have tried to search for genes related to prolongation of life by finding variants that have extended life span among Arabidopsis with great genetic benefits. By finding extended mutants and searching for the gene for this variant, the aging related gene was identified as a gene consisting of 850 nucleic acids encoding a small subunit of chloroplast ribosomes, and the gene was named ORE4 . In addition, the present invention was completed by confirming that ore4 , which is a mutant type of this gene, greatly increases the lifespan of Arabidopsis.

It is an object of the present invention to provide a variant gene of said gene which shows the gene which can control the life of a plant and the trait which has extended lifespan. Specifically, the present invention not only reveals signaling pathways affecting the speed of aging, but also identifies new aging-related genes that can solve practical problems such as improving plant productivity and increasing the storage efficiency of fruits before and after harvest through transformation. It aims to provide.

Figure 1 is a phenotype of the Arabidopsis wild-type and life-extending variant ore4 is a photograph showing the entire plant and the fourth left lobe at 41 days (Fig. 1a) and 53 days (Fig. 1b) after germination,

Figure 2a is a graph showing the change over time of photosynthetic activity in the Arabidopsis wild type and life extension mutant ore4 (photosynthetic activity is represented by Fv / Fm representing the photochemical efficiency of PSII, where Fv is the maximum modified fluorescence (maximum) variable fluorescence), Fm is the maximum yield fluorescence),

□: Wild type ■: ore4

Figure 2b is a graph showing the change over time of the chlorophyll content in ore4 of the Arabidopsis wild type and life extension mutant,

□: Wild type ■: ore4

Figure 2c is a graph showing the time-dependent change in membrane ion outflow degree in ore4 of the Arabidopsis wild type and life-extending variant ( measurement of membrane ion outflow is expressed as a percentage of the initial conductivity to the total conductivity),

□: Wild type ■: ore4

Figure 2d is a result of Northern blot analysis of the expression patterns of senescence associated genes (SAGs) and other photosynthesis-related genes over time during the development of the leaves in the Arabidopsis wild type and life extension mutant ore4 ,

CAB: Chlorophyll a / b binding protein

RBCS: ribulose biphosphate carboxylase small subunit

SAG12: senescence-associated gene 12

3 is a graph showing the change in leaf life as photosynthetic efficiency (A) and chlorophyll content (B) after dark treatment affecting the onset and progression of aging in ore4 , the Arabidopsis wild-type and life-extending variants.

□: Wild type ■: ore4

Figure 4 shows that plant hormones affecting the onset and progression of aging in ore4 , the Arabidopsis wild-type and life-extending variants, ABA (abscisic acid) (Figure 4a), MeJA (methyl jasmonate) (Figure 4b), ethylene (ethylene) ( Figure 4c) is a graph showing the photosynthetic efficiency and chlorophyll content changes in leaf life after each treatment,

Black Bar: Untreated Plant Hormone

White bar: plant hormone treatment

Figure 5a illustrates the RPS17 gene inserted into T-DNA as ore4 variants, ore4 variant in Figure schematic representation of the T-DNA insertion position and the direction a (direction of transcription is indicated by an arrow under the gene constructs RPS17),

LB; Left boarder RB; Right boarder

And Figure 5b results confirmed the expression pattern of the RPS17 gene in Arabidopsis wild type and mutant type ore4 life extension by Northern blot analysis,

Figure 6 is a graph showing the change in weight of leaves in wild type and ore4 variants.

□: Wild type ■: ore4

In order to achieve the above object, the present invention provides a gene ORE4 involved in the regulation of aging and ORE4 protein expressed from the gene, which is found in a mutant Arabidopsis thaliana whose leaf life is significantly extended compared to wild type. . The present invention also provides a method of searching for a gene or a substance capable of inhibiting aging related to aging of a plant using the aging control gene or protein.

The leaf life regulation gene ORE4 of the present invention encodes the chloroplast ribosome small subunit 17 (RPS17) of chloroplast ribosomes, each of which is required in equal amounts for the combination of ribosomes with normal function, Therefore, chloroplasts cause oxidative damage to cells by generating a large amount of reactive oxygen species beyond the limits that can be regulated during normal plant aging.

In addition, the present invention provides a variant ore4 genetically engineered genetically engineered to decrease the expression of the gene ORE4. The method of making a variant ore4 gene may use a method of suppressing expression of genes well known in the art, such as insertional mutagenesis or antisense suppression, but preferably T-DNA in the upper region of the ORE4 gene. By inserting the variant ore4 gene. The variant ore4 gene represents a trait that extends the life of the plant, and a method of extending the life by transforming the mutant ore4 gene into a plant or by directly manipulating the plant's ORE4 gene to make the variant also extends the scope of the present invention. Belongs to.

Plants having the mutant gene ore4 of the present invention are unable to form a complete ribosomal combination due to the lack of small subunit protein 17 of chloroplast ribosomes and cannot form chloroplasts with normal functions, resulting in reduced photosynthetic efficiency and low activity compared to wildtype. The production of oxygen species prolongs the life of the leaves.

In the present invention, 'ore' means long lived, and is defined by the present inventors to mean a gene, a protein, or a trait expressed therefrom that is involved in controlling the life of a plant. Specifically, the ' ORE4 gene' or the 'ORE4 protein' refers to the life control gene or protein searched for in the present invention, respectively, and the 'variable ore 4 gene' is a genetically engineered mutation to lower the expression of the gene of ORE4 . Type gene.

Hereinafter, the present invention will be described in detail.

In the present invention, in order to search for genes involved in lifespan regulation, first, mutants showing prolonged traits were selected. For this purpose, we used Arabidopsis as an experimental plant, which is widely used as a material for genetic and molecular biological studies of plants. The Arabidopsis has a small size of about 125 Mbp and almost completely decoded genome in five chromosomes. It is widely used as a genetic model of plant because it has the complete genetic and physical map, has a short lifetime, produces many seeds, and is easy to cultivate and transform (http://www.arabidopsis.org). .

In the present invention, the T-DNA is inserted to select mutations for screening mutants having extended leaf life for the Arabidopsis larvae, and then, among the grown individuals, individuals with slow yellowing speed of leaf yellowing are selected, and their lifespan. Leaf viability, chlorophyll content, photosynthetic efficiency, and ion outflow rate changes were examined to identify extended traits. The above-selected variant was named as ore4 variant, and its traits were compared with wild type. As a result, wild type had already started aging of leaves at 41 days after germination (DAG), while the fourth leaf was completely yellowed. Type ore4 still had large amounts of chlorophyll in the 53 DAG. On the other hand, the ore4 mutant was slower in aging than the wild type in terms of photosynthetic activity reduction and membrane ion efflux, which are other indicators of aging progression.

In general, leaf aging is accepted as already scheduled in the gene, but the onset and progression of aging is such as abscisic acid (ABA), methyl jasmonate (MeJA) and ethylene. It is known to be altered by plant hormones (Hensel et al., Plant Cell 5: 553, 1993). Therefore, the progress of aging after treatment with ABA, MeJA and ethylene, respectively, was investigated by investigating the chlorophyll content and photosynthetic activity in order to investigate the change of leaf life in ore4 variants according to the treatment of these plant hormones. As a result, there was no difference in photosynthetic activity and chlorophyll content in wild-type and ore4 mutants. This suggests that ORE4 is not involved in the aging process promoted by these hormones, and thus is involved in the aging process only through life-dependent methods.

On the other hand, in the embodiment of the present invention, in order to determine whether the extension of life in the ore4 variant acts at the molecular level as well as the physiological level, the expression pattern of various aging-related genes were investigated through Northern blotting. For example, anabolic and self-maintenance gene activity, such as photosynthesis, increases during leaf growth and decreases during aging (Nam et al., Curr. Opin. Biotech. 8 : 200, 1997). In wild type, photosynthetic gene expression, such as chlorophyll a / b binding protein, decreases in proportion to aging progression. However, the ore4 variant of the present invention showed little difference in expression of these genes. On the other hand, expression of various aging-related genes SAG12 increases with the progress of aging in the wild type. However, at the same time, it was confirmed that the expression of the aging-related genes hardly increased in the ore4 variant. This fact suggests that the life-long effects of ore4 variants are at the physiological and molecular levels.

Genetic analysis of ore4 variants isolated from T-DNA inserted mutants to find genes involved in plant life regulation as described above resulted in the induction of ore4 mutations by insertion of one T-DNA. I could confirm that. Genomic DNA isolated from the T-DNA insertion by inverse polymerase chain reaction resulted in T-DNA being inserted into the top 758 bp from the translation start site of the RPS17 gene, resulting in no expression of the gene. Confirmed by blot analysis. From this, the 2.8 kb fragment containing the RPS17 gene was subcloned and confirmed that the fragment was sufficient to complement the ore4 variant. The nucleotide sequence of the ORE4 gene and the amino acid sequence of the ORE4 protein provided in the present invention are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

The chlorophyll ribosomal small subunit protein, encoded by the ORE4 gene, the chlorophyll RPS17 gene, is regulated by a common mechanism because ribosomal combinations require the same amount as other subunits. Since the RPS17 gene is present in the Arabidopsis as one copy number, the ore4 variant will slow down the overall rate of photosynthesis by reducing the expression of many types of photosynthetic elements that are not specific photosynthetic elements. In order to confirm the decrease in photosynthetic ability, the chlorophyll fluorescence rate of the fourth left lobe was measured in 16 DAEs (wild day and mutant), and the ore4 mutant photosystem II was partially impaired. It was confirmed that it was reduced. For plants, photosynthetic processes are the only means of energy supply and cause cell damage when free radicals produced during the oxidation / reduction reactions involved in these processes are leaked and cannot be processed immediately, especially those free radicals, including plants. It has long been considered a risk factor for oxidative injury in the aging process of a wide variety of species. After all, the low photosynthesis rate of the ore4 variant confirms that it produces lower intracellular free radicals than the wild type. Furthermore, the average weight of the fourth left lobe of the variant at 67 DA of the wild type at 20 DAE confirms the correlation between leaf growth and photosynthetic rate in the ore4 variant.

The mechanism by which the ORE4 protein of the present invention affects the leaf life of Arabidopsis can be estimated as follows. The absence of this ORE4 protein prevents the formation of ribosome combinations that function in plant chlorophyll and inhibits the production of several elements necessary for photosynthesis, resulting in a reduction in the overall plant photosynthesis rate. The reduced photosynthetic rate in these plants lowers the metabolic rate and eventually slows aging of the plant leaves with the production of low reactive oxygen species. There is no known reduced metabolic rate and aging delay in plants. Thus, the study of the ore4 variant will provide a direct genetic review of the role of energy balance and aging.

However, the lifetime control effect or the long life effect due to ORE4 gene and the protein or variants ore4 gene according to the present invention is to rely on, but may be that the mechanism is explained by the theory as described above, or bound by the theory are limited to It is not.

Meanwhile, the ORE4 gene and ORE4 protein of the present invention can be usefully used to search for aging-related genes or aging inhibitors of plants. For example, ORE4 genes and nucleotide sequences can be compared to search for genes with high sequence homology, or hybridize with cDNAs prepared using RNA or mRNA extracted from plants treated with aging substances as part of probes. By carrying out the reaction, similar genes can be searched. In addition, the present invention may be used to search for substances that bind directly to the gene of the present invention, substances that inhibit or activate the expression of the gene, or to search for aging inhibitors by analyzing the binding patterns with the ORE4 protein. Specific methods can be performed by various methods including DNA chips, polymerase chain reaction (PCR), Northern blot, and the like, which are well known in the art.

In addition, when using the ORE4 protein, the assay can be performed by confirming the expression pattern of the ORE9 protein by a method selected from the group including enzyme immunoassay (ELISA), protein chip and 2-D gel analysis.

On the other hand, the present invention provides a method for extending the life of the plant by transforming the plant with ore4 variant genes. As a method for producing a plant transformed with the mutant gene, a known plant transformation method may be used, for example, Agrobacterium (Agrobacterium) using a binary vector for plant transformation into which the mutant ore4 gene is introduced. ), Or by using a vector that does not contain a T-DNA site, electroporation, microparticle bombardment, polyethylene glycol precipitation media, etc. Can be used.

In addition, the present invention provides a method of extending the life of the plant by direct genetic engineering of the ORE4 gene of the plant to make a variant ore4 gene. The method of making the variant ore4 gene may use a method of suppressing expression of genes well known in the art such as, for example, insertional mutagenesis or antisense suppression, but preferably, the T region is located in the upper region of the ORE4 gene. By inserting DNA the variant ore4 gene is made.

As a plant which can be extended in life by the method of the present invention, most dicotyledonous plants including lettuce, Chinese cabbage, potatoes, and radish can be used. In particular, thin skins such as tomatoes have a aging quality. It is effective to increase storage efficiency when applied to edible vegetables or fruits and plants whose leaves are traded as main products.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Example 1 Baby Pole ( Arabidopsis thaliana Selection of Life Extension Mutants from

Mutations in which T-DNA was inserted into the seed of the Arabidopsis wild-type WS were grown in a temperature-controlled greenhouse at about 23 ° C, and the degree of leaf yellowing due to the decrease in chlorophyll due to age-dependent plant aging was observed. One individual with a slower yellowing rate of leaves compared to the wild type was selected and named as ore4 to live the variant for a long time. In contrast, from the results of biochemical analysis (chlorophyll content analysis, photochemical efficiency analysis), which is used as a biomarker to measure the degree of aging of leaves, the mutant plants are actually functional stay-green plants. It was confirmed). The above life-spanning variants and wild-type individuals to be used as controls were grown in a growth room (Korea Instrument Inc.) at 22 ° C., 16 hours light / 8 hours dark condition prior to use in subsequent experiments. The left lobe was used 3 or 4 times for the experiment. In the wild type, the left lobe has already begun aging at 41DAG, while the left lobe of ore4 still contains a large amount of chlorophyll and even at 53DAG has a high chlorophyll content (see Figure 1a / b).

Example 2 Life Extension Variants ore4 Investigation of the expression of

In order to determine the longevity of transfected mutant ore4 the leaf chlorophyll content of ore4, photosynthetic activity and membrane measuring approximately ion leakage was compared to that of wild-type Arabidopsis thaliana.

2-1) photosynthetic activity

To measure photosynthetic activity, Oh et al. (Oh SA et al., Plant Mol. Biol. 30: 939, 1996) was used. First, the leaves of each DAE were treated with cancer for 15 minutes, and then fluorescence of chlorophyll was measured by using a Plant Efficiency Analyzer. Photosynthetic activity was expressed by the photochemical efficiency of PSII (photosystemII) using the fluorescence properties of chlorophyll, which was the maximum variable fluorescence (Fv) against the maximum value of fluorescence (Fm). It is expressed as the ratio of (Fv / Fm). Higher values indicate better photosynthetic efficiency. As a result, wild-type showed no photosynthetic efficiency at 36 DAE, while ore4 maintained more than 70% (see FIG. 2A).

2-2) Chlorophyll content measurement

In order to measure the content of chlorophyll, the leaves of each sample were boiled with 80 ° C. and 95% ethanol to extract chlorophyll. Chlorophyll content was measured by absorbance at 648 nm and 664 nm and expressed as chlorophyll concentration to fresh weight of leaves (Vermon et al., Anal. Chem. 32: 1142-1150, 1960). As a result, as shown in FIG. 2B, only 19% of the amount of chlorophyll at 16 DAE was maintained in the wild type at 28 DAE, while 80% of the value was maintained in the ore4 variant (see FIG. 2B).

2-3) Investigation of membrane ion leakage

The degree of membrane ion efflux was determined by measuring the electrolyte emanating from the leaves. Two leaves per Arabidopsis were collected, immersed in 3 ml of 400 mM mannitol and gently shaken at 22 ° C. for 3 hours, followed by a conductivity meter ( Initial conductivity was measured using the conductivity meter SC-170). After boiling the sample for 10 minutes, the total conductivity was measured, and the conductivity was expressed as the ratio of the initial conductivity to the total conductivity (%). As a result, the outflow of membrane ions increased rapidly after 28 DAE in the wild type, and rapidly increased after 36 DAE in the case of ore4 (see FIG. 2C).

Taken together, the ore4 variant was found to have a much longer phenotype of leaves than the wild type, and the effect of prolonging the lifespan was expressed by decreased chlorophyll content, decreased photosynthetic activity, and membrane ion release. It can be seen that the biochemical changes with aging appear later than the wild type.

<Example 3> ore4 Age-related Gene Expression in Variants

To determine how ore4 affects the expression of senescence associated genes (SAGs), the expression patterns of SAG proteins over time during leaf development were examined by Northern blot. Samples were examined by extracting total RNA from 16, 24, and 28 DAEs, which were at full maturity, 10% or less chlorophyll loss, and about 50% chlorophyll loss, based on wild-type leaves. Each lane was loaded with 10 μg of RNA and the full-length ORE4 gene was used as a probe. Anabolic activity and self-maintenance gene activity, such as photosynthesis, are known to increase during leaf growth and decrease during the aging stage (HG Nam, Curr. Opin. Biotech. 8: 200, 1997). . This result was confirmed to be consistent with the results. In wild type, the expression of photosynthetic genes, such as chlorophyll a / b binding protein (CAB), decreased in proportion to aging over time. . However, the ore4 variant showed little change in the expression pattern of these genes. On the other hand, as compared to expression levels of aging related genes such as the SAG12 was increased Over wild type this time, in the variant was found that is not the expression effect in the same time (see Fig. 2d) This fact ore4 mutations physiological In addition to phenomena, at the molecular level, it delays the onset of aging, prolonging leaf life.

Example 4 According to Cancer Treatment and Plant Hormone Treatment ore4 Leaf Life Variation of Variants

Leaf aging is known to be developmentally scheduled, but the onset and progression of aging is also indicated by constant concentrations of plant growth inhibitors, abscisic acid (ABA), methyl jasmonate (MeJA) and ethylene. can be altered by phytohormones such as ethylene. (Hensel et al., Plant Cell 5: 553, 1993; Weidhase et al., Physiol. Plant 69: 161, 1987; Zeevaart et al., Annu. Rev. Plant Phylol. Plant Mol. Biol. 39: 439,1988 ). First, the change in lifespan during dark treatment was investigated by measuring photosynthetic activity and chlorophyll content changes. In addition, changes in leaf lifespan of ore4 variants according to plant hormone treatment were investigated by measuring photosynthetic activity and chlorophyll content. Continue to shine the separated leaves in 3 mM 2- [N-morpholino] -ethanesulfonic acid buffer (2- [N-morpholinol] -ethanesulfonic acid; MES buffer, pH 5.8) containing 50 μM ABA or 50 μM MeJA. Floated. Ethylene treatment was performed by incubating in a glass box containing 5 μM ethylene gas. Plant hormone treatment as described above was carried out for 3 days at 22 ℃ under continuous light. The sample used 12 independent leaves in 12 DAE, and chlorophyll content and photosynthetic activity were measured by the same method. The results showed that leaf aging of the ore4 variant after cancer treatment, ABA, MeJA, and ethylene treatment was not delayed, indicating that ORE4 was not involved in the aging process induced by cancer treatment and aging-stimulating hormone. 3 and 4)

<Example 5> ORE4 Gene Cloning and Sequencing

The ore4 variant was initially isolated from T-DNA insertion mutants, and genetic analysis revealed that it is a recessive mutant resulting from one T-DNA insertion. Inverse polymerase chain reaction was performed to clone genomic DNA adjacent to T-DNA insertion. This resulted in self ligation of the genomic DNA of the ore4 mutant with Bgl II restriction enzyme. The contiguous sequences of T-DNA were isolated using 5 'acgtgggtttctggcagctgga 3' and 5 'ggccagcgtatcgtgctgcg 3'. Sequence analysis showed that T-DNA was inserted into the top 758 bp of the start of translation of the RPS17 gene (FIG. 5A).

Northern blot analysis using RNA isolated from wild type and mutant showed only about 850bp of transcript in the wild type, and it was confirmed that the transcript did not exist in the mutant (FIG. 5B).

The 2.8 kb fragment containing the RPS17 gene was subcloned into the pGTE vector using the 5 'ttagatgaggctgccaccggat 3' and tccgactaccaattgtttgctc 3 'primers. Deposited to the Institute of Engineering Gene Bank (Accession Number: KCTC 10037BP).

To determine if the potential RPS17 gene could complement lifespan regulation in the ore4 variant, a 2.8kb fragment containing the RPS17 gene inserted into the recombinant vector was transferred to a pCAMBIA vector and transformed into ore4 individuals to perform a complementary experiment. It was. As a result of observing the antibiotic resistance and phenotype in the T2 generation of transformed individuals, it was confirmed that the fragment containing the RPS17 gene can complement the variant ore4 as shown in Table 2 below. These results prove that RPS17 gene is ORE4 .

TABLE 1

Complementation experiment of ore4 variants by transgenes

Genotype Hygromycin resistance Expression Hyg ^r Hyg ^s + - Wild type - - 25 0 ore4 - - 0 25 ore4 / RPS17-a 76 24 21 8 ore4 / RPS17-b 134 52 28 8 ore4 / RPS17-c 74 24 27 9

Note: Hygr means resistance to hygromycin, Hygs means sensitivity to hygromycin, + means wild type phenotype, and-means phenotype of delayed aging.

Example 6 Leaf Growth Inhibition Due to Reduced RPS17 Expression

The effect of the ore4 variant on leaf growth rate was examined by testing the hypothesis that reduced photosynthetic activity caused leaf growth inhibition. Weighing the 4th left lobe of the wild type and the mutant from 4 DAE to 20 DAE showed similarly increased weight of the left lobe in these two plants, but the mean weight of the 4th left lobe of the variant increased from 20 DAE to 67% of the wild type. Not too much (see FIG. 6). Thus, there is a correlation between photosynthetic rate and leaf growth in the ore4 variant.

The novel aging control gene ORE4 of the present invention and the ORE4 protein expressed from the gene can be usefully used for the study of aging mechanisms of plants, the search for aging-related genes or aging inhibitors. It can also achieve such increasing of extending the useful life of the plants by making the ORE4 gene itself or to plants transformed with the plant in variations ore4 type gene of the gene variants increase productivity and storage efficiency.

<110> POSTECH FOUNDATION <120> Gene ORE4 which regulates leaf longevity in Arabidopsis thaliana and mutant genes according <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 450 <212> DNA <213> Arabidopsis thaliana <220> <221> CDS <222> (1) .. (447) <400> 1 atg ata acg tcg tcc cta acc tca tct ctg caa gct ctc aag ctt tcg 48 Met Ile Thr Ser Ser Leu Thr Ser Ser Leu Gln Ala Leu Lys Leu Ser 1 5 10 15 tct ccg ttc gcc cat ggc tcc act cct ctc tca tct ctc tct aag ccc 96 Ser Pro Phe Ala His Gly Ser Thr Pro Leu Ser Ser Leu Ser Lys Pro 20 25 30 aat tcc ttc ccg aac cac aga atg ccc gct tta gtt ccg gtc atc aga 144 Asn Ser Phe Pro Asn His Arg Met Pro Ala Leu Val Pro Val Ile Arg 35 40 45 gcc atg aaa acg atg cag ggg cgc gtg gtg tgc gca acc agt gac aag 192 A la Met Lys Thr Met Gln Gly Arg Val Val Cys Ala Thr Ser Asp Lys 50 55 60 act gtg gcg gtg gag gtg gtg agg ctg gct ccc cac ccc aag tac aag 240 Thr Val Ala Val Glu Val Val Arg Leu Ala Pro His Pro Lys Tyr Lys 65 70 75 80 agg cgc gtg agg atg aag aag aag tac caa gct cac gac ccc gat aat 288 Arg Arg Val Arg Met Lys Lys Lys Lys Tyr Gln Ala His Asp Pro Asp Asn 85 90 95 cag ttc aag gtt ggc gac gtg gtc aga ctg gaa aag agc aga ccc atc 336 Gln Phe Lys Val Gly Asp Val Val Arg Leu Glu Lys Ser Arg Pro Ile 100 105 110 agt aag act aaa tca ttt gtg gcg ctt cct gtc atc gca agg gcc gcc 384 Ser Lys Thr Lys Ser Phe Val Ala Leu Pro Val Ile Ala Arg Ala Ala 115 120 125 agg aaa gcc gaa gcc gga gga gat gaa ctc ctt ggc ctt ccc ttg gag 432 Arg Lys Ala Glu Ala Gly Gly Asp Glu Leu Leu Gly Leu Pro Leu Glu 130 135 140 tct cag cag ccg gcg tag 450 Ser Gln Gln Pro Ala 145 <210> 2 <211> 149 <212> PRT <213> Arabidopsis thaliana <400> 2 Met Ile Thr Ser Ser Leu Thr Ser Ser Leu Gln Ala Leu Lys Leu Ser 1 5 10 15 Ser Pro Phe Ala His Gly Ser Thr Pro Leu Ser Ser Leu Ser Lys Pro 20 25 30 Asn Ser Phe Pro Asn His Arg Met Pro Ala Leu Val Pro Val Ile Arg 35 40 45 Ala Met Lys Thr Met Gln Gly Arg Val Val Cys Ala Thr Ser Asp Lys 50 55 60 Thr Val Ala Val Glu Val Val Arg Leu Ala Pro His Pro Lys Tyr Lys 65 70 75 80 Arg Arg Val Arg Met Lys Lys Lys Tyr Gln Ala His Asp Pro Asp Asn 85 90 95 Gln Phe Lys Val Gly Asp Val Val Arg Leu Glu Lys Ser Arg Pro Ile 100 105 110 Ser Lys Thr Lys Ser Phe Val Ala Leu Pro Val Ile Ala Arg Ala Ala 115 120 125 Arg Lys Ala Glu Ala Gly Gly Asp Glu Leu Leu Gly Leu Pro Leu Glu 130 135 140 Ser Gln Gln Pro Ala 145

Claims (13)

Life control protein of plants having the amino acid sequence of SEQ ID NO: ORE4. The plant life control protein of claim 1, wherein the protein is isolated from Arabidopsis thali1ana. Gene encoding the ORE4 protein of claim 1. 4. The ORE4 gene according to claim 3, having a nucleotide sequence represented by SEQ ID NO: 1. Recombinant vector comprising a gene extending the life of the plant of claim 3. PGTE-ORE4 according to claim 5, comprising the ORE4 gene (Accession No .: KCTC 10037BP) To search for aging regulatory genes of plants characterized by examining the sequence homology or hybridization reaction with the gene by DNA chip, Northern blot analysis or Southern blot analysis using the ORE4 gene encoding the amino acid sequence of SEQ ID NO: 2 Way. Aging regulation of plants characterized by examining the binding reaction or expression pattern with the protein by protein chip, enzyme immunoreaction (ELISA) or 2-D gel analysis using ORE4 protein comprising the amino acid sequence of SEQ ID NO: 2 How to explore protein. Extending plant life by transforming the plant with a variant ore4 gene engineered to lower its expression by insertional mutagenesis or antisense suppression of the ORE4 gene encoding the amino acid sequence of SEQ ID NO: 2 How to increase plant productivity and storage efficiency. ORE4 gene, which encodes the amino acid sequence of SEQ ID NO: 2 of the plant, is manipulated to lower its expression by insertional mutagenesis or antisense suppression to make the mutant ore4 gene, thereby extending the life of the plant. How to increase plant productivity and storage efficiency. delete The method of claim 9 or 10, wherein the variant ore4 gene is characterized in that the gene is not expressed by inserting the T-DNA into the upper region of the ORE4 gene. The plant of claim 9 or 10, wherein the plant comprises: food crops including rice, wheat, barley, corn, soybeans, potatoes, wheat, red beans, oats, sorghum; Vegetable crops including arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion, carrot; Special crops including ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut, rapeseed; Fruit trees including apple trees, pears, jujube trees, peaches, leeks, grapes, citrus fruits, persimmons, plums, apricots, bananas; Flowers, including roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; Or fodder crops, including lygras, redclover, orchardgrass, alphaalpha, tolsquesco, perennial lygragrass.