JPWO2020069373A5

JPWO2020069373A5 -

Info

Publication number: JPWO2020069373A5
Application number: JP2021517602A
Authority: JP
Publication date: 2022-10-05

Claims

a) a factor that induces OCT4 expression;
b) an agent that induces SOX2 expression; and
c) a factor that induces KLF4 expression;
A composition comprising
The composition, which does not contain a factor that induces c-MYC expression.

2. The composition of claim 1, wherein each agent is independently a nucleic acid, small molecule, or polypeptide (eg, antibody).

3. The composition of claim 1 or 2, wherein at least one agent is encapsulated in nanoparticles.

4. A composition according to claim 2 or 3, wherein the nucleic acid is DNA, optionally the DNA is plasmid DNA; or the nucleic acid is RNA, optionally the RNA is mRNA.

The agent that induces OCT4 expression is an engineered nucleic acid encoding OCT4; and/or the agent that induces SOX2 expression is an engineered nucleic acid that encodes SOX2; and/or induces KLF4 expression The composition of any one of claims 1-4, wherein the factor is an engineered nucleic acid encoding KLF4.

Inducible, wherein the engineered nucleic acid is present on one or more expression vectors, optionally the expression vector(s) is operably linked to any one or a combination of the engineered nucleic acids and/or optionally the promoter is a TRE3G promoter, a TRE2 promoter, or a P tight promoter, and/or optionally the promoter comprises a tetracycline responsive element (TRE). Item 6. The composition according to item 5.

the expression vector is
(i) a self-cleaving peptide, optionally the self-cleaving peptide is a 2A peptide; and/or (ii) a nucleic acid sequence encoding OCT4, a nucleic acid sequence encoding SOX2, a nucleic acid sequence encoding KLF4, or optionally, the distance between the ITRs is 4.7 kb or less,
7. A composition according to claim 6.

The composition further comprises an inducer, optionally the inducer is tetracycline, optionally the tetracycline is doxycycline, or the inducer is reverse tetracycline-regulated transactivator (rtTA), optionally A composition according to any one of claims 1 to 7, wherein rtTA is M2-rtTA or rtTA3.

The one or more expression vectors are viral vectors, optionally the viral vectors are lentiviral, retroviral, adenoviral, alphaviral, vaccinia viral, or adeno-associated viral (AAV) vectors, optionally the AAV vectors are A composition according to any one of claims 6 to 8, which is AAV2 or AAV9.

A composition according to any one of claims 1 to 9, wherein the composition comprises in the following order:
a. a first terminal inverted repeat (ITR) sequence, optionally wherein the first ITR sequence is at least 80% identical to SEQ ID NO:22;
b. A TRE3G promoter sequence, optionally wherein the TRE3G promoter sequence comprises at least one minimal CMV promoter sequence, optionally the minimal CMV promoter sequence is at least 80% identical to SEQ ID NO: 20, and/or optionally , wherein the TRE3G promoter sequence is at least 80% identical to SEQ ID NO:7;
c. OCT4 sequence, optionally wherein the OCT4 sequence is at least 80% identical to SEQ ID NO: 40 and/or optionally wherein the OCT4 sequence is at least 80% identical to SEQ ID NO: 2 or 41 code;
d. P2A cleavage sequence, optionally wherein the P2A sequence is at least 80% identical to SEQ ID NO: 119 and/or optionally wherein the P2A sequence is at least 80% identical to SEQ ID NO: 118 code;
e. A SOX2 sequence, optionally wherein the SOX2 sequence sequence is at least 80% identical to SEQ ID NO: 42 and/or optionally wherein the SOX2 sequence is at least 80% identical to SEQ ID NO: 4 or 43 code the sequence;
f. a T2A cleavage sequence, optionally wherein the T2A sequence is at least 80% identical to SEQ ID NO: 120, and/or optionally wherein the T2A sequence is at least 80% identical to SEQ ID NO: 9. code;
g. The KLF4 sequence, optionally wherein the KLF4 sequence encodes a human Klf4 protein, optionally the KLF4 sequence is at least 80% identical to SEQ ID NO: 44, and/or optionally the KLF4 sequence is SEQ ID NO: encodes an amino acid sequence that is at least 80% identical to 6 or 45;
h. an SV-40-derived terminator sequence, optionally wherein the SV-40-derived terminator sequence is at least 80% identical to SEQ ID NO:8; and
i. a second terminal inverted repeat (ITR) sequence;
comprising an expression vector comprising a nucleic acid element in
optionally wherein the expression vector comprises a sequence that is at least 80% identical to SEQ ID NO: 38 or SEQ ID NO: 121; and/or optionally wherein the expression vector is encapsulated in a nanoparticle.
said composition.

A composition according to any preceding claim for use in rejuvenating at least one cell, tissue or organ of a subject in need thereof.

12. The composition for use according to claim 11, wherein rejuvenating at least one cell, tissue or organ does not comprise reprogramming at least one cell to a pluripotent state.

OCT4 over a period of time wherein the composition is sufficient to rejuvenate at least one cell, tissue, or organ and insufficient to reprogram the cell to a pluripotent state. 13. Composition for use according to claim 11 or 12, for inducing expression, SOX2 expression and/or KLF4 expression.

After administration of the composition to the subject, the at least one rejuvenated cell, tissue, or organ does not express at least one stem cell marker, optionally wherein the stem cell marker is Esrrb, Nanog, Lin28, TRA-1-60 /TRA-1-81 /TRA-2-54, SSEA1, SSEA4, or any combination thereof; and/or at least one rejuvenated cell, tissue, or Composition for use according to any one of claims 11 to 13, wherein the organ expresses RBPMS, Brn3a, or any combination thereof.

Rejuvenating at least one cell, tissue or organ comprises restoring epigenetic information of at least one cell, tissue or organ; contains epigenetic information lost due to aging, injury, disease, or any combination thereof of cells, tissues, or organs; and/or rejuvenates at least one cell, tissue, or organ reestablishing the epigenetic status of a cell, tissue, or organ to an epigenetic status similar to that formed shortly after fertilization or terminal differentiation A composition for use according to any one of claims 11 to 14, comprising

The subject has, is suspected of having, or is at risk for ocular disease, aging, cancer, musculoskeletal disease, age-related disease, or neurodegenerative disease; or a non-human mammal.

Cells, tissues, or organs are: eye, ear, nose, mouth, bone, lung, breast, breast, pancreas, stomach, esophagus, muscle, liver, blood vessel, skin, heart, brain, nerve tissue, kidney, testis, from the prostate, penis, cloaca, fins, ovaries, or intestines, optionally the mouth is gums or roots, optionally the muscle is heart muscle, or optionally the skin is hair. A composition for use according to any one of claims 11 to 16, wherein

The following order:
a. a first terminal inverted repeat (ITR) sequence;
b. TRE3G promoter sequence;
c. OCT4 sequence;
d. P2A cleavage sequence;
e. SOX2 sequence;
f. a T2A cleavage sequence;
g. KLF4 sequence;
h. a terminator sequence derived from SV-40; and
i. a second terminal inverted repeat (ITR) sequence,
An expression vector comprising a nucleic acid element with
Optionally, said expression vector, wherein the vector is encapsulated in a nanoparticle.

19. The expression vector of claim 18,
(a) the OCT4 sequence encodes an amino acid sequence that is at least 80% identical to SEQ ID NO: 2 or 41;
(b) the SOX2 sequence encodes an amino acid sequence that is at least 80% identical to SEQ ID NO: 4 or 43; and/or (c) the KLF4 sequence encodes an amino acid sequence that is at least 80% identical to SEQ ID NO: 6 or 45. optionally (i) the OCT4 sequence is at least 80% identical to SEQ ID NO:40;
(ii) the SOX2 sequence is at least 80% identical to SEQ ID NO:42; and/or (iii) the KLF4 sequence is at least 80% identical to SEQ ID NO:44;
Optionally, said vector wherein the OCT4 sequence encodes the human OCT4 protein, the SOX2 sequence encodes the human SOX2 protein and/or the KLF4 sequence encodes the human KLF4 protein.

20. The expression vector of claim 18 or 19,
(a) the P2A sequence encodes a polypeptide having a sequence that is at least 80% identical to GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 118), optionally the P2A sequence is at least 80% identical to GGCAGCGGCGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCT (SEQ ID NO: 119);
(b) the T2A sequence encodes a polypeptide that is at least 80% identical to SEQ ID NO: 9, optionally the T2A sequence is at least 80% identical to GGCTCCGGCGAGGGCAGGGGAAGTCTTCTAACATGCGGGGACGTGGAGGAAAATCCCGGCCCA (SEQ ID NO: 120);
(c) the TRE3G promoter sequence is at least 80% identical to SEQ ID NO:7; and/or the TRE3G promoter sequence comprises at least one minimal CMV promoter sequence, optionally at least one minimal CMV promoter sequence comprises the sequence and/or (d) the terminator sequence from SV-40 is at least 80% identical to SEQ ID NO:8; and/or the first ITR sequence and/or the second is at least 80% identical to SEQ ID NO: 22,
the expression vector.

An expression vector according to any one of claims 18-20, comprising a sequence that is at least 80% identical to SEQ ID NO:38; and/or that comprises a sequence that is at least 80% identical to SEQ ID NO:121.

A recombinant virus comprising an expression vector according to any one of claims 18-21.

An engineered cell, tissue or organ produced by any one of the uses according to claims 11-17, an engineered cell comprising an expression vector according to any one of claims 18-21. , tissue or organ, or an engineered cell, tissue or organ comprising the recombinant virus of claim 22.

A kit comprising an expression vector according to any one of claims 18-21, a recombinant virus according to claim 22, or an engineered cell, tissue or organ according to claim 23.

A composition comprising an expression vector according to any one of claims 18-21, a recombinant virus according to claim 22, and/or an engineered cell, tissue or organ according to claim 23. which is optionally a pharmaceutical composition.