KR100435824B1 - Improved purification method for hcv protease - Google Patents

Abstract

The present invention is an improved purification method of hepatitis C virus protease, which is improved in yield and reduced purification time by using SP Sepharose column and gel permeation chromatography column. A method for purifying hepatitis virus protease.

Description

Improved purification method of hepatitis C virus protease {IMPROVED PURIFICATION METHOD FOR HCV PROTEASE}

[TECHNICAL FIELD OF THE INVENTION]

The present invention is an improved method for purifying hepatitis C virus protease, and more specifically, using SP Sepharose column and gel permeation chromatography column, the yield is improved and the purification time is shortened. The present invention relates to a method for purifying a new hepatitis C virus protease.

[Private Technology]

Hepatitis C virus (hereinafter referred to as "HCV") is a major cause of hepatitis known to be non-A and non-B hepatitis so far, and the infection with hepatitis C virus is not only acute hepatitis, but also liver cancer Cause serious diseases up to (Alter et al., 1989, N Engl J Med., 321, 1494-1500).

Hepatitis C virus is currently spreading infections on continents around the world, but in particular in Africa, Japan and Korea, 1.5 to 2.0% of the total population is known to be chronic carriers. The main feature that distinguishes hepatitis from hepatitis C virus from hepatitis B virus is that the probability of chronic hepatitis is much higher than that of hepatitis B virus.

More than half of patients with non-A and non-B hepatitis due to blood transfusions develop chronic hepatitis, and about 10 to 20% of patients have cirrhosis. It is known that the anti-HCV antibody formation rate in patients without hepatitis B virus and suffering from cirrhosis or liver cancer is much higher than the control group (Ikeda et al., 1993, Hepatology, 18,47-53).

According to the survey, 75% of hepatitis C virus infections progress to liver cancer after 15 years, which is much higher than 27% of those of hepatitis B virus infections. It is showing.

Currently, diagnostic reagents have been developed for the hepatitis C virus to prevent infection by transfusion to some extent, but there is still no risk of infection through a route other than transfusion because vaccines have not been developed. In addition, blood for six months after infection can be used for blood transfusions, and there is a risk that blood from this group can also be used for blood transfusions because antibodies are not found in about 10% of patients with hepatitis C virus.

The only treatment for patients infected with hepatitis C virus is alpha-interferon, which has been shown to be ineffective against hepatitis C virus, which has an interferon resistance sequence against interferon. Development is required.

As one of the treatments, the development of inhibitors for proteins such as proteases or RNA polymerases, as in the treatment for AIDS virus, can be expected to be an effective treatment.

Genome of hepatitis C virus is expressed as a polyprotein consisting of about 3010 to 3033 amino acids, and then structural proteins such as core protein and envelope protein and non-structural proteins involved in the replication of hepatitis C virus genome (NS protein). Cleavage) shows the activity.

Nonstructural proteins are cleaved by two proteases, NS2-3 and NS3. The NS2-3 protein cleaves the amino terminal portion of NS3 and the NS3 protein is involved in releasing nonstructural proteins such as NS4A, NS4B, NS5A, NS5B. NS3 protein has proteolytic activity at the amino-third side and helicase activity at the rest, and when expressed separately, it was confirmed that each of them has an activity in vitro (D`Souza et al. , 1993, J. Gen. Virol. 76, 1729-1736).

The NS3 protein contains histidine at amino acid 57, aspartate at 81, and serine at 139, and has a typical catalytic motif of a typical trypsin-like serine proteinase. The typical active site is perfectly consistent with the numerous strains of hepatitis C virus found.

NS3 proteins are distinguished from trypsin-like serine proteases in several ways. Firstly, it is linked to halicase protein, secondly, it needs divalent metal ion such as zinc, and thirdly, it is involved in NS4A peptide consisting of 54 amino acids as a major factor in degrading enzyme activity. NS3 and NS4A interact with each other to help form protein structures with degrading enzyme activity (Hijikata et al., 1993, J. Virol. 67, 4665-4675).

In order to develop inhibitors of hepatitis C virus protease, secondary and tertiary structures of NS3 protein are required. In order to investigate the structure of NS3 protein, a large amount of NS3 protein is required, and for this, an efficient purification method of the protein is required.

In the existing purification method of hepatitis C virus protease, Vertex Corp. was purified using a heat affinity column and a sizing column (Cell, 87, 343-355, 1996). Agouron was purified using SP column, FPLC Mono-S column and Sephacryl S-200 column (Cell, 87, 331-342, 1996), Merck was SP Sepharose column, Heparin Column and SP Sepharose column (Protein Science, 7, 837-847, 1998).

However, Virtex's method can only be used for the purification of proteins marked His, and cannot be used for proteins not marked His, and Aguron's method is effective for purification due to too much yield loss in FPLC Mono-S columns. It's not a way. In addition, Merck's method requires three column purification steps and two dialysis steps, resulting in poor yields and time consuming effects.

Accordingly, an object of the present invention is to provide a method for purifying hepatitis C virus protease, which has high yield and a short time required for purification.

1 is a nucleotide sequence and amino acid sequence of proteolytic enzymes derived from hepatitis C virus L2 strain and hepatitis C virus BK strain.

2 is a comparison of amino acid sequences of proteases derived from hepatitis C virus L2 strain and hepatitis C virus BK strain.

Figure 3 is a result of the electrophoresis of SDS containing the purified material purified by hepatitis C virus BK strain protease derived by SP Sepharose column.

Figure 4 is a result of the electrophoresis of SDS containing purified material purified by hepatic C virus BK strain proteolytic enzyme purified by Sephacryl S-200 column.

5 is a result of analyzing the protease obtained by the purification method of the present invention in HPLC.

In order to achieve the above object, the present invention provides a method for purifying hepatitis C virus protease,

A first purification step of purifying the supernatant containing hepatitis C virus protease by SP sepharose column; and

A secondary purification step of developing and purifying the first purified hepatitis C virus protease by gel permeation chromatography column;

It provides a method for purifying hepatitis C virus protease, characterized in that it comprises a.

Hereinafter, the present invention will be described in detail.

In order to develop inhibitors of hepatitis C virus protease, secondary and tertiary structures of NS3 protein are required. A large amount of NS3 protein is required for the structure of NS3 protein. The present invention is to introduce the SP Sepharose column and gel permeation chromatography column for efficient purification of the NS3 protein.

The preparation of hepatitis C virus protease begins with a known hepatitis C virus protease expression system and can be started from the E. coli expression vector of the previously published patent publication No. 1998-069021. The proteolytic enzyme (genebank # U01214) derived from the hepatitis C virus L2 strain expressed from the E. coli expression vector is expressed in an inclusion body form and its expression level is also significantly low.

Therefore, in order to improve the solubility of the protein, a protease derived from hepatitis C virus L2 strain is mutated to a protease derived from BK strain (genebank # M58335), in which four lysines are added at the carboxy terminus.

In addition, E. coli cells expressing proteolytic enzymes derived from the mutated hepatitis C virus BK strain are cultured with shaking. In order to purify the proteolytic enzymes derived from the hepatitis C virus BK strain from the cultured E. coli cells, E. coli cells must be crushed. The crushing method, which is mainly used, is crushed by an ultrasonic mill after centrifugation.

Purification of hepatitis C virus proteolytic enzymes was carried out by firstly disintegrating the supernatant with 20 to 80 mM phosphate (pH 6.5), 5 to 20 v / v% glycerol, and 1 to 10 mM DTT buffer. It is bound to a previously equilibrated SP Sepharose column. The column is eluted with a concentration gradient of 0.01 to 1 M sodium chloride, and then loaded on SDS-PAGE to collect only proteolytic enzyme portions derived from hepatitis C virus BK strain. .

The reason why SP Sepharose columns are used is that the amount of sample developed can be large. Phosphoric acid chloride acts as a buffer in the above, it does not serve as a buffer below 20 mM, it is not good to cause a bond between the protein and the column above 80 mM. Preferably 45 to 55 mM is more preferable.

In addition, glycerin serves as a protein stabilizer. Below 5%, protein molecules become unstable and above 20%, viscosity increases, making column development difficult. Preferably it is 8 to 12% more.

In addition, the DTT acts to maintain the protein structure of the form as it is, less than 1 mM to produce an undesired cysteine bond changes the protein structure, if it exceeds 10 mM there is no synergistic effect due to increased administration. It is more preferable if it is 4-6 mM.

In addition, the sodium chloride in order to match the concentration gradient, less than 0.01 M has no effect of the concentration gradient and exceeds 1 M to prolong the time required for elution. Preferably 0.4-0.5 M is preferable.

The first purified protein in the SP Sepharose column was passed through a gel permeation chromatography column that was previously equilibrated with the same buffer as the buffer used in the SP Sepharose column and loaded by SDS-PAGE to hepatitis C virus BK strain. Only the derived proteolytic enzymes are collected.

Gel permeation chromatography is useful for separating proteins according to the size of the protein may be used columns such as Sephacryl S-100, Sephacryl S-200, preferably Separcryl S-200.

In addition, since the protease of hepatitis C virus contains divalent metal ions, it is better to use the cation exchange method in parallel when the column is developed.

On the other hand, as a result of comparing the yield when passing through the SP Sepharose column and Sephacryl S-200 column of the present invention and the SP Sepharose column-Heparin column-SP Sepharose column of Merck purification method, the yield is In the case of the purification method of the Merck company takes 70 to 75 hours, but in the case of the present invention takes 24 to 36 hours, the time required for the purification is shortened a lot when the present disease is carried out.

EXAMPLE

Hereinafter, the Example and description of this invention are described. However, the following examples are intended to illustrate the invention and not to limit the invention.

Example 1 Preparation of Protease from Hepatitis C Virus BK Strain

Site-specific mutagenesis was performed in vitro using the Emega's Gene editor system Cat # Q9280 as a template with the E. coli expression vector pET HCP-L2. The experimental procedures were all followed by the manufacturer's method and the primers used were as follows.

Primer 1: ATCACGGCCTACTCCCAACAGACG

Primer 2: GCTGGACTGTCTACCATGGCGCTGGC

Proximal 3: GCTGGCAGGCGCCCCCCGGGGCGCGTTCCCTGAC

Prototype 4: GGGGGGGACAGTAGGGGGAGC

Probe 5: TACTATGCGGTCTAAGAAAAAGAAATAGTCGACGGATCCGGC

Primer 1 is the proteolytic enzyme derived from hepatitis C virus L2, ser 7, primer 2 is the 56th phe tyr, primer 3 is the 88th ala pro, 91th met is ala, Primer 4 replaced the 122nd Gly with ser, and Primer 5 added 4 lysines at the carboxy terminus.

The base sequence and amino acid sequence of the protease derived from hepatitis C virus L2 strain and the proteolytic enzyme and amino acid sequence of the protease derived from hepatitis C virus BK strain are shown in Figure 1, the amino acid of the two protease Figures comparing the sequences are shown in FIG.

Example 2 Escherichia Coli Cell Culture

E. coli cells expressing protease derived from hepatitis C virus BK strain were inoculated into LB medium and shaken at 37 ° C. for 4 hours to culture E. coli cells. Shaking was carried out at 37 ° C until the absorbance at 600 nm was 1. IPTG was added at a concentration of 0.4 mM to induce expression and shaken at 15 ° C. for 16 hours.

Example 3 E. coli cell disruption

Escherichia coli cultured in Example 2 was centrifuged at 6000 rpm for 10 minutes using a centrifuge (Beckman J2-21, USA) to collect E. coli cell precipitate, 25 mM phosphate (pH 7.5), 10% glycerol, 5 It was suspended in a buffer of mM DTT (Dithiothreitol) composition. The suspension was treated in an ice bath with an ultrasonic grinder (Heat Systemas-Ultrasonics, Inc. W225, USA) three times at 50% power for 3 minutes to disrupt cells.

The crushed solution was centrifuged at 16000 rpm for 30 minutes with a centrifuge to separate the supernatant. In addition, the precipitate was again suspended in the buffer solution and crushed once more in the same manner as described above. The supernatant obtained by centrifugation was also combined with the first supernatant to make 200 ml.

Example 4 SP Sepharose Column Chromatography

200 ml of the supernatant obtained in Example 3 was bound to a SP Sepharose column previously equilibrated with a buffer solution of 50 mM phosphate (pH 6.5), 10% glycerol, and 5 mM DTT, followed by using a 0.5 M sodium chloride concentration gradient. After elution, loading was carried out by SDS-PAGE to collect only the protease portion derived from hepatitis C virus BK strain. In addition, the cation exchange method was used in parallel when the SP Sepharose column was developed.

Figure 3 is a result of electrophoresis of SDS containing the result of purifying the protease derived from hepatitis C virus BK strain with SP Sepharose column.

Example 5

After concentrating the protease obtained in Example 4, the protein derived from hepatitis C virus BK strain was passed through a Sephacryl S-200 column previously equilibrated with the buffer solution of Example 4 and loaded by SDS-PAGE. Only the enzyme part was collected. In addition, the cation exchange method was used in parallel when developing the Pepacryl S-200 column.

Figure 4 is a result of electrophoresis containing SDS to the result of purifying the protease derived from hepatitis C virus BK strain with Sephacryl S-200 column.

Table 1 shows the amounts and yields of the proteolytic enzymes obtained in Examples 3 to 5 as shown in Table 1 below.

Analytical Sample Volume (ml) HCP (mg / ml) HCP (mg) yield(%) Example 3 200 0.26 52.6 100 Example 4 36 1.25 45.1 85.7 Example 5 40 0.90 36.0 68.4

Example 6

The protein solution obtained in Example 5 was measured for purity using HPLC. The solvent was 0.1% trifloroacetate / H ₂ O / acetonitrile and the column was analyzed using a Vydac 18 assay with a 50% gradient of acetonitrile at a flow rate of 0.9 ml / min.

Under the above conditions, the peaks corresponding to proteolytic enzymes from the remaining peaks except for the peaks appearing even when only the buffer solution is analyzed by comparing the result of analyzing the buffer solution with the same composition as the protein solution and the protein solution analysis result. Purity was calculated by dividing the area by the total peak area.

5 is a graph showing the solution obtained in Example 5 on HPLC.

The calculated protease purity was 96.8%.

Example 7

Purification was carried out using SP Sepharose Column- Heparin Column-SP Sepharose Column, which is a Merck purification method, to compare with the purification method of the present invention. The protein obtained in Example 4 was dialyzed with the above buffer solution for 15 hours, and then bound to a previously equilibrated heparin column and eluted using a 0.5 M sodium chloride concentration gradient. The eluted material was loaded with SDS-PADE to collect only the protease portion derived from hepatitis C virus BK strain.

In addition, the protease obtained above was dialyzed with a buffer solution of 25 mM HEPES (pH 7.0), 10% glycerol, and 5 mM DTT for 15 hours, and then bound to the SP Sepharose column equilibrated with the same buffer, and then 0.5 M sodium chloride. Elution was carried out using a concentration gradient, and the results were loaded into SDS-PAGE to collect only the protease portion derived from hepatitis C virus BK strain.

Table 2 shows the amounts and yields of the proteolytic enzymes obtained in the above steps.

Analytical Sample Volume (ml) HCP (mg / ml) HCP (mg) yield(%) Example 3 200 0.26 52.6 100 After SP Sepharose Column Deployment 36 1.25 45.1 85.7 After Heparin Column Deployment 35 0.89 31.3 59.5 After Separcryl S-200 Column Deployment 36 0.74 26.7 50.8

As can be seen in Table 1 and Table 2, when comparing the yield when the purification is finished, the yield in the present invention is 68.4%, in the case of the purification method of Merck company 50.8% of the purification method of the present invention It can be seen that the yield is high.

On the other hand, when using the purification method of Merck, it took 74 hours, and when using the purification method of the present invention, it took 30 hours. It was found that the time required for the purification method of Merck's company took two times or more than the time required for the purification method of the present invention.

Example 8

Purity was calculated in the same manner as in Example 6 when the proteolytic enzyme obtained after the development of the SP Sepharose column, which is the third column in Example 7, was 97.1%. It can be seen that there is no difference from the purity of 96.8% in the present invention.

Therefore, it can be seen that the purification method of the present invention has a higher yield and requires less time than the purification method of Merck.

As described above, the present invention is useful for the purification of hepatitis C virus protease due to the high yield and the time required for purification of the hepatitis C virus protease.

Claims (5)

In the method for purifying hepatitis C virus protease, A first purification step of purifying the supernatant containing hepatitis C virus protease by SP sepharose column; and A second purification step of purifying the first purified hepatitis C virus protease by developing into a Sephacryl S-100 column or Sephacryl S-200 column; Purification method of hepatitis C virus protease, characterized in that it comprises a. The method of claim 1, wherein the secondary purification step is performed with Sephacryl S-200 column. delete The method of claim 1, wherein the column development buffer used in the first purification step and the second purification step 20 to 80 mM phosphoric acid chloride (pH 6.5); 5-20 v / v% of glycerol; And Dithiothreitol of 1 to 10 mM; Purification method of hepatitis C virus protease, characterized in that it comprises a. The method of claim 4, wherein the buffer solution 45-55 mM phosphoric acid chloride (pH 6.5); Glycerol at 8-12 v / v%; And 4 to 6 mM Dithiothreitol; Purification method of hepatitis C virus protease, characterized in that it further comprises.