KR100381930B1 - Method and Primers for Detecting Genetically Modified Organism - Google Patents
Method and Primers for Detecting Genetically Modified Organism Download PDFInfo
- Publication number
- KR100381930B1 KR100381930B1 KR10-2000-0013464A KR20000013464A KR100381930B1 KR 100381930 B1 KR100381930 B1 KR 100381930B1 KR 20000013464 A KR20000013464 A KR 20000013464A KR 100381930 B1 KR100381930 B1 KR 100381930B1
- Authority
- KR
- South Korea
- Prior art keywords
- seq
- genetically modified
- gox
- primer
- gene
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2531/00—Reactions of nucleic acids characterised by
- C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
- C12Q2531/113—PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Abstract
본 발명은 유전자 변형 농산물(Genetically Modified Organism)의 검출 방법 및 검출용 프라이머에 관한 것으로, 더욱 구체적으로는 조작된 5-에놀피루빌시키메이트-3-포스페이트 합성효소 (5-enolpyrovylshikimate-3-phosphate synthase(EPSPS)) 또는 글리포세이트 산화환원효소 (glyphosate oxidoreductase) 유전자 및 프로모터를 특이적으로 검출할 수 있는 프라이머를 사용하여 중합효소연쇄반응을 수행하여 상기 조작 유전자 또는 프로모터를 검출하는 것을 특징으로 하는 유전자 변형 농산물 검출방법 및 검출용 프라이머에 관한 것이다. 본 발명의 방법 및 프라이머를 사용함으로써 빠른시간내에 효율적으로 유전자 변형 농산물이 검사될 수 있다.The present invention relates to a method for detecting genetically modified organisms (Genetically Modified Organism) and primers for detection, and more particularly to 5-enolpyrovylshikimate-3-phosphate synthase (EPSPS)) or a gene characterized in that the polymerase chain reaction is carried out using a primer capable of specifically detecting a glyphosate oxidoreductase gene and a promoter to detect the engineered gene or promoter. It relates to a modified agricultural product detection method and a detection primer. By using the methods and primers of the invention, genetically modified agricultural products can be tested efficiently and quickly.
Description
본 발명은 유전자 변형 농산물의 검출 방법 및 검출용 프라이머에 관한 것이다.The present invention relates to a method for detecting genetically modified agricultural products and a primer for detection.
유전자 변형 농산물(Genetically Modified Organism: GMO)이란 일반적으로 생산량 증대 또는 유통 가공상의 편의를 위하여 유전공학기술을 이용, 기존의 번식방법으로는 나타날 수 없는 형질이나 유전자를 지니도록 개발된 농산물을 말한다.Genetically Modified Organism (GMO) refers to agricultural products that are developed to have traits or genes that cannot be represented by conventional breeding methods by using genetic engineering techniques for increasing production or distribution processing convenience.
유전자 변형 식품(GM Food)의 원료가 되는 유전자 변형 농산물은 미국, 캐나다, 아르헨티나 등지에서 생산되고 있다. 유전자 변형 작물(GMO) 생산에 있어서 최대규모를 자랑하는 몬산토(Monsanto)라는 회사는 '라운드-업-레디'라는 제품을 개발하였는데, 몬산토사는 원래 농약을 만드는 미국의 화학기업으로서, 이 회사의 주력상품 중에는 '라운드-업'이라는 제초제가 있다. 몬산토사는 더욱 '라운드-업' 제초제를 아무리 뿌려도 끗떡없는 제초제 내성인 유전자 조작 콩 '라운드-업-레디'를 개발했다. 듀퐁, 다우케미컬, 노바티스 같은 화학 회사들도 동일한 목적으로 유전자 조작 농산물을 개발하고 있다.GM foods, which are the source of GM food, are produced in the United States, Canada, and Argentina. Monsanto, the largest producer of genetically modified crops (GMOs), developed a product called Round-Up-Ready. Monsanto was originally an American chemical company that makes pesticides. Among the products is the herbicide 'round-up'. Monsanto has developed 'round-up-ready' genetically engineered soybeans that are more resistant to herbicides, no matter how much they sprinkle 'round-up' herbicides. Chemical companies like DuPont, Dow Chemical and Novartis are also developing GM products for the same purpose.
몬산토사가 농가가 매년 종자를 구입하여야 하는 'Terminator'를 발매한 사실이나, Nature지에 monarch나비의 유충이 GM 옥수수의 꽃가루를 먹고 죽었다는 기사가 나오면서부터, EU나 일본 등지에서 일제히 GM Food 반대 운동이 확산되면서 일부 대중매체는 GM 식품을 'Frankenstein Food' 혹은 'Farmageddon'으로 부르며 혹평을 가하고 있다.Since Monsanto released a 'Terminator' that farmers must buy seeds every year, and the Nature magazine reported that the monarch butterfly larvae died eating pollen from GM corn, the movement against GM food in the EU and Japan all started simultaneously. As it spreads, some media have criticized GM foods as 'Frankenstein Food' or 'Farmageddon'.
GMO의 이해부족과 일부 소비자 단체의 과잉반발로 많은 식품 회사들이 GMO를 사용하지 않겠다는 움직임도 높아지고 있다. 그러나 대기업들은 표면적으로는 GMFood 불사용을 선언하면서도 GMO 개발에의 투자는 멈추지 않고 오히려 늘리고 있는 실정이다.The lack of understanding of GMOs and the overreaction of some consumer groups has led many food companies not to use them. However, while large companies have apparently declared that they are not using GMFood, their investment in GMO development is not stopping but increasing.
미국 옥수수재배업자협회(ACGA)는 비유전자변형 곡물을 재배하는 미국 농가들에 대해 재래 종자들이 유전자 변형된 종자들로 인해 혼합되어 가고 있다는 증거가 발견됨에 따라 재래 종자의 검사를 받도록 촉구했다. 유전자변형생물(GMO) 검사 분야의 선구자격인 '지네틱 ID'사도 ACGA와의 공동성명에서 20 종의 재래 씨옥수수를 검사해 본 결과 이중 유전자 변형된 종자가 무려 45%에 달했다고 밝히고 이는 주로 옥수수 경작지의 오염에서 비롯된 것이라고 지적했다.The American Corn Growers Association (ACGA) urged US farmers to grow non-genetically modified grains to be tested as they are found to be mixing due to genetically modified seeds. Genetic ID, a pioneer in the field of genetically modified organisms (GMO), also tested 20 species of native corn in a joint statement with the ACGA, revealing that 45 percent of the genetically modified seeds were found in corn cropland. He pointed to the pollution.
한편 국내 수요량의 91% 정도를 거의 전량 미국에서 수입하고 있는 가운데 수입콩의 GM콩 혼입률이 30%를 훨씬 넘는 것으로 추정된다. 콩뿐만 아니라 많은 곡물을 미국에서 수입하고 있는 우리나라도 GMO 표시문제는 커다란 문제가 아닐 수 없다. 농림부는 한국소비자보호원이 시판되는 두부의 82%에 GM콩이 섞여 있다고 발표, 소비자들의 불안감이 증폭되자 최근 GM 농산물 구분 표시제를 2001년 3월부터 시행하기로 확정한 바 있다.Meanwhile, almost 91% of domestic demand is imported from the US, and GM soybean mixing is estimated to exceed 30%. Not only soybeans, but also Korea, which imports a lot of grain from the United States, is a big problem. The Ministry of Agriculture and Forestry announced that 82% of tofu sold by the Korea Consumer Protection Agency is mixed with GM soybeans. Recently, as consumers' anxiety amplified, the Ministry of Agriculture and Forestry recently decided to implement the GM agricultural product labeling system from March 2001.
향후 GMO 개발 및 보급은 더욱 빨라질 것으로 예상되며, 유전자변형농산물의 편리성과 경제성으로 재배면적이 크게 증가되고 다국적 식품회사를 중심으로 유전자 변형 농산물에 대한 수요가 빠르게 증가하고 있어 관련 시장규모도 급속하게 성장할 것으로 전망된다. 전문가들은 2010년에 세계 유전자 변형 농산물 시장 규모가 200억 달러로 확대될 것으로 보고 있다.In the future, GMO development and distribution is expected to be faster. The convenience and economical efficiency of genetically modified agricultural products will greatly increase the area of cultivation, and the demand for genetically modified agricultural products will increase rapidly. It is expected to be. Experts expect the global genetically modified agricultural market to expand to $ 20 billion in 2010.
유전자 변형 농산물의 유해 여부에 관해서는 논란이 계속되고 있다. 이 같은이유는 유전자 변형작물을 오랜 기간 섭취했을 경우 발생할 수 있는 여러 가지 문제점을 많은 과학자들이 지적하고 있기 때문이다. 그러나 이러한 유해 여부를 떠나서 현재 국내에는 유전자 변형 농산물의 가부를 가릴 수 있는 실험법의 확립이 미비한 실정이다.Controversy continues over whether genetically modified agricultural products are harmful. This is because many scientists point out a number of problems that can arise from prolonged ingestion of GM crops. However, apart from the harmful status of the present situation in Korea, the establishment of a test method that can mask the whether or not genetically modified agricultural products are insufficient.
이처럼 확산되는 유전자 변형 농산물의 동향과 GMO 검사의 관심이 증가되는 현실에 발맞추어 보다 효율적인 GMO 검사 시스템의 개발이 요구되고 있다. 현재 이용가능한 검사방법에는 DNA를 분석하는 PCR법과 단백질을 분석하는 ELISA법을 들 수 있다. 일반적으로 단백질을 대상으로하는 ELISA법은 검출감도에 있어서 PCR법에 비해 떨어지며 열처리 등으로 단백질의 변성이 생길 수 있는 식품류에서의 검출에 한계를 가지고 있다. 따라서, 정확한 신뢰성을 갖는 유전자 변형 농산물을 검사하기 위한 방법이 필수적으로 요구되고 있다.In line with the proliferation of genetically modified agricultural products and the increasing interest in GMO testing, the development of more efficient GMO testing systems is required. Currently available test methods include PCR for DNA analysis and ELISA for protein analysis. In general, the ELISA method for protein is inferior to the PCR method in the detection sensitivity, and has a limitation in the detection in foods that may cause protein denaturation due to heat treatment. Thus, there is a need for a method for testing genetically modified agricultural products with accurate reliability.
이에 본 발명자는 유전자 변형 농산물로부터 변형된 유전자를 특이적으로 검출할 수 있는 변형/조작된 유전자 또는 프로모터 특이적인 프라이머를 설계하고, 설계된 프라이머를 이용하여 중합효소연쇄반응(Polymerase Chain Reaction)을 통하여 변형된 또는 조작된 유전자 또는 프로모터를 증폭함으로써 유전자 조작의 유무를 확인할 수 있음을 알고 본 발명을 완성하게 되었다.The present inventors designed a modified / engineered gene or promoter specific primer that can specifically detect the modified gene from the genetically modified agricultural products, and modified through the polymerase chain reaction using the designed primer The present invention has been completed by knowing that amplification of an engineered or engineered gene or promoter can be used to confirm the presence of genetic manipulation.
따라서, 본 발명의 목적은 유전자 변형 농산물의 검출 방법 및 검출용 프라이머를 제공하는데 있다.Accordingly, an object of the present invention is to provide a method for detecting genetically modified agricultural products and a primer for detection.
도 1은 대두 및 옥수수 가루로부터 게놈 염색체를 추출한 아가로즈 겔 사진이고,1 is agarose gel picture extracted genomic chromosome from soybean and corn flour,
도 2는 추출한 대두 염색체를 주형으로 사용하여 대두의 양성대조군 프라이머를 사용하여 gtr(Soy-bean Glycine max glutamyl-tRNA reductase gene) 유전자를 증폭한 PCR 결과를 나타내는 겔 전기영동 사진이고,Figure 2 is a gel electrophoresis picture showing the PCR result of amplifying the gtr (Soy-bean Glycine max glutamyl-tRNA reductase gene) gene using the extracted soybean chromosome as a template using a positive control primer of soybean,
도 3은 추출한 대두 염색체를 주형으로 사용하여 본 발명의 프라이머로 PCR 실험한 결과를 나타내는 겔 전기영동 사진이고,Figure 3 is a gel electrophoresis picture showing the results of PCR experiments with the primer of the present invention using the extracted soybean chromosome as a template,
도 4는 추출한 대두 염색체를 주형으로 사용하여 대두의 양성대조군 프라이머와 유전자 변형 검출용 프라이머를 사용하여 멀티플렉스 PCR(Multiplex PCR) 실험한 결과를 나타내는 겔 전기영동 사진이고,Figure 4 is a gel electrophoresis picture showing the results of multiplex PCR (Multiplex PCR) using the extracted soybean chromosome as a template using a positive control primer of the soybean and a primer for the detection of genetic modification,
도 5는 유전자 변형 콩으로부터 증폭된 PCR 산물을 염기서열분석한 결과를 나타내는 겔 전기영동 사진이다.Figure 5 is a gel electrophoresis picture showing the results of sequencing the PCR product amplified from genetically modified soybean.
본 발명은 유전자 변형 농산물의 검출 방법 및 검출용 프라이머에 관한 것이다.The present invention relates to a method for detecting genetically modified agricultural products and a primer for detection.
본 발명은 유전자 조작 여부를 검출할 수 있어 유전자 변형 농산물의 검출에 유용한 서열번호 1 내지 서열번호 18로 제시되는 프라이머를 제공한다.The present invention provides a primer set forth in SEQ ID NO: 1 to SEQ ID NO: 18 useful for the detection of genetically modified agricultural products can detect whether the genetic modification.
상기 프라이머는 조작 또는 변형된 유전자인 5-에놀피루빌시키메이트-3-포스페이트 합성효소(5-enolpyruvylshikimate-3-phosphate synthase(EPSPS)) 유전자 또는 글리포세이트 산화환원효소(glyphosate oxidoreductase) 유전자 또는 조작된 프로모터로부터 유래된다.The primer is a 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene or a glycosylated oxidoreductase gene or engineered or modified gene. Derived promoters.
본 발명은 서열번호 1 내지 서열번호 5에서 선택된 1종과 서열번호 11내지 서열번호 14에서 선택된 1종으로 구성되는 프라이머쌍을 이용하여 중합효소연쇄반응을 수행하여 농산물의 유전자 조작 여부를 검출하는 유전자 변형 농산물의 검출방법을 제공한다.The present invention is a gene for detecting the genetic manipulation of agricultural products by performing a polymerase chain reaction using a primer pair consisting of one species selected from SEQ ID NO: 1 to SEQ ID NO: 5 and one species selected from SEQ ID NO: 11 to SEQ ID NO: 14 It provides a method for detecting modified agricultural products.
상기 프라이머쌍은 특히 EPSPS-35-1(서열번호3)/EPSPS-35R-1(서열번호13), EPSPS-35-2(서열번호4)/EPSP-35R-1(서열번호13), EPSPS-35-3(서열번호5)/EPSPS-35R-1(서열번호13)에서 선택된 어느 하나가 바람직하다.The primer pair is specifically EPSPS-35-1 (SEQ ID NO: 3) / EPSPS-35R-1 (SEQ ID NO: 13), EPSPS-35-2 (SEQ ID NO: 4) / EPSSP-35R-1 (SEQ ID NO: 13), EPSPS Preferred is any one selected from -35-3 (SEQ ID NO: 5) / EPSPS-35R-1 (SEQ ID NO: 13).
본 발명은 서열번호 6 내지 서열번호 10에서 선택된 1종과 서열번호 15 내지 서열번호 18에서 선택된 1종으로 구성되는 프라이머쌍을 이용하여 중합효소연쇄반응을 수행하여 농산물의 유전자 조작 여부를 검출하는 유전자 변형 농산물의 검출방법을 제공한다.The present invention is a gene for detecting the genetic manipulation of agricultural products by performing a polymerase chain reaction using a primer pair consisting of one species selected from SEQ ID NO: 6 to SEQ ID NO: 10 and one species selected from SEQ ID NO: 15 to SEQ ID NO: 18 It provides a method for detecting modified agricultural products.
상기 프라이머쌍은 GOX-P-1(서열번호8)/GOX-PR-1(서열번호17), GOX-P-1(서열번호8)/GOX-PR-2(서열번호18), GOX-P-2(서열번호9)/GOX-PR-1, GOX-P-2/GOX-PR-2, GOX-P-3(서열번호10)/GOX-PR-1, GOX-P-3/GOX-PR-2에서 선택된 어느 하나가 바람직하다.The primer pair is GOX-P-1 (SEQ ID NO: 8) / GOX-PR-1 (SEQ ID NO: 17), GOX-P-1 (SEQ ID NO: 8) / GOX-PR-2 (SEQ ID NO: 18), GOX- P-2 (SEQ ID NO: 9) / GOX-PR-1, GOX-P-2 / GOX-PR-2, GOX-P-3 (SEQ ID NO: 10) / GOX-PR-1, GOX-P-3 / Preference is given to any one selected from GOX-PR-2.
또한, 본 발명은 서열번호 1 내지 서열번호 5에서 선택된 1종과 서열번호 11내지 서열번호 14에서 선택된 1종의 프라이머쌍을 포함하는 유전자 변형 농산물 검출 키트를 제공한다.The present invention also provides a genetically modified agricultural product detection kit comprising one primer pair selected from SEQ ID NO: 1 to SEQ ID NO: 5 and one primer pair selected from SEQ ID NO: 11 to SEQ ID NO: 14.
마지막으로, 본 발명은 서열번호 6 내지 서열번호 10에서 선택된 1종과 서열번호 15내지 서열번호 18에서 선택된 1종의 프라이머쌍을 포함하는 유전자 변형 농산물 검출 키트를 제공한다.Finally, the present invention provides a genetically modified agricultural product detection kit comprising one primer selected from SEQ ID NO: 6 to SEQ ID NO: 10 and one primer pair selected from SEQ ID NO: 15 to SEQ ID NO: 18.
유전자 변형 농산물로부터 변형 또는 조작된 유전자는 제초제 저항성을 가지는 5-에놀피루빌시키메이트-3-포스페이트 합성효소 또는 글리포세이트 산화환원효소 유전자임을 확인하고, 상기 5-에놀피루빌시키메이트-3-포스페이트 합성효소 또는 글리포세이트 산화환원효소 유전자 및 관련 프로모터를 바탕으로 하여 프라이머를 설계하였다. 설계된 프라이머중 효율적인 프라이머를 선별한 후, 선별된 프라이머쌍을 이용하여 중합효소연쇄반응을 수행한 결과 상기 변형 또는 조작된 유전자 또는 프로모터가 특이적으로 검출됨을 확인하였다.The gene modified or engineered from the genetically modified agricultural product was identified as a 5-enolpyrubilicimate-3-phosphate synthase or glyphosate oxidoreductase gene having herbicide resistance. Primers were designed based on phosphate synthase or glyphosate oxidoreductase genes and related promoters. After selecting efficient primers among the designed primers, polymerase chain reaction was performed using the selected primer pairs to confirm that the modified or engineered genes or promoters were specifically detected.
따라서, 본 발명의 방법 및 프라이머에 의하면 효과적으로 유전자 변형 농산물이 검출될 수 있다.Thus, according to the methods and primers of the present invention, genetically modified agricultural products can be detected effectively.
이하, 본 발명을 실시예를 들어 상세히 설명하고자 하지만 본 발명의 범위가 이들 실시예에만 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail with reference to Examples, but the scope of the present invention is not limited only to these Examples.
실시예 1 : 유전자 변형 농산물 검사를 위한 특이적 프라이머 설계Example 1 Design of Specific Primers for Testing Genetically Modified Agricultural Products
유전자 변형 작물에 대해 조사하기 위해 최대의 유전자 변형 작물 제조회사인 몬산토사의 유전자 변형 작물을 검색하였다. 검색결과 모두 6종류의 유전자 변형 작물에 대한 특허가 검색되었으며, 이중 4개의 유전자 변형 콩에 관한 특허를 확인하였다. 유전자 변형 농산물 특허는 크게 2종류의 유전자 조작에 관한 내용이었는데, USP 5,776,760(Glyphosate tolerant plants)과 USP 5,463,175 (Glyphosate tolerant plants)는 글리포세이트 산화환원효소 유전자 조작에 대한 특허였으며, USP 5,188,642(Glyphosate-resistant plants)와 USP 4,940,835 (Glyphosate- resistant plants)는 5-에놀피루빌시키메이트-3-포스페이트 합성효소 유전자 조작에 대한 특허였다. 상기 몬사토사의 특허에는 각각의 프로모터에 대한 언급과 유전자 서열이 제시되어 있었으며, 이 같은 내용에 근거하여 각각의 조작된 유전자 및 조작된 프로모터에 대한 서열을 확보하였다. 그 후, 상기 조작된 유전자 및 조작된 프로모터 염기서열을 바탕으로 하여 유전자 조작/변형 유무를 검사할 수 있는 특이적 프라이머를 Primer3라는 프라이머 디자인 프로그램을 사용하여 설계하였다. 그 결과가 표 1에 제시되어 있다.To investigate GM crops, we searched for GM crops from Monsanto, the largest producer of GM crops. As a result, all six types of genetically modified crops were searched for patents, and four of them were identified for patents. Genetically modified agricultural patents were largely related to two types of genetic manipulation. USP 5,776,760 (Glyphosate tolerant plants) and USP 5,463,175 (Glyphosate tolerant plants) were patents for glyphosate oxidoreductase genetic engineering, and USP 5,188,642 (Glyphosate- resistant plants) and USP 4,940,835 (Glyphosate-resistant plants) were patents for genetic engineering of 5-enolpyrubilicimate-3-phosphate synthase. In the Monsato patent, reference was made to each promoter and a gene sequence, and based on the above information, the sequence for each engineered gene and engineered promoter was obtained. Subsequently, specific primers that can be tested for genetic modification / modification based on the engineered gene and engineered promoter sequences were designed using a primer design program called Primer3. The results are shown in Table 1.
실시예 2 : 게놈 DNA 추출Example 2 Genomic DNA Extraction
본 발명에 있어서, 유전자 변형 농산물의 변형 유전자 검사를 위해서는 각 종 농산물 또는 식품으로부터 유전자를 추출하고 추출된 유전자를 중합효소연쇄반응(PCR)으로 검사하게 된다. 유전자의 추출을 위해서 본 발명에서는 바람직하게 추출키트를 사용하여 실험하였다. 추출키트는 분리 정제를 위해 필요한 모든 시약들을 갖추었고, 칼럼 타입의 정제 시스템을 사용하여 빠른 시간 내에 간편하게 고순도의 DNA를 분리 정제할 수 있게 하였다. 상기 추출 기트를 사용하여 콩, 옥수수, 쌀, 씨앗 등 각 종 농산물뿐만 아니라 콩나물, 두부, 분유 등 가공식품에서도 유전자를 분리정제하였다.In the present invention, for the genetic testing of genetically modified agricultural products, the genes are extracted from various agricultural products or foods and the extracted genes are examined by polymerase chain reaction (PCR). In the present invention for the extraction of the gene was preferably experimented using the extraction kit. The extraction kit was equipped with all the reagents required for separation purification, and using a column type purification system, it was possible to easily separate and purify high purity DNA in a short time. The extraction kit was used to isolate and purify genes from processed foods such as soybean sprouts, tofu, and milk powder as well as various agricultural products such as soybeans, corn, rice, and seeds.
본 발명에서는 정확한 결과를 얻기 위해 참고 물질(Certified Reference Materials)인 Round-Up-Ready Soya SB-0(유전자 변형 콩 없음), SB-0.1(0.1% 유전자 변형콩이 섞여 있음), SB-1(1% 유전자 변형 콩이 섞여 있음), SB-5(5% 유전자 변형 콩이 섞여 있음)를 IRMM (Institutr for Reference Materials and Measurements, Belgium)으로부터 구입하였다.In the present invention, in order to obtain accurate results, the Reference Reference Material (Round-Up-Ready Soya SB-0 (without genetically modified soybeans), SB-0.1 (with 0.1% genetically modified soybeans), SB-1 ( 1% genetically modified soybeans) and SB-5 (5% genetically modified soybeans) were purchased from Institutr for Reference Materials and Measurements, Belgium.
먼저 대두 가루, 옥수수 가루, 두부 각각 0.1g씩 1.5 ml 튜브에 넣고 여기에 lysis buffer(8.0 M urea, 0.25% SDS, 0.25% sodium lauryl sarcinosate, 50 mM disodium EDTA, pH8.0) 1 ml과 Proteinase K (10mg/ml) 10 ul를 첨가하여 60℃에서 30분간 반응시켰다.First, soybean flour, cornmeal, and tofu were each placed in a 1.5 ml tube of 0.1 g each, containing 1 ml of lysis buffer (8.0 M urea, 0.25% SDS, 0.25% sodium lauryl sarcinosate, 50 mM disodium EDTA, pH8.0) and Proteinase K. 10 ul (10mg / ml) was added and reacted at 60 ° C for 30 minutes.
반응이 끝난 튜브를 3,000 ∼ 5,000rpm으로 5분간 원심분리시킨 후, 상층액을 동량의 Binding buffer (4 M GuHCl, 50 mM Sodium citrate, 0.3 M Sodiumacetate, 10 mM DTT, 1% tween20, pH4.0)와 혼합하여 Collection Tube에 장착된 Spin-Column튜브로 옮겨 8,000rpm에서 1분간 원심분리하여 염색체를 칼럼의 필터에 결합시켰다. 이 후 500 ul의 Washing Buffer (20mM NaCl, 2mM Tris-HCL, pH7.7, 80% EtOH)로 칼럼을 2차례 씻어준 후, 100 ul의 Elution Buffer를 첨가하여 새 튜브로 염색체를 받아냈다. 이렇게 정제한 염색체를 겔 전기영동하여, 그 결과를 도 1에 나타내었다. 도 1에서 M은 마커를, 1레인과 2레인은 콩, 3레인과 4레인은 두부, 5레인과 6레인은 옥수수 가루로부터 추출된 게놈 DNA를 나타낸다. 그후 이렇게 정제한 염색체를 정량한 후 PCR 실험에 사용하였다.The reaction tube was centrifuged at 3,000 to 5,000 rpm for 5 minutes, and then the supernatant was washed with the same amount of binding buffer (4 M GuHCl, 50 mM Sodium citrate, 0.3 M Sodiumacetate, 10 mM DTT, 1% tween20, pH 4.0). The mixture was transferred to a spin-column tube mounted on a collection tube, and centrifuged at 8,000 rpm for 1 minute to bind the chromosome to the filter of the column. After washing the column twice with 500 ul of Washing Buffer (20mM NaCl, 2mM Tris-HCL, pH7.7, 80% EtOH), 100 ul of Elution Buffer was added to the chromosome in a new tube. The purified chromosome was subjected to gel electrophoresis, and the results are shown in FIG. 1. In Fig. 1, M denotes a marker, 1 and 2 lanes are soybeans, 3 and 4 lanes are tofu, and 5 and 6 lanes represent genomic DNA extracted from corn flour. The purified chromosomes were then quantified and used for PCR experiments.
실시예 3 : 대두의 양성 대조군 프라이머에 의한 gtr 유전자 증폭Example 3: Amplification of gtr Gene by Soybean Positive Control Primer
본 발명에서는 유전자 변형 농산물로부터 변형유전자의 검출에 앞서 정상적인 유전자의 추출 여부를 확인하기 위해서 양성 대조군 프라이머를 설계하여 대두로부터 추출한 염색체를 주형으로하여 PCR 실험을 하였다. 양성 대조군을 위한 프라이머는 대두의 경우 gtr (Soy-bean Glycine max glutamyl-tRNA reductase gene)유전자를 목표로 하였으며, gtr-F (5'-gcctgtggaaatgcgtgaaaa)와 gtr-R (5'- tggtggaaagggagtgaaaaagga)를 한쌍의 프라이머로 사용하였고, 옥수수의 경우 튜블린(Tubulin) 유전자를 목표로 하여 Tub-F (5'-cgagcccagtcagccaggtc)와 Tub-R (5'- gcggcgtggaagagagaagg)를 한쌍의 프라이머로 각각 사용하였다.In the present invention, in order to confirm whether normal genes are extracted before genetically modified agricultural products are detected, a positive control primer was designed and PCR experiments were performed using chromosomes extracted from soybean as templates. The primer for the positive control targets the soy-bean Glycine max glutamyl-tRNA reductase gene (gtr) gene in soybean, and a pair of gtr-F (5'-gcctgtggaaatgcgtgaaaa) and gtr-R (5'-tggtggaaagggagtgaaaaagga) In the case of corn, Tub-F (5'-cgagcccagtcagccaggtc) and Tub-R (5'-gcggcgtggaagagagaagg) were used as a pair of primers for the tubulin gene.
PCR의 경우 실시예 2에서 추출한 게놈 DNA를 주형으로 사용하여 양성대조군 프라이머를 각각 20 pmoles씩 PCR 증폭 키트인 AccuPower PCR PreMix((주)바이오니아 제품)에 넣어 증폭하였다. 증폭 조건은 초기 변성을 94℃에서 5분간 한 후, 94℃에서 1분간 변성 (denaturation), 57℃에서 1분간 어닐링 (annealing), 72℃에서 1분간 익스텐션(extension)을 30 사이클 실시하고 후기 익스텐션 (last-extension)을 5분간 실시하였다.In the case of PCR, the genomic DNA extracted in Example 2 was used as a template, and the positive control primers were amplified by inserting 20 pmoles into AccuPower PCR PreMix (Bionia Co., Ltd.), a PCR amplification kit. The amplification conditions were performed for 5 minutes at 94 ° C. for initial denaturation, 1 minute denaturation at 94 ° C. for 1 minute, annealing at 57 ° C. for 1 minute, and extension for 1 minute at 72 ° C. for 30 cycles. (last-extension) was performed for 5 minutes.
도 2에 나타낸 바와 같이, 대두에서는 342bp의 PCR 산물을 옥수수에서는 310bp의 PCR 산물을 각각 얻을 수 있었다. 또한 주형 DNA를 넣치 않은 음성 대조군에서는 PCR 단편이 전혀 검출되지 않았다. 도 2에서 M은 마커를, 레인 1은 음성 대조군을, 레인 2는 두부를, 레인 3은 SB-0을, 레인 4는 SB-0.1을, 레인 5는 SB-1을, 레인 6은 SB-5를 가지고 실험한 결과를 나타낸다.As shown in FIG. 2, 342 bp PCR product in soybean and 310 bp PCR product in corn was obtained, respectively. In addition, no PCR fragment was detected in the negative control without template DNA. In Figure 2, M is a marker, lane 1 is a negative control, lane 2 is tofu, lane 3 is SB-0, lane 4 is SB-0.1, lane 5 is SB-1, lane 6 is SB- The result of experiment with 5 is shown.
실시예 4 : 유전자 변형 농산물로부터 변형 유전자의 PCR 증폭Example 4 PCR Amplification of Modified Genes from Genetically Modified Agricultural Products
유전자 변형 농산물의 변형 유전자 검사를 위해 5%의 유전자 변형 콩을 함유하고 있는 SB-5를 가지고 실험하였다. 본 발명에서 설계한 수 십종의 프라이머들을 시험한 결과 최적의 검사 효율을 보이는 3종의 프라이머쌍(EPSPS-35-1/EPSPS-35R-1, EPSPS 35-2/EPSPS-35R-1 그리고 EPSPS-35-3/EPSPS-35R-1)를 선별하였다. PCR 반응조건은 초기 변성을 94℃에서 5분간 한 후, 94℃에서 1분간 변성(denaturation), 57℃에서 1분간 어닐링 (annealing), 72℃에서 1분간 익스텐션(extension)을 30 사이클 실시하고 후기 익스텐션 (last-extension)을 5분간 실시하였다. PCR 반응의 생성물을 전기영동하여 그 결과를 도 3에 나타내었다. 도 3에서, M은 마커를, 레인 1은 공지되어 있는 프라이머 쌍인 EU-35S-1(5-gctcctacaaatgccatca)/EU-35S-2(5-gatagtgggattgtgcgtca)로 실험한 결과를 나타내고, 레인 2는 공지되어 있는 프라이머 쌍인 EU-NOS-1 (5-gaatcctgttgccggtcttg)/EU-NOS-2 (5-ttatcctagtttgcgcgcta)로실험한 결과를 나타내고, 레인 3은 EPSPS-35-1/EPSPS-35R-1로, 레인 4는 EPSP 35-2/EPSPS-35R-1로, 레인 5는 EPSPS-35-3/EPSPS-35R-1로 실험한 결과를 나타낸다. 그 결과 각각 195bp, 180bp, 248bp, 146bp, 그리고 88bp의 PCR 산물을 얻음으로써 유전자 변형 콩이 효과적으로 검출됨을 확인하였다.In order to test the modified genes of GM crops, they were tested with SB-5 containing 5% transgenic soybeans. Dozens of primers designed in the present invention were tested to show three primer pairs (EPSPS-35-1 / EPSPS-35R-1, EPSPS 35-2 / EPSPS-35R-1 and EPSPS-) that showed the optimal test efficiency. 35-3 / EPSPS-35R-1) was selected. PCR reaction conditions were performed after initial denaturation at 94 ° C for 5 minutes, denaturation at 94 ° C for 1 minute, annealing at 57 ° C for 1 minute, and extension for 1 minute at 72 ° C for 30 cycles. Extension (last-extension) was carried out for 5 minutes. The product of the PCR reaction was electrophoresed and the results are shown in FIG. 3. In FIG. 3, M represents a marker, lane 1 represents the result of experiments with known primer pairs EU-35S-1 (5-gctcctacaaatgccatca) / EU-35S-2 (5-gatagtgggattgtgcgtca), and lane 2 is known. Test results with the primer pair EU-NOS-1 (5-gaatcctgttgccggtcttg) / EU-NOS-2 (5-ttatcctagtttgcgcgcta), lane 3 is EPSPS-35-1 / EPSPS-35R-1, and lane 4 is Lane 5 shows the results of experiments with EPSPS-35-3 / EPSPS-35R-1. As a result, it was confirmed that genetically modified soybean was effectively detected by obtaining PCR products of 195bp, 180bp, 248bp, 146bp, and 88bp, respectively.
실시예 5 : 멀티플렉스 중합효소연쇄반응(Multiplex PCR)Example 5 Multiplex Polymerase Chain Reaction (Multiplex PCR)
본 발명에 있어서, 본 발명의 프라이머쌍을 포함하는 유전자 증폭 PCR 키트를 제조하여 중합효소연쇄반응을 수행하였다. 상기 키트는 검사에 필요한 모든 구성 성분들을 미리 혼합하여 1회 분량씩 동결건조시켰고, 특수 안정화물질을 첨가시켜 PCR 반응혼합물의 특이성 및 안정성을 증가시켰으며, 극미량의 유전자를 검출할 수 있게 하였을 뿐만 아니라, 안정성의 증가로 장기보관(상온에서 1개월, 냉동보관시 2년 이상 활성 유지)이 가능하게 하였다. 또한, 확인용 염색시약을 첨가시켜 반응 후 곧바로 전기영동 확인이 가능하게 하였다.In the present invention, a gene amplification PCR kit comprising a primer pair of the present invention was prepared to perform a polymerase chain reaction. The kit was pre-mixed with all the components needed for the test, lyophilized in one portion, added with special stabilizing agents to increase the specificity and stability of the PCR reaction mixture, as well as to detect trace amounts of genes. As a result of increased stability, long-term storage (1 month at room temperature, 2 years or more during frozen storage) was possible. In addition, confirmation dye was added to enable electrophoresis immediately after the reaction.
대두의 양성대조군 프라이머와 유전자 변형콩 검출용 프라이머를 동시에 사용하여 멀티플렉스 PCR (Multiplex PCR) 실험을 실시예 3 및 4의 증폭 조건으로 실시하여 그 결과를 도 4로 나타내었다. 도 4에 나타낸 바와 같이 모든 시료에서 342bp의 양성대조군 증폭산물이 일정하게 나타났으며, 각각 5쌍의 변형유전자 증폭 산물을 시료별로 확인할 수 있었다. 각각의 레인은 도 3에 제시된 바와 동일하다.Multiplex PCR (Multiplex PCR) experiments were performed under the amplification conditions of Examples 3 and 4 using the positive control primer of soybean and the primer for detecting the transgenic soybean at the same time, and the results are shown in FIG. 4. As shown in FIG. 4, 342 bp positive control amplification products appeared constant in all samples, and five pairs of modified gene amplification products were identified for each sample. Each lane is the same as shown in FIG. 3.
실시예 6 : 염기서열분석Example 6 Sequencing
상기에서 실시한 PCR 증폭산물은 정제를 거친 후, PCR directed Sequencing을 통하여 증폭된 PCR 산물이 변형 유전자와 관련이 있는지를 조사하였다. 정제된PCR 산물을 PCR에 사용한 프라이머를 사용하여 직접 염기서열 결정반응을 하여 이 반응물을 8M Urea가 들어있는 6% 변성 아크릴아마이드 겔에 전기영동하고 겔이 붙어 있는 유리판을 은 염색하여 그 결과를 도 5로 나타냈다. 유전자의 염기서열을 판독한 결과 실험에서 증폭한 유전자는 유전자 변형 농산물에 사용되는 유전자인 5-에놀피루빌시키메이트-3-포스페이트 합성효소(EPSPS) 유전자의 일부 유전자임을 알 수 있었다.After the PCR amplification products were purified, the PCR products amplified by PCR directed sequencing were examined to determine whether they were related to the modified gene. Direct sequencing of the purified PCR product using primers used in PCR was carried out on electrophoresis on 6% modified acrylamide gel containing 8M Urea and silver staining of the glass plate with gel was performed. 5 is shown. As a result of reading the nucleotide sequence of the gene, it was found that the amplified gene in the experiment was part of the 5-enolpyrubilicimate-3-phosphate synthase (EPSPS) gene, which is a gene used for genetically modified agricultural products.
본 발명의 유전자 변형 농산물 검출 방법 및 검출용 프라이머에 의해 콩, 옥수수, 씨앗 등은 물론 콩나물, 두부, 분유 등과 같은 식품류로부터 보다 간단하면서도 정확하게 유전자 조작 유무를 검사할 수 있다.The genetically modified agricultural product detecting method and primer for detecting the present invention can more easily and accurately examine the presence or absence of genetic manipulation from foods such as soybeans, corn, seeds, and soybean sprouts, tofu, and powdered milk.
상기한 바와 같이, 본 발명의 유전자 변형 농산물 검출 방법 및 검출용 프라이머에 의하면 정확하게 유전자 조작 유무를 검사할 수 있다.As described above, according to the genetically modified agricultural product detection method and the detection primer of the present invention, it is possible to accurately examine the presence or absence of genetic manipulation.
Claims (6)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2000-0013464A KR100381930B1 (en) | 2000-03-16 | 2000-03-16 | Method and Primers for Detecting Genetically Modified Organism |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2000-0013464A KR100381930B1 (en) | 2000-03-16 | 2000-03-16 | Method and Primers for Detecting Genetically Modified Organism |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20010100216A KR20010100216A (en) | 2001-11-14 |
KR100381930B1 true KR100381930B1 (en) | 2003-04-26 |
Family
ID=45787432
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR10-2000-0013464A KR100381930B1 (en) | 2000-03-16 | 2000-03-16 | Method and Primers for Detecting Genetically Modified Organism |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR100381930B1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100461702B1 (en) * | 2002-03-28 | 2004-12-14 | 한국과학기술연구원 | Determination Method of Glyphosate, Endothall and Chloramben in Water Samples |
WO2006121277A1 (en) * | 2005-05-09 | 2006-11-16 | Korea Research Institute Of Standards And Science | Fret probes for fluorescent detection of the epsps gene |
Families Citing this family (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100376796B1 (en) * | 2000-05-02 | 2003-03-19 | (주)넥스젠 | GMO Detective Kit and Primer for PCR |
KR100474115B1 (en) * | 2001-06-01 | 2005-03-08 | 대한민국 | Primer for detection of generally modified organism |
KR100439168B1 (en) * | 2001-07-02 | 2004-07-05 | (주)넥스젠 | DNA Amplification Kits for Detecting Genetically-Modified Plants Quantitatively and Methods Using the Same |
KR20030018218A (en) * | 2001-08-27 | 2003-03-06 | 주식회사 지디바이오텍 | Detection primer for genetically modified organism and manufactured goods, and detection kit using same |
KR20030084184A (en) * | 2002-04-25 | 2003-11-01 | 주식회사 지디바이오텍 | Detection primer for genetically modified organism and manufactured goods, primer and probe for quantification of genetically modified organism, and detection kit using same |
KR100794700B1 (en) * | 2002-08-02 | 2008-01-14 | (주)바이오니아 | Quantitative Analysis Method for Analyzing Mingled Ratio of Genetically Modified Organisms |
KR100458009B1 (en) * | 2002-09-03 | 2004-11-18 | 대한민국 | Single PCR primer amplifying the potato specific DNA and duplex PCR method for the screening of genetically -modified potato using thereof |
WO2006031061A1 (en) * | 2004-09-18 | 2006-03-23 | Korea Research Institute Of Standards And Science | Fret gene probe selection method using pcr screening |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992000377A1 (en) * | 1990-06-25 | 1992-01-09 | Monsanto Company | Glyphosate tolerant plants |
WO1992004449A1 (en) * | 1990-08-31 | 1992-03-19 | Monsanto Company | Glyphosate tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
WO1992006201A1 (en) * | 1990-09-28 | 1992-04-16 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases |
KR20000047764A (en) * | 1998-11-30 | 2000-07-25 | 미야무라 심뻬이 | Copper foil for printed wiring board having excellent chemical resistance and heat resistance |
KR20010027321A (en) * | 1999-09-13 | 2001-04-06 | 서평원 | Reporting Method for position of mobile telephone |
KR20010032919A (en) * | 1997-12-11 | 2001-04-25 | 에바-마리아 시마-메이어, 얼설라 멜져, 마거, 하르트만 | Purification Method for Producing Fludarabine Phosphate |
-
2000
- 2000-03-16 KR KR10-2000-0013464A patent/KR100381930B1/en not_active IP Right Cessation
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992000377A1 (en) * | 1990-06-25 | 1992-01-09 | Monsanto Company | Glyphosate tolerant plants |
WO1992004449A1 (en) * | 1990-08-31 | 1992-03-19 | Monsanto Company | Glyphosate tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
WO1992006201A1 (en) * | 1990-09-28 | 1992-04-16 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases |
KR20010032919A (en) * | 1997-12-11 | 2001-04-25 | 에바-마리아 시마-메이어, 얼설라 멜져, 마거, 하르트만 | Purification Method for Producing Fludarabine Phosphate |
KR20000047764A (en) * | 1998-11-30 | 2000-07-25 | 미야무라 심뻬이 | Copper foil for printed wiring board having excellent chemical resistance and heat resistance |
KR20010027321A (en) * | 1999-09-13 | 2001-04-06 | 서평원 | Reporting Method for position of mobile telephone |
Non-Patent Citations (4)
Title |
---|
논문(1998. 6. .) * |
논문(1998. 7. .) * |
논문(1998.10. .) * |
논문(1999. 12. .) * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100461702B1 (en) * | 2002-03-28 | 2004-12-14 | 한국과학기술연구원 | Determination Method of Glyphosate, Endothall and Chloramben in Water Samples |
WO2006121277A1 (en) * | 2005-05-09 | 2006-11-16 | Korea Research Institute Of Standards And Science | Fret probes for fluorescent detection of the epsps gene |
Also Published As
Publication number | Publication date |
---|---|
KR20010100216A (en) | 2001-11-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20220010326A1 (en) | Transgenic Maize Event MON 87419 and Methods of Use Thereof | |
JP5685228B2 (en) | Corn event DAS-59122-7 and method for its detection | |
JP5256020B2 (en) | Elite event A2704-12 and methods and kits for identifying the event in a biological sample | |
US7223907B2 (en) | Cotton event MON15985 and compositions and methods for detection thereof | |
JP5281392B2 (en) | Elite event A5547-127 and methods and kits for identifying the event in biological samples | |
CA2740812A1 (en) | A method to identify disease resistant quantitative trait loci in soybean and compositions thereof | |
KR100381930B1 (en) | Method and Primers for Detecting Genetically Modified Organism | |
Hernández et al. | Current methodology for detection, identification and quantification of genetically modified organisms | |
US20230383307A1 (en) | Corn Elite Event MZIR098 | |
WO2017214074A1 (en) | Corn elite event mzhg0jg | |
US20020100082A1 (en) | Method for determining content of heterologous individual | |
KR100723069B1 (en) | Qualitative and quantitative detection methods using specific primers probes and standard plasmid for GM corns | |
JP2006197926A (en) | Primer or primer set for testing nucleic acid and testing kit and method for testing using the same | |
KR100639393B1 (en) | DNA chip for diagnosing living modified plant kit comprising the chip and diagnostic method using the kit | |
Kharb et al. | Utilization of SSR markers for seed purity testing in popular maize hybrids | |
KR102540582B1 (en) | Method for simultaneously detecting genetically modified alfalfa | |
CN114656546B (en) | Parthenogenesis haploid induction gene and application thereof | |
KR20030018218A (en) | Detection primer for genetically modified organism and manufactured goods, and detection kit using same | |
KR20020066413A (en) | A method and test kit for detecting genetically modified organism by pcr |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20120329 Year of fee payment: 10 |
|
FPAY | Annual fee payment |
Payment date: 20130403 Year of fee payment: 11 |
|
LAPS | Lapse due to unpaid annual fee |