KR100261856B1 - Nucleotide sequence encoding the tumor rejection antigen precursor, mage-1 - Google Patents

Abstract

The present invention relates to an isolated DNA sequence encoding an antigen expressed by tumor cells that is recognized by cytotoxic T cells and causes lysis of the tumor expressing the antigen. Also described are various therapeutic and diagnostic uses resulting from the characteristics of cells transfected with DNA sequences and DNA and antigens encoded by DNA.

Description

[Name of invention]

Tumor Rejecting Antigen Precursors, Tumor Rejecting Antigens and Uses thereof

[Brief Description of Drawings]

1 shows detection of a transfectant expressing antigen P815A.

2 shows clones P1.HTR, PO.HTR, genomic transfectance P1A.T2 and cosmid transfectant P1A.TC3.1 for lysis by various CTLs, as determined by chromium release assay. Showing the sensitivity of the sensor.

3 shows a restriction map of cosmid C1A.3.1.

4 shows a Northern Blot analysis of the expression of gene P1A.

5 shows the structure of gene P1A with restriction positions.

FIG. 6 shows the results obtained when cells were transfected with the gene of P1A isolated from P815 or normal cells and subsequently tested with CTL lysis.

FIG. 7 shows lysis studies using mast cell line L138.8A.

FIG. 8 also shows a map of the subfragment of the 2.4 kb antigen E fragment sequence expressing antigen.

9 shows homology of exon 3 sites of genes mage 1, 2 and 3.

10 shows the results of northern blotting on MAGE genes of various tissues.

FIG. 11 is a table showing the data of FIG. 13 in a tabular form. FIG.

12 is a diagram showing Southern blotting experiments using various human melanoma cell lines used in the present application.

FIG. 13 is a diagram showing the generalized expression of MAGE 1, 2 and 3 genes for tumors and normal tissues.

This application is filed on September 23, 1991, part of Applicant No. 728,838, filed on July 9, 1991, filed on July 9, 1991, which is part of Appl. Part of Serial No. 764,364. Applicant Part of Serial No. 807,043, filed December 12, 1991, is a continuing application.

[Field of Invention]

The present invention relates generally to the field of immunogenetics used in oncology research.

More specifically, the present invention relates to the study and analysis of the mechanism by which the immune system of an organism recognizes tumors through the provision of so-called immunosuppressive antigens, and the expression of those referred to herein as "tumor rejection antigen precursors".

Background and Prior Art

Research on the recognition or deficiency of cancer cells by the host organism has been conducted in many other areas. Understanding of this field requires some understanding of both basic immunology and oncology.

Early studies on mouse tumors revealed that when tumors were transplanted into syngeneic animals, they produced molecules that caused tumor cell rejection. These molecules are "recognized" by the T-cells of the receptor animal and elicit a cytolytic T-cell response to lyse the transplanted cells. This evidence was first obtained in tumors induced ex vivo by chemical carcinogens such as methylcholanthrene. It has been found that the antigens expressed by the tumors causing the T-cell response are different for each tumor. For general information on the induction of tumors and the differences of cell surface antigens with chemical carcinogens, see Prehn et al., J. Natl. Canc. Inst. 18: 769-778 (1957); Klein et al., Cancer Res. 20: 1561-1572 (1960); Gross, Cancer Res. 3: 326-333 (1943), Basombrio, Cancer Res. 30: 2458-2462 (1970). This kind of antigen has been known as "tumor specific transplant antigen" or "TSTA". Similar observations were obtained when there was observation of the provision of such antigens when induced by chemical carcinogens, and then when the tumors were induced ex vivo by ultraviolet light. Kripke, J. Natl. Canc. Inst. 53: 333-1336 (1974).

While T-cell mediated immune responses were observed in the tumor types described above, spontaneous tumors were generally considered to be non-immunogenic. It is therefore believed that this does not provide the patient with the tumor with an antigen that causes a response to the tumor. Hewitt et al., Brit. j. See Cancer 33: 241-259 (1976).

The tum-antigen presenting cell line family is an immunogenic variant obtained by mutagenesis of mouse tumor cells or cells, and is described by Boon et al. in J. Exp. Med. 152: 1184-1193 (1980), the contents of which are incorporated by reference. In detail, tum-antigens are obtained by mutating tumor cells (eg, "tum ⁺ " cells) that form tumors without causing an immune response in syngeneic mice. When these tum ⁺ cells are mutated, they are rejected by syngeneic mice and do not form tumors. (Thus "tum ^-"). Boon et al., Proc. natl. Acad. Sci. See USA 74: 272 (1977). Many tumor types have been shown to exhibit this phenomenon. For example, Frost et al., Cancer Res. 43: 125 (1983).

The tum ^- variants do not form advanced tumors because they cause an immune rejection response. In evidence to support this hypothesis, normally a fail to form tumors tumors "tum ^-" variants have the ability to form tumors in mice with an immune system inhibited by a short survey (irradiation) to lethal (Van Pel et al., Proc. Natl.Acad. Sci. USA 76: 5252-5285 (1979); and tum ^- cells of peritoneal mastocytoma P815 proliferated exponentially for 12-15 days, in just a few days upon influx of lymphocytes and macrophages. Observations of elimination (Uyttenhove et al., J. Exp. Med. 152: 1175-1183 (1980)), etc. Other evidence suggests that mice, even when immunosuppressive doses are prescribed for subsequent challenge of cells, Has been observed to obtain immune memory that allows for resistance to subsequent challenges to the same tum ^- variant (Boon et al., Proc. Natl. Acad. Sci. USA 74: 272-275 (1977); Van Pel et al., Supra). Uyttenhove et al., Supra).

Subsequent studies revealed that when a natural tumor was mutated, a truly reactive immunogenic variant was produced. Indeed, these variants could elicit an immune protective response against the original tumor. Van Pel et al., J. Exp. Med. 157: 1992-2001 (1983). It is therefore known that it is possible to provide so-called "tumor rejection antigens" in tumors that are targeted for syngeneic rejection. Similar results were obtained when the foreign gene was transfected into the native tumor. In this regard, Fearson et al., Cancer Res. 48: 2975-1980 (1988).

When any kind of antigen is provided on the surface of tumor cells, it is recognized and lysed by cytotoxic T cells. This kind of antigen will hereinafter be referred to as "tumor reject antigen" or "TRA". TRA may or may not induce antibody responses. The research results of these antigens have been obtained through in vitro cytotoxic T cell characterization studies, namely the identification of antigens by specific cytotoxic T cells (hereinafter “CTL”) subsets. This subset recognizes and propagates provided tumor rejection antigens and lyses the antigen presenting cells. Characterization studies have identified CTL clones that specifically lyse cells expressing antigen. Examples of such studies are described in Levy et al., Adv. Cancer Res. 24: 1-59 (1977); Boon et al., J. Exp. Med. 152; 1184-1193 (1980); Brunner et al., J. Immunol. 124; 1627-1634 (1980); Maryanski et al., Eur. J. Immunol. 124: 1627-1634 (1980); Maryanski et al., Eur. J. Immunol. 12: 406-412 (1982); Palladino et al., Canc. Res. 47: 5074-5079 (1987). This type of analysis is minor histocompatibility (histocompatibility) antigens, the male specific HY antigens, and "tum ^-" is also required for other types of antigens recognized by the CTL comprising the antigen type known as antigens, are discussed herein have.

Tumor typicals of the subject matter described above are known as P815. Deplaen et al., Proc. Natl. Acad. Sci. USA 85: 2274-2278 (1988); Szikora et al., EMBO J 9: 1041-1050 (1990), and Sibille et al., J. Exp. Med. 172: 35-45 (1990). P815 tumors are mastocytosis, induced in DBA / 2 mice with methylcholanthrene and cultured in both ex vivo tumors and cell lines.

P815 cell lines produced many tum ^- variants, including P91A (DePlaen, supra), 35B (Szikora, supra), and P198 (Sibille, supra) by mutagenesis. In contrast to tumor rejection antigens-this is an important difference-tum ^- antigens only appear after tumor cells have been mutated. Tumor rejection antigens are present in cells of a given tumor, without mutagenesis. For this reason, with reference to the literature, cell lines can be tum ⁺ , such as the cell line referred to as “P1,” and can be caused to produce tum ⁻ variants. tum ^- phenotype differs from that of the parent cell line because, tum ^- cell lines are their tum ⁺ Mo as compared to cell lines and to predict the DNA will be different, these differences are tum ^- may be used to identify the gene of interest in the cell. As a result, it was found that genes of tum ^- variants such as P91A, 35B, and P198 differed from normal alleles by point mutations in the coding region of the gene. See Szikora and Sibille (see above), and Lurquin et al., Cell 58: 293-303 (1989). This proved not to be the case with the TRA of the present invention. These papers also demonstrated that peptides derived from tum ⁻ antigens are provided by L ^d molecules for recognition by CTL. P91A is provided by L ^d , P35 by D ^d , and P198 by K ^d .

Genes that are processed and actually form a tumor rejecting antigen (hereinafter referred to as "tumor rejecting antigen precursor", "precursor molecule" or "TRAP") are not expressed in most normal adult tissues but are expressed in tumor cells. It turns out that now. The gene encoding TRAP is now isolated and cloned and represents part of the present invention disclosed herein.

The gene is useful as a source for isolated and purified tumor rejection antigen precursors and TRA itself useful as a therapeutic for cancer in which the antigen is "marker", as well as for various diagnostic and oncology studies. Will be discussed later. E.g. tum ^- cells, as well as tum ⁺ cells different tum ^- it is known that can be used for the production of CTL of dissolving the cells to provide antigen. Maryanski et al., Eur. J. Immunol 12: 401 (1982); And Van den Eynde et al., Modern Trends in Leukemia IX (June 1990). Tumor rejection antigen precursors can be expressed in cells transfected by genes and then used to elicit an immune response against a tumor of interest.

In similar cases of human neoplasms, self-derived mixed lymphocyte-tumor cell cultures (hereinafter referred to as "MLTCs") dissolve self-derived tumor cells or target natural killer, self-derived EBV. Transformed B cells, or self-derived fibroblasts, have been observed to produce highly reactive lymphocytes that do not lyse (see Anichini et al., Immunol. Today 8: 385-389 (1987)). This reaction is particularly well studied for melanoma, and MLTC has been performed with peripheral blood cells or tumor infiltrating lymphocytes. Examples of literature in this area include Kunth et al., Proc. Natl. Acad. Sci. USA 86: 2804-2802 (1984); Mukherji et al., J. Exp. Med. 158: 240 (1983); Herin et al., Int. J. Canc. 39: 390-396 (1987); Topalian et al., J. Clin. Oncol 6: 839-853 (1988). Stable cytotoxic T cell clones (hereinafter “CTL”) are derived from MLTC reactant cells, which clones are specific for tumor cells. See Mukherji et al. (See above), Herin et al. (See above), Kunth et al. (See above). Antigens recognized on tumor cells by these self-derived CTLs did not exhibit culture artifacts because they were found in fresh tumor cells. Topalian et al. (See above); Degiovanni et al., Eur. j. Immunol. 20: 1865-1868 (1990). These observations allow for the isolation of nucleic acid sequences encoding tumor rejection antigen precursors of TRA present in human tumors in conjunction with the techniques used herein to isolate genes for specific murine tumor rejection antigen precursors. With the derivatives described below, it is now possible to isolate nucleic acid sequences encoding tumor reject antigen precursors including, but not limited to, the characteristics of most specific tumors. As described below, nucleic acid sequences encoding human tumor reject antigen precursors and their use are also subject of the invention.

These and various other aspects of the present invention are described in detail below.

Brief description of the sequence

SEQ ID NO: 1 is cDNA for a portion of gene P1A.

SEQ ID NO: 2 shows coding region of cDNA of gene P1A.

SEQ ID NO: 3 shows non-coding DNA for P1A cDNA of 3 ′ of the coding region of SEQ ID NO: 2. FIG.

SEQ ID NO: 4 is the full sequence of cDNA for P1A.

SEQ ID NO: 5 is the genomic DNA sequence for P1A.

SEQ ID NO: 6 shows amino acid sequence of antigenic peptide for P1A TRA. The sequence is for a cell expressing both A ⁺ B ⁺ , ie both A and B antigens.

SEQ ID NO: 7 is a nucleic acid sequence encoding antigen E.

SEQ ID NO: 8 is a nucleic acid sequence encoding MAGE-1.

SEQ ID NO: 9 is the gene of MAGE-2.

SEQ ID NO: 10 is the gene of MAGE-21.

SEQ ID NO: 11 is cDNA of MAGE-3.

SEQ ID NO: 12 is the gene for MAGE-31.

SEQ ID NO: 13 is the gene of MAGE-4.

SEQ ID NO: 14 is cDNA of MAGE-41.

SEQ ID NO: 15 is the cDNA of MAGE-4.

SEQ ID NO: 16 is the cDNA of MAGE-5.

SEQ ID NO: 17 is the genomic DNA of MAGE-51.

SEQ ID NO: 18 is the cDNA of MAGE-6.

SEQ ID NO: 19 is the genomic DNA of MAGE-7.

SEQ ID NO: 20 is the genomic DNA of MAGE-8.

SEQ ID NO: 21 is the genomic DNA of MAGE-9.

SEQ ID NO: 22 is the genomic DNA of MAGE-10.

SEQ ID NO: 23 is the genomic DNA of MAGE-11.

SEQ ID NO: 24 is the genomic DNA of smage-I.

SEQ ID NO: 25 is the genomic DNA of smage-II.

[Detailed Description of Preferred Embodiments]

Many other "MAGE" genes have been identified and sequences are shown at the end of the application. The methods described in the following examples were used to isolate these genes and cDNA sequences.

As used herein, "MAGE" refers to a nucleic acid sequence isolated from human cells. The acronym "smage" was used to indicate a sequence of murine origin.

When "TRAP" or "TRA" is referred to herein as specific for a tumor type, it is meant that the molecule under consideration is associated with that type of tumor, although not necessarily excluding other tumor types.

Example 1

Gene transfection was used to identify and isolate genes encoding antigen P815A. This method requires a gene source and a soluble cell line. The highly transfectable cell line P1.HTR was the starting material for the receptor but provided it with one of four recognized P815 tumor antigens, "antigen A" and could not be used without further treatment. See Van Pel et al., Molecular Genetics 11: 467-475 (1985). Thus, screening experiments were performed to isolate cell lines with the desired properties of P1.HTR without expressing this antigen.

To perform this experiment, P1.HTR was screened with CTLs specific for each of tumor antigens A, B, C and D. Such CTLs are described by uyttenhove et al., J. Exp. Med. 157: 1040-1052 (1983).

To perform the selection, 10 ⁶ cells of P1.HTR were mixed with 2-4 × 10 ⁶ cells of CTL clones in 2 ml of medium in a round bottom tube and centrifuged at 150 × g for 3 minutes. After 4 hours at 37 ° C., Maryanski et al., Eur. J. Immunol. 12: The cells were washed according to 406-412 (1982) and resuspended in 10 ml of medium. Further information on CTL analysis and screening methods is generally described in Boon et al., J. Exp. Med. 152: 1184-1193 (1980), and Maryanski et al., Eur. J. Immmunol. 12: 406-412 (1982).

When these selections were performed, cell line variants were found that did not express both antigens A and B. Then, further screening with CTLs specific for antigen C also yielded additional variants without antigen C. See FIG. 2, which summarizes these screening results. Variant P0.HTR was negative for antigens A, B and C and was therefore selected for transfection experiments.

The cell line P0.HTR has been deposited in the Institute Pasteur Collection Nationale De Cultures De Microorganismes, 28, Rue de Docteur Roux, 75724 Paris, France, according to the Budapest Treaty, accession number I-1117.

This method can be used to identify other cell lines that are variants of the cell type which are variants that do not provide any of the antigens A, B and C, which normally provide at least one of the four recognized P815 tumor antigens, namely antigens A, B, C and D. Applicable to get As P1.HTR is a mastocytoma cell line, it will be appreciated that the method enables the isolation of biologically pure mastocytoma cell lines that do not express any of P815 antigens A, B and C but are highly transfected. This method also allows other types of tumors to be screened into desired biologically pure cell lines. The resulting cell lines were transfected with at least foreign DNA as in P1.HTR and selected to not express specific antigens.

Example 2

DePlaen et al., Proc. Natl. Acad. Sci. Previous studies reported by USA 85: 2274-2278 (1988), the contents of which are hereby incorporated by reference, show the effectiveness of cosmid library transfection for obtaining genes encoding tum ^- antigens. gave.

Selection plasmids and genomic DNA of P1.HTR were prepared according to Wolfel et al., Immunogenetics 26: 178-187 (1987). Transfection procedures are described in Corsaro et al., Somatic Cell Molec. Genet 7: 603-616 (1981) was performed with minor modifications. In short, Bernard et al., Exp. Cell. Biol. 158: 3 μg of DNA of plasmid pHMR272 as described in 237-243 (1985) and 60 μg of cellular DNA were mixed. This plasmid confers hygromycin resistance to the receptor cells, thus providing a convenient method for the screening of transfectants. 940 μl of 1 mM Tris-HC1 (pH 7.5), 0.1 mM EDTA; And 310 μl of ₁ M CaCl ₂ . 1.25 mL of 50 mM Hepes, 280 mM NaCl, 1.5 mM Na ₂ HPO ₄ were slowly added with constant stirring of the solution, and the pH was adjusted to 7.1 with NaOH. Calcium phosphate-DNA precipitate was formed by standing at room temperature for 30-45 minutes. Five groups of P0.HTR cells (5 × 10 ⁶ ) per group were then centrifuged at 400 × g for 10 minutes. After removing the supernatant, the pellet was directly resuspended in the medium containing the DNA precipitate. The mixture was incubated at 37 ° C. for 20 minutes and then added to an 80 cm 2 tissue culture flask containing 22.5 ml of DMEM supplemented with 10% fetal bovine serum. After 24 hours the medium was changed. Cells were harvested and counted 48 h after transfection. Transfected cells were selected by mass culture using a culture medium supplemented with hygromycin B (350 μg / ml). This treatment resulted in the selection of hygromycin resistant cells.

Two flasks were prepared for each group, each containing 8 × 10 ⁶ cells per 40 ml of medium. To determine the number of transfectants, 1 × 10 ⁶ cells were taken from each group and DMEM 5 containing 300 μg / ml of 10% fetal bovine serum (FCS), 0.4% bactoagar, and hygromycin B. Plated in ml. After 12 days, the colonies were counted. Two independent measurements were taken to average. This was multiplied by 5 to calculate the number of transfectants in the corresponding group. Corrected for cloning efficiency of P815 cells and was about 0.3.

Example 3

Eight days after transfection, antibiotic resistant transfectants were separated from dead cells using density centrifugation using Ficoll-Paque as described in Example 2 (see above). These cells were maintained for 1 or 2 days in non-selective media. Cells were plated in 96-well microplates (round bottoms) at 30 cells / microwells in 200 μl of culture medium. 100 to 400 microwells were made depending on the number of transfectants prepared. It was 500 to 3000 as calculated by the agar colony test. After 5 days, the wells contained 6 × 10 ⁴ cells and one-tenth of the wells were transferred to microplates to make replica plates and incubated at 30 ° C. After one day, the master plate was centrifuged to remove the medium and prepared 750 CTL (CTL-P1: 5) for P815 antigen A to kill human IL-2 40U / ml, and stimulator cells. Each well was added with irradiated 10 ⁶ syngeneic feeder splenocytes in CTL culture medium containing HAT medium. Six days later, CTLs were visually observed to identify wells that proliferated. If there is a growing microculture on the plate, 100 μl aliquots of the wells are transferred to another plate containing ⁵¹ Cr labeled P1.HTR target cells (2 × 10 ³ to 4 × 10 ^{3 per well} ) and 4 h. Later release of chromium was observed. Replication cultures corresponding to those exhibiting high CTL activity were grown and cloned through limited dilution in DMEM containing 10% FCS. After 5 days, about 200 clones were harvested and screened for CTL.P1: 5 cell line by visual lysis assay as above. See Figure 1a for these results.

In these experiments, 3 of 15 transfectants produced some positive cultures. These cultures were tested for lytic activity against P1.HTR as above. Most of the cultures whose growth was observed showed lytic activity. As shown in Figure 1b, this activity was higher than the background. This figure summarizes data for two groups of cells (groups "5" and "14") inoculated with 30 hygromycin resistant cells transfected with 400 and 300 microwells. Anti-A CTL P1: 5 was added after amplification and replication of the culture. After 6 days, the dissolution activity against P1.HTR was tested. In the figure, each dot represents the lytic activity of a single culture.

Replication cultures corresponding to several positive wells were subcloned and it was confirmed that at least 1% of the subclones were lysed by anti-A CTL. Therefore, three independent transfectants expressing P815 A were obtained from 33,000 hygromycin resistant transfectants. One of these cell lines was named P1A.T2 below and further tested.

The relevant antigenic profile of P1A.T2 is shown in Figure 2, which was obtained via the anti-CTL assay described above.

Example 4

CTL analysis performed on P1A.T2 demonstrated that it received a gene from P1.HTR since it provides antigen A (“P815A”). In addition, this cell line was used as a source of genes for the antigen precursors of the next experiment.

Previous studies have shown that genes encoding tum ^- antigens can be recovered directly from transfectants obtained with cosmid libraries. DePlaen et al., Proc. Natl. Acad. Sci. See USA 85: 2274-2278 (1988). This procedure was followed for recovery of the P815 gene.

Partially digested whole genomic DNA of P1A.T2 with restriction enzyme Sau 3A1 and fractionated by NaCl density gradient ultracentrifugation according to Grosveld et al., Gene 10: 6715-6732 (1982) to concentrate 35-50 kb DNA. . These fragments were linked to cosmid arms of C2RB as described in Bates et al., Gene 26: 137-146 (1983), the disclosure of which is incorporated by reference. These cosmid arms were cut with SmaI and treated with small intestine phosphatase and digested with BamHI. After filling the lambda phage components with DNA linked according to Grosveld et al. (See above). Titrated with E. coli ED 8767. Approximately 9 × 10 ⁵ ampicillin resistant colonies were obtained per microgram of DNA insert.

30,000 independent cosmids were mixed with 2 ml of EO 8767 in 10 mM MgCl ₂ , incubated at 37 ° C. for 20 minutes, diluted with 20 ml of Luria Bertani (“LB”) medium and incubated for 1 hour to amplify the cosmid group. . This suspension was titrated and inoculated in 1 liter of LB medium containing ampicillin (50 μg / ml). At a bacterial concentration of 2 × 10 ⁸ cells / ml (OD ₆₀₀ = 0.8), an aliquot of 10 ml was frozen and incubated overnight by adding 200 μg / ml chloramphenicol to the medium. Total cosmid DNA was isolated by alkaline lysis and purified by CsCℓ gradient.

In these experiments a library of 650,000 cosmids was prepared. Amplification methods involved using 21 groups of approximately 30,000 cosmids.

Example 5

A group of 5 × 10 ⁶ P0.HTR cells was used as the transfectant host, using 4 μg pHMR272 and 21 groups (60 μg) of the cosmids mentioned above as described above. Transfection was performed in the same manner as described in the previous experiment. Using CTL analysis again as described, an average of 3000 transfectants per group was tested for antigen presentation. One cosmid group yielded a positive transfectant with a frequency of about 1 / 5,000 drug resistant transfectants. The transfectant also expressed both antigens A and B as in P1A.T2. The expression pattern of transfectant P1A.TC3.1 is shown in FIG.

Example 6

As shown in Example 5 above, P815A antigen presenting cells transfected with three independent cosmids were isolated. DePlaen et al., Proc. Natl. Acad. Sci. According to USA 85: 2274-2278 (1988), the DNA of the transfectant was isolated and directly packaged with the lambda phage extract. As in Example 5, the obtained product was titrated against E. coli ED 8767 with ampicillin selection. Similarly, cosmids were amplified according to Example 5 again using P0.HTR and transfection was performed.

As described in Table 1 below, high frequency of transfection was observed:

TABLE 1

Analysis of cosmids with restriction enzymes revealed that the directly packaged transfectant P1A.TC3.1 contained 32 cosmids, of which seven were different. Each of these 7 cosmids were transfected with P0.HTR in the above manner and again investigated if the transfectant provided P815 according to the above methods. Four of the cosmid transfectants showed P815A presentation and, as in all the experiments described herein, P815 was co-expressed.

Of the four cosmids showing the presentation of the two antigens, cosmid C1A.3.1 was only 16.7 kb in length and was selected for further analysis as described below.

Gene maps obtained by analyzing cosmid C1A.3.1 with restriction endonucleases are shown in FIG.

Again the method described above was used to transfect all EcoRI fragments and only 7.4 kb fragments produced transfects that anti-A CTLs could dissolve. Similar experiments were performed for PstI fragments, with only 4.1 kb fragments completely contained in 7.4 kb EcoRI fragments producing soluble transfectants.

This fragment (ie, 4.1 kb PstI fragment) was digested with SmaI to prepare a 2.3 kb fragment that produced host cells providing antigens A and B after transfection. The 900 base length fragment finally obtained as SmaI / XbaI also transferred precursor expression of these two antigens. That is, the transfected host cell provided both antigen A and antigen B.

Example 7

The 900 base fragment described above was used as a probe to investigate P815A gene expression in the parent cell line P1.HTR. To do this, first, whole cell DNA was isolated using the guanidine-isothiocyanate method of Davis et al., Basic Methods In Molecular Bioloqy (Elseview Science Publishing Co. New York) (1986). Poly A ⁺ mRNA was isolated and purified by the method in the same reference using oligo dT cellulose column chromatography.

The sample was then analyzed with Northern blots. Samples of 1% agarose gels containing 0.66 M formaldehyde were fractionated. The gel was treated with 10 × SSC (SSC: 0.15M NaCl; 0.015M sodium citrate, pH 7.0) for 30 minutes and then blotted onto nitrocellulose membrane overnight. These membranes were baked at 80 ° C. for 2 hours and then prehybridized for 15 minutes in 60% solution containing 10% dextran sulfate, 1% SDS and 1M NaCl. Next, hybridization was performed using a denatured probe (900 base fragment) together with 100 μg / ml salmon sperm DNA.

When this method was performed using P1.HTR poly A ⁺ RNA, a band of 1.2 kb and two more faint bands were identified as shown in lane 1 (RNA 6 μg) in FIG.

The same probe was used to screen cDNA libraries prepared from polyA ⁺ RNA of cell lines. This yielded a clone with a 1 kb insert, indicating no 5 'end. Northern blot of cDNA is not shown.

Hybridization experiments in each case were performed overnight at 60 ° C. Blots were washed twice with 2 × SSC at room temperature and twice with 2 × SSC supplemented with 1% SDS at 60 ° C. Previous experiments using known Sanger dideoxy chain termination methods have identified DNAs expressing sufficient P815A antigen precursors for sequencing. This was done for clones made using various restriction enonucleases and specifically primed with synthetic oligonucleotide primers. The results for exon of genes are shown in SEQUENCE ID NO: 4.

Example 8

The northern analysis indicated that there was no 5 ′ end of the cDNA. To obtain this sequence, cDNA was prepared from P1.HTR RNA using primers corresponding to positions 320-303. Then 3 'primer corresponding to positions 286-266 and Frohman et al., Proc. Natl. Acad. Sci. USA 85; Sequences were amplified by polymerase chain reaction using the 5 'primers described in 8998-9002 (1988). Southern blots showed a band of expected size (270 bases) to hybridize with the 900 bp SmaI / XbaI fragment described above. After cloning to 130 λ tg of m13tg, the sequence of the small fragment 270bp fragment was determined. The sequence is shown in SEQUENCE ID NO: 1.

Example 9

After obtaining the sequences described in Examples 7 and 8 and shown in SEQ ID NO :, the sequence of the 5.7 kb region of cosmid C1A.3.1 was determined. This fragment was found to contain 900 base fragments expressing P815A in the transfectant. This experiment enabled the identification of introns and exons because the cosmids originated in the genome.

The identified structure of the gene is shown in FIG. These data along with SEQ ID NO: 4 show that the antigen precursor gene (hereinafter referred to as "P1A") is approximately 5 kilobases long and contains three exons. The ORF for a protein of 224 amino acids starts at exon 1 and ends at exon 2. The 900 base pair fragments that delivered expression of precursors to antigens A and B included only exon 1. The promoter region comprises a CAAT box and enhancer sequence, as shown in SEQ ID NO: 1. The latter feature is Geraghty et al., J. Exp. Med 171: 1-18 (1990); As observed by Kimura et al., Cell 44: 261-272 (1986), most of the MHC class I gene promoters have been observed.

Using Lipman et al., Science FA 227: 1435-1441 (1985), a program FASTA with K-triparameters of 3 and 6, and Genbank database release 65 (October 1990). Computer homology investigation was performed. Bourbon et al., Mol. Biol. 200: 627-638 (1988), and Schmidt-Zachmann et al., Chromosoma 96: 417-426 (1988), exon 1 similar to the sequence encoding the acidic region present in the mouse phosphorus protein NO38 / B23 (position 524) -618) and found no homology except for the 95 base stretch corresponding to a portion of the acidic region encoded by. 56 of 95 bases were identified. To test whether these homology is the basis for cross hybridization, experiments were carried out using a mouse spleen cDNA library screened with 900 base fragments. CDNA clones were obtained that correspond closely to the size of the cross hybridization band. These were partially sequenced and 2.6 kb cDNA exactly matched the reported cDNA sequence of mouse nucleolin, whereas 1.5 kb cDNA was consistent with mouse phosphorus protein NO38 / B23.

Analysis of the nucleotide sequence of a gene (hereinafter referred to as "P1A") suggested that its encoded product had a molecular weight of 25 kd. Analysis of SEQ ID NO: 4 revealed a latent nuclear targeting signal of residues 5-9 as well as a large acidic domain at positions 83-118 (Dingwall et al., Ann. Rev. Cell Biol. 2: 367-390 (1986) ). As noted above, this includes homologous regions between P1A and two phosphorus proteins. The estimated phosphorylation site can be confirmed at position 125 (serine). The second acidic domain was also found to be close to the C-terminus as a continuous stretch of 14 glutamate residues. Similar C-terminal structures are described in Kessel et al., Proc. Natl. Acad. Sci. USA 84: 5306-5310 (1987) was found in murine homeodomain proteins associated with nucleation localization.

In a study comparing the sequence of gene P1A with the sequences of P91A, 35B and P198, no similarity was found, thus indicating that P1A is a different type of gene and antigen.

Example 10

To determine whether the genes present in normal tissues are the same as those expressed by the tumor, a study was conducted with P1A probes and sequences. To accomplish this, phage libraries were made using the genomic DNA of lambda zapII 10 and DBA2 murine kidney cells. P1A was used as the probe. Hybridization conditions were as described above and hybridization clones were found. The clone contained exons 1 and 2 of the P1A gene, corresponding to positions -0.7 to 3.8 of FIG. After determining the position of this sequence, RCR amplification was performed to obtain a sequence corresponding to 3.8 to 4.5 in FIG.

Sequence analysis showed no difference between the genes of normal kidney and the P1A gene obtained from P815 tumor cells.

In further experiments, the genes found in DBA / 2 kidney cells were transfected with P0.HTR as described above. As shown in FIG. 7, these experiments showed that antigens A and B are effectively expressed by kidney genes isolated from normal kidneys, such as P1A genes isolated from normal kidney cells.

Through these experiments, the gene encoding the tumor rejection antigen precursor is not a gene derived from a mutation; Rather, it was concluded that the gene is identical to that present in normal cells but is not expressed there. The consequences of this finding are important and are discussed below.

Although not described in detail herein, studies show that variants of these genes are readily available. Some cells were "P1A ^- B ⁺ " rather than normal "P1A". The only difference between them is the point mutation at exon 1 with the 18th triplet encoding Ala instead of Val in the variant.

Example 11

Further experiments were performed with other cell types. In accordance with the Northern blot hybridization method described above, a test was performed with RNA of normal liver and splenocytes to determine whether the transcript of the P1A gene was present. Northern blot data are shown in Figure 4, indicating no evidence of expression.

The murine P815 cell line from which P1A was isolated was mast cell tumor. Therefore, to investigate the expression of the gene was studied with mast cell lines. Short-term cultures of mast cell line MC / 9, and myelogenous mast cells described by Nabel et al., Cell 23: 19-28 (1981) were tested by the method described above (Northern blotting) but no transcript was found. In contrast, the Balb / C-derived IL-3 dependent cell line L138.8A ( Et al., J. Immunol. 142: 3440-3446 (1989)), a strong signal was found. The results of the study of mast cells are shown in FIG.

BALB / C and DBA / 2 mouse is because both share the H-2 ^d-phase-type (haplotype) known to be possible to test sensitivity to dissolved using the above-described CTL. The results in FIG. 8 essentially demonstrated that anti-A and anti-B CTLs severely lyzed the cells, but not anti-C and anti-D cell lines.

Further testing was performed with other murine tumor cell lines, such as the teratocarcinoma cell line PCC4 (Boon et al., Proc. Natl. Acad. Sci. USA 74: 272-275 (1977)) and leukemia LEC and WEH1-3B. . No expression was observed in any of these samples.

Example 12

Substantial provision of the P1A antigen by the MHC molecule is important. To test this, cosmid C1A.3.1 was transfected with fibroblast cell line DAP showing phenotype H-2 ^k . These cell lines were transformed with genes expressing one of the K ^d , D ^d and L ^d antigens. After transformation with both cosmid and MHC genes, lysis was again examined by CTLs as described above. The results of these studies are shown in Figure 2, showing that L ^d is required for the provision of P1A antigens A and B.

TABLE 2

H-2-limitation of antigens P815A and P815B

The observation that it is possible to link the provision of tumor rejection antigens with specific MHC molecules has been confirmed in experiments with human cells and HLA molecules2 and is described in detail below.

Example 13

Using the P1A gene sequence and the amino acid sequence derived therefrom, an antigenic peptide that is A ⁺ B ⁺ (ie, is characteristic of a cell expressing both A and B antigens), and an antigenic peptide that is A ^- B ⁺ It was. Peptides are shown in FIG. This peptide lysed P0.HTR cells when administered to a sample of P0.HTR cells in the presence of a CTL cell line specific for the cells providing it. This supports the view that peptides based on products expressed by genes can be used as bexin.

Example 14

Human melanoma cell lines (hereinafter referred to as MZ2-MELs) are not clone cell lines. It expresses four stable antigens recognized by self-derived CTLs, known as antigens “D, E, F and A”. Besides. Two different antigens "B" and "C" are expressed by different sublines of the tumor. CTL clones specific for these six antigens are described in Van den Eynde et al., Int. J. Canc. 44: 634-640 (1989). Recognized subclones of MZ2-MEL are MEL.43, MEL3.0 and MEL3.1. (Van den Eynde et al., Supra). The cell line MEL3.1 was selected as a source of nucleic acid sequences expressing antigen precursors because it expressed antigen E as a result of a CTL study as described above for the P815 variant.

In isolating appropriate nucleic acid sequences for tumor rejection antigen precursors, the above developed technique has shown that receptor cells that meet the following two criteria are required: (i) Receptor cells should not express relevant TRAP under normal conditions. And (ii) the receptor cell must express the relevant class I HLA molecule. Receptor cells should also be "good" receptors with high transfection frequency.

To obtain such cell lines, clonal subline ME3.1 was repeatedly selected with anti-ECTL 82/30 as described by Van den Eynde (see above). Subclonal MZ2-MEL-2.2 isc E ⁻ was isolated by repeated selection cycles. This subclone was also HPRT ⁻ , (ie, sensitive to HAT medium (10 ⁻⁴ M hypoxanthine, 3.8 × 10 ⁻⁷ aminopterin, 1.6 × 10 ⁻⁵ M 2-deoxythymidine). For simplicity, this subclone is called "MEL-2.2".

Example 15

Specification is included for reference Et al, Immunogenetics 26: 178-187 (1987) to prepare genomic DNA of Ken MEL3.0. Nicolas et al., Cold Spring Harb., Conf. Cell Prolif. 10: 469-485 (1983) As plasmid pSVtkneoβ confers geneticin resistance, it was used as a marker for coat transfection in this experiment.

Corsao et al., Somatic Cell Molec. Whole genomic DNA and plasmids were coatfected using a similar but not identical to that of Genet 7: 603-616 (1981). Genomic DNA (60 μg) and plasmid DNA (6 μg) were mixed in 940 μl of 1 mM Tris.HCL (pH 7.5), 0.1 mM EDTA and then 310 μL of CaCℓ ₂ was added. This solution was added to 1.25 ml of ₂ × HBS (50 mM HEPES, 280 mM NaCl, 1.5 mM Na ₂ HPO ₄ , adjusted to pH 7.1 with NaOH) with constant stirring. After 30 to 45 minutes at room temperature to form calcium phosphate DNA precipitate, 80 inoculated with 3 × 10 ⁶ MEL2.2 cells in 22.5 ml of melanoma culture medium (Dulbecco's Modified Eagle's Medium) supplemented with 10% fetal bovine serum Put into cm 2 tissue culture flask. After 24 hours the medium was changed. Cells were harvested 48 h after transfection and inoculated at 4 × 10 ⁶ cells per 80 cm 2 flask in melanoma culture medium supplemented with 2 mg / ml of genesis. Geneticin served as a screening marker.

Example 16

13 days after transfection, geneticin-resistant colonies were counted and harvested and incubated for 2 or 3 days in non-selective media. The transfected cells were then plated in a 96-well microplate at 200 cells / well in 200 μl of culture medium containing 20% fetal bovine serum (FCS) to obtain about 30 growing colonies per well. The number of cultures was adjusted in large amounts, ie, at least four times all independent transfectants.

After 10 days, the wells contained about 6 × 10 ⁴ cells. These cells were separated and one third of each culture was transferred to replicate plates. After reattaching in 6 hours, the medium was removed and 1500 anti-E CTL (CTL 82/30) was added to each well with 100 μl of CTL culture medium containing 35 U / ml IL-2. One day later, the supernatant (50 μl) was collected and measured for TNF concentration.

Example 17

The mammalian genome is 6 × 10 ⁶ kb in size. Since an average amount of DNA inserted into each drug-resistant transfectant was expected to be about 200 kb, at least 30,000 transfectants were required for testing to confirm antigen E transfection. Previous studies with murine cells showed that when CTL stimulation assays were used, groups containing only 3% of cells expressing the relevant antigen could be identified. This reduced the number of analyzes by 30 factors. As described above, anti-E CTL analysis in mixed E ⁺ / E ⁻ cells was useful, while constant results were not obtained and were not satisfactory.

As a result, an optional trial was planned. The stimulation of CTLs was investigated through the release of tumor necrosis factor ("TNF") using known methods that do not need to be repeated here. As described in Example 15, 1500 CTL 82/30 cells were added per well of transfectant. These CTLs were harvested 6 days after stimulation. As indicated above, one third of the cells present in each well were removed and the remaining 2/3 (4 × 10 ⁴ ) were reattached, followed by addition of CTL and IL-2. After 24 hours, 50 μl of supernatant was removed and W13 culture medium (L-arginine (116 mg / L), L-asparagine (36 mg / L), L-glutamine (216 mg / L), and 8% CO ₂ atmosphere 3 × 10 ⁴ W13 (WEHI-164 clone 13; Espevik et al., J. Immunol. Meth. 95: 99 in 50 μl of RPMI-1640 containing 10% FCS supplemented with 37% 2 μg of actinomycin D) -105 (1986)) were transferred to microplates containing cells. Cell line W13 is a cell line in mouse fibrosus sensitive to TNF. Recombinant TNF-β dilution in RPMI 1640 was added to the target cell control.

After counting the number of W13 cultures 20 hours after incubation, Hansen et al., J. Immunol. Meht. Colorimetric analysis of 119: 203-210 (1989) was applied to determine the percentage of dead cells. This was followed by adding 50 ml of PBS containing (3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide at 2.5 mg / ml and incubating at 37 ° C. for 2 hours. 1 volume of N, N dimethylformamide, 1.6% acetic acid and 2.5 mixed with 2 volumes of water containing 100 μl of lysis solution (30% (w / v) sodium dodecyl sulfate at 37 ° C. Blue formazan crystals were dissolved by adding% 1N HCL at pH 4.7. The plates were incubated overnight at 37 ° C., and ODs were measured at 570 nm and 650 nm was used as a control. Percentages were determined by the following equation according to Espevik et al., J. Immunol.Meth. 95: 99-105 (1986).

The results showed that there was active CTLs because sufficient production of TNF was observed even when the ratio of E ⁺ / E ⁻ cells was as low as 1/45. This led to the conclusion that drug-resistant transfectants may be tested in 30 groups.

Example 18

Cells were tested for TNF production as discussed in Example 17 above. A total of 100 groups of E-cells (4 × 10 ⁶ cells / group) were tested after transfection and 7 × 10 ⁷ independent geneticin resistant transfectants corresponding to an average of 700 per group were obtained. Only one group of transfected cells produced cultures that caused the anti-E antigen CTL clone 82/30 to produce TNF. Of the 300 clones tested, eight were positive. The lysis by anti-E CTLs of these clones was then tested using standard ⁵¹ Cr release assay to confirm that they lysed as efficiently as the original E ⁺ cell line. Transfectant E.T1 had the same dissolution pattern as MEL2.2 dissolved for CTLs for antigens B, C, D and F, as discussed herein.

The fact that only one transfectant of the 70,000 genesine resistant transfectants provided the antigen seems very low at first glance, but it is not. The study described above for P815 showed an average 1 / 13,000 frequency. Human DNA receptor MEL2.2 has been shown to integrate 5 times less DNA than P1.HTR.

Example 19

Once the transfectant E.T1 was identified, an analysis was performed to identify several issues, including whether the E ⁺ contaminant in the cell population was the cause. Analysis of antigen presentation described above shows that E.T1 is B ⁻ and C ⁻ , similar to the receptor cell MEL2.2. In addition, using standard screening process results HPRT ^- turned out to be. However, all E ⁺ cells used in the studies described herein were HPRT ⁺ .

The E ⁺ revertant of MEL2.2 could also be a source of E.T1. To test this, cotransfected sequences were performed based on the observations of Perucho et al., Cell 22: 309-317 (1980), which are usually integrated simultaneously into a single location in the receptor genome. If antigen E in the transfectant is obtained from pSVtkneoβ and cotransfection, the sequence is linked and deletion of the antigen will also remove the neighboring pSVtkneoβ sequence. Et al. (See above) showed that this is true. Normally, E ^- if the cells are to be transfected with pSVtkneoβ, sequences are deleted in the connected and the antigen will also remove pSVtkneoβ sequence neighbors. However, if the transfected E + cells normally with pSVtkneoβ are E. T1, no "co-deletion" will occur. To test this, the transfectant E.T1 was immunoselected at 82/30 as described above. Two variants were obtained in which the antigen that was not dissolved by this CTL was lost. None of them lost geneticin resistance, but Southern blots showed that some neo ^r sequences were missing in the variant, indicating a close link between the neo ^r gene and the E gene in E.T1. E.T1 leads to the conclusion of the transfectant.

Example 20

E ⁺ subclone MZ2-MEL 4B was used as a source of DNA for cosmid library preparation. According to the cosmid transfection method described above, this library of nearly 700,000 cosmids was transfected into MZ2-MEL 2.2 cells.

It is often possible to package the DNA of the cosmid transfectant directly into the lambda phage component to recover the cosmid containing the sequence of interest. Since this method was not successful here, we linked the transfectant DNA to the cosmid vector pTL6 with appropriate restriction fragments to obtain the transfected sequence. This was done using two transfectants and one of them was successful. One cosmid, referred to below as B3, was recovered in this experiment and digested into large 12 kb XmaI transfection fragments by restriction endonuclease XmaI or by BamHI. This fragment was cloned into vector pTZ 18R and then transformed with MEL2.2. TNF production was then measured to determine successful transfection. This experiment determined a gene sequence capable of transforming antigen E onto a 12 kb XmaI fragment and a 2.4 kb fragment in which the 12 kb fragment was digested with BamHI.

As investigated by Southern blot, the 2.4 kb fragment hybridizes with the 2.4 kb fragment of MZ2-MEL and the T cell clone of patient MZ-2 (DNA digested with BamHI / SmaI). As shown in FIG. 12, there is no band in the E ^- antigen loss variant of MZ2-MEL.

The sequence of the E antigen precursor gene was determined and is as follows:

Example 21

After identifying the 2.4 kb genomic fragment, a study was conducted to determine whether the "E ⁺ " subline is expressed by all homologous DNA. CDNA libraries were prepared from its mRNA by known techniques using cell line MZ2-MEL 3.0 as a source. A 2.4 kb fragment was used as a probe and Northern blot analysis was performed to confirm that about 1.8 kb of mRNA was homologous. When cDNA was screened, clones were obtained that almost matched some of the 2.4 kb fragments. Thus two exons were identified. Sequencing of fragments of Cosmis B3 located in front of the 2.4 kb BamHI fragment revealed additional exons upstream of them. The gene was about 4.5 kb in size as shown in FIG. PCR for the 5 'end of the cDNA was used to confirm the starting point of the region to be transcribed. Three exons contain 65.73 and 1551 base pairs. ATG was located at difference 66 of exon 3 followed by a 828 base pair reading frame.

Example 22

E ^- cells were transfected after preparing smaller fragments corresponding to larger genes using known techniques to determine whether smaller fragments of the 2.4 kb fragment delivered expression of antigen E. 8 shows the boundaries of the three intercepts.

As a result of delivering antigen expression in this manner, it was found that the gene encodes the antigen precursor rather than the protein that activates the antigen.

Example 23

The probing of the cDNAs described above was surprisingly different but identified two closely related cDNAs. Testing showed that these cDNAs did not deliver expression of antigen E but were substantially homologous to the first cDNA fragment. Three fragments were referred to as "MAGE" for the "melanoma antigen" as the newly recognized genotype. In FIG. 9, "mage-1" allows antigen expression of MZ2 cells. The third exon portion of each gene is shown in FIG. The second and third sequences are more closely related to each other than the first sequence (18.1 and 18.9% different for the first sequence; 12% different from each other). Among the 9 cDNA clones obtained, there were three clones for each species showing the same expression. As used below, "MAGE" refers to a molecular group and a nucleic acid encoding the same. These nucleic acids share some homology and are expressed in tumor cells, including human tumor cells as well as several types of human tumor cells. The family is referred to as "MAGE" because the first members have been identified in human melanoma cells. However, later experiments showed that members of the MAGE family were not limited to melanoma tumors at all. Rather, MAGE refers to a family of tumor rejecting antigen precursors and nucleic acid sequences encoding it. The antigen resulting therefrom is referred to herein as "MAGE TRA" or "melanoma antigen tumor rejection antigen".

Example 24

Experiments with mouse tumors demonstrate that new antigens recognized by T cells can be obtained from point mutations that modify active genes in regions encoding new antigenic peptides. New antigens can also be obtained by activating genes that are not expressed in most normal cells. To identify the problem with antigen MZ2-E, the mage-1 gene present in melanoma cells was compared with that present in normal cells of patient MZ2. The DNA of phytohemagglutinin-activated blood lymphocytes was amplified by polymerase chain reaction (PCR) using a 1300 bp primer corresponding to the first half of the 2.4 kb fragment. As expected, the PCR product was obtained while the DNA of the E ⁻ variant was not obtained. The sequence of this PCR product was found to be identical to the corresponding sequence of the gene carried out by E ⁺ melanoma cells. Furthermore, it was found that antigen MZ2-E is expressed by cells transfected with the cloned PCR product. These results suggest that activation of normally silent genes is associated with the appearance of tumor rejection antigen MZ2-E.

Example 25

Northern blots were hybridized with probes comprising most of the third exons to investigate expression of gene mage-1 by various normal and tumor cells. In contrast to the results observed in the human tumor cell line MZ2-MEL 3.0, no bands were observed in RNA isolated from the CTL clone of patient MZ2 and phytohemagglutinin-activated blood lymphocytes of the same patient. In addition, the normal tissues of several other individuals were negative (Figures 10 and 11). Fourteen melanoma cell lines from other patients were tested. Eleven showed positive for varying intensities. In addition to these cultured cell lines, four samples of melanoma tumor tissue were analyzed. Two samples were positive, including metastasis of patient MZ2, and the possibility of gene expression providing tissue culture artifacts was ruled out. Several tumors belonging to different histological types, including lung tumors, were tested. Most of these tumors were benign (Figures 10 and 11). These results indicate that the MAGE gene family is expressed not only by many melanoma but also by other tumors. However, they did not provide clear evidence as to whether genes mage-1, 2 or 3 are expressed by these cells because the DNA probes corresponding to the three genes cross-hybridized to a significant level. To analyze this more specifically, PCR amplification and hybridization using oligo-nucleotide probes with high specificity were performed. After cDNA was obtained, it was amplified by PCR using oligonucleotide primers corresponding to the sequence of exon 3 identical to the three MAGE genes discussed herein. It was then tested whether the PCR product hybridized with three other oligonucleotides that showed complete specificity in one of the three genes (Figure 9). Control experiments by diluting the melanoma MZ2-MEL 3.0 with RNA from negative cells showed that the signal intensity decreased in proportion to dilution under the conditions used here and positive signals could be detected even at 1/300 dilution. Showed that there is. Normal cells (lymphocytes) tested by PCR were found to be negative for the expression of three MAGE genes, suggesting that expression levels were lower than 1/300 of the MZ2 melanoma cell line (Figure 11). 11 degrees). Results obtained for a panel of melanoma cell lines showed that some melanoma expressed the MAGE genes, mage 1, 2 and 3 while others expressed only mage-2 and 3 (FIGS. 10 and 11). In addition, some of the other tumors expressed all three genes while others expressed only mage-2 and 3 or only mage-3. It is impossible to formally exclude that some positive PCR results do not represent the expression of one of the three characterized MAGE genes but the expression of another closely related gene that shares the sequence of priming and hybridization oligonucleotides. It can be concluded that the MAGE genotype is expressed by many different tumors and that these genes are latent in normal cells tested for this point.

Example 26

The use of sequences that transfect with high efficiency and effectively express TRAP makes it possible to investigate the major histocompatibility complex (MHC) class I molecules involved. Specific to class I of patient MZ2 are HLA-A1, A29, B37, B44 and C6. Four other melanoma of patients with MZ2 and A1 in common were co-transfected with 2.4 kb fragment and pSVtkneoβ. Three of them yielded neo ^r transfectants that stimulate the release of TNF, which is CD8 + by anti-E CTL clone 82/30 (FIG. 10). E-transfectants were not obtained in four other melanoma, some of which shared AZ, A29, B44 or C6. This suggests that the donor molecule of antigen MZ2-E is HLA-A1. Certainly, two of six melanoma cell lines derived from tumors of HLA-A1 patients were found to stimulate TUF release by anti-E CTL clone 82/30 of patient MZ2. In addition, one of these tumor cell lines, MI13443-MEL, also showed high sensitivity to lysis by these anti-E CTLs. These two melanoma were those that expressed the mage-1 gene (Figure 13). Eight melanoma of patients with HLA haplotypes not comprising A1 were tested for sensitivity to lysis and the ability to stimulate TNF release by CTL. None showed positive. The ability of some human anti-tumor CTLs to dissociate allogeneic tumors sharing the proper HLA specificity with the original tumor has been previously reported (Darrow, et al., J. Immunol. 142: 3329 (1989)). As detailed above, the antigenic peptides encoded by genes mage 2 and 3 may also be provided for self-derived CTLs by HLA-A1 or other class I molecules, especially given the same results found in murine tumors. The probability is very high.

Example 27

As indicated above, melanoma MZ2 expressed antigens F, D and A 'in addition to antigen E. After separating the nucleic acid sequence encoding the antigen E, the same experiment was performed to separate the nucleic acid sequence encoding the antigen F.

To accomplish this, the culture of the cell line MZ2-MEL2.2, the E ^- cell line described above, was treated with anti-F CTL clone 76/6 in the same way as for the anti-E CTL clone. Through this, F antigen loss variants were isolated and selected several times. The cell line obtained, “MZ2-MEL2.2.5”, showed complete resistance to lysis by anti-F CTL, but was still proven to lyse to anti-D CTL.

On the other hand, after the isolation method of antigen-E precursor DNA was carried out, F ⁻ variants were transformed with genomic DNA of the F ⁺ cell line MZ2-MEL3.0. The experiment yielded 90,000 drug resistant transfectants. For these, a pool of 30 cells was used to examine MZ2-F expression in the TNF detection test as above. One pool stimulated TNF release by anti-F CTL, which was cloned. Five of 145 clones were found to stimulate anti-F CTL. The dissolution test, also performed according to the method described above, demonstrated (i) expression of the gene encoding antigen F, and (ii) provision of antigen F itself.

Example 28

After identifying the F ⁺ cell lines, the DNA obtained therefrom was used to transfect the cells. To accomplish this, the cosmid library of the F ⁺ cell line MZ2-MEL.43 was prepared using the method described above again. The library was divided into 14 groups of about 50,000 cosmids, and then transfected with MZ2-MEL2.2.5 with DNA from each group. The transfectant's ability to stimulate TNF release from anti-F CTL clone 76/6 was then tested. Of the 14 groups of cosmids, one made two independent transfectants expressing antigen F; Two positive of 17,500 genitine resistant transfectants were obtained.

Example 29

The presence of the gene family was shown in the pattern observed in Southern blots (Figure 12). For these runs, a 2.4 kb BamHI fragment carrying the expression of antigen M22-E was labeled with 32p and used as a probe in Southern blot using BamHI digested DNA of E + cloned subclone M22-MEL2.2. Hybridization conditions were 50 μl / cm 2 of 3.5 × SSC, 1 × Denhardt's solution; 25 mM sodium phosphate buffer (pH 7.0), 0.5% SDS, 2 mM EDTA and 2.4 kb probes were labeled with [α ³² p] dCTP (2-3000 Ci / mol) at 3 × 10 ⁶ cpm / ml. Hybridization was performed at 65 ° C. for 18 hours. The membrane was then washed four times in 2 × SSC, 0.1% SDS at 65 ° C. for 1 hour and finally left in 0.1 × SSC, 0.1% SDS for 30 minutes. To confirm hybridization, radiographs were made using Kodak X-AR film and Kodak X-Omatic precision magnification screen.

In the examples which follow, when referring to "hybridization", the stringency conditions used were similar to those described above. Therefore, the term "stringent condition" as used herein refers to the preceding condition, and refers to a variation that is recognized as a routine or technical.

Example 30

cDNA encoding mage 4 was identified from a sample of human sarcoma cell line LB23-SAR. The cell line was found not to express mage 1, 2 or 3, but the mRNA of the cell line hybridized with the 2.4 kb sequence of mage 1. To further study this, cDNA libraries were prepared from total LB23-SAT mRNA and hybridized with 2.4 kb fragments. The cDNA sequence was confirmed to hybridize with this probe, later identified as mage 4.

Example 31

Experiments were performed using PHA-activated lymphocytes of patient "MZ2", the source of "MZ" cells described above. Oligonucleotide probes homologous to mage 1 but not to mage 2 or 3 hybridized with cosmid libraries derived from PHA activated cells. However, the size of the hybridizing BamHI cosmid fragment was 4.5 kb, thus indicating that the material was not mage 1. However, in view of the similarity with mage 1 to 4, the fragment may be referred to as "mage 5". The sequence of MAGE 5 is shown in SEQ ID NO: 16.

Example 32

Testing with melanoma cell line LB-33-MEL. CDNA was prepared using total mRNA obtained from the cell line and then amplified with oligo CH09: (ACTCAGCTCCTCCCAGATTT), and CH010: (GAAGAGGAGGGGCCAAG). These oligos correspond to exon 3 regions common to the previously described mage 1, 2 and 3.

To do this, 2 μl of 10 × PCR buffer, 2 μl of 10 mM dNTP, ₂ μl of 25 mM MgCl ₂ , 1.2 μl, 1 μl of CH09 80 mM solution, 20 units of RNAsin, and 200 units of M-MLV reverse transcriptase as described above 1 μg of RNA was diluted to a total volume of 20 μl. Next, the cells were incubated at 42 ° C for 40 minutes. PCR amplification was carried out by adding 8 μl of 10 × PCR buffer, 4.8 μl of 25 mM MgCl ₂ , 1 μl of CH010, 2.5 units of Thermus acquaticus (“Taq”) polymerase, and water to make 100 μl of the total volume. Was performed. Amplification was then performed for 30 cycles (1 min at 94 ° C., 2 min at 52 ° C., 3 min at 72 ° C.). Subsequently, 10 μl of each reaction was fractionated by size on an agarose gel, followed by nitrocellulose blotting. The product hybridized with oligonucleotide probe CH018 (TCTTGTATCCTGGAGTCC). The probe identified mage 1 but not mage 2 or 3. However, this product did not hybridize with probe SEQ 4 (TTGCCAAGATCTCAGGAA). The probe also binds to mage 1 but not to mage 2 and 3. This indicates that the PCR product contains different sequences than mage 1, 2 and 3. The sequencing of the fragments also showed a difference with mage 4 and 5. These results indicated that the sequence differed from the previously identified mage 1, 2, 3, 4 and 5, named mage 6.

Example 33

In further experiments with a cosmid library derived from PHA-activated lymphocytes of MZ2, complementary fragments were isolated using a 2.4 kb mage 1 fragment as a probe. However, the clone did not bind to oligonucleotides specific for mage 1, 2, 3 or 4. The obtained sequence showed some homology with exon 3 of mage 1 but was different from mage 1-6. Hereinafter referred to as mage 7. Further screenings revealed mage 8-11.

Example 34

The usefulness of the TRAPs as well as the TRAs derived therefrom was demonstrated below.

Exon 3 of mage 1 has been shown to deliver expression of antigen E. As a result, it was tested whether synthetic peptides derived from exon 3 can be used to confer sensitivity to anti-E CTLs.

To accomplish this, cells normally insensitive to anti-E / CTL were incubated with synthetic peptides derived from exon 3.1 using standard methods. The CTL dissolution test described above for P815A using a peptide concentration of 3 mM showed that the peptide Glu-Ala-Asp-Pro-Thr-Gly-His-Ser-Tyr was the best. The test showed a dissolution of 30%, indicating that it confers sensitivity to anti-E CTLs.

Example 35

Nucleic acid sequences referred to as "smage" were isolated from murine cells. Cosmid libraries were prepared from aluminum of normal DBA / 2 kidney cells using the cosmid vector C2RB following the method described above. A 2.4 kb BamHI fragment of MAGE-1 was used as a probe. The DNA was floated on a nylon filter, and washed with 2 × SSC at 65 ° C. to confirm smage water.

Example 36

The method described above was further used to test for the presence of the MAGE gene in tissue samples. Some of these results are as follows.

There was no expression of the MAGE gene in brain or kidney tumor tissues. Not all tumors tested showed expression of all MAGE genes, but colon cancer tissues showed expression of MAGE 1, 2, 3 and 4. This is consistent with the following results: pancreatic tumor (MAGE 1); Non-small cell lungs (MAGE 1, 2, 3 and 4), prostate (MAGE 1), sarcoma (MAGE 1, 2, 3 and 4), chest (MAGE 1, 2 and 3), and larynx (MAGE 1 and 4).

The previous specification, including examples, provides many means of great value to those skilled in the art. First, the Examples provide a method for identifying and isolating nucleic acid molecules encoding tumor rejection antigen precursors as well as complementary nucleic acid molecules. DNA exists in double stranded form, one of which is complementary to the other. Nucleic acid hybridization techniques have evolved to the level where the skilled person has isolated or synthesized the other side of a given DNA strand.

As used herein, "nucleic acid molecule" refers to all types of DNA and RNA having the properties discussed above. As can be seen from the examples for the isolation of MAGE coding sequences, both genomic and complementary DNA, or "cDNA", encode specific proteins, and this specification teaches the technician how to obtain both.

Similarly, RNA molecules such as mRNA can be obtained. On the one hand, the skilled person has the coding sequence in hand and can isolate or synthesize mRNA.

Complementary sequences that do not encode TRAP, such as "antisense DNA" or mRNA, are useful, for example, in probing coding sequences as well as in methods of inhibiting expression.

The examples also illustrate the preparation of biologically pure cultures of cell lines transfected with nucleic acid sequences encoding or expressing TRAP molecules. Such cultures can be used as a source of tumor rejection antigen, or as a treatment. This aspect of the invention is discussed next.

Cells transfected with a TRAP coding sequence can also be transfected with other coding sequences. Examples of other coding sequences include cytokine genes, such as interleukins (eg IL-2 or IL-4), or major histocompatibility complex (MHC) or human leukocyte antigen (HLA) molecules. Cytokine gene transfection is important because their expression is expected to increase the therapeutic effect of biologically pure cultures of cells in vivo. This technique is well known for the treatment in which an interleukin transfectant is administered to a patient for the treatment of a cancer disease. In a particularly preferred embodiment, the cells are transfected with sequences encoding (i) TRAP molecules, (ii) HLA / MHC half molecules, and (iii) cytokines, respectively.

Transfection with MHC / HLA coding sequences is preferred because some TRAs are preferably or specifically provided only by specific MHC / HLA molecules. Therefore, if the receptor cells already express MHC / HLA molecules associated with TRA presentation, further transfection is not necessary even if further transformation is used for over-expression of the antigen. On the other hand, if the receptor cells do not normally express the relevant MHC / HLA molecule, it is preferable to transfect with the second sequence. Of course it can be understood that transfection with one additional sequence does not reject any further transfection with another sequence.

The term "biologically pure" as used in connection with the cell lines described herein simply means essentially no other cells. To be precise, the definition of "cell line" refers to "biologically pure," but this expression will fully prove this.

Transfection of cells requires the use of appropriate vectors. Thus, the present invention includes expression vectors of interest in which the coding sequence for TRAP is suitably linked to a promoter. Promoters may be strong promoters known in the art, or differential promoters that act only in specific cell types. The expression vector will also include all or part of a vaccinia virus or virus or bacterium genome, such as BCG. Such vectors are particularly useful for vaccine manufacture.

As long as the TRAP sequence is included, the expression vector can merge several coding sequences. The cytokines and / or MHC / HLA genes discussed above can be included in a single vector along with the TRAP sequence. If this is not desired, an expression system can be provided where two or more separate vectors are used where each coding sequence is properly linked to a promoter. On the other hand, the promoter may be a strong promoter or a differential promoter. Blank transfection is well known in the art and one skilled in the art is expected to use this technique. The vector will be prepared to directly encode the TRA molecule rather than the TRAP molecule. This eliminates the need for post-translational processing.

As clearly discussed above, the sequence encoding the "tumor reject antigen precursor" ("TRAP") is processed in order to become a tumor reject antigen ("TRA"). Separate forms of these categories are described herein, including each specific example. Perhaps the most notable aspect is the vaccine for the treatment of various cancers. Evidence is that an immune response occurs after TRA is given on tumor cells, resulting in cell removal. The examples show that when various TRAs are administered to the cells, a CTL response occurs and the donor cells are removed. Since this is a characteristic of the vaccine, the TRAP processed and the TRA itself, and the TRA itself, can be used alone or as a pharmaceutically suitable vaccine. Similarly, donor cells will be used alone or in admixture with the ingredients that make up the pharmaceutical composition through the same method. Additional substances that can be used as vaccines include TRAP fragments as well as isolated cell mutated viruses, in particular etiolated form, and transfected bacteria, in which TRA molecules are present on the surface. As used herein, “fragment” refers to a peptide that is smaller than TRA but has the properties required for the vaccine as described for. Another vaccine consists of a complex of TRA and HLA molecules. The types of vaccines described herein can be administered to a human in an amount sufficient to prevent the development of cancer disease.

The development of an immune response involving T-cells or B-cells is a feature that indicates the effect of a given tumor rejection antigen. Among other things with respect to B-cell responses, this involves the production of antibodies to TRA, to which TRA specifically binds. Moreover, TRAP molecules are large enough to confer immunogenicity on them, and antibodies that specifically bind thereto are part of the invention. These antibodies may be polyclonal or monoclonal, the latter being prepared by all well known methods of preparation which do not need to be repeated here. For example, mAbs can be made using EBV transformants in animal models such as Balb / C mice or in vitro. In addition, antisera can be isolated from patients who are losing cancerous diseases in which specific cells provide TRA. Such antibodies can also be produced against epitopes defined by the interaction of TRA and HLA / MHC molecules.

A review of the previous specification reveals many aspects of the system referred to as "providing and recognizing tumor rejection antigens." Recognition of these phenomena provides useful results for diagnosis. For example, the presence of an antibody against a particular CTL clone or TRA can be used to diagnose or monitor cancer disease by monitoring the activity of CTLs, TRAs and antibodies in a sample obtained from a subject, or the activity of anti-TRA CTL associated with a subject sample. Enable it (described below). Similarly, expression of nucleic acid molecules on TRAP can be examined through amplification (eg, "polymerase chain reaction"), anti-sense hybridization, probe technique, and the like. Various patient samples can be analyzed as such, including body fluids (blood, serum, and other exudate), tissues, and tumors.

Specific diagnostic methods can be used to apply the standard "tuberclin response" used to diagnose tuberculosis recently. This standard skin reaction adds a stable form of "purified protein derivative" or "PPD" as a diagnostic aid. In a similar manner, the TRA of the present invention can be used for such skin reactions as a vaginal adjuvant or in irradiation methods.

The term "cancer disease" is used herein to include all physiological phenomena that cause cancer and ultimately exhibit clinical signs. Tumors do not occur in the first place, which is visible from the beginning; On the contrary, after normal cells are transformed into malignant tumors, various phenomena related to the development and metastasis of biomass such as tumors and the like occur. Moreover, since tumors do not spontaneously disappear, recovery is considered part of "cancer disease".

Diagnostic aspects of the present invention include all the phenomena involved in carcinogenesis from initial transformation of a single cell to malignant tumor as well as tumor development and metastasis as well as recovery. All are included here.

The term "subject" as used includes all species that may develop cancer. This includes humans or non-humans such as pets, pet livestock and the like. The therapeutic aspect of the present invention is shown. The effect of administering effective amounts of TRAP and TRA as a vaccine has already been discussed above. Similarly, certain CTLs can be generated ex vivo and then administered to a subject. Antibodies that specifically bind to cells that provide related TRAs can be administered either polyclonal or monoclonal. These antibodies will be made into specific antitumor agents, including, but not limited to, methotrexate radioiodinated compounds, toxins such as lysine, other cytostatic or cytolytic agents, and the like. Therefore, "targeted" antibody treatments are included herein, such as to remove cancer cells under CTL.

The terms and expressions used are for descriptive purposes and not for purposes of limitation, and are not intended to use those terms and surfaces to exclude all equivalents or portions thereof, and various variations are within the scope of the present invention. It should be understood that this is possible.

(1) General Information:

(i) Applicants: Boone, Thieti, Van den Ade, Benoit

(ii) Name of the Invention: Isolated and purified DNA sequences encoding antigens expressed by tumor cells and recognized by cytotoxic T cells, and uses thereof

(iii) SEQ ID NO: 26

(iv) communication address:

(A) To: Felfe & Lynch

(B) Distance: 850 Third Avenue

(C) State: New York City

(D) State: New York

(F) Zip code: 10022

(v) computer readable format:

(A) Media Type: Diskette, 5.25 inches, 360kb storage

(B) Computer: IBM

(C) Operating system: PC-DOS

(D) Software: WordPerfect

(vi) Current application data:

(A) Application number:

(B) filing date:

(vii) First application data:

(A) Application number: 07 / 807,043

(B) Filed December 12, 1991

(vii) First application data:

(A) Application number: 07 / 764,364

(B) Application date: September 23, 1991

(vii) First application data:

(A) Application number: 07 / 728,838

(B) Filed: July 9, 1991

(vii) First application data:

(A) Application number: 07 / 705,702

(B) Application date: May 23, 1991

(viii) Patent Attorney / Agent Information:

(A) Name: Norman D. One hand

(B) Registration Number: 30,946

(C) Certificate / Certificate Number: LUD 253.4

(ix) Telecommunication Information:

(A) Telephone: (212) 688-9200

(B) Telephone fax: (212) 838-3884

(2) Information about SEQ ID NO: 1:

(i) sequence properties:

(A) Length: 462 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(xi) Sequence description: SEQ ID NO: 1:

(2) Information about SEQ ID NO: 2:

(i) sequence properties:

(A) Length: 675 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(xi) Sequence description: SEQ ID NO: 2:

(2) Information about SEQ ID NO: 3:

(i) sequence properties:

(A) Length: 228 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(xi) Sequence description: SEQ ID NO: 3:

(2) Information about SEQ ID NO: 4:

(i) sequence properties:

(A) Length: 1365 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(xi) Sequence description: SEQ ID NO: 4:

(2) Information about SEQ ID NO: 5:

(i) sequence properties:

(A) Length: 4698 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(xi) Sequence description: SEQ ID NO: 5:

(2) Information about SEQ ID NO: 6:

(i) sequence properties:

(A) Length: 9 base pairs

(B) Class: Amino Acid

(D) mode: linear

(ii) Molecular Type: Protein

(xi) Sequence description: SEQ ID NO: 6:

(2) Information about SEQ ID NO: 7:

(i) sequence properties:

(A) Length: 2418 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(xi) Sequence description: SEQ ID NO: 7:

(2) Information about SEQ ID NO: 8:

(i) sequence properties:

(A) Length: 5724 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-1 gene

(xi) Sequence description: SEQ ID NO: 8:

(2) Information about SEQ ID NO: 9:

(i) sequence properties:

(A) Length: 4157 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-2 gene

(xi) Sequence description: SEQ ID NO: 9:

(2) Information about SEQ ID NO: 10:

(i) sequence properties:

(A) Length: 662 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-21 gene

(xi) SEQ ID NO: SEQ ID NO: 10:

(2) Information about SEQ ID NO: 11:

(i) sequence properties:

(A) Length: 1640 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: cDNA for mRNA

(ix) Features:

(A) Name / Key: cDNA MAGE-3

(xi) Sequence description: SEQ ID NO: 11:

(2) Information about SEQ ID NO: 12:

(i) sequence properties:

(A) Length: 943 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-31 gene

(xi) SEQ ID NO: SEQ ID NO: 12:

(2) Information about SEQ ID NO: 13:

(i) sequence properties:

(A) Length: 2531 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-4 gene

(xi) Sequence description: SEQ ID NO: 13:

(2) Information about SEQ ID NO: 14:

(i) sequence properties:

(A) Length: 2531 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-41 gene

(xi) Sequence description: SEQ ID NO: 14:

(2) Information about SEQ ID NO: 15:

(i) sequence properties:

(A) Length: 1068 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: cDNA for mRNA

(ix) Features:

(A) Name / Key: cDNA MAGE-4

(xi) Sequence description: SEQ ID NO: 15:

(2) Information about SEQ ID NO: 16:

(i) sequence properties:

(A) Length: 2226 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-5 gene

(xi) Sequence description: SEQ ID NO: 16:

(2) Information about SEQ ID NO: 17:

(i) sequence properties:

(A) Length: 2305 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-51 gene

(xi) SEQ ID NO: SEQ ID NO: 17:

(2) Information about SEQ ID NO: 18:

(i) sequence properties:

(A) Length: 225 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: cDNA

(ix) Features:

(A) Name / Key: MAGE-6 gene

(xi) SEQ ID NO: SEQ ID NO: 18:

(2) Information about SEQ ID NO: 19:

(i) sequence properties:

(A) Length: 1947 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-7 gene

(xi) SEQ ID NO: SEQ ID NO: 19:

(2) Information about SEQ ID NO: 20:

(i) sequence properties:

(A) Length: 1810 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-8 gene

(xi) SEQ ID NO: SEQ ID NO: 20:

(2) Information about SEQ ID NO: 21:

(i) sequence properties:

(A) Length: 1412 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) Name / Key: MAGE-9 gene

(xi) SEQ ID NO: SEQ ID NO: 21:

(2) Information about SEQ ID NO: 22:

(i) sequence properties:

(A) Length: 920 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-10 gene

(xi) SEQ ID NO: SEQ ID NO: 22:

(2) Information about SEQ ID NO: 23:

(i) sequence properties:

(A) Length: 1107 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) name / key: MAGE-11 gene

(xi) SEQ ID NO: SEQ ID NO: 23:

(2) Information about SEQ ID NO: 24:

(i) sequence properties:

(A) Length: 2150 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) Name / Key: smage-I

(xi) SEQ ID NO: SEQ ID NO: 24:

(2) Information about SEQ ID NO: 25:

(i) sequence properties:

(A) Length: 2099 base pairs

(B) Type: nucleic acid

(D) mode: linear

(ii) Molecular type: genomic DNA

(ix) Features:

(A) Name / Key: smage-II

(xi) Sequence description: SEQ ID NO: 25:

(2) Information about SEQ ID NO: 26:

(i) sequence properties:

(A) Length: 9 amino acids

(B) Class: Amino Acid

(D) mode: linear

(ii) Molecular Type: Protein

(xi) SEQ ID NO: SEQ ID NO: 26:

Claims (41)

An isolated nucleic acid molecule encoding a human tumor rejection antigen precursor, wherein the nucleic acid molecule has a complementary sequence that hybridizes to the sequence of SEQ ID NO: 8 at 0.1 × SCC, 0.1% SDS. The isolated nucleic acid molecule of claim 1, wherein the molecule encodes a MAGE antigen precursor. The isolated nucleic acid molecule of claim 2 comprising the nucleotide sequence shown in FIG. 9. Microorganisms and mammalian cells transfected with the nucleic acid molecule of claim 1. Microorganisms and mammalian cells transfected with the nucleic acid molecule of claim 2. Microorganisms and mammalian cells transfected with the nucleic acid molecule of claim 3. The microorganism and mammalian cell of claim 4, wherein the human tumor rejection antigen precursor is found in melanoma cells. 8. The microorganism and mammalian cell of claim 7, wherein the tumor rejection antigen precursor is mage-1 and the isolated nucleic acid molecule is composed of the following nucleotide sequence: The microorganism and mammalian cell of claim 4, wherein the cell is transfected with a nucleic acid molecule encoding a cytokine. 10. The microorganism and mammalian cell of claim 9, wherein said cell is further transfected with a nucleic acid molecule encoding a HLA molecule. 10. The microorganism and mammalian cell of claim 9, wherein said cytokine is an interleukin. 5. The microorganism and mammalian cell of claim 4, wherein the cell is transfected with a nucleic acid molecule encoding an MHC molecule or an HLA molecule. The method of claim 4, wherein when the cell expresses an MHC or HLA molecule that provides a tumor reject antigen derived from a tumor reject antigen precursor (TRAP), the TRAP is encoded by a nucleic acid molecule transfected into the cell. Characterized in microorganisms and mammalian cells. 5. The microorganism and mammalian cell of claim 4, wherein said cell is non-proliferative. 5. The microorganism and mammalian cell of claim 4, wherein said cell is a fibroblast cell. A transfected bacterium comprising the nucleic acid molecule of claim 1. An expression vector useful for transfection of a cell comprising the isolated nucleic acid molecule of claim 1 operably linked to a promoter. An expression vector useful for transfection of a cell comprising the isolated nucleic acid molecule of claim 3 operably linked to a promoter. 18. The expression vector of claim 17, further comprising a nucleic acid molecule encoding MHC or HLA. An expression system useful for transfection of cells, comprising: (i) a first vector comprising a nucleic acid molecule encoding a tumor rejection antigen precursor of claim 1, and (ii) (a) a tumor derived from the tumor rejection antigen precursor An expression system comprising a second vector selected from the group consisting of a vector comprising a nucleic acid molecule encoding an MHC or HLA molecule providing a reject antigen and (b) a vector comprising a nucleic acid molecule encoding an interleukin. An isolated tumor rejection antigen, which is derived from a tumor rejection antigen precursor encoded by the nucleic acid molecule of claim 1. An isolated peptide having the amino acid sequence of SEQ ID NO: 26, useful for treating a subject with cancer disease. An antibody that specifically binds to a tumor rejection antigen precursor encoded by the nucleic acid molecule of claim 1. A method of determining whether a blood sample contains cell soluble T cells specific for a complex of tumor rejection antigen and a HLA molecule, the method comprising contacting the sample with the cell line transfected with the DNA molecule of claim 1, and Determining the lysis value, wherein the lysis indicates that cytolytic T cells are present in the sample. The method of claim 24, wherein the tumor rejection antigen is a MAGE antigen. A method of determining the decrease, increase, or onset of expression of a MAGE tumor reject antigen precursor, comprising: (i) a tumor reject antigen precursor encoded by the nucleic acid molecule of claim 1, (ii) a tumor reject antigen of claim 74 and (iii) the Examining the blood sample for a parameter selected from the group consisting of cytolytic T cells specific for tumor rejection antigens, wherein the amount of said parameter indicates a decrease, increase or initiation of expression of the MAGE tumor rejection antigen precursor How to. The method of claim 26 comprising contacting the sample with the antibody of claim 23. The method of claim 27, wherein the antibody is labeled with a radiolabel or enzyme. The method of claim 27, wherein said antibody is a monoclonal antibody. 27. The method of claim 26, comprising amplification of RNA encoding said tumor rejection antigen precursor. 31. The method of claim 30, wherein said amplification is carried out a polymerase chain reaction. 27. The method of claim 26, wherein said sample is contacted with a nucleic acid molecule that specifically hybridizes to a nucleic acid molecule encoding or expressing said tumor rejection antigen precursor. 27. The method of claim 26, comprising analyzing said sample for said tumor rejection antigen. The method of claim 26, wherein said parameter is cytolytic T cells. A method of making a biological material useful for treating a subject with cancer, comprising the steps of: (i) transfecting a host cell with the nucleic acid molecule of claim 1 encoding a tumor rejection antigen precursor; (ii) transfecting said host cell with a nucleic acid molecule encoding an HLA molecule that provides a tumor rejection antigen derived from said tumor rejection antigen precursor to a cell surface; (iii) treating said host cell under conditions that promote expression of said nucleic acid molecule and provision of said tumor rejection antigen by said human leukocyte antigen. 36. The method of claim 35, further comprising treating the host cell after providing the tumor rejection antigen to impart non-proliferative properties. The method of claim 36, wherein the cytokine further comprises transfecting said host cell with a nucleic acid encoding or expressing a nucleic acid. The method of claim 36, wherein said cytokine is an interleukin. A method of identifying cytotoxic T cells specific for a complex of tumor rejection antigen and HLA molecules in a blood sample, comprising: contacting the complex of tumor rejection antigen and HLA molecules of claim 74 with the cytolytic T cells; And (i) determining whether said cytotoxic T cells proliferate or (ii) whether said cytotoxic T cells release cytotoxic T cell production factors. 40. The method of claim 39, wherein said factor is tumor necrosis factor. A method for determining whether cells in a blood sample express abnormal levels of MAGE tumor reject antigen precursor, the method comprising the steps of: measuring the amount of tumor reject antigen precursor encoded by the nucleic acid molecule of claim 1 expressed by said cell, and Comparing it to the level produced by normal cells.