KR100316464B1 - Novel recombinant endoinulinase gene and its expression vector of Aspergillus sp. strain and tranformant using the same - Google Patents

Abstract

The present invention relates to a gene sequence of a novel recombinant Aspergillus endoinulinase that degrades inulin to produce oligo fructose. Aspergillus picum ATCC 16882 is an endinulinase that makes oligosaccharide from inulin. Purified from Aspergillus ficuum ATCC 16882, the gene was cloned, the gene sequencing was determined, the gene was introduced into the microorganism and cultured to express a large amount of recombinant endonininase. It has an excellent effect of producing high purity oligosaccharides from.

Description

Novel recombinant endoinulinase gene and its expression vector of Aspergillus sp. strain and tranformant using the same}

The present invention relates to a novel recombinant Aspergillus endoinulinase gene, an expression vector thereof, and a transformed microorganism using the same that degrade inulin to produce oligosaccharides. More specifically, the present invention relates to a gene of recombinant Aspergillus endonininase that degrades inulin to produce oligosaccharides, an expression vector into which the gene is introduced, and a microorganism transformed with the expression vector.

Conventionally, the method of producing oligosaccharides from sugar using fructosyltransferase is mainly used by Meiji Seka of Japan, Korea's first sugar, Samyang Genex, Sewon, and others. However, these methods use price-dependent sugars as the main raw material, which can lead to price fluctuations due to external dependence of resources and because glucose is produced as a by-product of the manufacturing process. Should be added. Inulin, which is present in many plants, is a polymer of fructose, with one glucose bound to about 30 to 60 fructose molecules, which can produce an almost pure oligosaccharide if it is broken down. What's more, the main plants that contain high levels of inulin (about 80% of total dry matter), such as pork potatoes, chicory, and dahlia bulbs, grow not only on poor soils, but also because their yield per unit area is high compared to potatoes or corn. In Korea, there is an advantage that can be mass-produced through contract cultivation. Inulin and its oligosaccharides, which are found in more than 30,000 plants, including onions, have been ingested by humans for thousands of years, so they are not toxic to humans. In Europe, these products are used in ice cream, sweets and yogurt. Currently there are two inulin and oligosaccharide manufacturing plants in Belgium, producing inulin and oligosaccharides from chicory. Currently, the main source of endoinulinase is fructozyme produced by Novo A / S, Denmark^R(Fructozyme^RAspergillus Picum ATCC 16882 () byAspergillus ficuumATCC 16882 (Norman, B.E. and Hojer-Pedersen, B. (1989), The production of fructooligosaccharides from inulin orsucrose using inulinase or fructosyltransferase fromAspergillus ficuum, Denpun Kagaku,36(2), 103-111). However, this fructozyme^R(Fructozyme^R) Can not make oligosaccharides from inulin because exoinulinase, which is cut from the end of fructose, is mixed with endoinulinase. Therefore, only endonulinase (endoinulinase) must be separated from the mixed enzyme solution, and the process is not easy and expensive. So, we take the first step Aspergillus Picum ATCC 16882Aspergillus ficuumThe gene sequence expressing endinulinase of ATCC 16882) was first disclosed. By identifying the gene sequence, it is possible to express this enzyme in other strains without exoinulinase, thus eliminating the process cost of separating endinulinase and inexpensive mass production of the enzyme. Was done.

Accordingly, it is an object of the present invention to provide a gene sequence of a recombinant endinulinase enzyme capable of commercially producing oligosaccharides from inulin. Another object of the present invention is to provide a recombinant vector into which the gene of the recombinant endonininase enzyme is inserted. Still another object of the present invention is to provide a microorganism transformed by introducing the recombinant vector.

The above object of the present invention is to isolate and purify the enzyme aspergillus ficuum endoinulinase ( Aspergillus ficuum endoinulinase) enzyme from Aspergillus picum ATCC 16882 to identify a sequence of amino acids from the synthesis of degenerated primer (degenerated primer) from the specific restriction enzyme a Kpn I to chromosome DNA (chromosomal DNA) pressing the cut endoyi Lena kinase (endoinulinase) endoyi press Lina kinase has been inserted and then to find the gene which it was coupled to pUC19 to transform the E. coli DH5α (transformation) containing A new vector, pINU21, was made and subcloned again to reveal the 2,230 bp gene sequence, including the recombinant endonininase gene and its promoter and terminator. .

1 is a gene map showing the location of the press endoyi Lena kinase (endoinulinase) of restriction enzyme Kpn I fragment maps and endoyi press Lina dehydratase gene containing the gene.

Figure 2 shows the nucleotide sequence of the endoinulinase gene.

Figure 3 shows the amino acid sequence encoded by the nucleotide sequence of the endoinulinase gene.

The present invention comprises the steps of purifying enzymes from Aspergillus ficuum ATCC 16882, which secrete both endinulinase and exoinulinase; Analyzing an amino acid sequence inside the purified enzyme; PCR was performed using the primers prepared from the analyzed amino acid sequence, and the gene sequence of the PCR product was confirmed. From this, a PCR primer capable of selectively detecting endoninase was again prepared, and the PCR reaction was carried out with the PCR primer. Performing a step of preparing a probe for detecting endonininase in Southern hybridization; Genomic DNA (DNA genomeic) the step of cutting a number of restriction enzymes to make a restriction enzyme map (restriction enzyme map) Kpn I enzyme is confirmed by pressing the cut the Lena dehydratase gene endoyi at the appropriate position; Cut with Kpn I restriction enzyme by combining the genomic DNA in pUC19 was synthesized new pINU21 vector was transformed to E.coli DH5α endoyi introduced in the step of cloning a press Lina dehydratase gene; Wherein by the pINU21 vector each Kpn I + Bgl II, Eco RV + Kpn I, Xho I + Bgl II, ligated (ligation) to the Xho I + rear cut into Eco RV pBluescript Ⅱ KS (+) to create a sub-cloning vector again Subcloning the recombinant endonininase gene by transforming E. coli DH5α; Sequencing the recombinant endonininase using T3 and T7 primers of the subcloning vector and M13 and reverse primers of the cloning vector.

Hereinafter, specific examples for elucidating the nucleotide sequence of the recombinant endonininase gene of the present invention and preparing a transformant will be described in detail by way of examples, but the scope of the present invention is not limited to these examples.

Example 1 Aspergillus picum endoinulinase ( Aspergillus ficuum endoinulinase) Purification and Enzyme Characterization

The analysis of endoninulinase and sucrase is described by Uhm et al. (Uhm, TB, Jeon, DY, Byun, SM, Hong, JS, and GrootWassink, JWD (1987) Purification and properties of β-fructofuranosidase from Aspergillus niger , Biochim. Biophys. Acta. 926, 119-126) and the raw material of the purified enzyme was a culture concentrate of Aspergillus ficuum ATCC 16882. Purification of enzymes from culture concentrates is described by Yun et al. (Yun, JW, Kim, DH, Uhm, TB, and Song, SK (1997) Production of high-content inulooligosaccharides from inulin by a purified endoinulinase, Biotechnology Letters 19 (9), 935 -938). After purification, SDS-PAGE showed two bands with molecular weight of 64,000 and 66,000. However, when each formation band was treated with endoglycosidase F, the molecular weight was about 62,000. The formation band was found to be the same protein caused by the difference in degree of glycosylation. In addition, the molecular weight of the native endoinulinase by HPLC gel filtration column (HPLC gel filtration column) was 54,000, it can be seen that the endoninase is a protein consisting of one polypeptide (polypeptide). The activity of the final purified enzyme was 370 U / mg.

To investigate the mechanism of hydrolysis of inulin by this enzyme, enzyme (2 U in 10 μl H₂O) was added to 1 mL dahlia inulin (10% w / v), and reacted at 50 ° C., followed by hourly extraction. Bio-Gel P-2 column (1.6 cm × 90 cm) equilibrated with water at 8.4 ° C./min and 65 ° C. , Bio-Rad) and each peak was separated by a refractive index detector (Shimadzu Model RID-6A) and freeze-dried. These fractions are D₂Melt in O¹³C- and^OneThe structure was confirmed by H NMR (JEOL Model JNM-EX 400). As a result, the purified enzyme showed almost absolute substrate specificity only for inulin and inulooligosaccharides, and inulin mainly produced inulotriose and inulotetraose as final products. Km and Vmax for inulin hydrolysis were 8.1 mM and 773 U / mg. Therefore, Aspergillus picum (Aspergillus ficuum) The enzyme purified from the crude enzyme solution was confirmed to be an endinulinase that cuts inulin into endo-cleavage.

Example 2: Amino Acid Sequence Analysis of Endonininase Peptide Fractions

Purified enzyme (125 μg in 125 μl H ₂ O) was dissolved in 15 μl 1 M Tris-HCl containing 1% SDS and 1% β-mercaptoethanol, followed by 1.25 μg lysyl endopeptidase (lysyl). endopeptidase) was added and reacted at 37 ° C. for 6 hours. When cutting 125 μg purified enzyme with trypsin, 1.25 μg trypsin was added and reacted at 37 ° C. for 4 hours. After the reaction was dried in vacuo and it was dissolved in 1% trifluoroacetic acid solution and injected into a Vydac C ₁₈ reverse phase column. At this time, the separation conditions were used concentration gradient of 0% ~ 100% acetonitrile (acetonitrile) for 100 minutes at 1.0 mL / min flow rate. Amino acid sequence analysis by Edman degradation was performed using a pulsed liquid or gas phase protein sequencer (Applied Biosystems, Perkin Elmer Division, Foster City, Ca). As a result, three trypsin degradation products and three lysyl endopeptidase degradation products were obtained from the purified enzyme, and the amino acid sequence of each product was as follows.

Trp1; DFDGALSWVNVPASD

Trp2; IIAAVMNSYGSNP

Trp3; LAFSXDXGATW

Lys1; KFQGNPIISTSQEAPXDITGGLE

Lys2; KVFFHRQSGNWIMVLAHGGQ

Lys3; KSFTADPVDASTMWLD

Where X is an unidentified amino acid

Example 3: Probe Construction for Cloning Endonininase Gene

Based on DFDGAL, which is part of the peptide sequence (peptide 1) obtained from the amino acid sequence, and WMNDPNG, the amino acid sequence best conserved in the known fructofuranosidases (invertase, exoinulinases) 2 Dog degenerated primers were synthesized. The base sequences of these degenerate primers P1 and P2 are as follows.

P1: 5 'GGGAATTCTGGATGAAYGAYCCNAAYGG 3'

P2: 5 'GGGAATTCSARRGCRCCRTCRAARTC 3'

PCR was performed on Aspergillus picum ATCC 16882 (Aspergillus ficuumATCC 16882) using chromosomal DNA as a template, 95 ℃ 3 min, 35 cycles (94 ℃ 30 sec → 43 ℃ 30 sec → 72 ℃ 30 sec], 72 ℃ 3 min extension Proceed under conditions. The PCR product was isolated, ligated to the pGEM-T vector, transformed, plasmids were isolated, and inserts were sequenced. As a result, an endonininase partial sequence of 842 bp was obtained. From this sequence, it was found that WMNDPNG, a conserved region, and some sequences known in the amino acid sequence analysis of Example 2 were well matched.

Therefore, we decided to use this partial sequence to determine the full sequence of the A. ficuum endoinulinase gene from the genomic DNA library. In order to obtain a PCR product probe that can be selectively identified only in the endoninulinase gene, a new PCR primer is raised in this partial DNA sequence, since it is an amino acid sequence commonly present in fructofuranosidases and the like. (Oligo program) was used again. As a result, two suitable primers were obtained and PCR conditions were 95 ℃ 3 min, 35 cycles (94 ℃ 30 sec → 50 ℃ 30 sec → 72 ℃ 30 sec], 72 ℃ 3 min extension It was made.

INUP: 5 'CCTGGCACCTGTTCTTTCAA 3'

INLW: 5 'TGGTCTCCTCAGTGCCTTCA 3'

As a result of PCR, a single band of 650 bp was obtained, which was extracted from the gel and used as a probe for isolation of endonininase gene.

Example 4 Preparation of Genomic DNA

A. ficuum was inoculated in 100 mL YM broth (Difco), incubated for 24 hours, squeezed in Miracloth, and then added to liquid nitrogen and ground in powder to lysis buffer. After pipetting several times, phenol extraction and ethanol precipitation were followed by purification and electrophoresis by CsCl density gradient centrifugation. As a result, it was confirmed that genomic DNA was prepared well without being degraded.

Example 5: Screening of Restriction Enzymes for Endoninulinase Gene Isolation

Since the restriction enzyme to be used should not cut the partial sequence of the endoinulinase gene found in Example 3, it was searched using DNASIS (Hitachi software, Japan) program to know the type of restriction enzyme that does not cut the partial sequence. . The genomic DNA was cut from the program using at least the restriction enzymes Bgl II, Kpn I, Hind III, Eco RV, Pvu II, Sac I, Sal I, Sma I, Xba I, which do not cut this sequence. The 650bp probe prepared by PCR amplification in Example 3 was randomly labeled using α- ³² P-dCTP. This was followed by Southern hybridization. Experimental results showed that bands were cut at 3.4 kb, Kpn I 2.7 kb, Hind III 10 kb, Eco RV 4.5 kb, Pvu II> 12 kb, Sac I> 12 kb, Sal I 12 kb, Sma I 8 kb, and Xba I 12 kb when cut with Bgl II. Seemed. Although it contains the endonininase gene, it was necessary to know the restriction enzyme cleavage site around 850 bp in order to insert the smallest insert into the vector. So, genomic DNA was cut with a combination of two restriction enzymes ( Bgl II + Kpn I, Bgl II + Eco RV, Bgl II + Sma I, Kpn I + Eco RV, Kpn I + Sma I, Eco RV + Sma I). Southern hybridization was performed. Experimental results, restriction map PCR probe of 650 bp in (Restriction enzyme map) was confirmed that in each segment of the Kpn I and Bgl II, Penny room Solarium endoyi press Lina kinase (Penicillium endoinulinase) sequence and the other fructo furanyl it can be seen that no let kinase (fructofuranosidases) in a well of a conserved amino acid sequence WMNDPNG in SEQ ID nO: cloning of endoyi press Lina azepin considering that it is close to the N-terminal of (cloning), the Bgl II than Kpn I a suitable restriction enzyme .

Example 6 Cloning of Endonininase and Comparison of Identity with Other Endoninaseases According to Sequence Determination

Experimental Example 1: Cloning of Endonininase Gene

About 2.5 kb fragments of genomic DNA cut with restriction enzyme Kpn I were extracted from the gel, ligated to pUC19 vector also cut with restriction enzyme Kpn I and introduced into E. coli DH5α for transformation. After colonies were grown, they were transferred to Hybond N + (Amersham) and colony hybridized using a labeled PCR probe. In the first screening, we obtained two colony spots presumed to have endonininase genes, and many screenings were performed after colonies matching the spots. Colony spots were obtained. The colonies were grown in LB medium containing ampicillin (ampilicin) and then plasmid pINU21 was isolated and the restriction enzyme Kpn I was reacted to remove only 2.5 kb inserts.

At this time, the transformed E. coli containing the plasmid pINU21 was named E. coli DH5α / pINU21, and was deposited with the accession number KCCM-10130 on June 26, 1998 at the Department of Food Science and Engineering, Yonsei University.

Experimental Example 2: Subcloning of Endonininase Gene

For subcloning, the plasmid was cut into Xho I, Bgl II, Eco RV, Xho I + Bgl II, Xho I + Eco RV, Bgl II + Eco RV and subjected to electrophoresis. From this, four subcloning vectors were created.

(1) pBluescript Ⅱ KS (+ ) (Stratagene) to Kpn I and rear cut into Bam HI of about 3.5 kb size fragments eluted (elution) to and caused fragment of approximately 300bp in size when jalrateul the pINU21 this with Kpn I and Bgl II And ligation.

(2) pBluescript Ⅱ KS (+ ) to Eco RV and back cut into Kpn I 3.5 kb elution (elution) the size of fragments, and caused approximately 400bp size fragments when it jalrateul the pINU21 with Eco RV and Kpn I and ligated ( ligation).

(3) pBluescript II KS (+) was cut into Xho I and Bam HI, followed by elution of 3.5 kb fragments, which were then cut into ligation and ligation of approximately 800 bp in size when pINU21 was cut with Xho I and Bgl II. ligation).

(4) The pBluescript II KS (+) was cut into Xho I and Eco RV, followed by elution of 3.5 kb fragments, and the fragments and ligation of about 800 bp generated when pINU21 was cut with Xho I and Eco RV. (ligation).

The vectors were introduced into E. coli DH5α, transformed to obtain insert-containing colonies, and each of these colonies was cultured, and then the insert-containing plasmids were isolated and provided for the next experiment.

Experimental Example 3: Endonininase Sequencing

T3 and T7 primers in the pBluescript II KS (+) vector subcloned in Experimental Example 2 were sequenced using an ABI PRISM 377 DNA sequencer (Applied Biosystems) in both directions of the inserted DNA. In addition, the sequencing was performed using the M13 forward primer and the reverse primer in the pINU21 vector in the same manner, and the portions that were not partially read during sequencing were newly primers based on the sequence of adjacent sites. After synthesis it was sequenced again. The linkage and analysis of these sequences was performed using the DNASIS program, and as a result, as shown in FIG. 2, a completely identical sequence was obtained, and a gene including a 2230 bp total endonininase was identified. An open reading frame (ORF) of 1551 bp encoding endonininase was obtained, which includes a signal peptide consisting of 22 amino acids and an endoinul consisting of 493 amino acids, as shown in FIG. 3. It contained linase protein. The sequence results of the amino acids derived from the gene sequences were shown to be 100% consistent with the results obtained from the amino acid sequence analysis of Example 2.

Experimental Example 4: Comparison of Sequence Identity with Other Endoinulininase Genes

The endonininase gene known to date is pelicillium perfurogogenum (Penicillium purpurogenum(Onodera, S., Murakami, T., Ito, H., Mori, H., Matsui, H., Honma, M., Chiba, S. and Shiomi, N. (1996) Molecular cloning and nucleotide sequences of cDNA and gene encoding endo-inulinase fromPenicillium purpurogenum,Biosci. Biotech. Biochem. 60 (11), 1780-1785) were the only ones. Penicillium perfuruginumPenicillium purpurogenum)And Aspergillus picumAspergillus ficuum)Comparing the endoinulinase gene and amino acid sequence showed 61.4% of the gene and 72.7% of the amino acid.

The present invention purifies the endonininase that makes oligosaccharides from inulin as described through Examples and Experimental Examples from Aspergillus ficuum , clones the gene, and determines the gene sequence. Introduced and cultivated in yeast or other molds to express large amounts of recombinant endonininase, and the expressed large amount of recombinant endonininase has the effect of producing high purity oligosaccharides from inulin, and the produced oligosaccharides are easily obtained Since it is possible to manufacture from the effect of lowering the fructose production price is a very useful invention in the food industry.

Claims (5)

Gene sequence of the recombinant endonininase as described below separated from the genus Aspergillus . The amino acid sequence of the recombinant endonininase as follows isolated from the genus Aspergillus. A recombinant endoninase having a gene sequence encoding the recombinant endonininase according to claim 2 isolated from the genus Aspergillus. Recombinant vector pINU21 comprising a DNA fragment having a nucleotide sequence encoding the recombinant endonininase according to claim 2 isolated from the genus Aspergillus. Recombinant vector pINU21 comprising a DNA fragment having a nucleotide sequence encoding the recombinant endonininase of claim 2 isolated from the genus Aspergillus was introduced into E. coli DH5α, transformed and cloned to obtain colonies. The plasmid pINU21-containing transgenic bacterium E. coli DH5α / pINU21 (Accession No. KCCM-10130), wherein the colony was grown in ampicillin-containing medium again to obtain plasmid pINU21 from the medium.