KR100435143B1 - Plant tissue specific promoters - Google Patents

Abstract

The present invention relates to a plant-specific promoter of a plant, which controls and determines when and how much of a desired foreign gene is expressed in a plant's tissue during the developmental stage of the plant. To provide a base sequence of promoters.

Genes used for this purpose are all five cabbage genes, BAN102, BAN103, BAN84, BcA9 and BIF38. The BAN102, BAN103, and BAN84 genes were isolated by differentiation selection of the cDNA gene banks of Chinese cabbage (anther) and leaves (leaf) (by selecting drug-specific genes that are not expressed in leaves but specifically expressed in drugs), and BcA9. Genes were isolated using PCR and BIF38 genes were isolated from cDNA gene banks of young buds. The promoters of these genes were separated from the cabbage genomic gene bank, and then the characteristics of each promoter were examined using reporter, GUS, and genes.

As a result, the promoters of BAN102, BAN103, and BAN84 showed pollen specificity, the promoter of BcA9 showed carpet specificity, and the promoter of BIF38 was found to be a vascular specific promoter.

Description

PLANT TISSUE SPECIFIC PROMOTERS

When the foreign gene is expressed in a plant, the present invention is directed to a promoter (gene control region) which controls when and how much the desired foreign gene is expressed in the tissues of the plant in the developmental stage of the plant. It is about.

In general, a promoter is a type of regulatory region having a function of controlling the expression of a gene, ie, a base sequence that determines when and where a gene is expressed.

Research and development of gene expression regulation in the field of plant molecular biology has been very active, and a large number of special function promoters have already been reported.

The promoters previously reported in this field can be classified according to their functions into two groups: strong promoters that increase expression levels, tissue-specific promoters that limit expression tissues, and promoters that limit expression times. Looking in detail as follows.

1) Strong promoter to increase expression

It was initially developed as a promoter used to maximize the expression level of foreign genes. Plant promoters include the 35S RNA gene promoter of Cauliflower mosaic virus and the actin gene promoter of rice. These are mainly used for the purpose of antibiotic resistance genes used as selection markers in plant transformation, genes for inhibiting pests of plants, or production of substances using plants.

2) Tissue specific promoters that limit expression tissue

Promoters are used to achieve transgenic juggling by limiting the expression of foreign genes to specific tissues of plants. The carpet-specific TA29 promoter of flower male organs was used to develop male sterile crops with protein genes toxic to cells. The promoter of the Rubisco small subunit gene is a strong promoter, but restricts the expression of the gene only to green tissue. A large number of these types of promoters have been reported for each tissue of the plant depending on the various purposes it is intended to use.

3) promoters that limit the timing of expression

Numerous examples have been reported as promoters that limit the expression of foreign genes to only specific stages of plant development. For example, promoters of genes involved in flowering express the gene only in the flowering period. In addition, promoters of genes expressed by various biological or abiotic stimuli may be included in the timing controlling promoter. Promoters of potato proteinase inhibitor II genes function by wounds (or when insects pluck leaves). The promoter of the alcohol dehydrogenase gene is activated by alcohol.

On the other hand, these promoters are required to develop foreign gene transgenic plants having more diverse functions for more precise gene expression control according to the intention of the developer, but the use of the domestically developed promoter is still poor.

Therefore, the present invention is a major vegetable widely cultivated in Northeast Asia such as China, Japan, Korea, and the like, the production of cDNA and genomic gene banks of Chinese cabbage, which is the basic material of kimchi, which has already become a global food, tissue-specific genes and their promoter isolation and By providing new plant tissue-specific promoters through sequencing and promoter function analysis using reporter genes, plant traits such as limiting or regulating the expression level, timing and place of expression of the target gene when introducing the appropriate gene into the crop The purpose is to make it available for conversion.

1 is a restriction map of a genomic clone of the BAN102 gene.

2 is a plasmid pCR102 comprising a promoter region of 1.2 kb of BAN102 gene.

3 is a GUS transformation vector using Pban102 and P102del.

Figure 4 is a photograph showing the state of GUS expression in pollen and pollen of tobacco using p102GN and pSPGN.

Figure 5 shows the nucleotide sequence around the TATA box of the BAN102 gene (A) and PCR primer nucleotide sequence (B) for core promoter replacement

Figure 6 is a plasmid p102A for identifying the pollen specific region of P102del.

Figure 7 is a temporary transformation by the plasmid p102A, (A) the pollen and pollen tube of tobacco, (B) leaves of tobacco, (C) cabbage operating table, (D) a photo showing the cabbage pistil. Arrow indicates GUS expression)

8 is a production process of the GUS expression vector p102G by Pban102.

9 is a state diagram of GUS expression in pollen of tobacco transformed with the plant expression vector p102G.

10 is a restriction map of a genomic clone of the BAN103 gene.

11 is a protein coding part nucleotide sequence and amino acid sequence diagram of the BAN103 gene.

12 is a plasmid pCR103R comprising a promoter region 1.8 kb of BAN103 gene.

Figure 13 is a GUS transformation vector using Pban103 and P103del.

Figure 14 shows the transient transformation by plasmid p103XGN and pHSGN, (A) is a flower of Chinese cabbage, (B) is an enlarged view of GUS expression in the flower of Chinese cabbage, (C) is a commitment of Chinese cabbage, (D) Picture of pollen and pollen of tobacco (arrow shows GUS expression)

Figure 15 is a production process of the GUS expression vector p103XG by Pban103.

Figure 16 shows the GUS response in the pollen of the tobacco transformed with the plant expression vector p103XG, (A) is a mature pollen, (B) is a pollen tube, (C) is an embryo, (D) is a parent of calyx, (E) is a photograph showing the parent body of the petal.

Figure 17 is the manufacturing process of each p102DT (A) and p103DT (B) to make a male sterile transformant.

18 is a PCR analysis of kanamycin selected transgenic tobacco after p103DT transformation.

Figure 19 shows male sterile flowers of tobacco transformed with DTx-A gene, (left) normal flowers, (center) semi-male sterility, (right) complete male sterility.

Figure 20 shows restriction map of pGBAN84 with genomic clone 7.8kb of BAN84 gene and derived plasmids p84Xb, p84Bm and p84Sm. (The arrow indicates the direction and position of the BAN84 gene.)

21 shows pCRP84 with BAN84 promoter and pCRT84 plasmid with pBSP84 and terminator. (Arrows show the direction of promoter and terminator)

FIG. 22 shows plasmids pKP101, pKP201, pKP301 for BAN84 promoter (P84) and terminator (T84) functional analysis with transient transformation.

Figure 23 is a photograph showing the expression of GUS in tobacco pollen and pollen tube using plasmids pKP101, pKP301.

Figure 24 is a plasmid pBc9 cloned into pUC19 genomic clone 5.5kb, including the BcA9 gene and its surroundings of the Chinese cabbage (arrow shows the position and direction of the BcA9 gene, the vertical segment of the promoter region of BcA9).

25 shows amino acid sequences of Chinese cabbage BcA9 gene, rapeseed A9 (BnA9) gene, and Arabidopsis A9 (AtA9) gene.

Fig. 26 is a Southern analysis state diagram of the parent and minor genomic DNA of Chinese cabbage (Jangwon F ₁ ).

27 is a BcA9 promoter (PBcA9) isolation and plant expression vector production process.

Figure 28 is a picture showing a cabbage flower, the left side is a normal state, the right side is a male sterile state.

Figure 29 shows the development of pollen blast cells of the drug when the bud of cabbage is 1mm (A) is a normal state, (B) is male sterility state.

Figure 30 shows the four-molecule development of the drug when the bud of cabbage is 1.5mm (A) is a steady state, (B) is male sterility.

Figure 31 shows the pot development status of the drug when the bud of cabbage is 3mm (A) is a steady state, (B) is male sterility.

Figure 32 shows restriction map of plasmid pGBIF38E-11 with genomic clone of BIF38 (horizontal segment lines show exons, vertical segment lines show introns; arrows indicate direction and position of BIF38 gene)

Figure 33 is a process for producing a plant transformation vector pANL1 for promoter Pbif38 function assay.

Fig. 34 is a diagram illustrating the expression of GUS expression in the endosperm of the tobacco seeds (upper left), seedlings of the seedlings (upper center) and leafy veins of the main leaf (upper right), and vascular tissues (bottom) of the stem by the promoter Pbif38.

35 shows the abscess zone (upper left), young root (upper right), petals and pistil duct tissue and distribution (bottom left), and vascular tissue (bottom right) of the operating table by the promoter Pbif38. GUS expression state diagram.

Hereinafter, with reference to the accompanying drawings, the present invention for realizing the above object will be described in detail.

The present invention includes three pollen specific promoters (Pban102, Pban103 and P84), one carpet promoter (PBcA9), and one vascular specific promoter (Pbif38). All five promoters were isolated from Chinese cabbage (Chinese cabbage, Brassica campestris ssp. Pekinensis ).

Differentiated screening method using the cDNA clones in vivo excision from the cDNA gene bank of medicine as a probe made of RNA of medicine (anther) and leaf (leaf). Chinese cabbage drug-specific genes that are specifically expressed only in E. coli were selected. Among these genes, BAN102 and BAN103 cDNA sequences were analyzed, and the probes were used for northern analysis of RNA of cabbage tissues. The BAN102 and BAN103 genes were new drug-specific genes. Using genomic cDNAs from BAN102 and BAN103 as probes, genomic clones of BAN102 and BAN103 genes were isolated from the genome gene bank of cabbage. The nucleotide sequences of the 5 'noncoding regions of the BAN102 and BAN103 genes were analyzed and the promoter portions of 1.2 kb and 1.0 kb were isolated, respectively. As a result of analyzing the function of each promoter using the GUS gene, the promoters of BAN102 and BAN103 induced GUS pollen and pollen tube-specific expression. In addition, plants expressing male infertility (or semi-infertility) were obtained by transforming the plant-expressing bets connecting the respective promoters and the diphtheria toxin A chain gene (DTx-A) into tobacco.

Based on the nucleotide sequence of the A9 gene (abbreviated as AtA9) of Arabidopsis (Arabidopsis) was prepared primers and PCR to obtain the same gene BcA9 from the cabbage. The probe was used to select the genomic clone, analyzed the sequence, and compared it with AtA9. The promoter portion of the BcA9 gene 687bp (PBcA9) was isolated and linked to the DTx-A gene to transform the cabbage to obtain a male sterile cabbage.

The nucleotide sequence of gene BIF38 isolated from the cabbage cDNA gene bank of Chinese cabbage showed amino acid sequence similarity to lipid transfer protein. Using this cDNA clone as a probe, a genomic clone of BIF38 was obtained from the cabbage genomic gene bank, and some nucleotide sequences were analyzed. Initiation of translation of the BIF38 gene 4.3kb (Pbif38) of the promoter portion upstream of the codon ATG was isolated and linked to the GUS gene and transformed into tobacco. As a result of analyzing the transformants, Pbif38 began to express the GUS gene specifically in the flow line tissues of the firearms from the formation of the buds of tobacco, and thus the embryos of tobacco seeds, the total flow rate of germinated seedlings (young plants) and post-germination 6 GUS expression was observed in the main lobe ducts up to the week.

On the other hand, summarized the experimental method generally used in the following examples. For DNA experiments not specifically mentioned in the following method, see Sambrook et al., "Molecular Cloning: A Laboratoty Manual, Cold Spring Harbor Laboratory Press, second edition, 1989".

(1) Cloning and Plasmid Construction

General procedures such as DNA cloning and plasmid construction were carried out by Maniatis et al. (1989). E. coli strains were XL1-Blue MRF '(Stratagene), XL1-Blue MRA (P2) (Stratagene), SOLR (Stratagene), DH5a (GIBCO BRL), and the plasmid was pBluescript SK (+/-) (Stratagene), pUC19 (GIBCO BRL), pBI102 (Clontech), pBI221 (Clontech) and the like were used.

(2) Preparation of isotopically labeled DNA probes

DNA fragments digested with appropriate restriction enzymes were labeled by ramdom priming method (Feinberg and Bogelstein 1983) using 1% low melting [α- ³² p] dCTP. The purified DNA fragments were heated for 10 minutes at 95 ° C for denaturation, and then mixed with random hexamer primer, deoxynucleotides and T7 DNA polymerase for 1 hour at 37 ° C. The unreacted nucleotides were removed by G-50 Sephadex columm chromatography.

(3) Exploration of Genome and cDNA Gene Bank

Chinese cabbage genome and cDNA gene bank phages, respectively, were mixed and infected with Lambda DASH II (Stratagene) and Lambda ZAP II (Stratagene) in 0.6 ml of OD600 = 0.5 porcine cells (XL1-Blue MRA p2 or MRF) to 50,000 PFU / plate. then mixed with 6 ml of the supernatant culture medium NAY (1 5g NaCl, 2g MgSO ₄ .7H ₂ O, 5g yeast extract, 10g NZ amine (pH7.5), agarose 7g per liter) in NZY plate (containing Bacot Agar 15g) After plating and incubating at 37 ° C. for 8 hours to form plaque, the plaque was transferred to a nylon membrane (Amersham). Herein, EcoRI / Xho I DNA fragments of each cDNA clone labeled with isotope ³² P were hybridized to select a plaque that reacted. The selection plaque in 1ml SM buffer 4 ℃ was mixed with chloroform in _{(1 NaCl 5.8g, MgSO 4 .7H} 2 O 2g, 1M Tris-HCI (pH7.5) 50ml, 2% gelatin solution 5ml per liter) and one drop Secondary or tertiary selection was performed in the same manner as above for accurate plaque selection during storage. On the other hand, the selected phage solution was sequentially diluted, and after forming the plaque by the above method, the number was calculated to determine the concentration of the phage solution.

(4) Phage clone DNA isolation

Selected phages were infected with host cells (XL-1 Blue MRA P2 or MRF) to 150 PFU per 150 mm plate and NZCYM supernatant medium (10 g of NZ amine, 5 g of NaCl, 1 g of yeast extract, 1 g of casamino acids, MgSO ₄ per liter). 7H ₂ O 2g, agarose 7g) was mixed on a plate (including agarose 15g) and incubated at 37 ℃ for 10 hours, and 5ml SM solution was added to a sufficiently formed plaque and shaken for 1 hour at room temperature to extract phage. The phage solution was collected, chloroform 0.1ml was added, centrifuged at 8000 xg to remove precipitates, and DNaser I and RNaseA were added to 1 ug / ml, respectively, and treated at 37 ° C for 2 hours. 20% (w / v) polyethylene glycol 8000. 2.5M NaCl solution prepared in SM solution was mixed in the same amount and placed on ice for 1 hour, followed by centrifugation at 10,000 g at 4 ° C. for 10 minutes. The supernatant was removed, 500ul SM beffer was added to the precipitate, suspended and centrifuged again to remove the precipitate, and the supernatant was taken. After adding 20ul of 0.5M EDTA (pH8.0), 10% SDS 10ul, and 10ul Proteinase K (2.5mg / ml) to the supernatant, warmed at 68 ℃ for 30 minutes, extracted with phenol / chloroform, and added NaOAc to 0.3M. Precipitated with twice the ethanol, washed with 70% ethanol and dried DNA precipitate was used to dissolve in 100ul of TE buffer.

(5) Genome DNA Isolation and Southern Blot Analysis

Genome DNA isolation was used by modifying the method of Dellaporata et al. (1983). After 2 g of the sample was put in liquid nitrogen and crushed, a 15 ml DNA extract solution (100 mM Tris-Hcl pH8.0, 50 mM EDTA, 500 mM NaCl, 10 mM 2-mercaptoethanol) was added and mixed. 1 ml of 20% SDS was added thereto, warmed at 65 ° C. for 10 minutes, 5 ml of 5M potassium acetate was added, and placed on ice for 20 minutes. After centrifugation at 15,000 rpm for 20 minutes, the supernatant was collected and 10 ml of isopropanol was added. After 30 minutes at 20 ℃ centrifuged for 10 minutes at 10,000 rpm at 4 ℃ dissolved in precipitated DNA in 1ml 50mM Tris-HCl (pH8.0), 10mM EDTA and centrifuged again for 10 minutes to remove the undissolved polysaccharide After processing 10ul of RNaseA, phenol / chloroform extraction was repeated several times to purify DNA.

The purified DNA was cut with a suitable restriction enzyme and electrophoresed on 1% agarose gel at 10 ug per lane. The gel was depurated by immersion in 0.2N HCl solution for 10 minutes, immersed in 0.4N NaOH, 1MNaCl solution for 15 minutes, and then denaturated with fresh solution for 20 minutes. After transferring the gel to the nylon membrane with the same solution, the nylon membrane was washed with 0.5m Tris-Cl (pH 7.2) m 1M NaCl solution for 15 minutes, dried and UV cross-linked.

DNA-immobilized nylon membrane was added to hybridization solution (6XSSC, 5X Dengardt's solution, 0.5% SDS, 100ug / ml denatured salmon sperm DNA) and pretreated at 68 ° C for at least 2 hours, and the ³² P-labeled probe at 95 ° C. 10 minutes of denaturation was added and hybridization was carried out for 16 hours. The reacted Nile membrane was washed with 2X SSC, 0.1% SDS solution for 30 minutes at room temperature, washed with 0.1X SSC, 0.1% SDS at 65 ° C. for 15 minutes and dried to expose to X-ray film.

(6) RNA isolation and northern blot analysis

Total RNA was isolated from various tissues of cabbage. After weighing the prepared sample, the sample was frozen in liquid nitrogen, chilled, ground, and transferred to a cold tube. RNA extract (100 mM LiCl, 100 mM Tris-NaOH pH8.9, 1% SDS, 10 mM EDTA) and phenol were mixed and mixed with phenol in the ground sample powder. And shaken for 30 minutes at 30 ℃ 300rpm. After adding 1ml of chloroform per 1g of live weight and shaking for 30 minutes continuously, the supernatant was collected by centrifugation at 20,000g for 30 minutes at 25 ° C, and shaken at 300rpm for 30 minutes by adding 1ml chloroform per sample live weight. Centrifuge this at 12,000g at 25 ℃ for 15 minutes, mix 1/3 of 8M LiCl with supernatant, store at 4 ℃ for more than 16 hours, precipitate RNA, and centrifuge at 12,000g for 30 minutes at 4 ℃. Precipitate, washed with 2M LiCl and 80% ethanol, dried, dissolved in sterile water and used at -70 ℃. The concentration of purified RNA was quantified by UV spectroscopy.

10 ug of purified RNA was electrophoresed on a 1.2% formaldehyde agarose gel and transferred to a nylon membrane according to the general method, followed by hybridization with a ³² P-labeled probe and exposure to X-ray film. In the northern dot blot, 10X MOPS solution and 37% formaldehyde were added to 4ul RNA to 1X MOPS and 6.4%, respectively, and heated in boiling water for 2 minutes, and then attached to nylon membrane by vacuum autonomy. Subsequent procedures followed the usual method.

(7) DNA sequencing and analysis

DNA sequence determination was performed by Sanger dideoxy method (1977). DNA fragments to determine nucleotide sequences were cloned into pBluescrip SK or KS vectors (Stratagene), and the deletion of clones was performed using the Erase-A-Base kit (Promega). DNA fragments were digested with two restriction enzymes appropriate for Exonuclease III to be deleted only in the desired direction. 150 units of exonuclease Ⅲ per 3'-end picomole were added, reacted at 37 ° C, and 2.5ul were taken at 20-30 second intervals, mixed with 7.5ul of S1 nuclease solution on ice, and treated at 30 ° C for 30 minutes. . Here, 1T of 0.3T Tris base, 50mMEDTA (pH8.0) was added and heated at 70 ° C. for 10 minutes to stop the S1 nucleae reaction and electrophoresis on agarose gel to confirm the deletion and size. Deleted fragments of appropriate size were collected, treated with Klenow enzyme, and ligation was performed to transform E. coli SOLR.

(8) Promoter Site Cloning and Plasmid Construction

Initiation of translation of the BAN102, BAN103, BAN84, BAN79, BIF38, and BcA9 genes The top portion of ATG was cloned by polymerase chain reaction (PCR). PCR was performed using Pyrobest DNA polymerase (Takara) once for 5 minutes at 97 ° C, 1 minute at 95 ° C for 2 minutes / 72 ° C for 40 minutes, and once for 10 minutes at 72 ° C. The promoter region of each gene, which is a PCR product, was cloned into pUC19 or pBluescript and linked to the GUS or DTx-A gene as a reporter gene to construct a transient or plant transformation vector.

(9) Assaying promoter activity by transient expression

M10 M17 tungsten particles were prepared according to the method of Sanford et al. (1992), coated with tungsten particles with plasmid DNA, loaded into a gene gun produced by Joe et al. (1994), and 3 cm at a helium gas pressure of 30-35 kgf / cm 2. Fired from the street

Buds of various sizes of Chinese cabbage and tobacco are sterilized for 10 minutes by immersing in 10% finite lacquer for 10 minutes, washed 2-3 times with sterile water, and then cut or unfolded to collect the surgery as it is or cut to raise the cutting surface. Arranged on the medium and firing the gene gun. Sterile tissue cultured cabbage and tobacco leaves were cut into 1 cm 2 sizes and arranged on MS0 medium to shoot gene guns. Collect pollen of anthers just before and after the cabbage and tobacco decay, sterilize for 10 minutes in chloramphenicol 50yg / ml solution, wash with sterile water, and then add pollen medium (0.01% H ₃ BO ₃ , 10mM CaCl ₂ , 0.05mM KH ₂ PO ₄ , 0.1% yeast extract, 10% sucrose, 1% agar) and evenly spread the gene gun. The treated samples were transferred as-is or in fresh medium and placed in a 24 ° C. incubation chamber for 1-2 days. GUS staining solution (0.1M NaPO ₄ buffer pH7.0, 10mM EDTA pH7.0, 0.5mM K Ferricyanide pH7.0, 0.5mM K Ferrocyanide pH7.0, 1.0mM X-Glucuronide, 0.1%) Triton X-100) was added or the treated samples were collected and immersed in GUS staining solution, and then immersed in GUS staining for 1-2 days at 37 ° C. for staining and staining.

(10) tobacco transformation

Tobacco (Nicotiana tabacum HAVANA SRI) leaf slices were inoculated with Agrobacterium tumefaciens LBA4404 (Statagene) strain solution containing each plant expression vector for about 10 seconds and inoculated into MS solid medium containing 1.5 mg / L of BAP. Air-conditioned for 3 days at 25 ℃. After co-cultivation, shoot was induced on MS selection medium containing 1.5 mg / L BAP, 200 mg / L cefotaxime and 100 mg / L kanamycin (or 50 mg / L hygromycin) and cultured at 25 ° C and 18L / 6D. It was. The induced shoots were transplanted into MS medium containing 200 mg / L cefotaxime and 100 mg / L kanamycin (or 50 mg / L hygromycin) to induce root formation. Rooted transgenic tobacco was transplanted into pots, purified, and grown in greenhouses.

(11) Cabbage Transformation

Cabbage seeds were sterilized with 70% ethanol and chlorax, and then cultivated in a medium without growth regulators and cultured for 5-7 days in a culture chamber (18 hr light / 6 hr cancer). The embryonic seedlings were cut into 0.5 cm in size and pre-cultured in regeneration medium for 2 days. Agrobacterium cultured in YEP medium for 2 days was suspended in liquid regeneration medium, adjusted to 5-7 × 10 ⁸ / ml, and then infected with precultured cabbage hypocotyl tissue for 10-20 minutes. Infected embryonic tissues were implanted in regeneration medium and co-cultured for 2 days in a 25 ° C dark condition. After coculture, the embryonic tissues were washed with medium containing carbenicillin and cefotaxime to remove Agrobacterium, followed by regeneration medium (MS medium + 1 mg / L NAA with added antibiotics such as hygromycin and agrobacterium-removing antibiotics). + 2 mg / L + 2 mg / L AgNO ₃ ) was incubated for 3 weeks in the culture chamber. Subcultured with a new cultivation medium and cultured for 2-3 weeks, green antibiotic-resistant callus and shoots formed in the embryonic tissues. Callus was reimplanted in regeneration medium with reduced NAA concentration to 0.1 mg / L to induce vinegar. The organic leaf was transferred to MS medium without growth hormone to induce roots. The transformants with the roots formed were purified and grown in greenhouses. The herbicide resistance of the transformants was confirmed by smearing or spraying 0.6% Basta on the foliar and browning of the leaves.

<Example 1> Pollen-specific Promoter of Chinese Cabbage BAN102 Gene

(1) Genomic Clonal and Promoter Part Isolation of the BAN102 Gene

Phage clones were obtained from the cabbage genome gene bank using BAN102 cDNA as a probe. Southern phage DNA was analyzed by BAN102 cDNA with a probe, and the 4.7 kb EcoRI DNA fragment containing the BAN102 gene was cloned into the EcoRI site of pBluescript SK (+), and this plasmid was named p246. This 4.7 kb restriction enzyme map was generated, and about 247 kb downstream of the BAN102 gene was removed using ClaI and self-ligation to make p247 (FIG. 1). The base sequence of 1,725 bp was determined based on the BAN102 gene of this genomic clone, which is shown in SEQ ID No. 1 of the attached sequence list. The base sequence includes translation start codon ATG 1177 bp (promoter part), coding part 267 bp, translation end codon TAA 282 bp downstream of BAN102 gene. Analysis of the nucleotide sequences of 10 BAN102 cDNAs isolated from the cDNA gene bank revealed that 1,113 nucleotide adenine was the transcriptional start and polyadenylation was identified as 1484 nucleotide adenine.

In order to obtain the BAN102 promoter, p247 was PCR-templated using primers 102-B, 5'-TGCTGAGACCTGAAAGAC-3 'and T3 primers synthesized from 1,177 to 1,160 bases, and blunt DNA fragments of about 1.2 kb into Klenow fragments. -end was made and cloned into EcoRV site of pBluescript SK (+) to construct plasmid pCR102, and the nucleotide sequence was confirmed (FIG. 2).

(2) Functional analysis of BAN102 promoter (Pban102) by transient transformation

pBI221 (Clontech) was digested with XbaI and EcoRI to isolate the GUS :: Tnos fragment and inserted into the XbaI-EcoRI site of pBluescript SK (+) to make plasmid pBSGN. pCR102 was cleaved with HincII and KpnI to isolate a Pban102 fragment of about 1.2 kb and inserted into pBSGN treated with SmaI and KpnI to make plasmid p102GN (Pban102 :: GUS :: Tnos). p102GN was treated with SpeI and self-ligation to remove 1 kb upstream of Pban102 and create pSPGN (P103del :: GUS :: Tnos). That is, a small promoter (p102del) containing only 177 bp upstream of the start of translation of the BAN102 gene was linked to GUS :: Tnos (FIG. 3).

p102GN and pSPGN plasmid DNA were transiently transformed into individual organs or tissues of tobacco and cabbage using a gene gun and assayed by GUS staining. PBI221 was used as a control. In the case of p102GN, GUS was expressed in the pollen and pollen of tobacco, but not in other tissues. pSPGN also showed the same result as p102GN (FIG. 4). That is, the promoter Pban102 of the Chinese cabbage BAN102 gene has 1,177bp of pollen-specific activity, and its small promoter P102del 177bp also has pollen-specific activity. PBI221 with the CaMV35S promoter expressed GUS only in the leaves of tobacco.

For more detailed analysis, the region from transcription start to TATA box of P102del in P102del was replaced with the same portion of CaMV35S promoter, and 1,069 base guanine (-44 at transcription point) to 1,001 base adenine of 109 bp of P102del. Pollen specific activity up to (-112 at the start of transcription) was confirmed. Upstream primer (-112) 5'-DGAGCTCACTAGTTAATTTTGGCTATC-3 '(27-MER) containing SstI starting at -112 at transcription initiation and downstream PRIMER (-K1) including KpnI starting at transcription initiation -44 44) 5′-gggtacccgtctggaactgtgttata-3 ′ (26-MER) was made (FIG. 5). Using the p247 as a template, the 69 bp DNA fragment was treated with restriction enzymes SstI and KpnI, and then connected to the core promoter (CP35S) from the initiation point of the CaMV35S promoter to -47, and then to the GUS to connect p102A. Made (FIG. 6). As a result of assaying GUS expression by transient transformation in each organ or tissue of tobacco and cabbage with this plasmid, GUS reaction (A) was seen in the pollen and pollen of the tobacco as shown in FIG. Therefore, the pollen specificity of the BAN102 promoter was found between -44 and -112 transcription start point. Unlike intact promoters, however, p102A was weak in tobacco leaves (B), cabbages (C) and pistils (D), but had a GUS response.

(3) Analysis of the Function of Pban102 by Tobacco Transformation

Plasmid pCR102 was digested with PstI and SalI to isolate Pban102 and inserted at the same site of pUC19 to make plasmid pKA1. Plasmid pKA1 was digested with SmaI and HindIII to separate Pban102 and inserted at the same site of pBI101 to produce a plant expression vector p102G (FIG. 8). This p102G was transformed into tobacco using agrobacterium LBA4404 and selected as kanamycine to grow transgenic tobacco. GUS staining of each tissue of the transgenic tobacco was seen only GUS response to pollen and pollen (Fig. 9).

<Example 2> Pollen-specific Promoter of Chinese Cabbage BAN103 Gene

(1) Genomic Cloning and Promoter Part Isolation of BAN102 Gene

Phage clones were obtained from the genomic gene bank of cabbage using BAN103 cDNA as a probe. Southern phage DNA was analyzed by BAN103 cDNA with a probe. A 2.5 kb EcoRI DNA fragment containing the BAN103 gene was cloned into the EcoRI site of pBluescript SK (+), and this plasmid was named p310 and a restriction map was prepared (Fig. 10). . The base sequence of the entire 2.5 kb genome clone of plasmid p310 was determined and shown in SEQ ID NO: 2 of the attached Sequence Listing. The total length of the genomic clone was 2,539 bp, including 1,831 bp upstream of the codon ATG for translation of the BAN103 gene (promoter portion, 1 to 1,831 nucleotides in the sequence listing), 370 bp of protein coding portion (1,832 to 2,201), downstream of the termination codon TAA. 338 bp (2,202 to 2,539). The coding portion 370bp had two introns, 95bp (1,892 to 1,986) and 71bp (2,056 to 2,126), respectively, and the size of the three exons encoded a total of 67 amino acids, 60bp, 69bp and 75bp, respectively (FIG. 11). Based on the cDNA nucleotide sequence, primer 5'-GTTGTTAGACATTTTCTTATCTCCGC-3 'was prepared and the primer initiation was confirmed by RNA extension of Chinese cabbage flower. As a result, the transcription start point of the BAN103 gene was identified as 1,768 base thymine in [SEQ ID NO: 2]. At 1,741 bases, the AATAAA polyadenylation signal is present near 2,493 bases, and polyadenylation starts with base adenine.

In order to obtain the BAN103 promoter, PCR was carried out using p310 as a template using primers 103-B, 5'-GGGTCGACTTTCTTATCTCCGC-3 'and T7 primers containing SalI (GTCGAC) sites at bases 1,831 to 1,818 in the sequence listing. 1.8 kb of the PCR product was treated with SalI and inserted into SalI site of pUC19, and this plasmid was called pCR103R, and the nucleotide sequence was confirmed (Fig. 12).

(2) Functional analysis of BAN103 promoter (Pban103) by transient transformation

pBI221 (Clontech) was digested with XbaI and EcoRI to isolate the GUS :: Tnos fragment and inserted into the XbaI-EcoRI site of pUC19 to make plasmid p19GN. pCR103R was cleaved with XbaI to isolate Pban103 fragment (995bp upstream of ATG of BAN103 gene) of about 1 kb and inserted into p19GN treated with XbaI to create plasmid p103XGN (Pban103 :: GUS :: Tnos) (FIG. 13). After PCR with p310 as a template using primer 103-A and primer 103-B containing 5'CCGACCGGAGAGTACTAAGC-3 'from 1,640 bases to 1,659 bases in [SEQ ID NO: 2]. 175bp (P103del) upstream of the ATG of this PCR product, BAN103 gene, was treated with HindIII and SalI and inserted into the HindIII / SalI site of p19GN to make plasmid pHSGN (P103del :: GUS :: Tnos) (FIG. 13).

p103XGN and pHSGN plasmid DNA were transiently transformed into individual organs or tissues of tobacco and cabbage using a gene gun and assayed by GUS staining. PBI221 was used as a control. In the case of p103XGN, GUS was clearly expressed in pollen and pollen of tobacco. In addition, GUS expression was observed in the cabbage flower and petals, although at a very low level. Figure 14 (A) is a flower of Chinese cabbage, (B) is an enlarged picture of GUS expression in the flower of Chinese cabbage, (C) is a cabbage of the Chinese cabbage, (D) shows the pollen and pollen tube of tobacco.

Thus, promoter Pban103 was judged to be the dominant promoter in pollen. On the other hand, pHSGN also showed the same result as p103XGN in tobacco pots and pollen tubes. That is, the small promoter P103del 175bp of the BAN103 gene of Chinese cabbage also has pollen-specific activity.

(3) Analysis of the Function of Pban103 by Tobacco Transformation

Plasmid pCR103R was digested with XbaI to isolate 1.0 kb of Pban103 and linked with pBI101 treated with XbaI and bacterial alkaline phosphatase (BAP) to make p103XG (NPTII-Pban103 :: GUS :: Tnos) (FIG. 15). p103XG was transformed into tobacco using Agrobacterium LBA4404 and selected as kanamycin to grow transgenic tobacco. GUS staining of each tissue of transgenic tobacco showed strong GUS response in pollen and pollen ducts. In addition, the expression of GUS was confirmed in the parental body of the embryo, calyx and petal (Fig. 16).

<Example 3> Male infertility cigarettes using pollen specific promoters Pban102 and Pban103

(1) Plant expression vector production

The plasmid pDTx-2 was digested with KpnI and SacI to isolate the diphtheria toxin gene (DTx-A), and the plasmid pKA1 was inserted into the site treated with KpnI and SacI to make pKD102 linked to Pban102 and DTx-A. Plasmid pKD102 was digested with HindIII and SacI to isolate Pban102 :: DTx-A, and then treated with pBI101-Hm with the same restriction enzyme and inserted to prepare p102DT (NPTII-Pban102 :: DRx-A :: Tnox-Hyg). It was. In addition, pCR103R was cleaved with XbaI to isolate Pban103 of 1.0 kb, and then pGA987 was treated with XbaI and linked to prepare p103DT (NPTII-Pban103 :: DTx-A :: 7'5 ') (FIG. 17).

(2) Selection and observation of transformation and male infertility tobacco

After transforming P102DT and p103DT to tobacco using Agrobacterium LBA4404, transformants were selected from kanamycin medium. Selected transformants were grown in a greenhouse and genomic DNA of each individual was isolated. Based on the nucleotide sequence of the DTx-A gene, two primers were prepared by 5'-AACTTTTCTTCGTACCAC-3 'and 5'-GCTTTCGCCTGTTCCCAG-3', and PCR was confirmed for transformation (FIG. 18). Male infertility of the transformed flowers was judged as the result of pollination development and production and pollination of normal flowers. Full male infertility as well as semi-male infertility individuals were praised (FIG. 19). These results may be related to the number of copies of the DTx-A gene. Seeds were obtained by pollinating normal tobacco pollen in pistils of male sterile individuals. These seeds were germinated in kanamycin medium and selected for cultivation and showed male sterility like mothers.

<Example 4> Pollen-specific Promoter of Chinese Cabbage BAN84 Gene

(1) Genomic Cloning and Promoter Part Isolation of BAN84 Gene

The sequencing of BAN84 cDNA identified this gene as the ascorbate oxidase gene. Phage clones were obtained from the genomic gene bank of cabbage using this BAN84 cDNA as a probe. The phage DNA was also analyzed by Southern BAN84 cDNA probe. The 7.8 kb EcoRI DNA fragment containing the BAN84 gene was cloned into the EcoRI site of pBluescript SK (+), and the plasmid was named pGBAN84. ). The position and direction of the BAN84 gene were determined by sequencing of both ends of the genomic clone of plasmid pGBAN84, Southerm analysis, and cDNA sequence. pGBA84 was cleaved with SmaI to remove about 3.1 kb distant to the 5 'side of the BAN84 gene and self-ligation to make plasmid p84Sm. In the same manner, about 4.1 kb in BamHI and about 6.0 kb in XbaI were deleted from pGBAN84, and plasmids p84Bm and p84Xb were generated and used for sequencing, respectively (FIG. 20). A total of 3,741 bp sequences were analyzed from the SmaI site of p84Sm ( SEQ ID NO: 3) . In the attached sequence list, a 21-mer primer KDH-1 (5'-TAATAATAAAACTTTGTTAATC-3 ') was created from base 565 to 545 base just above the codon ATG in translation of the BAN94 gene, and PCR of p84Sm with the T3 primer was used as a template. Cloning into the pCR2.1 vector made plasmid pCRP84 with 565bp of BAN84 promoter portion (P84). This was again cleaved with EcoRI and P84 was transferred to the EcoRI site of pBluescript SK (+) to make plasmid pBSP84. In addition, 22-mer primer KDH-2 (5'TTTTGTTAACACTTCTAC-3 ') from 3,338 bases to 3,359 bases, just below the translation termination codon TAA of the BAN84 gene in SEQ ID NO: 3, was prepared and PCR of p84Sm with the T7 primers as a template. Cloning into the pCR2.1 vector resulted in plasmid pCRT84 with approximately 2.0 kb of BAN84 terminator portion (T84) (FIG. 21).

(2) Functional analysis of BAN84 promoter (P84) by transient transformation

pBSP84 was cleaved with PstI and EcoRV to isolate P84, and pBI221 (Clontech) was cleaved with PstI and SmaI to insert the CaMV35s promoter to remove pKP101. After pCRT84 was isolated from T84 by partial cleavage of EcoRI and SacI, pBI221 was treated with the same enzyme to remove NOS terminator (Tnos) and inserted in place to make pKP201. In addition, pKP201 was cleaved with PstI and SmaI to insert P84 separated from pBSP84 by PstI and EcoRI in place of removing the CaMV35s promoter (pKP301) (FIG. 22).

After plasmids pKP101, pKP201 and pKP301 were each purified, gene guns were used to assay transient GUS expression in various tissues of tobacco. Plasmid pKP101 with the BAN84 promoter showed GUS response only in the pollen of tobacco and could not detect GUS expression in other tissues. In other words, P84 was a pollen specific promoter. On the other hand, pKP201 with CaMV35a promoter and BAN84 terminator showed strong GUS expression in tissues such as tobacco leaves and flower buds, and was very weak in pollen but could detect GUS expression. In other words, T84 replaces Tnos and fully performs terminator function. The transient GUS expression assay by pKP301 with P84 and T84 was identical to the results of pKP101 (FIG. 26).

Example 5 Carpet promoter of the Chinese cabbage BcA9 gene

(1) BcA9 gene isolation, genomic clone isolation and analysis

First, two primers 5'-ATGGTATCTCTAAAGT-3 'and 5'-ATTATTCCATCAATAG-3' were synthesized to obtain Arabidopsis A9 gene, PCR was performed with Arabidopsis genomic DNA, and the product was cloned into pCR2.1 vector. The nucleotide sequence was confirmed to be the A9 gene. Phage clones were isolated from the genomic gene bank of cabbage using a probe. Phage DNA was treated with XbaI, followed by electrophoresis, Southern analysis, and a 5.5kb that responded to the A9 gene probe was inserted into the XvaI site of pUC19 to make pBc9 (FIG. 24). Plasmid pBc9 was treated with various restriction enzymes, followed by Southern analysis and partial sequencing to confirm the location and orientation of BcA9 gene in the 5.5kb genomic clone. A nested deletion set of plasmid pBc9 was prepared and sequenced ( SEQ ID NO: 4 ). The base sequence includes 3,255 bp in total up to 1,462 bp upstream of the BcA9 gene, 312 bp of BcA9 protein coding portion without intron from 1,463 bases to 1774 bases and 1,481 bp downstream of the gene.

The amino acid rapeseed A9 (BnA9) and Arabidopsis A9 (AtA9) of the BcA9 gene were compared (Figure 25). BcA9 and BnA9 have 103 and 96 amino acid sequences, but they are completely identical to the 93rd amino acid and differ only in the C-terminus, whereas AtA9 is the longest with 107 amino acids and has a large homology with the other two species. The amino acid showed a blank.

On the other hand, the coding part of the BcA9 gene was used as a probe and the parent and minor genomic DNA of Chinese cabbage (Changwon F1), which was the material of the gene bank of this study, was treated with EcoRI, HindIII, and XbaI, and Southern analysis (FIG. 26). The parent and the minor showed the same pattern in. In addition, the BcA9 gene was found to exist in one copy on the cabbage genome.

(2) Isolation of BcA9 promoter (PBcA9) and production of plant expression vector

From 616 to 639 bases of FIG. 28, 5'-CTAGTCCAATAATGTGAGTCATGT-3 ', primer BARP4 and 1,462 bases to 1,436 bases, 5'-TTTGTTTAGATATTGTAGGAGTCTTC-3', primer BAPR3 were prepared and PCR of pBc9 with template was used to generate the BcA9 gene. The promoter portion 847bp was obtained and then inserted into the pCR2.1 vector to obtain plasmid pPBcA9. This was again cleaved with EcoRI to insert pBcA9 into the EcoRI site of pBluescript SK (+) to make pBSPBcA9. After plasmids pGR007 (Dtx-A :: 5'7 '/ P35s :: bar :: T35s) and pBSPBcA9 were treated with PstI and HindIII, respectively, the BcA9 promoter was inserted into pGR007 and pGR009 (PBcA9 :: Dtx-A :: 5' 7 '/ P35s :: bar :: T35s). In addition, pGR009 and p35HN (p35s :: HYG :: Tnos) were treated with HindIII and then ligation to prepare pGR011A (FIG. 27).

(3) Analysis of the function of PBcA9 by cabbage transformation

Plasmid pGR011A was transformed into cabbage via Agrobacterium and selected in hygromycin medium. Selected transgenic cabbages were incubated in a greenhouse. When treated with 0.6% Basta, the selected transgenic cabbage showed resistance.

Male infertility was confirmed in the flowering transgenic cabbage (FIG. 28). Male sterile flowers did not produce active pollen at all, and the length of the stamen was shorter than that of normal flowers. Pollen hair cell development in the drug when the length of the bud was about 1 mm was observed even in male sterile cabbage (Fig. 29). However, when the length of the buds is about 1.5mm, the quadrant of the normal flower had a quadrant but the male infertile flower had no quadrant and the pollen hair cells were abnormally deformed (FIG. 30). In addition, when the length of the bud is about 3mm, the vesicles were already released and grown at the top, but in the case of male infertility, no contents were observed in the drug (FIG. 31).

<Example 6> A vascular promoter of the Chinese cabbage BIF38 (lipid transfer protein) gene

(1) Isolation of genome clone and promoter (Pbif38) of BIF38 gene

Phage clones were obtained from the genomic gene bank of cabbage using BIF38 cDNA as a probe. Phage DNA was analyzed by Southern BIF38 cDNA probe and the 5.2kb EcoRI DNA fragment containing the BIF38 gene was cloned into the EcoRI site of pBluescript KS (+), and the plasmid was named pGBIF38E-11 and a restriction map was prepared (FIG. 32). ). The base sequence of genomic DNA of BIF38 cDNA and plasmid pGBIF38E-11 was analyzed ( SEQ ID NO: 5 ). The protein coding portion of the cDNA of the BIF38 gene encodes 119 amino acids at 360 bp, including the termination codon, and contains introns from 967 to 1,000 bases and from 1,512 to 1,837 bases in FIG. 37, and from 1,001 to 1,511. . The amino acid sequence of the BIF38 gene showed similarity with the lipid transfer protein. 37 prepared primer 38-1 AAATCTAGATTTCTGATC (18-mer) including XbaI site from 728 to 745 base and primer 38-2 GGATCGATTGTTGTTTTAATATCG (24-mer) with XbaI site from 966 to 951 base PCR was performed using pGBIF28E-11. The PCR product 247bp DNA fragment was digested with XbaI and ClaI, and then inserted into a pBluescript SK (+) vector treated with the same restriction enzyme to make plasmid pGBIF38P3. pGBIF28E-11 was cut into SacI and partially digested with XbaI to separate 3.7 kb DNA fragments, and then inserted into SacI and XbaI sites of pGBIF38P3 to make plasmid pGBIF38P1 to complete Pbif38 cloning. pGBIF38P1 was cleaved with SmaI and ClaI to isolate Pbif38, and then the pGA982 vector was inserted into the cleavage site with HpaI and ClaI to generate a GUS expression vector pANL1 (FIG. 33).

(2) Tobacco transformation and GUS expression analysis

pANL1 was transformed into tobacco using Agrobacterium LBA4404 and selected as kanamycin to grow transgenic tobacco. GUS staining of each tissue of transgenic tobacco showed expression of GUS in the endosperm of mature seeds, cotyledon and leafy veins of young seedlings, vascular tissues of stems and fine roots. On the other hand, when closely examining the flow of young seedling stems, the GUS reaction was observed only in the outside of the phloem and inside the water tube, and the GUS response was not seen in plants after 6 weeks of germination (Fig. 34). GUS response was also seen in the abscissasion zone, petals and ductal tissues of pistils and operating tables, and GUS expression was also observed in the growing ovule (FIG. 35). Therefore, the BIF38 promoter begins to be active in the developing tissues of the growing fire, and in the embryo tissues of cabbages and mature seeds, germinates and germinates in young seedlings within about 6 weeks. It was a promoter.

As described above, the promoter region of the present invention is separated from Chinese cabbage, and its function is confirmed in three pollen-specific promoters (Pban102, Pban103, P84), one carpet-specific promoter (PBcA9), and in the vascular specific promoter 1 All species (BIF38) have tissue specific promoter functions.

These promoters control the expression of foreign genes in a specific plant, and during developmental stages of the plant, by controlling how much of the tissues are expressed in which tissues, and in what amount, the development of transgenic plants for various purposes. It can be seen that it can be applied to research and development.

Claims (15)

Pollen-specific promoter region (Pban102) of the 1,177 bp upstream of the start codon ATG in the nucleotide sequence of SEQ ID NO: 1, a genomic clone of the BAN102 gene. A DNA molecule of 177 bp (P102del) downstream having pollen-specific promoter function in the promoter region of claim 1. Plasmid p246 with 4.7 kb of genomic clone of cabbage containing BAN102 gene and plasmid p247 with 2.5 kb. Pollen dominant promoter region (Pban103) from base 1 to base 1831 in the nucleotide sequence of SEQ ID NO: 2, a genomic clone of the BAN103 gene. A DNA molecule of 175 kb (P103del) downstream having a pollen-dominant promoter function in the promoter region of claim 4. Plasmid p310 with a 2.5 kb genomic clone of cabbage containing the BAN103 gene. Pollen-specific promoter region (P84) from base 1 to base 565 in the nucleotide sequence of SEQ ID NO: 3, which is a genomic clone of the BAN84 gene. Plasmids pGBAN84, p84Xb, p84Bm and p84Sm with genomic clones of cabbage containing the BAN84 gene. delete delete A carpet-specific promoter region (PBcA9) from 616 bases to 1,436 bases in the base sequence of SEQ ID NO: 4, a genomic clone of the BcA9 gene. Plasmid pBc9 with a 5.5 kb genomic clone of cabbage containing the BcA9 gene. Promoter region (Pbif38), which consists of the translational start codon of SEQ ID NO: 5 showing the protein coding portion of the genome clone of the BIF38 gene and its base sequence from EcoRI (from 1 base to 966 base). Plasmid pGBIF38E-11 with 5.2 kb of Chinese cabbage genome clone comprising the BIF38 gene. Plasmid pANL1 comprising the DNA molecule of the promoter region of claim 13.