KR100422074B1 - The method for production of egg containing anti-E.coli IgY and anti-Helicobacter pylori IgY and anti-Salmonella enteritidis and Salmonella typhimurium simultaneously, and egg, yolk, yogurt and ice-cream containing specific IgY for anti-E.coli and anti-Helicobacter pylori and anti-Salmonella enteritidis and anti-Salmonella typhimurium - Google Patents

Abstract

The present invention is to inoculate E. coli and gastroenteritis bacteria Helicobacter pylori and Salmonella enter Salmonella ( Salmonella enteritidis and Salmonella typhimurium ), which causes enteritis , can be inoculated in the central chicks at the same time to prevent gastroenteritis Independent of the production technology to share four complex special antibodies (anti-mixture special immune protein) in one egg, the four antigens are inoculated into the central chick, and then the special antibodies produced are mixed at an appropriate ratio to be used as a food additive. It is characteristic of providing technology.

Another invention relates to eggs, yolk, yogurt and ice cream containing anti-mixed bacteria special immune proteins.

Another invention is characterized by providing an anti-mixed bacterial special immune protein that can be co-inoculated with E. coli and Salmonella ( Salmonella enteritidis and Salmonella typhimurium ) at the same time to share anti-mixed bacteria special immune protein in one egg. .

Eggs, dairy products and beverages containing the complex special immune protein or the mixed special immune protein prepared by the present invention have an excellent effect on preventing gastroenteritis, and the disease caused by E. coli and duodenitis-causing bacteria that are chronically present in Korean people. It has the advantage of preventing, and also has the effect of preventing salmonella, a food poisoning contaminant.

Description

Egg production methods that share the special immune proteins of anti-E. Coli, Salmonella enteritidis, Salmonella typhimurium and Helicobacter pylori and eggs produced by the production method, yolks and yogurt and ice cream containing the anti-mixed bacteria special immune protein {The method for production of egg containing anti-E.coli IgY and anti-Helicobacter pylori IgY and anti-Salmonella enteritidis and Salmonella typhimurium simultaneously, and egg, yolk, yogurt and ice-cream containing specific IgY for anti-E.coli and anti-Helicobacter pylori and anti-Salmonella enteritidis and anti-Salmonella typhimurium}

The present invention is to inoculate E. coli causing enteritis and Helicobacter pylori , a gastritis bacterium, and Salmonella enteritidis and Salmonella typhimurium , which causes gastrointestinal diseases, and simultaneously inoculates the central disease with gastritis. Production technology to share anti-mixed bacteria special immune protein (IgY) in one egg to prevent enteritis and food poisoning.Independently inoculate four antigens into central chick, and then mix each produced special antibody in proper ratio It is characterized by providing a technology used as a food additive.

Another invention relates to eggs, yolks, yogurt and ice creams containing four anti-mixed bacteria special immune proteins.

Another invention is characterized by providing a production technology to share a special antibody (anti-mixture special immune protein) that can inoculate E. coli and Salmonella ( Salmonella enterphidis and Salmonellatyphimurium ) at the same time to prevent food poisoning to share in one egg There is also.

In relation to the present invention, the data reported so far, Enterotoxigenic E. coli ( E. coli) is one of the normal resident flora in the intestines of humans and livestock E. coli is a gastroenteritis in healthy adults as well as children It is known to be the causative agent of interest.

To date, five types of E. coli, which is a diarrhea of humans, have been identified. Enteropathogenic E. coli (hereinafter referred to as EPEC ), Enteroinvasive E. coli (hereinafter referred to as EIEC ), Enterotoxin Escherichia coli (hereinafter referred to as ETEC: Enterotoxigenic E. coli ), Enteroxiogenic E. coli (Hereafter referred to as EHEC: Enterohemorrhageic E. coli ) and enterococcal Escherichia coli (hereinafter referred to as EAEC: Enteroadhesive E. coli ).

In 1923, Adam isolated E. coli from infants' diarrhea and reported that it was associated with gastroenteritis. In the mid-1940s, mass diarrhea caused by Escherichia coli occurred in preschool, mainly in the UK. The name Pesogenic called Enteropathogenic E. coli was called Escherichia coli by Neter et al.

Summarizing the technology related to the conventional E. coli patent is as follows.

Yang Kwang-hyun (1994) has applied for a patent on the prevention and treatment of diarrhea in animals, which has an effect on the causative agent of diarrhea in animals by producing an immune antibody with cells inactivated by treating the causative organism of diarrhea with formalin. To facilitate the preparation of a therapeutic agent, an immune egg containing an antibody that specifically reacts to ETEC by immunizing chickens using a whole cell or cell surface inactivated by formalin treatment with ETEC as an immunogen. Thus, a patent was made for producing a diarrhea prevention agent for animals that specifically acts on ETEC, the causative agent of animal diarrhea. In addition, Kim Jung-woo (1999) has applied for a patent that aims to provide a technique for preparing egg yolk antibodies and effectively separating them using antigens of ETEC K88 strain and immunoglobulin (IgY) in egg yolk in pigs. . In addition, Kim Jung-woo et al. (1999) have a patent that aims to provide a technique for preparing and effectively separating egg yolk antibodies using immunoglobulin (IgY) in egg yolk in ETEC K99 and K88 strains in pigs. Filed. In addition, Kim Jung-woo et al. (1999) have a patent for the purpose of providing a technique for producing an egg yolk antibody using immunoglobulin (IgY) in the egg yolk of ETEC 987p strain and K88 strain in pigs. Filed. In addition, Kodamayoshikasu (1998) is an antibody IgY obtained from eggs laid by hens immunized against verotoxoid as whole antigen and E. coli cells and antigens for use in the prevention and treatment of infections caused by Enterocoliform Escherichia coli (ETHC). Applied for a patent. The National Veterinary Research and Quarantine Service (1998) has applied for a patent on the use of a combination immunologic agent using yolk antibodies for the prevention and treatment of diarrhea caused by swine coli and epidemic diarrhea.

In addition, a summary of some of the patents in the world as a prophylactic treatment for Helicobacter pylori , enteritis, which causes duodenitis.

Efforts have been made to address the treatment of gastritis and duodenitis by antigen-antibody reactions. Corrers et al. Have isolated immunoglobulins for the treatment of gastritis and gastrointestinal ulcers caused by Helicobacter pylori from mammalian breast secretions. (1992). Taiyo Kagaku Corporation immunized H. pylori on laying hens and immunized them to obtain special antibodies (1992) .The antigen used was H. pylori bacteria ATCC strain 43504, 43506. , 43579 and 43629.

In addition, in recent years, a situation that becomes salmonella entera itty display (S.enteritidis), Salmonella typhimurium (S.typhimurium), is increasingly serious injury of a person by the Minister of zoonotic infectious diseases in pathogenic microorganisms such as E. coli.

The most frequent cause of food poisoning is bacterial food poisoning. The main causative agents of food poisoning are Salmonella, Enteritis Vibrio and Staphylococcus aureus. Salmonella is the most common cause of food poisoning among human intestinal pathogens. Food poisoning by Salmonella accounts for 37.7% of the total number of patients. Among the main causes of food poisoning, enteritis vibrio is concentrated in summer, whereas salmonella food poisoning is reported annually and its importance is recognized. Food poisoning damage caused by Salmonella continues to occur in North America, South America, and Europe, and the incidence and incidence rates are increasing due to the increase of large-scale eating habits such as the formation of mass distribution network of meat, increase of environmental pollution and feeding to be.

The other 2,400 serotypes of Salmonella, except for the bacterium Baekli and Poultry typhoid, which have a limited host region, are infected or contaminated with at least one animal in any environment. Do. Among Salmonella species, Salmonella enteritidis and Salmonella typhiumrium have been reported as the main causes of food poisoning (National Institute of Infectious Diseases, Korea). In general, the most common route of infection is egg egg, but egg egg infection also occurs in Salmonella infection. In particular, in the case of Salmonella enteritidis and Salmonella typhimurium, there is an example that the infection of the ovary has been transferred to the egg yolk, and the importance is further emphasized. Therefore, if you remove it, it can be the basis of prevention against Salmonella-derived food poisoning by blocking the link of disease occurrence.

Birds have a high rate of Salmonella carriers among animals, including livestock, and therefore have a high frequency of detection. In addition, the typical infectious disease that infects people through eggs is Salmonella disease. Therefore, there is a concern about salmonella of eggs, which is a product of poultry, and there is a limit in processing and cooking such as requiring a high sterilization process.

Recently, this species (2000) reported from the National Institutes of Health and Prevention Division of each attempt in the infectious disease outbreak information sheet, the characteristics of the recent food poisoning tends to increase the collective food poisoning, such as the expansion of school lunches, etc. The development of the food service industry was attributed to the change of eating habits. The main causative agents were Salmonella, Enteritis Vibrio and Staphylococcus aureus. Among them, food poisoning caused by Salmonella reached 37.7% of the total number of patients. Among the main causes of food poisoning, enteritis vibrio was concentrated in summer, whereas salmonella was reported year-round. According to the Infectious Disease Occurrence Information Bulletin (Vol. 11, No. 5), Salmonella enteritidis was the most frequently isolated from gastroenteritis from March 16 to April 15, 2000 (60), followed by Salmonella typhimu. Leeum was separated nine times.

In the prior art related to Salmonella, Song Kyung-bin (2000) filed a patent for the expression in E. coli of a protein fused with the maltose binding protein of ATFA subunit of Salmonella enteridis. It is intended for use in the development of diagnostic kits and vaccines for Salmonella infection, the most problematic disease in chickens (application number: 10-2000-024818). Long Pling Inc. (1991) has applied for a method for treating a conductor for controlling bacterial growth. This relates to a method for controlling bacteria present in animal carcasses without causing a decrease in reaction characteristics by reducing and delaying the growth level of bacteria such as Salmonella during processing of food animals (Application No. 10-1991-019081). . Miwon Co., Ltd. (1993) has applied for a method of inhibiting the growth of Salmonella and Welsh bacteria. An object of the present invention is to provide a method of inhibiting the growth of Salmonella and Welsh bacteria by administering an effective compound having a function of inhibiting the growth of Salmonella and Welsh bacteria in the intestine of the livestock (Application No .: 10-1993-004430).

As described above, various methods such as the use of antibiotics and natural substances have been attempted for the inhibition of growth of Helicobacter and Salmonella, but a certain conclusion cannot be obtained in the efficacy evaluation. However, the problem of food poisoning is on the rise every year, and fundamentally, by including the Salmonella antibody in the egg at the same time with other antibodies can provide more effective preventive measures.

In addition, it is generally known to produce antibodies against certain bacteria and to carry out treatments using the antibodies. However, it is difficult to produce individual antibodies, and the problem of antibody separation is solved industrially. There is a problem that can not be.

In order to solve the above-mentioned conventional technical problems, four eggs or three anti-mixed bacteria special immune proteins (anti-E. Coli IgY, anti-Helicobacter pylori IgY, anti-salmonella enteritidis IgY and anti-salmonella typhi) in one egg Co-containing methods containing mulium IgY / or anti-E. Coli IgY, anti-salmonella enteritidis IgY and anti-salmonella typhimurium IgY), and eggs, yolks containing these four or three anti-mixture special immune proteins And to provide a dairy product such as yogurt, ice cream containing the anti-mixed bacteria special immune protein.

Therefore, the present invention to solve the above problems, two bacteria causing E. coli,Enteropathogenic E.coli) And Helicobacter pylori (Helicobacter pylori) Salmonella enteritidis, an antigen and food poisoning bacterium (Salmonella enteritidis) And Salmonella typhimurium (Salmonella typhymurium) And immunization to the central chicks at the same time, the method of producing the eggs sharing the antibodies against these four eggs in the egg after the chicken is grown and mixed with each of the four independently produced antibodies and then anti-mixing It is an object of the present invention to provide a method for producing eggs containing fungal special immune protein and yogurt, ice cream containing egg, egg yolk or immunoprotein produced by the method.

Another invention is characterized by providing a production method to share a special antibody to one egg to prevent food poisoning by inoculating three bacteria, E. coli and Salmonella two types ( Salmonella enteritidis and Salmonella typhimurium ) at the same time to inoculate.

1 shows anti-Helicobacter pylori specific IgY titer changes in E. coli and Salmonella enteritidis and Salmonella typhimurium and Helicobacter pylori inoculation.

FIG. 2 shows anti-Salmonella specific IgY titer changes upon E. coli and Salmonella enteritidis and Salmonella typhimurium and Helicobacter pylori inoculation.

Figure 3 is the anti-Helicobacter pylori special IgY mean titer when combined with E. coli and Salmonella enteritidis and Salmonella typhimurium and Helicobacter pylori inoculation.

Figure 4 shows the anti-Salmonella specific IgY mean titers of E. coli and Salmonella enteritidis and Salmonella typhimurium and Helicobacter pylori inoculation.

FIG. 5 shows anti-Salmonella specific IgY titer changes upon E. coli and Salmonella enteritidis and Salmonella typhimurium complex inoculation.

FIG. 6 shows anti-E. Coli specific IgY titer changes at E. coli and Salmonella enteritidis and Salmonella typhimurium complex inoculation.

7 shows anti-Salmonella specific IgY mean titers at E. coli and Salmonella enteritidis and Salmonella typhimurium complex inoculation.

FIG. 8 shows anti-E. Coli specific IgY mean titers at E. coli and Salmonella enteritidis and Salmonella typhimurium complex inoculation.

The configuration of the present invention for achieving the above technical problem,

E. coli , which causes enteritis , and Salmonella enteritidis , a food poisoning bacterium, and Salmonella typhymurium , and Helicobacter pylori , a gastritis, are simultaneously inoculated into the central chick. Independently of the production method to share the complex special antibodies (hereinafter referred to as anti-mixed bacteria special immune protein) to one egg to prevent enteritis, the four antigens are inoculated into the central chick, and then each produced anti-mixed bacteria It is characterized by providing a technology to use as a food additive by mixing a special immune protein in an appropriate ratio.

Another invention relates to eggs containing four anti-mixed bacteria special immune proteins, yolks, yogurt and ice cream containing anti-mixed bacteria special immune proteins.

Another invention is characterized by providing a production technology for sharing an anti-mixed bacteria special immune protein that can prevent food poisoning by inoculating both E. coli and Salmonella enteritis ( Salmonella enteritidis and Salmonella typhimurium ) at the same time to prevent food poisoning. .

In more detail, the configuration of the present invention,

The present invention is inoculated once to the central chicks with one ml of E. coli antigen, Salmonella enteritidis antigen, Salmonella typhimurium antigen, Helicobacter pylori, and 1 ml of mixed bacterial emulsion emulsified in a certain ratio. From the first time, the mixture was inoculated twice with 1 ml of the mixed bacteria emulsion using the emulsification aid (ISA25) at intervals of 2 weeks, and then the mixed bacteria emulsion using the emulsification aid (ISA25) was added to the grown laying hens every three months. A total of five inoculations were performed, including two inoculations of 0.5 ml each at the same rate as the emulsifier, and one egg produced was anti-E. Coli, anti-Salmonella enteritidis, anti-Salmonella typhimurium, and anti-helicobacter A method for producing eggs containing anti-mixed bacteria special immune protein (IgY), characterized by simultaneous sharing of special immune protein (IgY) of pylori . More specifically, the number of cells inoculated into the central chicks, E. coli antigen: Salmonella enteritidis antigen: Salmonella typhimurium antigen: Helicobacter pylori antigen: Emulsion aid ratio of 1.5: 1: 1: 3.5: 3 as to, 4.0 × 10 ⁸ / ㎖ coli antigen 0.15㎖ four bacterial solution and 4.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth antigen 0.10㎖ and 4.0 × 10 ⁸ / ㎖ Salmonella typhimurium antigen 0.10㎖ four bacterial solution and 4.0 × 10 ⁸ / ㎖ Helicobacter fatigue Lisa bacterial solution the mixed bacterial antigen 0.35㎖ with emulsifying adjuvant (ISA25) every two weeks starting when the first doses, and twice with a mixture fungus 1㎖ emulsion emulsified in aluminum hydroxide 0.3㎖ Inoculated twice with 1 ml of the mixed bacteria emulsion mixed in the same ratio, and then in the same proportion to the growing laying hens, 0.15 ml of 2.0 × 10 ⁸ / ml Escherichia coli antigen and 2.0 × 10 ⁸ / ml Salmonella enteritidis Fungal Antigen 0.10 And 2.0 × 10 ⁸ / ㎖ Salmonella typhimurium antigen 0.10㎖ four bacterial solution and 2.0 × 10 ⁸ / ㎖ Helicobacter fatigue Lisa broth antigen 0.35㎖ and painting the auxiliary liquid (ISA25) the bacteria were mixed with the emulsion prepared eda bridge 0.3㎖ 3 month A total of five inoculations, including two 0.5 ml inoculations, were used to produce one egg of anti-E. Coli, anti-salmonella enteritidis, anti-salmonella typhimurium, and anti-helicobacter pylori special immunity protein. The present invention relates to a method for producing eggs containing anti-mixed bacteria special immune protein (IgY), characterized by simultaneously sharing (IgY).

In another aspect, 1 ml of a mixed bacterial emulsion emulsified in E. coli antigen, Salmonella enteritidis antigen, Salmonella typhimurium antigen, Helicobacter pylori antigen and Freund's complete adjuvant (Adjuvant complete Freund's) Was inoculated once in one leg of the central chicks, and from the second time, the mixed bacterial emulsion using Freund's incomplete Freund's was inoculated twice at 1 ml intervals every two weeks at the same ratio as the mixed bacterial emulsion. Method for producing eggs containing anti-mixed bacteria special immunity protein (IgY) by inoculating a total of five times, including two inoculations of 0.5 ml every three months at the same rate on the growing laying hens at the same rate It is about. Specifically, the number of cells inoculated into the central chick diseased E. coli antigen: Salmonella enteritidis antigen: Salmonella typhimurium antigen: Helicobacter pylori antigen: Adjuvant complete Freund's ratio of 1.5: 1 : 1: 3.5: 3 by a, 4.0 × 10 ⁸ / ㎖ coli antigen 0.15㎖ four bacterial solution and 4.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth antigen 0.10㎖ and 4.0 × 10 ⁸ / ㎖ Salmonella typhimurium four bacterial solution 0.10㎖ antigen and 4.0 × 10 ⁸ / ㎖ Helicobacter fatigue Lisa the bacterial solution was mixed bacteria 1㎖ emulsion emulsifying the antigens in Freund's complete adjuvant 0.35㎖ (complete Freund's adjuvant) doses and 0.3㎖ 1, 2 Starting Freund when Inoculate 1 ml each of the mixed bacterial emulsion using an adjuvant incomplete Freund's as an emulsifier twice at the same rate as the mixed bacterial emulsion, and then grow 2.0 × 10 ⁸ / ml E. coli bacteria at the same rate to the growing hen. 0.15㎖ antigen and 2.0 × 10 ⁸ / ㎖ Salmonella antigen 0.10㎖ four bacterial solution and 2.0 × 10 ⁸ / ㎖ Salmonella antigen 0.10㎖ four bacterial solution and 2.0 × 10 ⁸ / ㎖ Helicobacter fatigue Lisa broth 0.35㎖ antigen and Freund's incomplete Eggs containing anti-mixed bacteria special immunity protein (IgY) are inoculated with a total of five doses of mixed bacterial emulsion emulsified with 0.3 ml of adjuvant incomplete Freund's, including two 0.5 ml doses every three months. It relates to a production method.

Another composition of the invention is an egg mixed with the anti-mixed bacteria special immune protein (IgY) produced by the above method at the same time, the egg produced by the above method is put into the egg yolk 20g removed from the yolk film in a predetermined container, 20 ml of alkaline water (pH 10) was added and stirred, and left to stand at low temperature (5 to 10 ° C.) for 24 hours, followed by mixing egg yolk: 18 times the amount of alkaline water (720 ml) of alkaline water (1: 1). After leaving for 48 hours to extract the water-soluble protein, the supernatant is concentrated by Hollow fiber membrane separation method in an ultra filteration system to produce lyophilized anti-mixed bacteria, characterized in that the production of special immunoprotein It relates to a method and an anti-mixture specific immunoprotein.

In another aspect, the present invention relates to an egg yolk, an egg yolk powder having an egg yolk in which a egg is produced by the above method in a container, and an anti-mixed bacterium special immunoprotein (IgY) for lyophilizing the egg yolk. , Anti-mixed bacteria special immunoprotein (IgY), yolk or yolk powder containing yolk powder.

In still another aspect of the present invention, the ratio of E. coli antigen: emulsification aid to chick is 1: 1, and the ratio of Salmonella enteritidis antigen: emulsification aid is 1: 1, and that of Salmonella typhimurium antigen and emulsification aid is The ratio is 1: 1, and the ratio of Helicobacter pylori antigen: emulsification aid is 1: 1, emulsifying 0.5 ml of 2.0 × 10 ⁸ / ml E. coli bacteria antigen and 0.5 ml of adjuvant complete Freund's. and, 2.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth 0.5㎖ antigen and Freund's complete adjuvant (Freund's complete adjuvant) to emulsify the 0.5㎖, apart from 2.0 × 10 ⁸ / ㎖ Salmonella typhimurium bacterial antigens and pro 0.5㎖ Emulsify 0.5 ml of adjuvant complete Freund's, separately emulsify 0.5 ml of 2.0 × 10 ⁸ / ml Helicobacter pylori antigen and 0.5 ml of adjuvant complete Freund's, and then individually 1 ml of the individual bacterial emulsion containing 10 ⁸ / ml of bacterial cells was inoculated once in one leg of different chicks, and from the second week, the individual bacterial emulsion using the adjuvant incomplete Freund's was added. Inoculated twice at 2 weeks intervals, 1 ml each at the same rate as the mixed bacteria emulsion, 0.5 ml of the antigen of 2.0 × 10 ⁸ / ml E. coli bacteria and adjuvant incomplete Freund's 0.5 at a monthly interval to the growing laying hens. Emulsify the ml, emulsify 2.0 ml of 2.0 × 10 ⁸ / ml Salmonella enteridis bacterium antigen and 0.5 ml of Freund's adjuvantincomplete Freund's, 0.5 ml of 2.0 × 10 ⁸ / ml Salmonella typhimurium antigen and pro Emulsify 0.5 ml of adjuvant incomplete Freund's, emulsify 0.5 ml of 2.0 × 10 ⁸ / ml Helicobacter pylori antigen and 0.5 ml of adjuvant incomplete Freund's. After the inoculation, the prepared emulsion was inoculated five times, including two inoculations of 0.5 ml in one leg to produce a separate egg having the produced special immune protein, and the egg yolk of the individually produced egg Each of the extracted water-soluble protein (crude IgY) powders were mixed in the ratio (Helicobacter pylori: Escherichia coli: Salmonella enteritidis: Salmonella typhimurium) at 1: 1: 1: 1, 2: 1: 1: 1, 3: 1: 1: 1, 4: 1: 1: 1, 5: 1: 1: 1 mixed composition of egg yolk special immune protein powder and the anti-mixture of yolk special immune protein powder It relates to an ice cream and yogurt containing a mixed composition.

Another invention, each egg yolk separated from the individual eggs produced by inoculating the individual bacteria emulsions (complete Freund's adjuvant at one time inoculation, emulsification aid Freund's incomplete adjuvant at the time of two inoculations) by the same method described above Ratio of Helicobacter pylori (E. coli: Salmonella enteritidis: Salmonella typhimurium) is 1: 1: 1: 1, 2: 1: 1: 1, 3: 1: 1: 1, 4: 1: 1: 1, 5: 1: 1: 1 containing a mixed composition of egg yolk containing special immune protein (IgY) and a mixed composition of egg yolk containing said anti-mixed bacteria special immunity protein (IgY) It is about ice cream and yogurt.

In addition, another invention is the egg yolk separated from the separate eggs produced by inoculating the individual bacteria emulsion (complete Freund's adjuvant at one time inoculation, emulsified adjuvant Freund's incomplete adjuvant at the time of inoculation two times) by the above method It relates to an ice cream and yogurt containing a mixed composition of yolk powder prepared by lyophilization and a yolk powder containing the special immunoprotein (IgY).

In another embodiment, the ratio of E. coli antigen: emulsifying aid to chick is 1: 1, Salmonella enteritidis antigen: emulsifying aid is 1: 1, and Salmonella typhimurium antigen: emulsifying aid is 1: The ratio of Helicobacter pylori antigen: emulsification aid is 1: 1, and emulsifies 0.5 ml of 2.0 × 10 ⁸ / ml E. coli bacteriophage antigen and 0.5 ml of aluminum hydroxide, and separately Salmonella enteritidis bacteriophage antigen. After emulsifying 0.5 ml and 0.5 ml of aluminum hydroxide, emulsifying Salmonella typhimurium bacterium antigen and 0.5 ml of aluminum hydroxide, and emulsifying 2.0 × 10 ⁸ / ml Helicobacter pylori bacterium antigen and 0.5 ml of aluminum hydroxide Inoculate 1 ml of each chick's leg once with the emulsion containing 10 ⁸ / ml of bacterial counts individually, and from the second week, separate bacterial emulsions using an emulsification aid (ISA25). Inoculate twice at 1 week intervals, 1 ml each at the same rate as the individual bacterial emulsion, and emulsify the growing laying hens with 2.0 × 10 ⁸ / ml E. coli antigen 0.5ml and 0.5ml emulsifier (ISA25) at 3 month intervals. Emulsify 0.5 ml of 2.0 × 10 ⁸ / ml Salmonella enteritidis bacteriophage antigen and 0.5 ml of emulsification aid (ISA25) and separately emulsify 2.0 × 10 ⁸ / ml Salmonella typhimurium antigen and 0.5 ml of emulsification aid (ISA25). After emulsifying, separately emulsifying 2.0 × 10 ⁸ / ml Helicobacter pylori antigen 0.5ml and 0.5ml emulsification aid (ISA25), the prepared emulsion was inoculated five times, including two inoculations of 0.5ml in the legs. By means of this method, an egg containing the produced special immune protein is produced, and the blending ratio of each of the water-soluble special immune protein (crude IgY) powders extracted from the individually produced eggs (Helicobacter pylori: E. coli: Salmonella enteritidis: Salmonella ty) Murium) is selected from the ratio of 1: 1: 1: 1, 2: 1: 1: 1, 3: 1: 1: 1, 4: 1: 1: 1, 5: 1: 1: 1 The present invention relates to a method for producing an anti-mixed bacteria special immune protein powder, and to an anti-mixed bacteria special immune protein produced by the production method, and also to an ice cream and yogurt containing the anti-mixed bacteria special immune protein.

In another invention, each egg yolk separated from a separate egg produced by inoculation with an individual bacteria emulsion (using an aluminum hydroxide emulsifier at a time of inoculation and using an emulsification aid (ISA25) at a time of inoculation two times) by the same method described above. The compounding ratio (Helicobacter pylori: Escherichia coli: Salmonella enteritidis: Salmonella typhimurium) is 1: 1: 1: 1, 2: 1: 1: 1, 3: 1: 1: 1, 4: 1: 1: 1 , 5: 1: 1: 1 containing a mixed composition of egg yolk containing a special immune protein (IgY) and a mixed composition of egg yolk containing said anti-mixed bacteria special immunoprotein (IgY) It relates to ice cream and yogurt.

In addition, another invention is freeze-dried the egg yolk separated from the separate eggs produced by inoculating the individual bacteria emulsion (using an aluminum hydroxide emulsifier at one time inoculation, emulsification adjuvant (ISA25) at two inoculations) by the above method. It relates to an ice cream and yogurt containing a mixed composition of yolk powder prepared by the above and a yolk powder containing said special immunoprotein (IgY).

In another embodiment, the chick's leg contains 1 ml of E. coli antigen, Salmonella enteritidis, Salmonella typhimurium antigen, and 1 ml of a certain proportion of mixed bacteria emulsion emulsified with Adjuvant complete Freund's. From the second time, the mixed bacteria emulsion using the adjuvant incomplete Freund's was inoculated twice at 1 ml at 2 weeks intervals at the same ratio as the mixed bacteria emulsion, and then at intervals of 1 month to the grown laying hens. The mixed bacteria emulsion was inoculated a total of five times, including two inoculations of 0.5 ml every three months at the same rate, and produced one egg of anti-E. Coli special immune protein (IgY) and anti-Salmonella enteritidis. Special Immune protein (IgY) and anti-Salmonella typhimurium Special Immune protein (IgY) is characterized by sharing at the same time The egg production method, which specifically describes the invention, wherein the number of cells inoculated into chicks is E. coli antigen: Salmonella enteritidis antigen: Salmonella typhimurium antigen: Adjuvant complete Freund's ratio of 3.5 : 1.8: 1.7: 3 by a, 4.0 × 10 ⁸ / ㎖ coli antigen 0.35㎖ four bacterial solution and 4.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth antigen 0.18㎖ and 4.0 × 10 ⁸ / ㎖ Salmonella typhimurium four bacterial solution 1 ml of a mixed bacterial emulsion emulsified with 0.17 ml of antigen and 0.3 ml of adjuvant complete Freund's was inoculated once, and a mixed bacterial emulsion containing an adjuvant incomplete Freund's as an emulsifier was used twice. the mixed bacterial emulsion and was inoculated by 1㎖ twice with the same rate, 2.0 × 10 ⁸ / ㎖ coli antigen 0.35㎖ four bacterial solution and 2.0 × 10 ⁸ / ㎖ at the same rate eda grown hens Salmonella four bacterial solution, wherein 0.18㎖ and 2.0 × 10 ⁸ / ㎖ Salmonella four bacterial solution of 5 including 0.17㎖ antigen and Freund's incomplete adjuvant (incomplete Freund's adjuvant) with a mixture of bacteria in the emulsion prepared by eda bridge 0.3㎖ 3 month 0.5㎖ 2 doses Inoculation of ash, anti-E. Coli special immune protein (IgY) and anti-Salmonella enteritidis special immune protein (IgY) and anti-Salmonella typhimurium special immune protein (IgY) in a single egg produced at the same time Egg production method having an anti-mixed bacteria special immune protein (IgY) characterized in that the sharing, egg produced by the production method, and egg yolk powder prepared by freeze drying the egg yolk separated from the egg, special immune protein It is related with the ice cream and yoghurt containing (IgY).

Hereinafter, the configuration of the present invention will be described in more detail based on embodiments and drawings or diagrams. However, the scope of the present invention is not limited to the claims of the present invention by the embodiments or the drawings.

Example 1

1.Isolation Identification and Antigen Production of Enteropathogenic E. coli

A) Isolation and Identification of Enterotoxigenic Escherichia coli (ETEC) in Humans

E. coli used in this test was isolated from humans. In other words, Escherichia coli ( Enterotoxigenic E. coli ) used as an antigen was isolated from feces of children with diarrhea symptoms. The isolation of bacteria was carried out in the following manner. After diarrhea in children was plated in blood agar medium, one colony colony showing α-hemolysis was selected by incubating for 18 hours at 37 ℃ thermostat. The selected colonies grew into pink colonies on MacConkey agar, and confirmed the specific colony characteristics of E. coli growing on metallic green by smearing on EMB medium (EMB agar).

B) Toxin Production Capacity Verification

The production of enterotoxin, a major cause of enterotoxigenicity of E. coli, was confirmed using a polymerase chain reaction (hereinafter, referred to as PCR) technique. Amplification was performed using a multiplex PCR technique using a specific primer for the STa1 gene of heat stable toxin (hereinafter referred to as ST) and LTh gene of heat labile toxin (hereinafter referred to as LT).

The ST toxin prototype

sense primer; CCCCTCTTTTAGTCAGTC

anti-sense primer; CCAGCACAGGCAGGATTACA

What was constructed to amplify the final product of 165 bps was used.

The prototype for LT toxin identification is

sense primer; CAGACTATCAGTCAGAGGTTG

anti-sense primer; TTCATACTGATTGCCGCA

What was constructed to amplify the final product of 417bps was used.

PCR conditions include pre-denaturation temperature at 95 ° C. for 5 minutes, denaturation temperature at 94 ° C. for 1 minute, annealing temperature at 56 ° C. for 1 minute, Elongation temperature was carried out for 1 minute under 72 ° C, and post-elongation temperature for 10 minutes under 72 ° C. The amplified product was confirmed by electrophoresis using 2% agar gel (agarose gel). The isolated strain used in the present invention was confirmed to produce ST toxin. This E. coli was named EB-E01.

C) Production of Escherichia coli ETEC ( Enterotoxigenic E. coli ) antigens

E. coli ETEC strains were inoculated with Trypticase soy agr and then colonized with 5 ml of Trypticase soy broth after 18 hours of incubation at 37 ° C. incubator. After 2 hours, inoculated in a large amount of tryticase soy broth, and then cultured for 48 hours at 37 ° C. The cultured cells were mixed with formaldehyde (formaldehyde) to 5% of the total amount and inactivated at room temperature for 24 hours. The inactivated bacteria solution was harvested by centrifugation at 4,000 rpm for 20 minutes and washed three times with sterile phosphate buffered saline (PBS) (pH 7.2). The harvested cells were used after floating in PBS so that O.D. (Oculus Dexter) was 1.2-1.3 at 410 nm.

2. Preparation of Helicobacter pylori Antigen

A) Helicobacter pylori

Helicobacter pylori was used by the American Type Culture Collection (ATCC 43504). Experimental strains trip tea case Soy medium (Trypticase soy agar: BBL) sheep serum (sheep serum) for 3-5 days, and passaged every plate in medium containing 10%, 37 ℃, CO ₂ concentration of 10% CO in the environment Incubated in ₂ incubators. The assay strain was carried out through microscopic observation and urease activity test.

B) Measurement of urease activity

Urease activity was measured using a urease test broth containing urea and phenol red. Urea broth and the culture or sample were mixed at a ratio of 4: 1 and reacted for 30 minutes, and then absorbance was measured at 540 nm to determine urease activity.

C) bacterial morphology

Visually observe the morphological changes of the cultured cultures for 3 and 5 days, smear the colonies on slide glass, gram stain, and then morph the bacteria into a gram-negative spiral with an optical microscope (× 1,000). It was observed whether it was in the form or transformed into a coccoid form.

D) Helicobacter pylori antigen production

The cultured Helicobacter pylori strain was recovered by a cell collector, suspended in physiological saline, heat-treated in a 60 ° C antigen bath for 30 minutes, inactivated antigen, and centrifuged at 10,000 × g for 15 minutes. The cells were recovered and centrifuged in physiological saline to the recovered cells three times to remove the media components in the cells. The number of cells of the inactivated cell stock solution was measured by a hematocytometer.

3. Production of Salmonella enteritidis and Salmonella typhimurium antigen

Salmonella entera ET display (Salmonella enteritidis) and Salmonella typhimurium (Salmonella typhimurium), each trip tea case soy agar and then inoculated in (Trypticase soy agr), and cultured at 37 ℃ thermostat 18 hours. One colony was incubated in a large amount of Tryptic soy broth and incubated at 37 ° C. for 48 hours. The cultured bacterial solution was mixed with formaldehyde (0.2% of the total amount) and inactivated at room temperature for 24 hours. The inactivated bacteria solution was recovered by centrifugation at 4,000 rpm for 20 minutes and washed three times with sterile physiological saline (pH 7.2). The recovered cells were stored at -70 ℃.

4. Inoculate the four complex antigens into the central chicks and boost the laying hens.

A) The number of cells inoculated into 12-week-old chicks was 10 ⁸ / ml, and the E. coli antigen: Salmonella enteritidis antigen: Salmonella typhimurium antigen: Helicobacter pylori antigen and emulsifier was 1.5: 1: 1: 3.5: 3. Specifically, 4.0 × 10 ⁸ / ㎖ coli antigen 0.15㎖ four bacterial solution and 4.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth antigen 0.10㎖ and 4.0 × 10 ⁸ / ㎖ Salmonella typhimurium strain used as inoculum antigen 0.10㎖ 0.35 ml of 4.0 × 10 ⁸ / ml Helicobacter pylori antigen was emulsified with 0.3 ml of aluminum hydroxide, and then inoculated once, and from the second time, the supplement used for boosting was inoculated using a known ISA25. Inoculate the emulsion twice in 2 weeks intervals, 1 ml into the central leg, including the first inoculation, and then inoculate 0.5 ml twice into the legs of the 28-week-old laying hens at the same rate every 3 months. It was. The four antigens were inoculated together a total of five times.

B) The average anti-Salmonella enteridis IgY titer and anti-Helicobacter pylori IgY mean titer in the case of using ISA25 emulsifier as shown in FIGS. 3 and 4 were significantly higher in the two or more mixed antigen treatment groups than the control alone. The anti-Helicobacter pylori IgY mean titers and anti-Salmonella enteridis IgY titers were high.

C) The number of cells inoculated into 12-week-old chicks was 10 ⁸ / ml, and the E. coli antigen: Salmonella enteritidis antigen: Salmonella typhimurium antigen: Helicobacter pylori antigen: Emulsion aid ratio was 1.5: 1: 1: 3.5: 3. Specifically, 4.0 × 10 ⁸ / ㎖ coli antigen 0.15㎖ four bacterial solution and 4.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth antigen 0.10㎖ and 4.0 × 10 ⁸ / ㎖ Salmonella typhimurium antigen 0.10㎖ four bacterial solution and 4.0 × 10 ⁸ / ㎖ H. Lee fatigue 0.35㎖ antigen and Freund's complete emulsions (complete Freund's adjuvant) the adjuvants known Freund incomplete emulsifier (adjuvant used in the immunization was boosted once after emulsifying the 0.3㎖, since at 2 times inoculated using incomplete Freund's), and the mixed bacterial emulsion was inoculated three times, including the first inoculation, at 2 weeks intervals, in 1 ml each of the central chicks, and then at the same rate every three months in a 28-week-old laying hen. 0.5 ml each was inoculated twice in the leg. The four antigens were inoculated together a total of five times. As a result, one egg produced from the laying hens inoculated with the mixed bacteria emulsion had anti-E. Coli special immunoprotein (IgY), anti-Salmonella enteritidis special immune protein (IgY), and anti-Salmonella typhimurium special immune protein ( IgY) and anti-helicobacter pylori special immune protein (IgY) were produced at the same time.

5. Inoculate the mixed three antigens into chicks and boost the laying hens

The ratio of antigen and emulsion adjuvant inoculated to 12-week-old chick was E. coli antigen: Salmonella enteritidis antigen: Salmonella typhimurium antigen: Emulsion adjuvant ratio was 3.5: 1.8: 1.7: 3, 4.0 × 10 ⁸ / ml E. coli Emulsion 10.3 ml of E. coli bacteria and 4.0 × 10 ⁸ / ml Salmonella enteridis 4 bacteria and 0.17 ml of 4.0 × 10 ⁸ / ml Salmonella typhimurium bacteriophage antigen emulsified with 0.3 ml of aluminum hydroxide 1 1 ml inoculated once, and 2 times from each time, inoculated twice with 1 ml of the mixed bacterial emulsion mixed with the same ratio of the mixed bacterial emulsion using the emulsification aid (ISA25) at the same rate, and then in the same proportion to the growing laying hens, 2.0 × 10 ⁸ / ㎖ coli antigen 0.35㎖ four bacterial solution and 2.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth antigen 0.18㎖ and 2.0 × 10 ⁸ / ㎖ Salmonella typhimurium antigen 0.17㎖ four bacterial solution and emulsifying auxiliary liquid (ISA25) Manufactured to 0.3ml 3 the mixed bacteria emulsion eda bridge month including the 2 doses each 0.5㎖ were inoculated with a total of 5 times. One egg produced produced eggs that simultaneously shared anti-E. Coli special immune protein (IgY), anti-Salmonella enteritidis special immune protein (IgY), and anti-Salmonella typhimurium special immune protein (IgY).

In another embodiment, 1 ml of a certain proportion of a mixed bacterial emulsion obtained by emulsifying E. coli antigen, Salmonella enteritidis and Salmonella typhimurium antigen in an chick is adjuvant complete freund's, on one leg of the chick. From the second time, the mixed bacterial emulsion using Freund's incomplete Freund's was inoculated twice at 1 ml at 2 weeks intervals at the same rate as the mixed bacterial emulsion, and then at the monthly spacing of the growing laying hens. The mixed bacterial emulsion was inoculated five times, including two inoculations of 0.5 ml every three months at the same rate. A special immunoprotein (IgY) that simultaneously shares anti-E. Coli special immune protein (IgY), anti-Salmonella enteritidis special immune protein (IgY) and anti-Salmonella typhimurium special immune protein (IgY) in one egg ) Eggs were produced. Specifically, when the number of cells inoculated into chicks is E. coli antigen: Salmonella enteritidis antigen: Salmonella typhimurium antigen: adjuvant complete Freund's ratio of 3.5: 1.8: 1.7: 3 and, 4.0 × 10 ⁸ / ㎖ coli antigen 0.35㎖ four bacterial solution and 4.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth antigen 0.18㎖ and 4.0 × 10 ⁸ / ㎖ Salmonella typhimurium bacterial solution used for antigen 0.17㎖ Freund's complete 1 ml of the mixed bacterial emulsion emulsified with 0.3 ml of adjuvant complete Freund's was inoculated once, and the mixed bacterial emulsion using adjuvant incomplete Freund's as an emulsifier was the same ratio as the mixed bacterial emulsion. after 2 doses by 1㎖ as, 2.0 × 10 ⁸ / at the same rate eda grown hens ㎖ coli antigen 0.35㎖ four bacterial solution and 2.0 × 10 ⁸ / ㎖ Salmonella antigen 0.18㎖ four bacterial solution and 2.0 × 10 ⁸ / ㎖ live Monel A mixed bacterial emulsion prepared with 0.17 ml of Lactobacillus bacterium antigen and 0.3 ml of Freund's incomplete Freund's was inoculated five times, including 0.5 ml twice every three months on the leg. A special immune protein (IgY) that simultaneously shares anti-E. Coli special immune protein (IgY), anti-Salmonella enteritidis special immune protein (IgY) and anti-Salmonella typhimurium special immune protein (IgY) in one egg ) Eggs were produced.

Another composition of the present invention is to simultaneously share the anti-E. Coli special immune protein (IgY), anti-Salmonella enteritidis special immune protein (IgY) and anti-Salmonella typhimurium special immune protein (IgY) produced by the above method One egg and 20 g of egg yolk from which a yolk film was removed from a predetermined container was added to the egg produced by the above method, and 20 ml of the same amount of alkaline ionized water (pH 10) was added thereto and stirred, followed by stirring at low temperature (5 to 10 ° C.) for 24 hours. After standing, egg yolk: 18 times the amount of alkaline water (1: 1) (720 ml) of alkaline water is mixed and allowed to stand for 48 hours to extract the water-soluble protein, and the supernatant is ultra-filtered in an ultra-filtering system. Hollow fiber) The present invention relates to a method for producing an anti-mixed bacteria water-soluble special immune protein, characterized in that it is concentrated and lyophilized by membrane separation, and a special immune protein containing an anti-mixed bacterium IgY.

6. Egg yolk separation, yolk powder extraction, immunoprotein isolation and titer measurement

A) Separation of egg yolk

Eggs produced by the above method are broken, and the rest of the eggs, except for egg yolk, are separated, and fresh egg yolk is separated into a flask or bottle.

B) egg yolk powder

After centrifugation of the separated fresh egg yolk is lyophilized to extract the yolk powder.

C) Immunoprotein Isolation and Titer Measurement

Isolation and measurement of immunoproteins used in test assays were by known methods.

35 g of the yolk removed from the membrane was placed in a 250 ml bottle, and 35 ml of alkaline ionized water was added thereto, followed by stirring. After standing at low temperature (5-10 ° C.) for 24 hours, egg yolk: mixed with 18 times the amount of alkaline ionized water (1: 1) and alkaline ionized water (1260 ml), left for 48 hours, extracted, and the supernatant was ultra-filtered. (Ultra filteration) concentrated in a hollow fiber membrane separation method (Hollow fiber) was concentrated by lyophilization.

The content of special IgY in the water-soluble protein obtained by the filtration was measured as follows.

In addition, the measurement of the content of special IgY was also performed by the sandwich ELISA method. Helicobacter pylori was diluted with buffer so that the OD value was 0.05 at 660 nm. The diluted cells were coated on a microplate and left overnight. After washing the microplate, the filtered water-soluble protein is added, reacted, and washed, and rabbit anti-cheek IgG Ab-HRP diluted to 1 / 10,000 is added. TMB was used as a substrate of HRP, and absorbance was measured at 450 nm using 2N-H ₂ SO ₄ as a reaction stopper. This result is illustrated in FIGS. 3 and 4.

7. Preparation of Yogurt Containing Four Antibodies

A) Extraction of water-soluble special immune protein

Water-soluble special immunoprotein extraction was carried out in the following manner.

35 g of the yolk removed from the membrane was placed in a 250 ml bottle, and 35 ml of alkaline ionized water was added thereto, followed by stirring. After standing at low temperature (5-10 ° C.) for 24 hours, egg yolk: mixed with 18 times the amount of alkaline ionized water (1: 1) and alkaline ionized water (1260 ml), left for 48 hours, extracted, and the supernatant was ultra-filtered. (Ultra filteration) concentrated in a hollow fiber membrane separation method (Hollow fiber) was concentrated by lyophilization.

B) Yogurt containing fresh egg yolk

As in the previous chapter, egg yolks were isolated from eggs produced after inoculation with a Helicobacter pylori antigen, an E. coli antigen, a Salmonella enteritidis antigen, and a Salmonella typhimurium antigen mixed antigen (Tables 3 and 4). In the yogurt manufacturing process, the sterilization problem is very serious, but the process of sterilizing pathogens is not suitable because it is processed for 1 minute at 65 ° C. The present invention has developed a technique that can be used in yogurt without sterilization by allowing Salmonella IgY to be contained in egg yolk itself.

C) Manufacture of yogurt and ice cream containing extracted water-soluble special immunoprotein

As described above, after inoculation of the complex antigen mixed with the E. coli antigen, the Salmonella enteritidis antigen, the Salmonella typhimurium antigen, and the Helicobacter pylori antigen, egg yolk was isolated from the produced egg, and the extracted water-soluble protein (crude IgY) powder was extracted. Addition, the preparation ratio of the ice cream and yogurt is as shown in Table 1, 2, 3, 4 below.

Example of the ratio of ice cream containing four anti-mixed bacteria special immune proteins Raw material Compounding ratio A Compounding ratio B Compounding ratio C Buttermilk Whey Powder Whole Milk Powder Skim Milk Powder Sugar Syrup (70% Brix) Lysozyme Stabilizer Anti-Mixed Bacillus Powder * Egg Yolk Powder (or Coating) Anti-Mixed Bacteria * IgY Extract Powder Anti-Mixed Bacteria 5.0% 36.0-15.6-5.014.50.50.65.0--Equivalent17.8 5.0% 23.0-14.6-5.013.50.50.6--15.0Equivalent17.8 8.0% 40.03.011.04.05.514.50.50.6-0.6-appropriate 12.3 * Mixed bacteria are egg yolk produced after four inoculations

Example of the ratio of ice cream containing four anti-mixed bacteria special immune proteins Raw material Compounding ratio A Compounding ratio B Compounding ratio C Cream (milk fat 35%) skim condensed milk (solid content 30%) skim milk (solid content 8%) skim milk sugar (80% brix) liquid sugar (67% brix) lysozyme stabilizer anti-mixing bacteria * yolk powder (or coating) anti-mixing Bacillus * Yolk IgY Extract Powder Anti-mixed Bacteria * Yolk Flavor 34.3% 25.010.02.05.014.50.50.65.0--Quality 3.1 34.3% 10.010.02.05.014.50.50.6--15.0 Equivalent 3.1 34.0% 25.011.04.05.514.50.50.6-0.6-appropriate 4.3 * Mixed bacteria are egg yolk produced after four inoculations

Example of the ratio of yogurt containing four anti-mixed bacteria special immune protein Raw material Compounding ratio A Compounding ratio B Compounding ratio C Skim Milk Milk White Sugar Anti-mixed Bacteria * Yolk Powder (or Coating) Anti-mixed Bacteria * Egg Yolk IgY Extract Powder Anti-Mixed Bacteria 0.4096.100.602.50--0.40 0.4093.600.60--5.000.40 3.0595.940.34-0.42-0.25 * Mixed bacteria are egg yolk produced after four inoculations

Example of the ratio of yogurt containing four anti-mixed bacteria special immune protein Raw material Compounding ratio A Compounding ratio B Compounding ratio C Skim milk milk pulp syrup anti-mixed bacteria * egg yolk powder (or coating) anti-mixed bacteria * egg yolk IgY extraction powder anti-mixed bacteria * egg yolk stabilizer 4.4078.1014.102.50--0.400.50 4.4080.609.10--5.000.400.50 8.0575.7715.01-0.42-0.250.50 * Mixed bacteria are egg yolk produced after four inoculations

8. Preparation of yogurt containing three antibodies (E. coli, Salmonella enteritidis, Salmonella typhimurium)

A) Extraction of water-soluble special immune protein

Water-soluble protein extraction was carried out in the following manner.

35 g of the yolk removed from the membrane was placed in a 250 ml bottle, and 35 ml of alkaline ionized water was added thereto, followed by stirring. After standing at low temperature (5-10 ° C.) for 24 hours, egg yolk: mixed with 18 times the amount of alkaline ionized water (1: 1) and alkaline ionized water (1260 ml), left for 48 hours, extracted, and the supernatant was ultra-filtered. (Ultra filteration) concentrated in a hollow fiber membrane separation method (Hollow fiber) was concentrated by lyophilization.

B) Preparation of yogurt containing fresh egg yolk

As described above, after inoculation with a mixed antigen mixed with an E. coli antigen, a Salmonella enteritidis antigen, and a Salmonella typhimurium antigen, egg yolk was separated from the produced eggs and used in yogurt (Table 7, 8). In the yogurt manufacturing process, the sterilization problem is very serious, but the process of sterilizing pathogens is not suitable because it is processed for 1 minute at 65 ° C. The present invention has developed a technique that can be used in yogurt without sterilization by allowing Salmonella IgY to be contained in egg yolk itself.

C) Preparation of yogurt and ice cream containing extracted water-soluble special immune protein

As shown in the preceding section, after inoculation with the complex antigen mixed with the E. coli antigen, Salmonella enteritidis antigen and Salmonella typhimurium antigen, egg yolk was separated from the produced eggs, and the extracted water-soluble protein (crude IgY) powder was added. Preparation ratio of the ice cream and yogurt is as shown in Table 5, 6, 7, 8.

Example of the ratio of ice cream containing three anti-mixed bacteria special immune protein Raw material Compounding ratio A Compounding ratio B Compounding ratio C Buttermilk Whey Powder Whole Milk Powder Skim Milk Powder Sugar Syrup (70% Brix) Lysozyme Stabilizer Anti-Mixed Bacillus Powder * Egg Yolk Powder (or Coating) Anti-Mixed Bacteria * IgY Extract Powder Anti-Mixed Bacteria 5.0% 36.0-15.6-5.014.50.50.65.0--Equivalent17.8 5.0% 23.0-14.6-5.013.50.50.6--15.0Equivalent17.8 8.0% 40.03.011.04.05.514.50.50.6-0.6-appropriate 12.3 * Mixed bacteria are egg yolk produced after three inoculations

Example of the ratio of ice cream containing three anti-mixed bacteria special immune protein Raw material Compounding ratio A Compounding ratio B Compounding ratio C Cream (milk fat 35%) skim condensed milk (solid content 30%) skim milk (solid content 8%) skim milk sugar (80% brix) liquid sugar (67% brix) lysozyme stabilizer anti-mixing bacteria * yolk powder (or coating) anti-mixing Bacillus * Yolk IgY Extract Powder Anti-mixed Bacteria * Yolk Flavor 34.3% 25.010.02.05.014.50.50.65.0--Quality 3.1 34.3% 10.010.02.05.014.50.50.6--15.0 Equivalent 3.1 34.0% 25.011.04.05.514.50.50.6-0.6-appropriate 4.3 * Mixed bacteria are egg yolk produced after three inoculations

Example of the ratio of yogurt containing three anti-mixed bacteria special immune protein Raw material Compounding ratio A Compounding ratio B Compounding ratio C Skim Milk Milk White Sugar Anti-mixed Bacteria * Yolk Powder (or Coating) Anti-mixed Bacteria * Egg Yolk IgY Extract Powder Anti-Mixed Bacteria 0.4096.100.602.50--0.40 0.4093.600.60--5.000.40 3.0595.940.34-0.42-0.25 * Mixed bacteria are egg yolk produced after three inoculations

Example of the ratio of yogurt containing three anti-mixed bacteria special immune protein Raw material Compounding ratio A Compounding ratio B Compounding ratio C Skim milk milk pulp syrup anti-mixed bacteria * egg yolk powder (or coating) anti-mixed bacteria * egg yolk IgY extraction powder anti-mixed bacteria * egg yolk stabilizer 4.4078.1014.102.50--0.400.50 4.4080.609.10--5.000.400.50 8.0575.7715.01-0.42-0.250.50 * Mixed bacteria are egg yolk produced after three inoculations

Example 2

Example 2 relates to yogurt and ice cream using special immune proteins extracted from eggs produced by the antibody mixing and the production method after producing the four antibodies independently.

1.Isolation Identification and Antigen Production of Enteropathogenic E. coli

E. coli used in the present invention was isolated from humans.

Isolation, identification and antigen production of E. coli are the same as shown in Example 1.

2. Preparation of Helicobacter pylori Antigen

Antigen preparation of Helicobacter pylori is also the same as that shown in Example 1.

3. Preparation of Salmonella enteritidis and Salmonella typhimurium antigen

Salmonella enteritidis and Salmonella typhimurium antigen preparations are also as shown in Example 1.

4. Inoculate four antigens independently and boost the laying hens

A) The number of cells inoculated into 12-week-old chicks was 10 ⁸ / ml, and the ratio of E. coli antigen to emulsifier was 1: 1, and the ratio of Salmonella enteritidis antigen to emulsifier was 1: 1. The ratio of mulium antigen: emulsification aid is 1: 1 and the ratio of Helicobacter pylori antigen: emulsification aid is 1: 1, emulsifying 0.5 ml of 2.0 × 10 ⁸ / ml E. coli bacteriophil antigen and 0.5 ml of aluminum hydroxide. Separately emulsify 0.5 ml of Salmonella enteritidis bacteria solution antigen and 0.5 ml of aluminum hydroxide, emulsify Salmonella typhimurium bacteria solution antigen and 0.5 ml of aluminum hydroxide, and separately 0.5 ml of Helicobacter pylori antigen and 0.5 ml of aluminum hydroxide. after emulsification the cells may each independently 10 ⁸ / ㎖ the inoculation once the 1㎖ the emulsion together eda other chicks one leg comprises, and after two ju with emulsifying adjuvant (ISA25) After the byeolgyun emulsifying the individual bacteria one by one at the same rate as the emulsifier 1㎖ every two weeks 2 doses, with one month intervals eda grown hens 2.0 × 10 ⁸ / ㎖ coli antigen 0.5㎖ four bacterial solution and emulsion adjuvant (ISA25) 0.5 Emulsify the mL, and separately emulsify 2.0 ml of 2.0 × 10 ⁸ / ml Salmonella enteridis bacterium antigen and 0.5 ml of emulsifying aid (ISA25), and separately separate 0.5 ml of 2.0 × 10 ⁸ / ml Salmonella typhimurium antigen and emulsifying aid. (ISA25) emulsified 0.5 ml, separately emulsified 2.0 × 10 ⁸ / ml Helicobacter pylori antigen 0.5 ml and 0.5 ml emulsification adjuvant (ISA25) separately, and the prepared emulsion was added to each leg of each chick 1 ml Inoculated twice, 1 ml each was inoculated three times, including inoculation once every two weeks using an emulsifying aid (ISA25). In a 28-week-old laying hen, 0.5 ml of 2.0 × 10 ⁸ / ml E. coli bacterium antigen and 0.5 ml of Emulsification aid (ISA25) were emulsified at 3 month intervals, and 0.5 ml of 2.0 × 10 ⁸ / ml Salmonella enteritidis antigen 0.5 ml of emulsification adjuvant (ISA 25) is emulsified and 0.5 ml of 2.0 × 10 ⁸ / ml Salmonella typhimurium antigen and 0.5 ml of emulsification adjuvant (ISA 25) are emulsified separately and 2.0 × 10 ⁸ / ml Helicobacter pylori antigen 0.5 ml and 0.5 ml of the emulsifying aid (ISA 25) were inoculated twice with 0.5 ml of each emulsion into the legs. The four (E. coli and Salmonella enteritidis and Salmonella typhimurium and Helicobacter pylori) antigens were inoculated five times in total without mixing.

B) The number of cells inoculated into 12-week-old chicks was 10 ⁸ / ml, and the ratio of E. coli antigen to emulsifier was 1: 1, and the ratio of Salmonella enteritidis antigen to emulsifier was 1: 1. The ratio of Salmonella typhimurium antigen and emulsifying adjuvant is 1: 1, and the ratio of Helicobacter pylori antigen: emulsification adjuvant is 1: 1, followed by 0.5 ml of 2.0 × 10 ⁸ / mL E. coli antigen and Freund's complete Emulsify 0.5 ml of adjuvant complete Freund's, and emulsify separately 2.0 × 10 ⁸ / ml of Salmonella enteridis tetrasaccharide antigen and 0.5ml of adjuvant complete Freund's, and separately 2.0 × 10 ⁸ / ml. 0.5 ml of Salmonella typhimurium antigen and 0.5 ml of adjuvant complete Freund's were emulsified and separately 0.5 ml of 2.0 × 10 ⁸ / ml Helicobacter pylori antigen and 0.5 ml of adjuvant complete Freund's. Individually After incubation, 1 ml of the individual bacterial emulsion containing 10 ⁸ / ml of the individual cells was inoculated once into one leg of different chicks, and from the second week, the individual bacterial emulsifier using adjuvant incomplete Freund's. Was inoculated twice at 1 week intervals of 1 ml each at the same rate as the individual bacterial emulsion, and 0.5 ml of the antigen of 2.0 × 10 ⁸ / ml E. coli bacteria and adjuvant incomplete Freund's were added to the growing laying hens every three months. ) Emulsify 0.5 ml, emulsify 2.0 ml of 2.0 × 10 ⁸ / ml Salmonella enteridis bacterium antigen and 0.5 ml of Freund's incomplete Freund's, and 2.0 × 10 ⁸ / ml Salmonella typhimurium antigen 0.5 Ml and 0.5 ml of adjuvant incomplete Freund's were emulsified, 0.5 ml of 2.0 × 10 ⁸ / ml Helicobacter pylori antigen and 0.5 ml of adjuvant incomplete Freund's. After emulsification, the prepared emulsion was inoculated five times in total, including two inoculations of 0.5 ml in one leg. As a result, the eggs produced from the laying hens inoculated with the individual bacterial emulsions had anti-E. Coli special immunoprotein (IgY), anti-Helicobacter pylori special immune protein (IgY), anti-Salmonella enteritidis special immune protein (IgY) or Eggs containing independently Salmonella typhimurium special immune protein (IgY) were produced.

5. Egg yolk separation, egg yolk powder extraction, immunoprotein isolation and titer measurement

Isolation, yolk powder extraction, and separation and measurement of the immunoprotein used in the test analysis is the same as in Example 1.

6. Preparation of Yogurt and Ice Cream Containing Mixed Immune Protein

As described above, Helicobacter pylori (Helicobacter pylori)Antigens and E. Coli Water-soluble special immunoprotein (crude IgY) powder extracted from eggs produced after inoculation of the antigen, Salmonella enteritidis antigen and Salmonella typhimurium antigen, fresh egg yolk or dried egg yolk were 1: 1: 1: 1, 2: 1: 1: 1, 3: 1: 1: 1, 4: 1: 1: 1, 5: 1: 1: 1 (Helicobacter pylori: Escherichia coli: Salmonella enteritidis: Salmonella typhimurium) as a mixed food additive The preparation ratio of the ice cream and yogurt is as shown in Table 9, 10, 11, 12 below.

Ice Cream Formulation Example Raw material Compounding ratio A Compounding ratio B Compounding ratio C Buttermilk Whey Powder Whole Milk Powder Skim Milk White Sugar Syrup (70% Brix) Stabilizer Anti-Mixed Bacillus * Yolk Powder (or Coating) Anti-Mixed Bacillus * Egg Yolk Extract Powder Anti-Mixed Bacillus 5.0% 36.0-15.6-5.014.50.65.5--Quality 17.8 5.0% 31.0-14.6-5.013.50.6--12.5Equivalent17.8 8.0% 40.03.011.04.05.514.50.6-1.1-appropriate 12.3 * Mixed bacteria is a mixture of four separately produced egg yolks after drying (or fresh egg yolk)

Ice Cream Formulation Example Raw material Compounding ratio A Compounding ratio B Compounding ratio C Cream (milk fat 35%) skim condensed milk (solid content 30%) skim milk (solid content 8%) skim milk fertilizer (80% brix) liquid sugar (67% brix) stabilizer anti-mixed bacteria * yolk powder (coating) anti-mixed bacteria * Egg yolk IgY extract powder-mixed bacteria * yolk flavoring 34.3% 25.510.02.05.014.50.65.0--Quality 3.1 34.3% 20.510.02.05.014.50.6--10.0 Equivalent 3.1 34.0% 25.011.04.05.514.50.6-0.6-appropriate 4.8 * Mixed bacteria is a mixture of four separately produced egg yolks after drying (or fresh egg yolk)

Formulation example of yogurt Raw material Compounding ratio A Compounding ratio B Compounding ratio C Anti skimmed milk milk sugar-Anti-mixed bacteria * Egg yolk powder (coating) Anti-mixed bacteria * Egg yolk IgY extract powder Anti-mixed bacteria * Egg yolk stabilizer 0.4095.500.602.55--0.400.55 0.4093.050.60--5.000.400.55 3.0595.620.10-0.43-0.250.55 * Mixed bacteria is a mixture of four separately produced egg yolks after drying (or fresh egg yolk)

Formulation example of yogurt Raw material Compounding ratio A Compounding ratio B Compounding ratio C Skim milk milk pulp syrup anti-mixed bacteria * yolk powder (coating) anti-mixed bacteria * egg yolk IgY extract powder anti-mixed bacteria * egg yolk stabilizer 4.4078.0514.102.55--0.400.50 4.4080.609.10--5.00.400.50 8.1075.6315.01-0.51-0.250.50 * Mixed bacteria is a mixture of four separately produced egg yolks after drying (or fresh egg yolk)

The present invention is not limited to the technical spirit described in the specific embodiments, diagrams or drawings described above, and those skilled in the art without departing from the gist of the invention claimed in the claims. As long as anyone can carry out various modifications, such changes are within the scope of the claims.

Four anti-mix bacteria or three anti-mix bacteria special immune protein shares produced by the present invention (anti-E. Coli IgY, anti-Helicobacter pylori IgY, anti-Salmonella enteritidis IgY and anti-Salmonella typhimurium IgY / or Anti-E. Coli IgY, anti-Salmonella enteritidis IgY and anti-Salmonella typhimurium IgY) or eggs or dairy products are excellent for gastrointestinal protection and have very high recurrence rates of gastroenteritis and duodenitis, even once treated with antibiotics It is effective in preventing the special immune protein produced in eggs.

In particular, because of the pathogenic microorganisms infected in the yolk separating plant, even though the yogurt is sterilized, the pathogenic microorganisms cannot be controlled and the life of the product is shortened. When using Salmonella IgY-containing eggs produced in the present invention can minimize the sterilization and can prevent secondary contamination in Salmonella. In addition, even if some contamination, the anti-salmonella IgY according to the present invention after ingestion can alleviate the food poisoning problem.

In addition, by producing and selling yolks or ice cream using egg yolk or egg yolk powder extracted from eggs produced by the production method according to the present invention, or a water-soluble special immune protein, the general consumer easily anti-E. Coli special immune protein (IgY) In addition, there is an effect that can be consumed functional foods containing both anti-Salmonella special immunoprotein (IgY) and anti-Helicobacter pylori special immune protein (IgY) at the same time.

Claims (37)

1 ml of the mixed bacterial emulsion, in which E. coli antigen, Salmonella enteritidis antigen, Salmonella typhimurium antigen, and Helicobacter pylori antigen, was emulsified in a certain ratio with aluminum hydroxide, was inoculated once on one leg of the central chick. After inoculating the mixed bacterial emulsion using the emulsifying aid (ISA25) twice at 1 ml at 1 week intervals, In the method of inoculating a total of five times, including two inoculations of the mixed bacterial emulsion using the emulsification aid (ISA25) at the same rate as that of the mixed bacterial emulsion at three-month intervals again in the growing laying hens. One egg produced has anti-mixed bacteria special immune protein, characterized by simultaneously sharing the special immune protein of anti-E. Coli, anti-Salmonella enteritidis, anti-Salmonella typhimurium and anti-Helicobacter pylori Egg production method. The method of claim 1, The number of cells inoculated into the above-mentioned central chicks is E. coli antigen: Salmonella enteritidis antigen: Salmonella typhimurium antigen: Helicobacter pylori antigen: Emulsion adjuvant ratio is 1.5: 1: 1: 3.5: 3. 4.0 × 10 ⁸ / ㎖ four bacterial solution of Escherichia coli antigen 0.15㎖ and 4.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth antigen 0.10㎖ and 4.0 × 10 ⁸ / ㎖ Salmonella typhimurium antigen 0.10㎖ four bacterial solution and 4.0 × 10 ⁸ 1 ml of 1 ml of mixed bacteria emulsion in which 0.35 ml of Helicobacter pylori bacteria antigen was emulsified with 0.3 ml of aluminum hydroxide, From the second time, inoculated twice in 1ml each of the mixed bacteria emulsions using the same amount of the mixed bacteria emulsions using the emulsification aids (ISA25) at the same rate every week, At the same rate the eda growing laying hens, 2.0 × 10 ⁸ / ㎖ coli antigen 0.15㎖ four bacterial solution and 2.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth antigen 0.10㎖ and 2.0 × 10 ⁸ / ㎖ Salmonella typhimurium four bacterial solution antigen A total of 5 inoculations were carried out, including two 0.5 ml doses of three doses of the mixed bacterial emulsion prepared in 0.15 ml and 2.0 × 10 ⁸ / ml of Helicobacter pylori bacterium antigen and 0.3 ml of an emulsifier (ISA25). In a way, One egg produced has anti-mixed bacteria special immune protein, characterized by simultaneously sharing the special immune protein of anti-E. Coli, anti-Salmonella enteritidis, anti-Salmonella typhimurium and anti-Helicobacter pylori Egg production method. 1 ml of a certain percentage of the mixed bacterial emulsion emulsified E. coli antigen, Salmonella enteritidis antigen, Salmonella typhimurium antigen and Helicobacter pylori antigen to Adjuvant complete Freund's in the central chick 1 Inoculated times, From the second time, after inoculating the mixed bacteria emulsion using the adjuvant incomplete Freund's twice at intervals of 1 ml each at the same ratio as the mixed bacteria emulsion, In the method of inoculating a total of five times, including two inoculations of 0.5 ml each of the mixed bacteria emulsion in the same proportion to the growing laying hens, every three months, One egg produced has anti-mixed bacteria special immune protein, characterized by simultaneously sharing the special immune protein of anti-E. Coli, anti-Salmonella enteritidis, anti-Salmonella typhimurium and anti-Helicobacter pylori Egg production method. The method of claim 3, The number of cells inoculated into the central chicks E. coli antigen: Salmonella enteritidis antigen: Salmonella typhimurium antigen: Helicobacter pylori antigen: Adjuvant complete Freund's ratio of 1.5: 1: 1: 3.5: 3 So, 4.0 × 10 ⁸ / ㎖ coli antigen 0.15㎖ four bacterial solution and 4.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth antigen 0.1㎖ and 4.0 × 10 ⁸ / ㎖ Salmonella typhimurium antigen 0.1㎖ four bacterial solution and 4.0 × 10 ⁸ / Inoculate once with 1 ml of a mixed bacterial emulsion emulsified with 0.35 ml of Helicobacter pylori bacterium antigen and 0.3 ml of adjuvant complete Freund's, From the second time, after inoculating the mixed bacterial emulsion using the Freund's incomplete Freund's as an emulsifier twice in 1 ml at the same ratio with the mixed bacterial emulsion, In the same proportion in grown hens 2.0 × 10 ⁸ / ㎖ coli antigen 0.15㎖ four bacterial solution and 2.0 × 10 ⁸ / ㎖ Salmonella entera Eighty four discharge broth antigen 0.1㎖ and 2.0 × 10 ⁸ / ㎖ Salmonella typhimurium four bacterial solution antigen 0.1㎖ and 2.0 × 10 ⁸ / ㎖ Helicobacter fatigue Lisa broth 0.35㎖ antigen and Freund's incomplete adjuvant (incomplete Freund's adjuvant) five times with a mixed fungal emulsions prepared with eda bridge 0.3㎖ 3 month including the 2 doses each 0.5㎖ How to inoculate, One egg produced has anti-mixed bacteria special immune protein, characterized by simultaneously sharing the special immune protein of anti-E. Coli, anti-Salmonella enteritidis, anti-Salmonella typhimurium and anti-Helicobacter pylori Egg production method. Eggs simultaneously sharing the anti-mixed bacteria special immune protein produced by the method of any one of claims 1 to 4. The egg produced by the method according to any one of claims 1 to 4 was placed in a predetermined container with 35 g of egg yolk in a 250 ml bottle, and then stirred by adding 35 ml of alkaline ionized water, and then low temperature (5 to 10 ° C.) for 24 hours. After leaving at After mixing 18 times (1260ml) or more alkaline water in the mixture of egg yolk and alkaline ionized water (1: 1), it is left for 48 hours to extract water-soluble special immune protein, and then the supernatant is ultra-filtered. Hollow fiber (Hollow fiber) A method for producing an anti-mixed bacteria special immune protein, characterized in that concentrated by lyophilization method. delete delete delete Egg yolk containing an anti-mixed bacteria special immune protein isolated from eggs produced by the method of any one of claims 1 to 4. Egg yolk powder having anti-mixed bacteria special immune protein freeze-dried yolk of claim 10. Ice cream containing egg yolk of Claim 10 or egg yolk powder of Claim 11. Yogurt containing the yolk of claim 10 or the yolk powder of claim 11. delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete