JPWO2021188729A5

JPWO2021188729A5 -

Info

Publication number: JPWO2021188729A5
Application number: JP2022556229A
Authority: JP
Publication date: 2024-03-28

Claims

A system comprising a CasX variant protein and a guide ribonucleic acid (g RNA ), wherein the CasX variant protein comprises a sequence having at least 70% sequence identity to SEQ ID NO: 138; exhibiting one or more improved properties relative to the reference CasX protein of SEQ ID NO: 2, or SEQ ID NO: 3, wherein said CasX variant protein forms a ribonucleoprotein complex (RNP) with said gRNA. and wherein the g RNA comprises a targeting sequence complementary to a target nucleic acid sequence comprising the chromosome 9 open reading frame 72 (C9orf72) gene.

The C9orf72 gene contains one or more mutations, or the C9orf72 gene mutations have a hexanucleotide repeat expansion (HRS) of more than 30, more than 100, more than 500, more than 700, more than 1000, or more than 1600. 2. The system of claim 1, comprising a copy of the hexanucleotide repeat sequence GGGGCC .

(a) the gRNA is a single molecule guide RNA ( gRNA ) comprising a scaffold sequence and a targeting sequence , wherein the scaffold sequence is a scaffold stem-loop sequence of CCAGCGACUAUGUCGUAGUGG (SEQ ID NO: 32); or a sequence having at least 1, 2, 3, 4, or 5 mismatches thereto;
(b) the targeting sequence of the gRNA is a sequence selected from the group consisting of SEQ ID NOs: 309-343, 363-2100, and 2295-21835, or at least about 65%, at least about 75%, at least comprising sequences having about 85%, or at least about 95% identity;
(c) the gRNA has a scaffold comprising a sequence having at least about 70% sequence identity to the sequence of SEQ ID NO: 2238; and/or
(d) the gRNA is chemically modified;
The system according to claim 1 or 2 .

further comprising a second gRNA, wherein said second gRNA is complementary to a different or overlapping portion of said target nucleic acid sequence compared to said targeting sequence of said gRNA. The system according to any one of claims 1 to 3 , comprising:

A first g RNA is complementary to a sequence that is 5' of said HRS, and a second g RNA is complementary to a sequence that is 3' of said HRS. The system according to item 4 .

the CasX variant protein further comprises one or more nuclear localization signals (NLS), wherein the one or more NLS are selected from the group of sequences consisting of SEQ ID NOs: 165-204; in,
(i) said one or more NLSs are expressed at or near the C-terminus of said CasX variant protein;
(ii) said one or more NLSs are expressed at or near the N-terminus of said CasX variant protein; and/or
(iii) said CasX variant protein comprises at least two NLSs at or near the N-terminus and C-terminus of said CasX variant protein ;
System according to any one of claims 1 to 5 .

5. The system of claim 4 , wherein the CasX variant protein and the g RNA are complexed as a ribonucleoprotein complex (RNP).

The RNP comprising the CasX variant protein and the g RNA variant comprises a reference CasX protein of any one of SEQ ID NO: 1 , SEQ ID NO: 2, and SEQ ID NO: 3 and any one of SEQ ID NOs: 4 to 16. exhibits at least one or more improved properties compared to one said gRNA , wherein said improved properties include improved folding of said CasX variant protein, an improvement to guided ribonucleic acid (gRNA); improved binding affinity for target DNA, improved ability to utilize a broader spectrum of one or more PAM sequences, including ATC, CTC, GTC, or TTC, in editing target DNA; improved unwinding of the target DNA, increased editing activity, improved editing efficiency, improved editing specificity, increased nuclease activity, increased labeled strand loading for double-strand breaks, single-strand nicking. Reduced labeled strand loading for reduced off-target cleavage, improved binding of non-target DNA strands, improved protein stability, improved protein solubility, improved protein:gRNA complexes (RNPs) stability, improved protein: selected from the group consisting of gRNA complex solubility, improved protein yield, improved protein expression, and improved fusion properties, and wherein said RNP of said CasX variant protein. of at least about 1.1 for said gRNA comprising said reference CasX protein of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 and any one of SEQ ID NO: 4-16. 8. The system of claim 7 , wherein the system is improved by a factor of ~100,000 .

(a) any one of the PAM sequences TTC, ATC, GTC, or CTC is located at the first nucleotide 5' to a non-target strand sequence that has identity with the targeting sequence of the gRNA; If the RNP comprising the CasX variant protein and the g RNA variant has a higher editing efficiency and/or binding in a cellular assay system compared to the editing efficiency and/or binding of an RNP comprising a reference CasX protein and a reference gRNA in an equivalent assay system. , exhibiting higher editing efficiency and/or binding of the target sequence in said target DNA, wherein
(i) said PAM sequence is TTC and said targeting sequence of said gRNA comprises a sequence selected from the group consisting of SEQ ID NOs: 5427-12893;
(ii) said PAM sequence is ATC and said targeting sequence of said gRNA comprises a sequence selected from the group consisting of SEQ ID NOs: 363-2100 and 2295-5426;
(iii) the PAM sequence is a CTC and the targeting sequence of the gRNA comprises a sequence selected from the group consisting of SEQ ID NO: 16203-21835; or
(iv) the PAM sequence is GTC and the targeting sequence of the gRNA comprises a sequence selected from the group consisting of SEQ ID NOs: 12894-16202;
and/or
(b) said RNP is at least 5%, at least 10%, at least 15% compared to an RNP with said reference CasX protein and said reference gRNA comprising any one of SEQ ID NOs: 4-16; has at least a 20% higher percentage of cleavage-competent RNP, or said RNA has at least a 2-fold, at least 5-fold, or at least 10-fold higher percentage of cleavage-competent RNP in an in vitro assay compared to the RNP of the reference CasX proteins of SEQ ID NOS: 1-3. 9. The system of claim 8 , having double cutting speed .

The system according to any one of claims 1 to 9 , wherein the CasX variant protein comprises a nuclease domain with double-strand cleavage activity.

(a) a g RNA comprising a targeting sequence complementary to a target nucleic acid sequence comprising the chromosome 9 open reading frame 72 (C9orf72) gene , and optionally;
(b) a CasX variant protein, wherein said CasX variant protein comprises a sequence having at least 70% sequence identity to SEQ ID NO: 138, and a reference to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3; exhibiting one or more improved properties relative to CasX proteins, wherein said CasX variant protein is capable of forming a ribonucleoprotein complex (RNP) with said gRNA according to (a); a CasX variant protein, wherein said CasX variant protein further comprises one or more nuclear localization signals (NLS);
A nucleic acid containing a sequence encoding.

12. A vector comprising the nucleic acid of claim 11 , wherein said vector is a nanoparticle, retroviral vector, lentiviral vector, adenoviral vector, adeno-associated virus (AAV) vector that mediates nucleic acid delivery to cells. , a herpes simplex virus (HSV) vector, a plasmid, a minicircle, a nanoplasmid, and an RNA vector.

The vector is an AAV vector , wherein the AAV vector is from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV44.9, AAV-Rh74, or AAVRh10. 13. The vector of claim 12 , wherein the vector is selected .

14. A host cell comprising a vector according to claim 12 or 13 , wherein the host cell is BHK, HEK293, HEK293T, NS0, SP2/0, YO myeloma cells, P3X63 mouse myeloma cells, PER, PER. ．． A host cell selected from the group consisting of C6, NIH3T3, COS, HeLa, CHO, and yeast cells .

A method of modifying a C9orf72 target nucleic acid sequence in a population of cells in vitro or ex vivo , the method comprising:
wherein said method provides said cells of said population with:
a. The system according to any one of claims 1 to 10 ;
b. The nucleic acid according to claim 11 ;
c. the vector according to claim 12 or 13 ; or
d. A combination of two or more of (a) to (c) ,
including introducing
wherein the C9orf72 gene target nucleic acid sequence of the cell targeted by the first g RNA is modified by the CasX variant protein ;
Here, the modification includes:
(i) introducing a single-strand break or a double-strand break in the target nucleic acid sequence of the cells of the population; and/or
(ii) introducing one or more nucleotide insertions, deletions, substitutions, duplications, or inversions in the target nucleic acid sequence;
and a method, wherein the expression of said HRS is reduced .

16. The method of claim 15 , wherein the cell is a eukaryotic cell selected from the group consisting of a rodent cell, a mouse cell, a rat cell, a pig cell, a primate cell, a non-human primate cell, and a human cell. .

16. The cell is selected from the group consisting of Purkinje cells, frontal cortical neurons, motor cortical neurons, hippocampal neurons, cerebellar neurons, upper motor neurons, spinal neurons, spinal motor neurons, glial cells, and astrocytes. The method described in.

further comprising a second g RNA or a nucleic acid encoding said second g RNA, wherein said second g RNA comprises a different or different sequence of said target nucleic acid compared to said first g RNA ; 17. The method of claim 15 or 16 , having targeting sequences that are complementary to the overlapping portions.

12. The first gRNA is complementary to a sequence that is 5' of the HRS, and the second gRNA is complementary to a sequence that is 3' of the HRS. 18. The method described in 18 .

a. The system according to any one of claims 1 to 10 ;
b. The nucleic acid according to claim 11 ;
c. a vector according to claim 12 or 13 ; or d. A combination of two or more of (a) to (c) ,
a population of cells modified by introducing into the cells, wherein said cells are
(i) at least 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least Approximately 90% have been modified to not express detectable levels of the dipeptide repeat protein (DPR);
(ii) the expression of functional C9orf72 protein is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least modified to be increased by about 60%, at least about 70%, at least about 80%, or at least about 90%; or
(iii) said mutation in said C9orf72 gene is corrected in said modified cells of said population and modified to result in expression of a functional C9orf72 protein by said modified cells;
and wherein said cells are selected from the group consisting of Purkinje cells, frontal cortical neurons, motor cortical neurons, hippocampal neurons, cerebellar neurons, upper motor neurons, spinal neurons, spinal motor neurons, glial cells, and astrocytes. A population of cells .

A composition for use in a method of treating a C9orf72-related disorder in a subject in need thereof, wherein said composition comprises a therapeutically effective dose of
a. The system according to any one of claims 1 to 10 ;
b. The nucleic acid according to claim 11 ;
c. The vector according to claim 12 or 13 ; or
d. The combination,
wherein the method comprises modifying the C9orf72 gene in a cell of the subject, wherein the modifying comprises contacting the cell with the composition, and wherein the method comprises: A composition, wherein said C9orf72 gene of said cell targeted by RNA is modified by said CasX variant protein.