KR100330674B1 - Sliced Kimchi and Kimchi Juice made by using Leuconostoc citreum IH22 - Google Patents
Sliced Kimchi and Kimchi Juice made by using Leuconostoc citreum IH22 Download PDFInfo
- Publication number
- KR100330674B1 KR100330674B1 KR1019990008008A KR19990008008A KR100330674B1 KR 100330674 B1 KR100330674 B1 KR 100330674B1 KR 1019990008008 A KR1019990008008 A KR 1019990008008A KR 19990008008 A KR19990008008 A KR 19990008008A KR 100330674 B1 KR100330674 B1 KR 100330674B1
- Authority
- KR
- South Korea
- Prior art keywords
- kimchi
- strain
- citrium
- beet
- juice
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23B—PRESERVING, e.g. BY CANNING, MEAT, FISH, EGGS, FRUIT, VEGETABLES, EDIBLE SEEDS; CHEMICAL RIPENING OF FRUIT OR VEGETABLES; THE PRESERVED, RIPENED, OR CANNED PRODUCTS
- A23B7/00—Preservation or chemical ripening of fruit or vegetables
- A23B7/10—Preserving with acids; Acid fermentation
- A23B7/105—Leaf vegetables, e.g. sauerkraut
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23B—PRESERVING, e.g. BY CANNING, MEAT, FISH, EGGS, FRUIT, VEGETABLES, EDIBLE SEEDS; CHEMICAL RIPENING OF FRUIT OR VEGETABLES; THE PRESERVED, RIPENED, OR CANNED PRODUCTS
- A23B7/00—Preservation or chemical ripening of fruit or vegetables
- A23B7/14—Preserving or ripening with chemicals not covered by groups A23B7/08 or A23B7/10
- A23B7/153—Preserving or ripening with chemicals not covered by groups A23B7/08 or A23B7/10 in the form of liquids or solids
- A23B7/154—Organic compounds; Microorganisms; Enzymes
- A23B7/155—Microorganisms; Enzymes; Antibiotics
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Food Science & Technology (AREA)
- Polymers & Plastics (AREA)
- Microbiology (AREA)
- Storage Of Fruits Or Vegetables (AREA)
- Preparation Of Fruits And Vegetables (AREA)
Abstract
Description
본 발명은 덱스트란을 생산하는 루코노스톡 시트리움 IH22(Leuconostoc citreum IH22)유산균을 이용하여 제조한 채 김치 및 김치 쥬스에 관한 것이다.The present invention relates to kimchi and kimchi juice prepared by using the Leuconostoc citreum IH22 lactic acid bacteria producing dextran.
한국의 전통발효식품인 김치는 앞으로 세계 각국에 수출될 가능성이 매우 높은 식품이다. 김치가 수출되기 위해서는 제품의 질을 향상시켜야 함은 물론이거니와 유통과정에서 보존성을 향상시켜야하고, 유통경비를 줄이는 것이 중요하다.김치에 대한 오늘날까지의 연구들을 살펴보면 주로 김치의 맛을 증진시키기 위한 식품학적 연구, 김치의 상품가치를 높이기 위한 포장방법에 대한 연구 및 김치를 발효시키는데 관련된 미생물에 대한 연구 등 이었다. 김치발효에 관련된 미생물에 대한 연구결과들은 젖산균들이 발효에 중요하다는 사실과 발효의 초기에는 주로 루코노스톡 메센테로이데스(Leuconostoc mesenteroides)가 나타나고 발효 후기에는 락토바실러스 플란타룸(Lactobacillus plantarum)을 포함한 락토바실러스(Lactobacillus)가 주로 나타난다는 사실이다. 루코노스톡 종들을 오랫동안 김치 내에서 유지시키기 위한 방법을 찾는 많은 연구가 진행되었으나 좋은 결과는 보고되지 않고 있다.Kimchi, a traditional Korean fermented food, is highly likely to be exported to countries around the world. In order for kimchi to be exported, it is important not only to improve the quality of the product, but also to improve the preservation in the distribution process, and to reduce the distribution cost.To date, studies of kimchi are mainly used to improve the taste of kimchi. The study was conducted on packaging methods to increase the value of kimchi and on the microorganisms involved in fermenting kimchi. The results of studies on microorganisms related to kimchi fermentation indicate that lactic acid bacteria are important for fermentation, and that lactose, including Lactobacillus plantarum, appears mainly at the beginning of fermentation, mainly Leuconostoc mesenteroides. It is a fact that Bacillus (Lactobacillus) occurs mainly. Many studies have been conducted to find ways to keep luconosestock species in kimchi for a long time, but good results have not been reported.
이와 더불어 스타터(starter)로서 루코노스톡을 이용하는 연구들이 진행되었고 특허 문헌에 보고된 경우도 있으나 김치의 질을 향상시키는 데는 크게 도움이 되지 못했다.In addition, studies using luconosestock as a starter have been conducted and reported in the patent literature, but it has not been very helpful in improving the quality of kimchi.
본 발명의 목적은 산에 대하여 비교적 내성이 강한 루코노스톡 시트리움 IH22 유산균을 스타터로 이용하여 보존성이 우수하고 제조시간을 단축시킬 수 있으며, 기호도가 높은 김치 및 김치 쥬스의 제조방법을 제공하는데 있다.An object of the present invention is to provide a method for producing kimchi and kimchi juice having high preservation and shortening the manufacturing time by using Luconosstock Citrium IH22 lactic acid bacteria, which are relatively resistant to acids, as a starter. .
도 1은 루코노스톡 시트리움 IH22를 첨가한 김치를 20℃에서 숙성시켰을 때의 pH의 변화그래프.Figure 1 is a graph of the pH change when the kimchi added to Lukonoscitrium IH22 is aged at 20 ℃.
도 2는 루코노스톡 시트리움 IH22를 첨가한 김치를 20℃에서 숙성시켰을 때의 총 산도변화그래프.Figure 2 is a graph of total acidity change when aged kimchi added to Luconostock citrium IH22 at 20 ℃.
도 3은 루코노스톡 시트리움 IH22와 비트를 첨가한 김치를 20℃에서 숙성시켰을 때의 pH와 총 산도의 변화그래프.Figure 3 is a graph of the change in pH and total acidity when aged kimchi added Lukonostock citrium IH22 and beet at 20 ℃.
도 4는 루코노스톡 시트리움 IH22와 비트를 첨가한 쥬스를 20℃에서 숙성시켰을 때의 pH와 총 산도의 변화그래프.Figure 4 is a graph of the change in pH and total acidity when the juice added Lukonostock citrium IH22 and beet at 20 ℃.
도 5는 루코노스톡 시트리움 IH22를 pH 3, pH 4인 0.05M 시트르산 용액에서 25℃, 3일간 배양했을 때의 살아있는 균의 변화그래프.Figure 5 is a graph showing the change of viable bacteria when culturing Luconosstock Citrium IH22 in 0.05M citric acid solution of pH 3, pH 4, 25 ℃, 3 days.
도 6은 루코노스톡 시트리움 IH22를 pH 2.5인 인공위액에서 3시간 배양했을 때의 살아있는 균의 변화그래프.Figure 6 is a graph of the change of viable bacteria when culturing Luconosstock Citrium IH22 in artificial gastric juice of pH 2.5 for 3 hours.
본 발명에서 이용하고 있는 균주는 김치에서 분리한 루코노스톡 시트리움 IH22(Leuconostoc citreum IH22) 유산균(기탁기관 : 한국유전자은행, 기탁번호 : KCTC 0542 BP, 기탁일자 : 1998년 11월 2일)이고, 본 발명의 채 김치 및 김치 쥬스는 상기 루코노스톡 시트리움 IH22을 이용하여 제조한 것이다.Strains used in the present invention are lactic acid bacteria (Leuconostoc citreum IH22) lactic acid bacteria isolated from Kimchi (deposit institution: Korea Gene Bank, deposit number: KCTC 0542 BP, date of deposit: November 2, 1998) , Kimchi and kimchi juice of the present invention is prepared using the Luconostock citrium IH22.
본 발명에서 이용하고 있는 균주는 다음과 같은 방법으로 분리한 것이다.The strain used in the present invention is isolated by the following method.
김치를 통상의 방법으로 제조 한 후 15℃에서 발효시킨 다음 12시간 간격으로 김치 숙성기까지 시료를 채취하여 집락이 30 ∼ 300개가 형성되도록 멸균생리식염수로 10배수 희석법에 따라 희석하여 설탕배지{배지 1리터당 트립톤(tryptone) 10g, 효모추출물 5g, 인산카리움(dipotassium phosphate) 5g, 구연산 암모늄(diammonium citrate) 5g, 설탕 50g, pH 7.0}의 평판배지에 도말하여 25℃ 배양기에서 2 ∼ 3일간 배양한다. 다양한 종류의 덱스트란 생성균이 자라는 바 집락의 모양이 다른 것을 30개 취하여 MRS 평판배지에서 순수 분리한다. 30개의 균주는 버기 매뉴얼(Bergey's manual)의 종 동정법에 의하여 크게 4가지의 집단으로 나뉘어졌는데 그중 가장 큰 집단은 19개의 균주가 포함되어 있다.After making kimchi in the usual way, ferment it at 15 ℃ and take samples up to the kimchi ripening machine at 12 hour intervals, and dilute by 10-fold dilution with sterile physiological saline so that 30 to 300 colonies are formed. 10 g of tryptone per liter, 5 g of yeast extract, 5 g of dipotassium phosphate, 5 g of ammonium citrate, 50 g of sugar, 50 g of sugar, pH 7.0} and plated in a 25 ° C. incubator for 2-3 days Incubate. As various types of dextran-producing bacteria grow, 30 colonies of different shapes are taken and separated from the MRS plate medium. Thirty strains were largely divided into four groups by the Bugy's manual species identification method, the largest of which contained 19 strains.
본 발명에서 사용된 루코노스톡 시트리움 IH22 균주는 19개중의 1균주이다.Luconosstock Citrium IH22 strain used in the present invention is one strain out of 19.
본 발명에서 이용하고 있는 균주는 표 1과 같은 특성을 가지고 있으며 이러한 특성으로 볼때 루코노스톡 시트리움으로 분류될 수 있다.The strain used in the present invention has the characteristics as shown in Table 1 and can be classified as lukonostium citrium in view of these characteristics.
루코노스톡 시트리움 IH22는 불용성 덱스트란을 분비하여 리보즈(ribose) 및 락토즈(lactose)를 이용하지 못하는 균주이다.Luconosstock Citrium IH22 is a strain that secretes insoluble dextran and thus does not utilize ribose and lactose.
상기 균주는 설탕 배지에서 성장률은 0.673 h-1, 더블링 타임(doubling time)은 1.03h으로 다른 유산균에 비해 빠른 성장을 보이고 있다.The strain is 0.673 h -1 in the sugar medium, the doubling time (doubling time) is 1.03h is showing a faster growth than other lactic acid bacteria.
균주의 16S rRNA 유전자 분석 ; 본 발명의 균주는 루코노스톡 시트리움으로 판정되었으나 이것을 명확히 하기 위해 16S rRNA 유전자 배열을 결정하였다.25℃에서 MRS 배지에 배양한 균주를 취하여 염색체를 분리하고 SL-1(5'gagtttgatcctggctcag3') 및 SL-2 탐침(5'agaaaggaggtgatccagcc3')을 이용하여 PCR(polymerase chain reaction)방법을 통해 16S rRNA 유전자의 일부분을 증폭시켰다{Suzuki ＆ Yamasato, FEMS Microbiol. Lett. 115 : 13(1994)}.이 DNA 조각을 pGEM 벡터(Promerga Co)에 삽입하고 DNA 서열을 결정한 결과는 표 2와 같다.16S rRNA gene analysis of strains; The strain of the present invention was determined to be Lukonostium citrium, but to clarify this, 16S rRNA gene sequence was determined. Strains cultured in MRS medium at 25 ° C were taken to isolate chromosomes and SL-1 (5'gagtttgatcctggctcag3 ') and A portion of the 16S rRNA gene was amplified using a polymerase chain reaction (PCR) method using the SL-2 probe (5'agaaaggaggtgatccagcc3 ') {Suzuki & Yamasato, FEMS Microbiol. Lett. 115: 13 (1994)}. Inserting this DNA fragment into the pGEM vector (Promerga Co) and determining the DNA sequence are shown in Table 2.
이 염기서열은 루코노스톡 시트리움 표준균주 KCTC 3526의 염기서열과 비교했을 때 전체 1501 bp중 오직 2군데만 차이가 있었다(99.86% 상동성). 이 서열은 GeneBank에 AF111949의 번호로 등록되어 있다.Compared to the nucleotide sequence of the ruconosstock citrium standard strain KCTC 3526, only two of the 1501 bp sequences differed (99.86% homology). This sequence is registered with GeneBank under the number AF111949.
본 발명의 김치는 아래와 같이 제조한 것이다.Kimchi of the present invention is prepared as follows.
통상의 김치제조방법데로 소금으로 절인 배추에 고춧가루, 마늘 등의 양념을 섞은 다음에 스타터(starter)로서 본 발명의 루코노스톡 시트리움 IH22를 첨가하여 20℃에서 24시간 숙성시킨 것이다.In a conventional kimchi production method, salted cabbage is mixed with seasonings such as red pepper powder, garlic, and the like, and then added to the starter (luconostoke citrium IH22) of the present invention and aged at 20 ° C. for 24 hours.
실시예 1 ; 채 김치Example 1; Chae Kimchi
배추무게 100g을 기준으로 하여 무게비로 무는 20%, 양파는 3.0%, 파, 마늘, 고춧가루는 1.5%, 생강 1.0%, 소금은 정제염(대한산업, 꽃소금)으로 배추무게(g)의 2.8%를 사용하였다.배추와 무는 1.5cm 두께로 채를 썰어서 채 김치 형태로 김치를 제조하였다.사용한 스타터의 양은 MRS 배지, 설탕 배지 또는 김치 배지에서 충분히 배양한 루코노스톡 시트리움 IH22 균주를 배추 1kg당 10㎖ 넣었으며 최종적인 스타터의 양은 보통 106세포/㎖정도 되었다. 김치의 발효온도는 BOD 항온조를 이용하여 20℃를 유지하였다.Based on 100g cabbage weight, 20% of radish, onion, 3.0%, green onion, garlic, red pepper powder, 1.5%, ginger 1.0%, salt is refined salt (Korean industry, flower salt), and 2.8% of the weight of cabbage (g) Chinese cabbage and radish were cut into 1.5cm thick slices to prepare kimchi in the form of kimchi. The amount of starter used was 10 ml / kg of Chinese cabbage, which was grown in MRS medium, sugar medium or Kimchi medium. The final starter volume was about 10 6 cells / ml. Fermentation temperature of kimchi was maintained at 20 ℃ using a BOD thermostat.
김치의 숙성되는 정도는 맛을 보는 동시에 김치 시료의 총 산도 및 pH를 측정함으로서 판단하였다. pH는 김치 시료 20㎖을 취한 후 pH 측정기(Orion,SA720)를 이용하여 측정하였으며 총 산도는 상기 시료중 10㎖을 0.1 N 가성소다 용액으로 pH가 8.9이 되는 시점까지 적정한 후 총산도로 환산하여 측정하였다.The degree of maturation of kimchi was judged by measuring the total acidity and pH of the kimchi sample while having a taste. The pH was measured using a pH meter (Orion, SA720) after taking 20 ml of Kimchi sample, and the total acidity was titrated with 0.1 N caustic soda solution until the pH reached 8.9 and then converted to total acidity. Measured.
김치 제조 후 12시간이 지나면 pH가 4.0 정도가 되며, 24시간 후가 되면 pH 3.8정도의 산성으로 변했다.(도 1 참고)12 hours after the kimchi production, the pH was about 4.0, and after 24 hours, the pH was changed to about pH 3.8 (see FIG. 1).
그 후 4일까지는 pH가 3.8정도로서 전혀 변화하지 않았다. 한편, 스타터를 사용하지 않은 대조 김치의 경우 김치제조 후 3일(72시간)후가 되면 pH 3.8 정도가 되고 그 후 pH는 계속 낮아져 김치 제조 후 5 일(120시간)이 되면 pH 3.5 정도가 되어 김치가 시어지게 된다.Until 4 days thereafter, the pH was about 3.8, which did not change at all. On the other hand, in the case of the control kimchi without the starter, the pH is about 3.8 after 3 days (72 hours) after the production of kimchi, and then the pH is continuously lowered. Kimchi is sour.
또 본 발명의 김치는 김치 제조 후 12시간이 지나면 김치의 총 산도는 약 0.5%가 되며 24시간이 지나면 총 산도가 0.9%정도에 도달하였다.(도 2 참고)In addition, kimchi of the present invention 12 hours after the production of kimchi total kimchi acidity is about 0.5% and after 24 hours the total acidity reached about 0.9% (see Figure 2).
그 후 총 산도는 5일(120시간)까지 1.1% 정도 수준에서 유지되었다. 한편, 스타터를 사용하지 않은 대조 김치의 경우 김치제조 후 3.5일 정도가 지나면 총 산도가 1.1% 수준이 되고 총 산도가 지속적으로 증가하여 5일 후가 되면 총 산도가 1.3% 정도가 되었다.The total acidity was then maintained at the level of 1.1% until 5 days (120 hours). On the other hand, in the case of the control kimchi without the starter, the total acidity was 1.1% after 3.5 days after the production of kimchi, and the total acidity was continuously increased. After 5 days, the total acidity was about 1.3%.
본 발명의 루코노스톡 시트리움 IH22를 이용하여 제조한 김치는 빠른 시간 내에 김치를 산성화 시키기 때문에 다양한 종류의 미생물 성장을 억제하는 장점이 있으며 김치의 숙성 또한 촉진 시키는 특징을 가지고 있다. 김치의 pH는 총 산도와 밀접한 관계가 있으며 김치의 발효정도 및 유산(lactate), 초산(acetate)의 생성정도를 간접적으로 파악하게 하는 기준이다.Kimchi prepared by using the Luconostock citrium IH22 of the present invention has the advantage of inhibiting the growth of various kinds of microorganisms because the acidic kimchi within a quick time and also has the characteristics of promoting the ripening of kimchi. The pH of kimchi is closely related to total acidity, and it is a standard for indirectly determining the degree of fermentation, lactate, and acetic acid.
위의 결과는 본 발명에서 사용한 균주를 스타터로 사용할 경우 김치의 발효를 촉진시키는 반면 발효에 의한 김치의 급격한 산성화를 지연시켜 김치의 보존을 용이하게 하는 장점이 있음을 보여준다.The above results show that when the strain used in the present invention is used as a starter, it promotes fermentation of kimchi while delaying rapid acidification of kimchi by fermentation, thereby facilitating preservation of kimchi.
실시예 2 ; 비트 첨가 채 김치Example 2; Beet kimchi
배추무게 100g을 기준으로 하여 무게비로 무 20%, 풋고추와 양파를 각각 3%, 파, 마늘 1.5%, 생강 1.0% 그리고 김치가 분홍색에서 적색을 띠게 하기 위하여 샐러드용으로 사용하고 있는 비트(red beet)를 1.5%되게 혼합하여 김치를 제조하였다.배추는 1.5cm 정도 두께로 절단하고 무는 채를 썰어서 혼합한 후 그 무게의 3%되게 건염을 뿌려 충분히 절였다. 배추와 무의 전체중량에 대하여 3중량％의 건염을 뿌려 충분히 절였다. 절임수를 제거한 후 양념과 채로 썬 비트를 혼합한 후 여기에 스타터로써 루코노스톡 시트리움 IH22 유산균을 접종하여 20℃에서 발효시켰다.Based on 100g cabbage weight, 20% radish, 3% green pepper and onion, 3% green onion, 1.5% garlic, 1.0% ginger, and beet used for salad to make kimchi red from pink (red beet) ) To make kimchi. The cabbage was cut to about 1.5 cm thick, sliced and sliced, and sprinkled with 3% of its weight. 3 wt% of dry salt was applied to the total weight of the cabbage and the radish, so that it was sufficiently pickled. After removing the pickled water, the sun beet was mixed with the seasoning and then inoculated with Lukonostium Citrium IH22 lactic acid bacteria as a starter and fermented at 20 ° C.
총 김치의 양은 4kg으로 하여 실험하였다.The total amount of kimchi was tested as 4kg.
그 결과 비트를 첨가한 김치는 적색을 띠었으며 전체적으로 발효가 약 2일정도 지연되었으나 pH의 저하 및 총산도의 증가와 같은 발효양상은 비트를 첨가하지 않은 김치와 유사하였다.(도 1, 도 2, 도 3 참고)그리고 루코노스톡 시트리움 IH22를 접종한 김치는 비트를 첨가하지 않은 김치(도 1, 도 2, 참고)와 같이 pH 3.5, 총산도 1% 정도 도달되는데는 1일 정도 빨랐으며, 그 이후 이 수치는 7일까지 유지되었다.As a result, the kimchi added with beet was red and the fermentation was delayed by about 2 days as a whole, but the fermentation patterns such as a decrease in pH and an increase in total acidity were similar to kimchi without added beet. 3) And kimchi inoculated with Lukonostium Citrium IH22 was about 1 day faster to reach pH 3.5 and total acidity of about 1%, as in kimchi without beets (Fig. 1, Fig. 2). Since then, this figure has been maintained for seven days.
본 발명의 비트 첨가 채 김치는 김치샐러드의 특징을 갖고 있다.Kimchi with beet added of the present invention has the characteristics of kimchi salad.
실시예 3 ; 비트 첨가 김치 쥬스Example 3; Beet Kimchi Juice
실시예 2에서 사용한 원료와 양념을 같은 비율로 혼합하여 착즙기로 짜서 적색의 야채즙을 만들었다. 이 야채즙과 절임수를 1 : 1비로 혼합하여 잘 섞은 다음에 루코노스톡 시트리움 IH22 유산균을 접종하여 20℃에서 발효시켰다. 총 쥬스의 양은 2ℓ로 하여 실험하였다.The raw material and the seasoning used in Example 2 were mixed in the same ratio, and squeezed with a juicer to make a red vegetable juice. The vegetable juice and pickled water were mixed at a ratio of 1: 1, and then mixed well, and then inoculated with Lukonostium Citrium IH22 lactic acid bacteria and fermented at 20 ° C. The total juice amount was 2L.
그 결과 비트를 첨가한 김치 쥬스는 적색을 나타냈으며 pH는 4일째 3.2정도로 되었으며 그 후 7일까지 유지되었다. 특징적으로 루코노스톡 시트리움 IH22를 첨가한 쥬스는 발효 3일째 총산도가 0.5%로 되었으며, 비트 첨가한 김치보다 총산도가 반으로 감소되었다(도 4 참고).As a result, the kimchi juice with beet showed red color and the pH was about 3.2 on the 4th day and maintained until 7 days thereafter. Characteristically, the juice added with Luconostock Citrium IH22 had a total acidity of 0.5% on the third day of fermentation, and the total acidity was reduced by half than kimchi added with beets (see FIG. 4).
비트와 루코노스톡 시트리움 IH22를 이용하여 제조한 본 발명의 채 김치와 김치 쥬스는 적색을 띠었으며 낮은 pH와 가식범위의 총산도가 되었다.그리고 공통적으로 비트 첨가한 김치는 관능검사에서 김치냄새와 풋냄새가 약하거나 거의 나지 않았으며 신맛도 약하게 나타났다. 특히 김치와 쥬스의 색조가 적색을 나타냄으로써 시각적인 면에서 좋은 평가를 받았으며 기호도가 높았다.The kimchi and kimchi juice of the present invention prepared using beet and luconostock citrium IH22 have a red color and have a low pH and total acidity in the range of edible range. The smell was weak or almost no smell, and the sour taste was weak. In particular, the color of kimchi and juice showed red color, so it was well received visually and highly palatable.
내산성, 담즙산에 대한 내성 및 인공위액에 대한 내성조사 ; 본 발명에서 이용하고 있는 균주가 김치와 함께 사람의 대장에 도달하는 정도에 대한 간접적인 평가를 하기 위해 산, 담즙산 및 인공위액에 대한 저항성을 조사하였다.Acid resistance, resistance to bile acids and resistance to artificial gastric juice; In order to indirectly assess the extent to which the strain used in the present invention reaches the large intestine of humans with kimchi, resistance to acids, bile acids and artificial gastric juice was investigated.
◎ 내산성 시험은 본 발명에서 이용하고 있는 균주를 설탕 액체배지에서 2일간 배양하여 덱스트란을 생성하게 한 후 그 배양액을 1㎖씩 취하여 pH 3, pH 4 인 0.05 M 시트르산 - 시트르산염 완충액 10㎖에 접종하여 25℃에서 배양하며 12시간 간격으로 생균수를 측정하였다.◎ Acid resistance test was performed by incubating the strain used in the present invention in a sugar liquid medium for 2 days to produce dextran, and then 1 ml of the culture solution was added to 10 ml of 0.05 M citric acid-citrate buffer having pH 3 and pH 4. Inoculation was incubated at 25 ° C. and the number of viable cells was measured at 12 hour intervals.
본 발명의 균주는 pH4 용액에서는 1일 동안 배양하더라도 약 70% 정도는 살 수 있는 것으로 나타났으며, pH 3에서는 1일 동안 배양했을 때 약 40%가 생존할 수 있으며 pH 3에서 12시간 배양했을 때는 약 60% 정도 생존할 수 있는 것으로 나타났다(도 5 참고).The strain of the present invention was found to be able to survive about 70% even if incubated for 1 day in pH4 solution, about 40% when incubated for 1 day at pH 3 and 12 hours at pH 3 About 60% can survive (see Figure 5).
음식물의 위 내에서의 체류시간이 30분 정도인 점을 감안할 때 pH 3인 환경에서 12시간동안 생존율이 60% 이상 된다는 사실은 바로 IH22 균주는 위(stomach)를 통과하는 동안에 대부분이 생존 할 수 있다는 점을 보여주고 있다.Given that the residence time in the stomach of the food is about 30 minutes, the survival rate is more than 60% for 12 hours in an environment of pH 3, which is why most of the IH22 strain can survive the passage of the stomach. It shows that there is.
◎ 담즙산 내성시험은 MRS 배지에 oxgall을 최종농도가 1% 및 4% 되게 첨가한 후 시험 균주를 접종하여 25℃에서 3일간 배양하여 성장여부를 판단하였다.◎ Bile acid resistance test was added to the final concentration of 1% and 4% oxgall in MRS medium and inoculated with the test strain was incubated for 3 days at 25 ℃ to determine whether the growth.
본 발명의 IH22 균주는 1% 및 4%의 oxgall 첨가 배지에서 모두 성장함으로서 담즙산에 대한 내성을 나타내었다. 따라서 IH22 균주는 인체의 담즙산에 의해 성장이 억제되지 않는 것으로 판단된다.The IH22 strain of the present invention showed resistance to bile acids by growing in both 1% and 4% oxgall addition medium. Therefore, IH22 strain is judged that the growth is not inhibited by the bile acid of the human body.
◎ 인공위액에 대한 내성조사는 MRS 액체배지 10㎖을 pH 2.5되게 조정한 후 펩신(pepsin)을 1000unit/㎖이 되도록 첨가하고 이 인공위액에 설탕 배지에서 배양한 균주를 1%되게 첨가하여 37℃에서 반응시키며 생균수를 관찰하였다.◎ To investigate the resistance to artificial gastric juice, adjust 10 ml of MRS liquid medium to pH 2.5, add pepsin to 1000 units / ml, and add 1% of the strain cultured in sugar medium to 37 ℃ Reacted at and observed the viable count.
설탕 배지에서 전 배양한 IH22 균주는 인공위액에서 30분 후 약 60%정도 생존하였으며 3시간 후에도 생균수가 크게 감소하지 않았다(도 6 참고).IH22 strain pre-cultured in sugar medium survived about 60% after 30 minutes in artificial gastric juice, and viable cell count did not decrease significantly after 3 hours (see FIG. 6).
한편 MRS 배지에서 전 배양한 IH22 균주는 인공위액에서 30분 후 약 40% 정도 생존하였고 3시간 후에는 생존한 균수가 발견되지 않았다.On the other hand, IH22 strains pre-cultured in MRS medium survived about 40% after 30 minutes in artificial gastric juice, and no viable cells were found after 3 hours.
이러한 결과는 IH22 균주를 설탕 배지에서 전 배양할 경우 인공위액에 대한 내성을 증가시킬 수 있음을 보여주는 것이다.These results show that the pre-culture of the IH22 strain in sugar medium can increase the resistance to artificial gastric juice.
루코노스톡 시트리움 IH22 균주를 스타터로 사용하여 제조된 본 발명의 채 김치는 숙성시간이 24시간으로 단축 되었으며, 숙성후의 총 산도가 5일이 될때까지 1.1정도로 유지되므로 김치 고유의 풍미를 5일까지 유지할 수 있게 되어서 김치의 보존성도 향상된다. 아울러 본 발명의 채 김치는 숙성시간이 단축되므로 김치에 유해한 미생물의 성장이 억제된다.Cha kimchi of the present invention prepared by using the leuconotium citrium IH22 strain as a starter was shortened to 24 hours of aging, and maintained at about 1.1 until the total acidity after aging was 5 days so that the unique flavor of kimchi was 5 days. It is possible to keep up to improve the preservation of kimchi. In addition, the kimchi of the present invention is shortened the ripening time, so the growth of harmful microorganisms to kimchi is suppressed.
또 본 발명의 채 김치는 내산성, 담즙산 및 인공위액에 대한 내성이 우수하기 때문에 대장 내에서 유산균에 의한 정장적용도 활성화 될 수 있다.In addition, because kimchi of the present invention has excellent resistance to acid resistance, bile acids and artificial gastric juice can be activated by lactic acid bacteria in the large intestine.
또 본 발명의 비트 첨가 채 김치는 김치냄새와 풋냄새가 거의 없고, 신맛도 약하므로 샐러드처럼 먹을 수 있으며, 상기 비트 첨가 채 김치와 본 발명의 비트 첨가 김치쥬스는 색조가 분홍색 내지 적색이므로 시각적으로도 기호도를 높일 수 있는 장점이 있다.In addition, the beet added kimchi of the present invention is almost no kimchi smell and green smell, and sour so weak that you can eat like a salad, the beet kimchi and the beet added kimchi juice of the present invention visually because the color tone is pink to red There is an advantage that can increase the degree of degree.
Claims (4)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1019990008008A KR100330674B1 (en) | 1999-03-10 | 1999-03-10 | Sliced Kimchi and Kimchi Juice made by using Leuconostoc citreum IH22 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1019990008008A KR100330674B1 (en) | 1999-03-10 | 1999-03-10 | Sliced Kimchi and Kimchi Juice made by using Leuconostoc citreum IH22 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR19990083667A KR19990083667A (en) | 1999-12-06 |
| KR100330674B1 true KR100330674B1 (en) | 2002-04-03 |
Family
ID=37479267
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1019990008008A KR100330674B1 (en) | 1999-03-10 | 1999-03-10 | Sliced Kimchi and Kimchi Juice made by using Leuconostoc citreum IH22 |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR100330674B1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100388866B1 (en) * | 2001-01-18 | 2003-06-25 | 주식회사 두산 | Method for producing kimchi using heat-sensitive lactic acid bacteria strains, the strains Leuconostoc mesenteroides ZK1 and Leuconostoc mesenteroides ZK2, and isolating method thereof |
| KR100418687B1 (en) * | 2000-10-02 | 2004-02-11 | (주)파마바이오 | METHOD FOR PREPARING KIMCHI CONTAINING γ- AMINO BUTYLIC ACID IN GREAT QUANTITIES |
| WO2011007924A1 (en) | 2009-07-16 | 2011-01-20 | 씨제이제일제당(주) | Novel leuconostoc citreum and fermented foods using the same as a starter, and compositions thereof |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100453376B1 (en) * | 2002-10-15 | 2004-10-15 | 박현근 | Culture Medium for Lactic Acid Bacteria Prepared from Chinese Cabbage Wastes |
| KR100453375B1 (en) * | 2002-10-15 | 2004-10-15 | 박현근 | Method for Producing Leuconostoc gasicomitatum by Fermenting Chinese Cabbage |
| KR20050041808A (en) * | 2003-10-31 | 2005-05-04 | 한국생명공학연구원 | Leuconostoc citreum km20 that can suppress the growth of pathogenic microorganisms and suppressed tumour growth |
| KR100722980B1 (en) | 2005-06-27 | 2007-05-30 | 안충기 | Method for production of houttuynia decoction fermentation product using Leuconostoc sp. |
| KR100814665B1 (en) * | 2006-12-08 | 2008-03-26 | 계명대학교 산학협력단 | 5 Leuconostoc citreum S5 producing dextran and production of fermentation product comprising the dextran |
| KR102353269B1 (en) * | 2021-03-17 | 2022-01-20 | (주)비비씨 | Liquid kimchi, liquid kimchi concentrate and liquid kimchi powder and making method of it |
-
1999
- 1999-03-10 KR KR1019990008008A patent/KR100330674B1/en not_active IP Right Cessation
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100418687B1 (en) * | 2000-10-02 | 2004-02-11 | (주)파마바이오 | METHOD FOR PREPARING KIMCHI CONTAINING γ- AMINO BUTYLIC ACID IN GREAT QUANTITIES |
| KR100388866B1 (en) * | 2001-01-18 | 2003-06-25 | 주식회사 두산 | Method for producing kimchi using heat-sensitive lactic acid bacteria strains, the strains Leuconostoc mesenteroides ZK1 and Leuconostoc mesenteroides ZK2, and isolating method thereof |
| WO2011007924A1 (en) | 2009-07-16 | 2011-01-20 | 씨제이제일제당(주) | Novel leuconostoc citreum and fermented foods using the same as a starter, and compositions thereof |
| US20120100256A1 (en) * | 2009-07-16 | 2012-04-26 | Bong Joon Kim | Novel leuconostoc citreum and fermented foods using the same as a starter, and compositions thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| KR19990083667A (en) | 1999-12-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5044769B2 (en) | Lactic acid bacteria Lactobacillus sakei strain, beverage manufacturing method, food manufacturing method, pickled bed manufacturing method, bread making raw material manufacturing method | |
| KR20010078325A (en) | Lactic acid bacterial fermentation products and manufacturing method thereof | |
| KR100330674B1 (en) | Sliced Kimchi and Kimchi Juice made by using Leuconostoc citreum IH22 | |
| JP4041850B2 (en) | A novel lactic acid bacterium that shows good growth at low temperatures, high nisin production, excellent saccharide utilization, produces γ-aminobutyric acid, and uses γ-aminobutyric acid in high production methods and techniques for preventing alcohol from burning out. | |
| KR101282968B1 (en) | Fermented pickle using homofermentive lactic acid bacteria and method of manufacturing the same | |
| KR101485539B1 (en) | A manufacturing method of kimchi comprising the fermented solution of whangchil and whangchil kimhi having the enhanced hardness manufactured therefrom | |
| KR100736835B1 (en) | Method for preparing old ripening kimchi using starter of microorganism | |
| KR101427415B1 (en) | Lactic acid bacterium separated from kimchii and fermented food using the strain | |
| CN105533577A (en) | Method for preparing vegetable-fermented product | |
| JP3091196B1 (en) | Method for producing pickles using lactic acid bacteria | |
| KR101746826B1 (en) | Method for Preparing Soy Sikhye Yogurt and the Soy Sikhye Yogurt Prepared by the Same Method | |
| KR102255983B1 (en) | Method for preparing long-term fermented kimchi by using lactobacillus sakei sc1 and long-term fermented kimchi prepared thereby | |
| KR101453837B1 (en) | Starter for Fermentation of a Korean Long-Term Ripened Kimchi comprising Saccharomyces servazzii MY7 and Lactobacillus curvatus ML17 as active ingredients | |
| KR20230019483A (en) | Leuconostoc mesenteroides PBio03 and methods for preparing kimchi using the same | |
| KR101481793B1 (en) | The method of Cottage cheese preparation containing ornithine using the strain of Pediococcus pentosaceus AYO-1 having ornithine production capacity | |
| KR100454591B1 (en) | A novel strain of Weisella, Weisella koreensis, and method for preparation of kimchi using this strain | |
| KR102229553B1 (en) | A Novel Lactobacillus paracasei ML7 and methods for preparing kimch using the same | |
| CN108402426A (en) | A kind of preparation method of rapid lactic acid fermentation mixed nuts soy preserved radish | |
| KR102240109B1 (en) | A Novel Bacillus subtilis TSD and methods for preparing Doenjang using the same | |
| KR101414163B1 (en) | Preparation Method for Korean Long-Term Ripened Kimchi Using Starter for Fermentation of a comprising Saccharomyces servazzii MY7 and Lactobacillus curvatus ML17 | |
| KR101513014B1 (en) | Obtained from Kimchi Lactobacillus plantarum K-1 using Functional food radish kimchi prepared using the method of functional | |
| JP5478692B1 (en) | Novel fermented flavor liquid and food containing the fermented flavor liquid | |
| KR100232907B1 (en) | Method for promoting growth of lactic acid bacteria by adding yam | |
| KR0160095B1 (en) | The preparation of fermentation beverage having a good flavor watery radish kimchi | |
| KR100388866B1 (en) | Method for producing kimchi using heat-sensitive lactic acid bacteria strains, the strains Leuconostoc mesenteroides ZK1 and Leuconostoc mesenteroides ZK2, and isolating method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| G15R | Request for early opening | ||
| N231 | Notification of change of applicant | ||
| E902 | Notification of reason for refusal | ||
| AMND | Amendment | ||
| E801 | Decision on dismissal of amendment | ||
| E601 | Decision to refuse application | ||
| AMND | Amendment | ||
| J201 | Request for trial against refusal decision | ||
| AMND | Amendment | ||
| B701 | Decision to grant | ||
| GRNT | Written decision to grant | ||
| FPAY | Annual fee payment |
Payment date: 20130318 Year of fee payment: 12 |
|
| FPAY | Annual fee payment |
Payment date: 20140318 Year of fee payment: 13 |
|
| FPAY | Annual fee payment |
Payment date: 20160317 Year of fee payment: 15 |
|
| FPAY | Annual fee payment |
Payment date: 20180319 Year of fee payment: 17 |
|
| EXPY | Expiration of term |