KR100253546B1 - Gfp mutation and its manufacture - Google Patents

Abstract

PURPOSE: Provided is a green fluorescence protein (GFP) mutant which is very useful as a reporter molecule to monitor gene expression and protein position while holding bioluminescence and clarifying domains. CONSTITUTION: A method for manufacturing a green fluorescence protein (GFP) mutant is characterized by the following steps of: i) amplifying NEX δ-GFP segments that code GFP through polymerase chain reaction (PCR) using primers, gfp1 (5'GGGAATTCCATATGAGAAAAGGAGAAGA) and gfp2 (5'GACACCAGACCAACTGG); ii) cutting PCR products with restriction enzymes Nde I and BamH I and inserting vector Nde I/BamH I-linear pET3a inducing GFP into E. coli; and iii) manufacturing various GFP mutants by using restriction enzymes, exonuclease, and recombinant primers. And the strength of bioluminescence of GFP mutants are measured in E. coli transformed by pET3a-GFP.

Description

Green Fluorescent Protein Mutation and Its Manufacturing Method

[Industrial use]

The present invention relates to a green fluorescence protein (hereinafter referred to as GFP) mutation, and more particularly jellyfish which can be usefully used as a reporter molecule for monitoring gene expression and protein location. (Jellyfish) It relates to a GFP mutation of Aequorea victoria and a method for producing the same.

[Private Technology]

In biochemistry, molecular biology, and medical diagnostics, it is often desirable to add fluorescent labels to easily track and quantify proteins. In general, the labeling process involves covalently binding proteins to fluorescent dyes in vitro and then rearranging them to remove excess dyes and damaging proteins. In order to use a labeled protein in a cell, the protein must be micro-injected, which is a difficult and time-consuming operation for a large number of cells. This problem can be solved by combining the target protein coding nucleotide sequence with the native fluorescent protein sequence to express the fusion protein.

On the other hand, bioluminescent jellyfish Aequorea Victoria's GFP absorbs blue light, producing a stable green hole. The GFP consists of 238 amino acids and is formed by cyclization and oxidation of the Ser-Tyr-Gly sequence at positions 65-67 of the protein itself without the need for other proteins or substrates for fluorescence activity. A strong fluorescence is emitted from the hydroxy-benzylidine imidazolone chromophore, which can be expressed as in Scheme 1 below.

The cDNA sequence for the GFP is disclosed by Prasher, D. C., et al., 1992, pages 111229-233, which are shown in SEQ ID NO: 1 below.

[SEQ ID NO 1]

Cloning of the cDNA enabled GFP expression in other subjects and the oxidative cyclization spontaneously relies on enzymes and reactants that occur spontaneously or anywhere from expressing proteins to fluorescence in a wide range of individual cells and that GFP is a molecule and cell. It is known that it can be used as a powerful new tool in the field of biology. Many neurobiologists, in particular, are tracers for individual neurons during differentiation and maturation of complex neural circuits, as well as markers for specific proteins during trafficking within complex myelin structures and axon subcellular structures. The potential of GFP as a

Accordingly, various GFP mutations have been developed so far to further enhance their applicability by increasing GFP fluorescence or modifying the fluorescence spectrum. Heim, R. et al. (1995), GFP mutant S65T, in which the 65th amino acid serine of GFP mutated to threonine in “Improved green fluorescence” on page 373 663-664, had a single excitation peak at 489 nm and 4 more than the wild type. It is disclosed to form fluorolhores twice as fast. Heim, R. et al., 1994, Proc. Nat'1. Acad. Sci. USA 91 12501-12504, "Wavelength mutations and porsttranslational autoxidation of green fluorescent protein," discloses that 167th amino acid isoleucine mutant I167T mutated to threonine changes the ratio of two excitation peaks and has more fluorescence at 475 nm than 395 nm. have.

On the other hand, from the three-dimensional structures of wild-type GFP and S65T, the fluoropores represent β-barrels or β-cans surrounded by 11 β-strands, according to Ormo, M et al. In 1996 272 1392-1395, "Crystal structure of the Aequorea". victoria green fluorescent protein "and in Yang, F. et al., 1996, Nature Biodeck 14, 1246-1125," The molecular structure of green fluorescent protein. " Dopf, J et al. Also proposed the structural requirements of the GFP backbone for fluorescence in the 1996 "Deletion mapping of the Aequorea victoria green fluorescent protein", pp. 173 39-44. Studies using the deletion mapping to determine) have reported that GFP requires 2-232 amino acids for fluorescence, but it is not possible to compare the mutations due to deletion with wild type. I couldn't.

The present invention has been made to solve the above problems of the prior art, an object of the present invention to more clearly identify the minimum domain required for GFP fluorescence, and GFP mutants having a stronger fluorescence activity and its preparation method, cDNA, recombinant vector And fusion genes.

1 shows schematic representation of various deletion mutations derived from wild type GFP, S65T and I167T and their fluorescence activity.

2 is a graph showing FACS analysis of GFP mutations expressed in E. coli system.

3 is a photograph showing fluorescence of GFP derivatives and expression of fusion proteins of GFP derivatives and β-galactosidase in apricia neurons.

In order to achieve the above object of the present invention, the first invention provides a GFP mutation in which 7-9 amino acids are deleted from the C-terminus of a green fluorescent protein.

In particular the invention provides GFP mutations in which nine amino acids are deleted from the C-terminus of a green fluorescent protein.

The green fluorescent protein is preferably selected from the group consisting of wild type, S65T mutation and I167T mutation.

The GFP mutations are preferably expressed in apricia neurons either alone or in fused form with the LacZ gene.

Secondly, the present invention provides a cDNA encoding a fraudulent GFP mutation, a recombinant vector comprising the cDNA, and a fusion gene of the cDNA and LacZ genes.

Hereinafter, the present invention will be described in detail.

We studied in detail the primary structure requirements for green fluorescence of jellyfish GFP and the known mutations of GFP, S65T and I167T. For this purpose, deletion mapping, fluorescence-activated cell sorting (FACS) and spectrofluorometry were performed. That is, several truncated GFP mutations were prepared using S65T and I167T as well as wild type to map the minimal structure of GFP that does not disrupt GFP function.

The procedure for preparing the GFP deletion mutation is as follows.

The coding region of GFP is amplified from pNEX δ-GFP by polymerase chain reaction (PCR) using primers gfp1 (5'GGGAATTCCATATGAGTAAAGGA GAAGA) and gfp2 (5'GACACCAGACCAACTGG). The product of the PCR is cleaved with Nde I and BamH I and introduced into a Nde I / BamH I-linearized pET3a vector (Novazen) which induces GFP expression of E. coli under the control of the T7 promoter. Various deletion mutations of GFP are prepared using restriction enzyme digestion within the coding site, exonuclease digestion using the ExoIII / Mung bean kit (stratazine), and PCR with designed recombinant primers.

In addition, the effects on the spectral characterization and intensity of the GFP green fluorescence of the deletion mutants are analyzed by spectrophotometry and fluorescence-activated cell sorting analysis. In other words, FACS analysis is performed using the same density of E.coil transformed with pET3a-GFP to compare the fluorescence intensity between GFP mutations in detail. The cells are grown and induced under the same conditions.

We found that cleavage of the 9 amino acids at the C-terminus (GFPΔC9, S65TΔC9, and I167TΔC9) increased green fluorescence (FIG. 2). Statistical analysis of blind experiments showed that the fluorescence intensity was 23% or more (54.10 ± 3.68, n = 31) in GFPΔC9 (denoted as SEQ ID NO: 2) and 7% or more (54.413 in S65TΔC9 (expressed in SEQ ID NO: 3)) by the cleavage. 20 ± 34.13, n = 29) and I167TΔC9 (indicated by SEQ ID NO: 4) showed 34% or more increase (82.77 ± 10.69, n = 10) respectively (2d). Whereas at the C-terminus 10 (GFPΔC10, S65 TΔC10 and I167TΔC10) or 11 (GEPΔC11, S65TΔC11, and I167TΔC11) amino acid deletions result in much weaker fluorescence than GEP, S65T or I167T, respectively (Fig. 2a- 2c) Further deletions, including the first amino acid Ala ²²⁷ , can be seen to completely eliminate GFP fluorescence (2a, 2b).

The difference in fluorescence intensity between the mutations can be seen that the production level is almost the same by SDS-PAGE analysis (not shown), so that it does not result from the difference in the expression level of GFP in E. coli. The difference in green fluorescence intensity between cleaved and uncleaved proteins appears to be due to different kinetics or changes in yield of protein folding or fluoropore formation.

The results provide a more detailed analysis of C-terminal deletions than the recent results that 6 amino acids can be deleted from the C-terminus of His-tagged GFP without interfering with GFP fluorescence and further advanced deletions of up to 9 amino acids result in It clearly shows that it not only maintains fluorescence but also enhances it. That is, a stretch of 9 amino acids from Thr230 to Lys238 present at the C-terminus forms a flexible loop. The removal of the flexible loop does not appear to have any catastrophic effect on the overall structure of the GFP, but instead the structural change caused by the removal of the loop causes a large increase in fluorescence intensity. More research will be needed to determine why these structural changes cause increased GFP fluorescence. The tenth amino acid Ile 229 from the C-terminus is the last component of the eleventh β-sheet in the cylinder structure of GFP and appears to be involved in protecting the fluoropores from the water molecules of Juy. Thus, partial damage on the eleventh β-sheet caused by removal from the C-terminus to Ile229 or Gly228 results in partial disruption of GFP fluorescence.

Thus, the present invention provides GFP mutations which are deleted 7-9 amino acids from the C-terminus of the green fluorescent protein, in particular GFP mutations which are deleted from the C-terminus of the green fluorescent protein. That is, a GFP mutation is provided in which the 9 amino acid component is deleted from the C-terminus of the wild type, S65T mutant or I167T mutant GFP. The amino acid sequence of the mutation from which the 9 amino acid component was deleted from the C-terminus of the wild type GFP is shown in SEQ ID NO: 2 below.

[SEQ ID NO 2]

In addition, a GFP mutation in which the 9th amino acid component was deleted from the C-terminus of the S65T mutant in which the 65th serine was mutated to threonine in SEQ ID NO: 2, and the 9 amino acid component from the I167T mutant C-terminus in which the 167th isoleucine was mutated to threonine in SEQ ID NO: 2 This provides the deleted GFP mutation.

We analyzed the spectral properties of wild type and S65T and their truncated mutations by using purified His-tagged proteins. As shown in Table 1 below, the spectra of GFP, S65T and I167T are nearly identical to those known and both excitation and divergence spectra are unaffected by cleavage of 9 or 10 components at the C-terminus from wild-type and GFP mutations. Do not. This means that an increase or partial decrease in GFP fluorescence due to deletion of amino acids at the C-terminus does not cause any shift in the wavelength spectrum of excitation and divergence.

The values in * () indicate the properties of the minor peak.

** That is the average peak wavelength from 2 to 4 independent experiments using the Dananut ㅌ His-tagged GFP mutations.

Finally, we investigated whether GFP deletion mutations could function as fluorescent markers in cells after fusion alone or with other proteins such as β-galactosidase. For this purpose, African neurons are used instead of E-coli, which contains its own high background β-galactosidase. This is also for the convenience of the truncated GFP mutations as gene expression markers in their nervous system. In-frame fusion of LacZ to cleaved GFP or S65T is performed. As shown in Table 1, the fusion does not change the excitation or divergence spectrum of the fluorescence for lacZ-S65TΔC9. Deletion mutations of the presynthetic fusion gene and GFP are subcloned into pNEXδ and expressed under the control of a promoter / enhancer complex in Apricia New Euron. The prepared plasmids (pNEXδ-GFP, -GFPΔC9, -S65T, -65TΔC9, -lacZ-GEPΔC9 and -lacZ-S65TΔC9) were described in Proc. Nat'1. Acad. Sci. USA 89, pp. 1133-1137, is microinjected into neurons cultured by methods such as the steel described in "Overexpression of an Aplysia shaker K + channel gene modifies the electric properties and synaptic efficacy of identified Aplysia neurons".

As a result, we found that some (about 20%) neurons injected with the plasmids emitted green light about 12 hours after microinjection (FIG. 3). Neurons injected with fusion genes express both green fluorescence and β-galactosidase (3e, 3f). This means that GEP deletion mutants function normally like wild-type GFP in African neurons and the fusion protein possesses both GFP fluorescence and β-galactosidase. The LacZ-GFP fusion gene cassette can be used as a double-check marker of gene expression in many cells, including neurons, by using two different reporter assay systems.

In conclusion, the deletion of the 9 amino acid component at the C-terminus of GFP has no negative effect on the fluorescence activity of GFP and substantially the deletion increases the intensity of fluorescence. The fluorescence activity of GFP is partially impaired when the 11 amino acid components are cleaved from the C-terminus of GFP and completely destroyed when the 12 or more amino acid components are cleaved. The truncated mutations are also expressed in apricia neurons, alone or in fused form with other reporter β-galactosidase. The reporter genes are useful for analyzing intracellular protein locations as reporter genes or through fusion with other proteins for gene expression monitoring.

EXAMPLE

An embodiment of the present invention is described. However, the following examples are merely examples of the present invention showing the constitution and effects of the present invention, and the present invention is not limited to the following examples.

Preparation Example 1. Preparation of pET3a-GEPΔC4, -GEPΔC8, and -GEPΔC12]

Double stranded oligonucleotides containing three stop codons (TGACTAGTTGA) were inserted to the right of the Kpn I position of pNEX δ-GEP. The Pvu II fragment (0.11 kb) with the multi stop codons was inserted into the end of the original stop codon of GFP in pET3a-GFP, digested with BamH I and treated with Mung bean nuclease. As a result, the plasmid was digested with BamH I / Kpn I, treated with exonuclease III and subsequently treated with Mung bean nuclease to prepare a group of serially degraded GFP according to the manufacturer's instruction manual (stratazine). It was.

Preparation Example 2 Preparation of pET3a-GEPΔC8, -GEPΔC9, -GEPΔC10, -GEPΔC11, -GEPΔC14, and -GEPΔ22]

T7 primer (Novagen) and antisense primer gfpΔC8 (5'CGGGATCCTTATGTAATCCCAGCAGCTG), gfpΔC9 (5'CGGGATCCTTAA ATCCCAGCAGCTGTTA), gfpΔC10 (5'CATAGACCTGACAGCAGCTTACCACTACTAGTACAA) ) And pfp3a-GFPΔC8, -GFPΔC9, -GFPΔC10, -GFPΔC11, -GFPΔC14 and -GFPΔC22 by PCR with gfpΔC22 (5'CGGGATCCTT AGTCTCTCTTTTCGTTGG) (underlined are BamH I position and stop codon). The PCR products were digested with Nco I and Bam I and substituted for Nco I / BamH I fragments of pET3a-GFP.

Preparation Example 3 Preparation of pET3a-S65T, -S65TΔC9, -S65TΔC10, -S65TΔC11, and -S65TΔC12

Mutation of Thr in component 65 (TCT → ACT) was obtained by two-step recombinant PCR. Namely, a 0.29 kb fragment using a T7 primer (Novazen) and an antisense primer (5'GAACACCATAAGTGAAAGTAGTGACAAGTG), and a 0.60 kb fragment using a sense primer (5'ACTTTCACTTATGGTGTTCAATGC) (underlined point mutation) and a T7 terminator (Novazen), respectively. Amplified from pET3a-GFP. The two duplicate fragments were mixed and recombinant PCR was run using T7 primer and T7 terminator to generate 0.87 kb fragment. The fragment was cleaved with Nde I and wild-type GFP was substituted for the 0.23 kb Nde I fragment to make pET3a-S65T, which was cleaved with Nde I. As a result, the 0.23 kb Nde I fragment was substituted for the same fragments of pET3a-GFPΔC9, -GFPΔC10, -GFPΔC11, -GFPΔC12 to prepare pET3a-S65TΔC9, -S65TΔC10, -S65TΔC11 and -S65TΔC12.

Production Example 4 Preparation of pET3a-I167T

Mutation of Ile of component 167 from Thr (ATT → ACT) was substantially the same as in Preparation Example 3 above using a sense primer (5'AACTTCAAAACTAGACACAACATTGAAG) and an antisense primer (5'TGTGT CTAGTTTTGAAGTTAACTTTG) (the underlined portion is a point mutation) Was executed. Recombinant PCR products were cleaved with Nco I and BamH I and substituted for 0.56 kb Nco I / BamH I fragments of wild type GFP.

Production Example 5. Preparation of pET3a-I167TΔC9, -I167TΔC10 and -I167TΔC11]

I167TΔC9, I167TΔC10 and I167TΔC11 were amplified from pET3a-I167T using T7 primers and their antisense primers gfpΔC9, gfpΔC10 and gfpΔC11, respectively. The PCR products were cleaved with Nco I / BamH I and substituted in place of the same fragment of pET3a0GFP.

Production Example 6. Preparation of pET3a-GFP ΔN7, -GFPΔN17, -GFPΔN23, -GFPΔN42, -GFPΔC14 and -GFPΔN77, -GFPΔC160, -GFPΔC (77-151) and -GFPΔC (49-57)]

PET3a-GFPΔN7, -GFPΔN17, -GFPΔN23, -GFPΔN42, -GFPΔC14 and -GFPΔN77, -GFPΔC160, -GFPΔC (77-151) and -GFPΔC (49-57) were prepared by methods similar to those of the preparation examples.

Preparation Example 7 Preparation of pNEXδ-S65T, -GFPΔC9, -S65TΔC9, -GFPΔC9-lacZ, and -S65TΔC9-lacZ

pNEX δ-S65T was prepared by replacing the Nco I / Xba I fragment of pET3a-GFP instead of that of pNEX δ-GFP. GFPΔC9 and S65TΔC9 were amplified from pET3a-GFP and -S65T, respectively, by PCR using primers gfp3 (5′CG GGATCCAAGCTTATGAGTAAAGGAGAAAGA (underlined position is HindIII position) and gfpΔC9.) PCR fragments were cleaved with HindIII / BamH I and the same enzyme. PNEX δ-GFPΔC9 and -S65TΔC9 were generated by inserting into the plowed pigs pNEX δ By the following procedure, a fusion gene was produced in the expression vector of aprisia neuron, pNEX δ The β-galactosidase gene lacZ was primed. 5'GCTCTAGAGATTCACTGGCCGTCGT (underlined is the Xba I position) and 5'CGGGATCCTTATTTTTGACACCAGA (underlined is the BamH I position) were rescued from pNEX-lacZ. PCR products were cleaved with Xba I / BamH I and pNEX Inserted into Xba I / BamH I of δ. Coding sequences of cleaved GFP and S65T were primer gfp3 and antisense primers (5′CCCAAGCTT AATCCCAGCGCTGTTA, underlined at HindIII position). Amplified by PCR from pET3a-GFP and -S65T using PCR) PCR products were digested with HindIII The resulting DNA fragments with GFPΔ9 (or S65TΔC9) were inserted into pNEX-lacZxb digested with HindIII to pNEX δ- Prepared with GFPΔC9-lacZ (or pNEX δ-GFPΔC9-lacZ).

Test Example 1. FACS Analysis of GFP Mutant Expressed in E. coli System

A single colony of E. coli strain BL21 (DE) pLysS transformed with various pET3a-GFP was able to reach 0.6-0.9 0D ₆₀₀ in LB broth containing 37 ° C., 60 μg / ml empicillin and 34 μg / ml chloramphenicol. Gently shake until grown. The broth was incubated with IPTG for 2.5 hours to a final concentration of 0.4 mM. After incubation with IPTG, the bacterial cultures were diluted with phosphate-buffered saline (PBS) containing 8 mM sodium azide in a 1:20 ratio. Flow cytometry analysis and sorting were performed by exciting 1 × 10 4 seafood at 488 nm using FACStar _plus (Becton Dickison) and relative fluorescence intensity was analyzed by the Lysis II program (Becton Dickison).

The results are shown in FIG. A-C in FIG. 2 shows representative FACS profiles for cleavage mutations derived from wild type GFP (A), S65T (B) and I167T (C), respectively: a is not induced negative control; b is the cleavage of 12 components from the C terminus (ΔC 12); c is cleavage of 11 components (ΔC11); d is the cleavage of 10 components (ΔC 10); e is uncut; f is cleavage of 9 components (ΔC9). D shows group data of FACS analyzes: e is uncleaved; f is cleavage of 9 components ((ΔC 9).

Each independent clone of transformed E. coli was individually FACS analyzed in a blind manner. The blind experiments were analyzed for 34 GFP, 31 GFPΔC9, 29 S65T, 29 S65TΔC9, 10 I167T and 10 I167TΔC9 clones, respectively. In FIG. 2, the height of each bar corresponds to the mean fluorescence ± SEM. As shown in FIG. 2, cleavage of 9 amino acids significantly increased the fluorescence of GFP, S65T and I167T: * P <0.05 relative to the corresponding non-cut; ** P <0.00001; **** P <0.02 (unpaired Student's t-test, two-tailed).

[Test Example 2. Fluorescence and expression of β-galactosidase of GFP derivatives in apricia neurons]

Green fluorescence from neurons was detected using a standard fluorescent filter set (B-2A: dichroic mirror, 510 nm; excitation filter, 470-490 nm; barrier filter, 520 nm) through a Nikon Diaphot-TMD microscope. In Figure 3 (a) is GFP; (b) is GFPΔC9; (c) is S65T; (d) S65TΔC9; (e-1, e-2) is GFPΔC9-lacZ; (f-1, f-2) is for S65TΔC-lacZ. Mol. For neurons f-1 and g-1. Β-galactosidase staining (e-2 and f-2) was performed by the 'strong' method described in Cells 6 (1996), pages 285-295, "Neuroal expression of reporter genes in the intact nervous system of Aplysia". . Negative control neurons adjacent to GFP-positive neurons give green fluorescence of GFP and identifiable yellow autofluorescence (b). One of the control neurons is marked with * (accumulating rod: 100 μm).

The GFP mutation according to the present invention can be usefully used as a reporter gene for gene expression and monitoring of protein position by more clearly identifying the minimum domain required for GFP fluorescence and having stronger fluorescence activity.

Claims (7)

GFP mutation with 7-9 amino acids deleted from the C-terminus of the green fluorescent protein. GFP mutation with deletion of 9 amino acids from the C-terminus of the green form and protein. The cytosolic GFP mutation of claim 2, wherein the green fluorescent protein is selected from the group consisting of wild type, S65T mutation, and I167T mutation. The GFP mutation according to claim 2 or 3, wherein the GFP mutation is expressed in apricia neurons alone or in fused form with the LacZ gene. A cDNA encoding the GFP mutation of claim 2. Recombinant vector comprising the cDNA of claim 5. A fusion gene of claim 5 cDAN and LacZ gene.

Images