KR100248943B1 - Process of preparing active human n-acetyl glucosamin transferase iii - Google Patents

Abstract

The present invention relates to a method for preparing an active human N-acetylglucosamine transcriptase III, which is useful for the production of antibodies for the clinical diagnosis of liver disease and for the development and detection of specific inhibitors of N-acetylglucosamine transcriptase III. Do.

Description

Method for preparing an active human N-acetylglucosamine transcriptase III

The present invention provides an active human UDP-N-acetylglucosamine: β-D-mannoside β-1,4-N-acetylglucosaminyl transferase [UDP-N-acetylglucosamine: β-D-mannoside β-1, 4-N-acetylglucosaminyl transferase III; Hereinafter, abbreviated as "N-acetylglucosamine transferase III" (EC 2. 4. 1. 144).

More specifically, the present invention is a recombinant expression plasmid obtained from the human hepatocellular carcinoma cell line Hep3B, which is rarely expressed in normal humans but strongly expressed in hepatic diseases such as liver cancer and hepatitis. To synthesize a large amount in E. coli and then activate the inactive N-acetylglucosamine transcriptase III expressed in the form of an inclusion body to prepare an active human N-acetylglucosamine transcriptase III. The present invention relates to N-acetylglucosamine transcriptase III produced by the present invention as an antigen for the production of antibodies for the clinical diagnosis of liver disease or to search for natural compounds that selectively inhibit N-acetylglucosamine transcriptase III activity. Useful for devising inhibitors.

The sugar chain on the cell surface is one of the components of glycoproteins and glycolipids that make up the outer membrane of mammals and has a very unique structure depending on the type of cell (Kornfeld, R., Kornfeld, S. Annu. Rev. Biochem. 45 , 217-237, 1976; Rademacher, TW et al., Annu. Rev. Biochem. 57 , 785-838, 1988). The structure of sugar chains is specifically changed in the process of animal cell fertilization, development, differentiation and tumorigenization (Feizi, T. Nature 314 , 53-57, 1985). exist. Sugar chains act as antigens in the process of cell differentiation and are recognized by specific antibodies (Fukuda, M. Biochem. Biophys. Acta. 780 , 119-123, 1985), and are recognized for the recognition of sugar chain binding proteins such as lectins and sugar transferases. Is involved in intercellular interaction.

The sugar chain structure in glycoproteins is classified into N-linked sugar chains and O-linked sugar chains. The O-linked sugar chain is bound to the hydroxy group (-OH group) of serine, and the N-linked sugar chain has the amino acid sequence of Asp-X-Ser / Thr at the reducing end of N-acetylglucosamine. Is bound to the amide group of asparagine.

N-linked sugar chains are roughly divided into high mannose, complex and hybrid forms, which are called trimannosyl cores of Man α1 → 6 (Man α1 → 3) Man β1 → 4 GlcNAc β1 → 4 GlcNAc → Asn. It has a common structure called. In particular, changes in complex N-linked sugar chains involved in tumorigenization of cells result in increased branching in the trimannosil center (Yamashita, K. et al., J. Biol. Chem. 259 , 10834-10840). , 1984), and a polylactosaminoglycan chain is formed (Pierce and Arango, J. Biol. Chem. 261 , 10772-10777, 1986; Hubbard, SCJ Biol. Chem. 262 , 16403-16411, 1987 Sialic acid addition (Warren et al., Proc. Natl. Acad. Sci. USA 69 , 1838-1842, 1972). These changes in the sugar chain structure are regulated by the sequential action of specific glycotransferases and glycolyses to control the degree of branching and the side chain end structures (Paulson, Colley, J. Biol. Chem. 264 , 17615-17618, 1989).

Glycosyltransferase is a membrane protein present in the endoplasmic reticulum and Golgi apparatus, which transfers sugar molecules from the donor substrate, the glyconucleotide derivative, to the acceptor substrate, It is an enzyme that regulates synthesis. Currently, the number of glycotransferases required for the synthesis of sugar chain structures in mammalian cells is estimated to be about 100-150 species in consideration of glycodonating substrates, receptor substrates, and binding states. ). Glycotransferases in the same family have similar receptor substrates and donor substrates, so it is expected that there will be a common amino acid sequence, but surprisingly compared to the amino acid sequence based on the base sequence of the cloned glycotransferases It is known that there are almost no regions homologous to the catalytic domain except for the sylyltranferase. However, the domain structure of glycotransferases has a common structure consisting of four regions: cytoplasmic tail region, trans-membrane region, stem region, and catalytic region.

Since glycotransferases can be directly applied to the synthesis of saccharides and functional oligosaccharides, which are expected as pharmaceutical preparations, there is a growing interest in mass production of active glycotransferases. As such a method, it was reported that when the GnT-I cDNA derived from mice and rats of the glycotransferases acting on the complex N-linked sugar chain was expressed in E. coli, an active soluble protein was produced (Kumar et al. Glycobiology. 2 , 383-393, 1992), and also mass production of active glycotransferases in insect cells using baculovirus expression vectors (Williams et al., Glycoconjugate J. 12 , 755-). 761, 1995).

N-acetylglucosamine transcriptase III is a bisecting group by adding N-acetylglucosamine as β-1,4- bond to β-linked mannose at the center of trimannosyl of an N-linked sugar chain. It is an enzyme that forms glucosamine residues.

The activity of N-acetylglucosamine transcriptase III was first detected in the fallopian tubes of hens (Narasimhan, J. Biol. Chem. 257 , 10235-10242, 1982). In addition, liver tissues and cell lines of liver cancer rats (Narasimhan et al., J. Biol. Chem. 263 , 1273-1281, 1988; Nishikawa et al., Biochem. Biophys. Res. Commun. 152 , 107-112, 1988; Pascale et al., Carcinogenesis 10 , 961-964, 1989), rat kidney (Nishikawa et al., Biochim. Biophys. Acta 1035 , 313-318, 1990), human B lymphocytes (Narasimhan et al., Biochem. Cell Biol. 66 , 889-900, 1988) , HL60 cells (Koenderman et al., FEBS Lett. 222 , 42-46, 1987), Novikoff multiple cancer (Koenderman et al., Eur. J. Biochem. 181 , 651-655, 1989), CaCO-2 cells ( Brockhausen et al., Cancer Res. 51 , 3136-3142, 1991), HuH-6 cells (Ohno et al., Int. J. Cancer 51 , 315-317, 1992), liver cancer cell lines Hep3B and HepG2 (Kim Cheol-ho et al., Kor. J. Chitin, Chitosan, 2 (3), 27-39, 1997), and high activity has been reported, and especially the enzyme activity of N-acetylglucosamine transcriptase III has been reported to increase specifically from serum of liver disease patients. (Ishibashi et al., Clin. Chim. Acta 185 , 325-332, 1991).

Recently, N-acetylglucosamine transcriptase III was purified from the kidneys of rats (Nishikawa et al., J. Biol. Chem. 267 , 18199-18204, 1992), and N-acetylglucosamine metastases in rat kidney cDNA libraries and human fetal liver cDNA libraries. Genes encoding enzyme III were cloned (Nishikawa et al., J. Biol. Chem. 267 , 18199-18204, 1992; Ihara et al., J. Biochem. 113, 692-698, 1993). One human N-acetylglucosamine transferase III gene is present on chromosome 22q.13.1 and encodes 531 amino acids.

It is not yet clear how the change of N-linked sugar chain structure due to the activity of N-acetylglucosamine transferase III affects the cells, but N-acetylglucosamine transcriptase depends on the cell malignancy and cancer metastasis. It is reported that the activity of III is greatly increased (Kim Chul-ho et al., Korean Patent Application No. 95-37788; Kim et al., Gene 170, 281-283. 1996,).

Therefore, developing a method for detecting the expression of N-acetylglucosamine transcriptase III, which is specifically expressed in liver disease and is increased in liver cancer, enables the diagnosis of liver disease in a clinically simple manner, and N-acetylglucosamine transcriptase III. The search and development of inhibitors that inhibit enzymatic activity can control liver disease by regulating the expression of N-acetylglucosamine transcriptase III.

However, the mass production of N-acetylglucosamine transcriptase III must be preceded in order to develop the above diagnostic and therapeutic methods.

To date, the N-acetylglucosamine transferase III gene has been isolated, but no mass production system has been established. The reason is that the enzyme has a transmembrane domain, so when E. coli is killed in mass production in recombinant E. coli, it is difficult to express and is inactivated because it is produced as an inclusion body even when expressed.

Accordingly, the present inventors found that the truncated form N-acetylglucosamine transcriptase III which removed the transmembrane domain was activated when refolding, and the deletion-type N-acetylglucosamine transcriptase III which removed the transmembrane domain was activated. The present invention was completed by preparing an active human N-acetylglucosamine transferase III through a step of producing and purifying a large amount in E. coli and activating it.

It is an object of the present invention to provide a method for mass production of an active human N-acetylglucosamine transcriptase III.

Figure 1 shows the design of primers for the isolation of the N-acetylglucosamine transcriptase III whole gene using the polymerase chain reaction (PCR) method using cDNA of the human liver cancer cell line Hep3B as a template,

Black box: coding region of N-acetylglucosamine transcriptase III cDNA

Figure 2 shows agarose gel electrophoresis of the product by performing a polymerase chain reaction from the cDNA of the human liver cancer cell line Hep3B,

Lane M: 1 Kb ladder;

Lane 1: PCR products of P1 and P2;

Lane 2: PCR product of P3, P4

Figure 3 shows the production process of the expression plasmid pET-GnTIII of the truncated form N-acetylglucosamine transcriptase III gene,

4a shows the results of SDS-PAGE analysis of N-acetylglucosamine transcriptase III expressed in E. coli BL21 (DE3),

Lanes 1-3: cytosolic fraction (soluble fraction); Lane 4-6: Insoluble Ingredient Capture

Lanes 1 and 4: samples before induction; Lanes 2 and 5: vector controls;

Lanes 3 and 6: whole cell fractions 3 hours after PTG induction;

Lane M: molecular weight standard

Arrow: Location of N-acetylglucosamine transcriptase III

Figure 4b shows Western blotting of N-acetylglucosamine transcriptase III expressed in E. coli BL21 (DE3),

Figure 5 shows the results of the SDS-PAGE to confirm the degree of purification of N-acetylglucosamine transferase III present in the inclusion (inclusion body).

Lane 1: tablet inclusion body; Lane 2: insoluble protein after ultrasound;

Lane 3: water-soluble protein after ultrasound; Lane 4: whole cell culture after induction;

Lane 5: non-induced control; Lane M: protein molecular weight marker standard

In order to achieve the above object, the present invention provides an expression plasmid containing all or part of the human N-acetylglucosamine transcriptase III gene and transformants transformed into E. coli.

Specifically, the present invention provides an expression plasmid pKNC 1.7 including the entire human N-acetylglucosamine transcriptase III gene, and N-acetylglucosamine metastasis in which the N-terminal 23 amino acids of human N-acetylglucosamine transcriptase III are deleted. An expression plasmid pET-GnTIII and an E. coli BL 21 transformant (Accession No .: KCTC 8829P) containing the enzyme III gene are provided.

The present invention also provides a method for producing an active human N-acetylglucosamine transcriptase III using the transformant.

Specifically, the method for producing activated human N-acetylglucosamine transcriptase III by culturing the transformant to obtain human N-acetylglucosamine transcriptase III in the form of an inclusion body, purifying and refolding the transformant. To provide.

The present invention also provides the use of the active human N-acetylglucosamine transcriptase III prepared by the above method for the production of antibodies for the clinical diagnosis of liver disease and the development of inhibitors specific for N-acetylglucosamine transcriptase III. do.

Hereinafter, the present invention will be described in detail.

As a template, cDNA of the human liver cancer cell line Hep3B is subjected to a polymerase chain reaction (PCR) to isolate the entire structural gene encoding N-acetylglucosamine transcriptase III.

The cDNA of N-acetylglucosamine transcriptase III of human hepatocellular carcinoma cell line is composed of 1,593 bp coding region and is identical to the existing fetal N-acetylglucosamine transcriptase III coding gene (Ihara et al., J. Biochem. 113, 692-698, 1993).

The expression plasmid containing the entire structural gene was named pKNC 1.7.

However, the entire N-acetylglucosamine transferase III structural gene encodes a protein having a transmembrane region composed of hydrophobic amino acids in the domain structure at the N-terminus, and is expressed in E. coli but expressed in E. coli. It is impossible to mass-produce N-acetylglucosamine transcriptase III because it causes a toxic effect on and kills recombinant E. coli.

Therefore, in the present invention, the forward primer E1: CACGGATCCAAGACCCTGTCCTATGTC, which starts at 69 bp downstream from the start codon in the coding region of N-acetylglucosamine transferase III, is synthesized, and starts at 33 bp downstream from the end code. Reverse primer E2: AACTCGAGCTGTCACAAACCCTATCATCA was synthesized and subjected to polymerase chain reaction using pKNC 1.7 as a substrate to amplify the truncated form N-acetylglucosamine transferase III gene.

The polymerase chain reaction product was cloned into the BamHI / XhoI sites of pET-22b (+) and named as pET-GnTIII, which was transformed into E. coli BL21 (DE3) strain to transform the transformant into the life of the Korea Institute of Science and Technology. It was deposited in the Gene Bank of Engineering Research Institute (Accession Number: KCTC 8829P).

When the transformant is cultured to induce expression with isotpropyl thio-β-D-galactosidase (IPTG), N-acetylglucosamine transferase III is expressed as an inclusion body combined with RNA, and then purified and reduced. It is prepared in active form by refolding through dialysis.

The present invention will be described in detail by the following examples. The following examples illustrate the invention in detail and are not intended to limit the scope of the invention.

<Example 1> Isolation of a structural gene encoding N-acetylglucosamine transcriptase III of human liver cancer cell line Hep3B

For the isolation of structural genes encoding N-acetylglucosamine transcriptase III of the human liver cancer cell line Hep3B, a cDNA library of the human liver cancer cell line hep3B was synthesized and used as a template for polymerase chain reaction.

Synthesis of cDNA library and preparation of phage lysate from human liver cancer cell line hep3B were performed by Maniatis et al. (Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982). Synthesis kit (Promega Co., USA) was used.

N-terminal amino acid sequencing of N-acetylglucosamine transcriptase III purified from Hep3B confirmed the same as that of N-acetylglucosamine transcriptase III of human fetuses reported previously, and the nucleotide sequence gene bank database [GenBank Nucleotide A primer was designed according to the Sequence Database (accession No. D13789).

The primers were composed of a DNA synthesizer (Applied Biosystem 391 DNA Synthesizer, USA), and a forward primer P1: GGATGAAGATGAGACGCTACAAG and a reverse primer P2: GGAACTTGAGCGGCCGCGGCT and a pair of forward primers P3: AGCCGCGGCCGCTCAAGAGTCCC, reverse primers, CTA CAGTCAGTCCC, CGGAGTCTC, etc.

Polymerase chain reaction (Saiki et al., Science 239 , 487-491, 1988) used 20 ng of DNA isolated from hep3B cDNA library of liver cancer cell line as a template, and included 10X reaction buffer [500 mM KCl, 100 mM Tris-HCl (pH 8.3). ), 15 mM MgCl ₂ , 0.1% gelatin] 5 μl, dNTP 200 μM, 0.2 μM of synthetic oligonucleotide primer, 2.5 U of Taq polymerase, and sterilized distilled water to make a total volume of 50 μl. After putting one or two drops of mineral oil, it was performed 40 times at 94 ℃, 40 seconds at 52 ℃, 30 times 1 minute at 72 ℃.

The above reaction amplified fragments of 762 bp (primers P1 and P2) of the N-acetylglucosamine transferase III cDNA 5 ′ region and 882 bp (primers P3 and P4) of the 3 ′ region.

The polymerase chain reaction product was electrophoresed on a 1% agarose gel, and then separated from the gel using the Geneclean kit (Bio 101, USA).

After digesting 10 μg of pBluescript SK (+) with restriction enzyme EcoRV, fragments of 762 bp in the 5 'region and 882 bp in the 3' region of the amplified N-acetylglucosamine transferase III cDNA were cloned and pKN 0.8 and pKC 0.8, respectively. Was built. Separation of the plasmid was performed by alkaline lysis method (Feliciello, Chinali, Anal. Biochem. 212 , 394-401, 1993). The cloned plasmid was dissolved in 50 μl of water, 2 μl of the cloned plasmid was digested with restriction enzymes EcoR I and Hind III, and electrophoresed on 1% agarose gel to identify the clones.

The clones identified were Sequencase ver. Sequences were followed according to the Sanger-dideoxy method (Sanger, F. et al., Proc. Natl. Acad. Sci. USA 74 , 5463-5467, 1977) using a 2.0 sequencing kit (USB, USA). Decided.

As a result, it was confirmed that the DNA fragment inserted into the vector prepared in accordance with the previously published N-acetylglucosamine transcriptase III cDNA nucleotide sequence was N-acetylglucosamine transcriptase III gene.

<Example 2> Construction of the expression plasmid of N-acetylglucosamine transcriptase III

To construct a full-length N-acetylglucosamine transcriptase III gene, a NotI / HindIII fragment of pKC 0.8 was cloned into the NotI / EcoRⅠ position of pKN 0.8, where the 3 'region of N-acetylglucosamine transcriptase III was cloned. Cloning was referred to as pKNC 1.7 (see FIG. 3 ).

Expression of the plasmid was confirmed by transforming E. coli DH5α and then separating the plasmid. The identified clone was partially determined by sequencing to accurately identify the reading frame.

However, the recombinant N-acetylglucosamine transferase III produced from pKNC 1.7 has a transmembrane region composed of hydrophobic amino acids in the domain structure at the N-terminus, which is expressed in E. coli but toxic to E. coli. production of N-acetylglucosamine transcriptase III was impossible due to the death of recombinant E. coli.

Accordingly, the present inventors have found that the BamHI in-frame of the N-acetylglucosamine transcriptase III is co-initiated in the stem region, i.e., 69 bp downstream from the start codon. Forward primer E1 containing site: Synthesis of CACGGATCCAAGACCCTGTCCTATGTC, and reverse primer E2: AACTCGAGCTGTCACAAACCCTATCATCA containing XhoI site overlapping with stop codon and starting 33 bp downstream from stop code, were synthesized as pKNC 1.7 as substrate The polymerase chain reaction was performed to amplify the truncated form N-acetylglucosamine transcriptase III gene.

The polymerase chain reaction product was cloned into BamHI / XhoI sites of pET-22b (+). Thus, a plasmid encoding the defective N-acetylglucosamine transcriptase III, in which 23 regions of N-terminal amino acids in the N-acetylglucosamine transcriptase III gene were deleted, was constructed and named pET-GnTIII.

The constructed expression plasmid is a pelB leader consisting of 540 amino acids when expressed in E. coli BL21 (DE3) strains because the gene of the GnT-III active domain is linked to the downstream region of the pelB leader gene in the vector. -GnTIII fusion protein is produced.

<Example 3> Induction of E. coli of N-acetylglucosamine transcriptase III

The expression plasmid pET-GnTIII was transformed into E. coli BL21 (DE3). The expression vector pET-GnTIII expresses the N-acetylglucosamine transferase III gene in a fused form to the pelB leader signal peptide by a T7 promoter, and the E. coli BL21 (DE3) expresses the lac UV5 promoter. Since the T7 RNA polymerase gene under the control is present on the chromosome, expression can be induced by IPTG (isopropyl thio-β-D-galactosidase).

Overnight incubated transformed E. coli BL21 (DE3) was diluted 1/100 in 100 ml of LB medium containing ampicillin at a concentration of 100 μg / ml, at 37 ° C. until A ₆₀₀ became 0.6. Shaking was incubated at 300 rpm and IPTG was added at a concentration of 0.4 mM to induce expression.

After addition of IPTG, the cells were incubated for 3 hours at 37 ℃, centrifuged to recover the cells, suspended in 5 ml of 10 mM Tris-HCl solution (pH 7.5), frozen at -70 ℃ and thawed in ice water twice. After ultrasonication three times for 1 minute with an ultrasonic wave (Ultrasonic Homogenizer, Cole-Parmer Instrument Co., USA), the cytoplasmic fraction and insoluble protein were separated by centrifugation at 10,000g for 20 minutes.

SDS-PAGE electrophoresis was performed by suspending insoluble protein in 5 ml of 10 mM Tris-HCl (pH 7.5) solution. 5 μl of 2X SDS-PAGE sample buffer [125 mM Tris-HCl, pH 6.8, 4% SDS, 20% glycerol, 10 μl 2-mercaptoethanol, 0.2% bromophenol blue] and 5 μl of the cytosol fraction were mixed with 5 μl of 2X SDS-PAGE sample buffer and boiled for 3 min, and then run at 20 mA at 10% gel concentration.

After electrophoresis, the cells were dyed overnight with a dye solution (0.025% Coomassie Brilliant blue R 250, 40% methanol, 7% acetic acid) and then decolorized with a decolorizing solution (10% methanol, 10% acetic acid).

SDS-PAGE electrophoresis was carried out by Laemmli method, and the molecular weight label used was made by Bio-Rad (USA), myosin (200 kDa), phosphorylase b (94 kDa), and bovine serum albumin (67). kDa), ovalbumin (45 kDa), carbonic anhydrolase (30 kDa), cytochrome C (12.5 kDa) were used. Protein quantitation was carried out by Lowry et al. Method using bovine serum albumin as a reference material.

Protein expression patterns when induced with a final concentration of 0.4 mM IPTG solution are shown in Figure 4a. Protein expression patterns were compared using the lysates of E. coli transformed with only pET-22b (+) and the lysates of E. coli before inducing expression.

Western blot using polyclonal antibodies obtained from rabbits confirmed that the insoluble fraction induced by IPTG solution contained N-acetylglucosamine transcriptase III (see FIG. 4B ).

N-acetylglucosamine transferase III was expressed in the form of an inclusion body with an inert molecular weight of about 54,000 Da. The result of FIG. 4A is that 2% Triton X-100 was solubilized from E. coli-derived protein and only sutures were recovered. About 40 mg of sutures were recovered from an E. coli 400 ml culture.

The formation of the suture is not clearly understood, but due to the rapid increase in the level of foreign protein expression, the protein is not properly folded and complexed with RNA to form crystals in the cytoplasm (Studier et al. , Meth.Enzymol. 185 , 60-89, 1990).

<Example 4> Purification of N-acetylglucosamine transcriptase III suture

For purification of the sutures, a modification of the method of Marson et al. (Marston et al., Bio / Technology 2 , 800-802, 1984) was used.

Pre-cultured E. coli was inoculated at 1% in 400 ml of LB medium containing 100 μg / ml of ampicillin and shaken at 37 ° C. and 300 rpm. When A ₆₀₀ reached 0.6, IPTG was added to 1 mM to incubate for another 3 hours. . After incubation, the cells were recovered by centrifugation at 2,000 g for 10 minutes. The recovered cells were washed twice in 100 ml of 10 mM Tris-HCl solution (pH 7.5) per 1 g of wet weight and centrifuged to recover the cells, and then in 40 ml of 50 mM Tris-HCl solution (pH 7.5). The suspension was sonicated and centrifuged at 15,000 g for 20 minutes to recover the precipitate.

The precipitate was suspended in 30 ml of 50 mM Tris-HCl (pH 7.5), 10% Triton X-100 solution and 0.5 M EDTA solution were added to 2% and 10 mM, respectively, and shaken by poultry at room temperature to derive E. coli. After removing the insoluble protein, the precipitate was recovered by centrifugation at 15,000 g at 4 ° C. for 20 minutes. The precipitate was washed twice with 30 ml of 50 mM Tris-HCl solution (pH 7.5) and then suspended in 4 ml of 50 mM Tris-HCl solution (pH 7.5), of which 10 μl was electrophoresed to identify the band . 5 )

<Example 5> Activation of N-acetylglucosamine transcriptase III

N-acetylglucosamine transferase III in purified suture form was dissolved in 2 ml of 200 mM Tris-HCl solution (pH 8.6), 8 M Urea solution per 10 mg of wet weight, and then β-mercaptoethanol (β-mercaptoethanol) 50 μl was added for reduction. Thereafter, the resultant was dialyzed three times with 5 liters of 50 mM Tris-HCl solution (pH 8.0) at 4 ° C. overnight, followed by redialysis with 1 liter of 50 mM MES buffer (pH 7.0) overnight to carry out the activity assay. It was confirmed that the active type N-acetylglucosamine transcriptase III was obtained.

N-acetylglucosamine transferase III activity assay was performed using conventional methods (Kim et al., Kor. J. Chitin & Chitosan, 2 (3), 27-39, 1997) as a substrate UDP-GlcNAc (Sigma Co., USA). ) And Pyridylamino (PA) fluorescence-labeled biantennary oligosaccharides GlcN, GlcN-biant-PA and GlcN (GlcN) GlcN-biant-PA. The reaction was performed with 120 mM Mes buffer (pH 7.0), 300 mM GlcNAc, 15 mM MnCl ₂ , 0.5% Triton X-100, 50 mM oligosaccharide GlcN, GlcN-biant-PA, 200 mM UDP-GlcNAc and purified enzyme (0.5- 1.5 μg protein) was performed at 37 ° C. for 18 hours at 100 μl. The reaction was stopped by boiling at 100 ° C. for 5 minutes and the reaction product was stabbed in a Lichrosorb-NH ₂ column (4 × 220 mm) (Darmstadt, Merck) equipped with Shimadzu HPLC, followed by 0.2% n-butanol ( butanol) -containing 0.1 M acetate buffer (pH 4.0) at a flow rate of 1.0 ml / min. Detection was performed using a fluorescence detector that detects PA-N-acetylglucosamine (PA-N-acetylglucosamine) and the activity was transferred to N-acetylglucosamine pmol / h / mg.

Activity Assay of Activated Human N-acetylglucosamine Transferase III origin Activation progress Activity (pmol / h / mg) Suture N.D (O) Initial 50 mM Tris-HCl (pH 8.0) Buffer 1 hour of dialysis 16.4 2 hours of dialysis 54.3 8 hours of dialysis 123.1 24 hours of dialysis 465.5 Second 50 mM MES (pH 7.0) Buffer 1 hour dialysis 645.7 2 hours of dialysis 1204.5 8 hours of dialysis 1568.2 Dialysis 24 hours (final) 2343.9

As shown in Table 1, the N-acetylglucosamine activity increased and finally showed high activity through the activation step.

As described above, using the E. coli expression plasmid of the present invention, it is possible to express human N-acetylglucosamine transcriptase III in E. coli in a large amount and to have the original activity by simply refolding the human N- The production method of the present invention is very useful for the production of acetylglucosamine transferase III.

In addition, human N-acetylglucosamine transcriptase III produced in large quantities by the present invention is an antibody for the clinical diagnosis of liver diseases such as human liver cancer and cirrhosis, and development and detection of N-acetylglucosamine transcriptase III-specific inhibitors. Useful for

Claims (7)

An expression plasmid comprising a defective gene in which a region encoding the amino terminal 23 amino acids of the human N-acetylglucosamine transcriptase III gene has been removed. The expression plasmid pET-GnTIII according to claim 1, wherein the expression plasmid pET-GnTIII comprises a deletion-type gene from which a region coding for the first 23 amino acids of the human N-acetylglucosamine transcriptase III gene has been removed. Transformant E. coli BL21 (DE3) / pET-GnTIII transformed with E. coli BL21 (DE3) strain with plasmid pET-GnTIII of claim 2 (Accession No .: KCTC 8829P) Promoter E1: CACGGATCCAAGACCCTGTCCTATGTC containing in-frame BamHI section units and primer E2: First 23 human N-acetylglucosamine transferase III genes using AACTCGAGCTGTCACAAACCCTATCATCA containing XhoI section units overlapping with end codons Method for producing a missing gene with an amino acid-coding region removed A method for producing human N-acetylglucosamine transcriptase III by culturing the transformant of claim 3 6. The method according to claim 5, comprising purifying and activating a defective human N-acetylglucosamine transcriptase III inclusion body produced from the transformant. Manufacturing method 7. The method for preparing human N-acetylglucosamine transferase III according to claim 6, characterized in that the enzyme is repolated by reducing with β-mercaptoethanol as an activation process and dialysis and reoxidation.

Images