JPWO2019209078A5 - - Google Patents

Description

The present invention relates to a novel fusion protein containing an extracellular domain of a Lrig-1 (leucine-rich and immunoglobulin-like domains 1) protein and an immunoglobulin Fc region, and its use.

Immunoglobulins include four polypeptide chains, two heavy chains and two light chains associated by interchain disulfide bonds. Each light chain has two domains, a variable light chain domain (VL) and an invariant light chain domain (CL), and each heavy chain has two regions, namely a variable heavy chain region (VH) and an invariant light chain. It has a heavy chain region (CH). The invariant heavy chain region (CH) consists of an invariant heavy chain region (eg, CH1, CH2, CH3, etc.) designated by a number (eg, US6,086,875 (Blumberg RS et al.), US5, 624). , 821 (Winter GP et al.) And US 5,116,964 (see Capon DJ and Lasky LA). Immunoglobulins treat their biological properties, biolocalization and different antigens. Classified into different isotypes (ie, IgG, IgM, IgA, IgD and IgE) based on their ability to do so, depending on the immunoglobulin isotype, the invariant heavy chain region (CH) has three or four CH domains. Also, in some isotypes (IgA, IgD and IgG), heavy chains contain hinge regions that add flexibility to the molecule (Janeway et al. 20011, Immunobiology, Garland Publishing, NY, N. .Y.).

There are four IgG subclasses in humans (IgG1, 2, 3, 4), which are named by the serum-rich order (IgG1 is the most abundant). The IgG isotype consists of two light chains and two heavy chains, each heavy chain containing three invariant heavy chain domains (CH1, CH2, CH3). The two heavy chains of IgG are linked to each other and to the light chain by disulfide bonds (-SS-), respectively. The antigen-binding site of IgG is a fragmented antigen-binding region (Fab region) containing an invariant light chain (CL) and an invariant heavy chain (CH1) domain as well as a variable light chain (VL) and a variable heavy chain (VH) domain. Located in. The fragmentation determinable region (Fc region) of IgG is part of a heavy chain containing CH2 and CH3 domains that bind to Fc receptors found on the surface of specific cells containing neonatal Fc receptors (FcRn). .. The IgG heavy chain further has a hinge region (hinge) between CH1 and CH2 that participates when the Fab region is separated from the Fc region and the two heavy chains are linked together by a disulfide bond. The structure of the hinge region contributes to the unique biological properties of each of the four IgG subclasses.

IgG is secreted as a small monomer that can easily circulate in tissues. It is the only isotype that has a receptor (neonatal Fc receptor (FcRn)) that facilitates passage through the human placenta to protect the fetus in utero. IgG absorbed through the placenta provides humoral immunity to newborns before their own immune system develops.

The IgG neonatal Fc receptor (FcRn) binding site is located in the Fc region of the antibody. FcRn is commonly expressed in human placenta and epithelial cells and participates in the intracellular translocation salvage pathway that prevents IgG degradation. This salvage pathway is mediated by the high pH-dependent binding affinity of IgG for FcRn at acidic pH. The high affinity of IgG for FcRn at acidic pH is thought to induce binding of IgG internalized to FcRn after absorption into acidic endosomes ([Goebl NA, et al., 2008]; [Junghans RP, et.] al., 1996]). Most soluble proteins go to the lysosome after internalization, but the internalized FcRn-bound IgG returns to the plasma membrane and is effectively rescued from the basic degradation pathway. Upon exposure to the neutral pH of the extracellular space, IgG can dissociate from FcRn and return to the circulatory system. Therefore, the extended serum half-life properties of the antibody are maintained in the Fc fragment.

The salvage pathway provides one mechanism for the development of next-generation protein drugs with extended half-life in blood circulation compared to non-deformed protein drugs. In particular, non-deformed protein drugs have a short circulating half-life and therefore require frequent administration over the required long treatment period. Extensive efforts have been made to extend the half-life of protein drugs by a number of methods, including PEGylated fusion protein technology (Food and Drug Administration, [Osborn BL, et al., 2002]). However, the results of such efforts were not ideal.

One object of the present invention is to provide a novel fusion protein containing an extracellular domain of a Lrig-1 (leucine-rich and immunoglobulin-like domines1) protein and an immunoglobulin Fc region.

Another object of the present invention relates to a nucleic acid molecule encoding the fusion protein according to the present invention.

Yet another object of the present invention is to provide an expression vector into which the nucleic acid molecule according to the present invention is inserted.

Yet another object of the invention is to provide a host cell line transfected with said expression vector according to the invention.

Yet another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer, which comprises the fusion protein according to the present invention.

However, the technical problems to be made by the present invention are not limited to the above-mentioned problems, and other problems not mentioned above are clearly understood by those having ordinary knowledge in the art from the following description. Will.

According to one embodiment of the invention, it relates to a fusion protein comprising an extracellular domain and an immunoglobulin Fc region of a Lrig-1 (leucine-rich and immunoglobulin-like domines1) protein.

In the present invention, the "Lrig-1 protein" is a transmembrane protein consisting of 1091 amino acids present on the surface of a regulatory T cell, and is an extracellular or rumen-side leucine-rich repeat (leucine-rich repeat). It is composed of LRR)) and three immunoglobulin-like proteins, a transmembrane sequence and a cytoplasmic tail. The LRIG gene family includes LRIG1, LRIG2 and LRIG3, and the amino acids between them are very conservatively constructed.

In one example of the present invention, the extracellular domain of the Lrig-1 protein is an extracellular domain of the Lrig-1 protein derived from mammals including primates such as humans and monkeys, and rodents such as mice and rats. You may.

In one example of the present invention, the extracellular domain of the Lrig-1 protein may be represented by SEQ ID NO: 1 corresponding to the amino acid sequence of the 35th to 794th amino acids of the human-derived Lrig-1 protein, which is represented by SEQ ID NO: 2. It can be encoded by, but is not limited to, the nucleic acid sequence represented (see Table 1).

In another example of the invention, the extracellular domain of the Lrig-1 protein may be represented by SEQ ID NO: 3, which corresponds to the amino acid sequence 35-794 of the mouse-derived Lrig-1 protein. It can be encoded by the nucleic acid sequence represented by 4, but is not limited to this (see Table 2).

In the present invention, the "immunoglobulin Fc region" refers to a site containing a heavy chain invariant region 2 (CH2) and / or a heavy chain invariant region 3 (CH3) portion excluding the heavy chain and light chain variable regions of immunoglobulin. means. The immunoglobulin Fc region may be one of the constituents of the protein complex of the present invention.

In the present invention, the immunoglobulin Fc region includes a hinge portion in the heavy chain invariant region, thereby affecting the structural flexibility of the finally produced fusion protein, and further increasing the productivity and stability of the fusion protein. It can be increased, but it is not limited to this.

In addition, the immunoglobulin Fc region of the present invention is a partial or whole heavy chain invariant region except for the heavy chain and light chain variable regions of the immunoglobulin as long as it has substantially the same or improved effect as the natural type. It may be an extended Fc region containing 1 (CH1) and / or a light chain invariant region 1 (CL1). It may also be a region from which some very long amino acid sequences corresponding to CH2 and / or CH3 have been removed.

For example, the immunoglobulin Fc regions of the present invention are 1) CH1 domain, CH2 domain, CH3 domain and CH4 domain, 2) CH1 domain and CH2 domain, 3) CH1 domain and CH3 domain, 4) CH2 domain and CH3 domain, 5 ) Combination of one or more domains of CH1 domain, CH2 domain, CH3 domain and CH4 domain with the hinge region (or part of the hinge region) of immunoglobulin, 6) each domain and light of the heavy chain invariant region. It may be a dimer of a chain invariant region. However, it is not limited to this.

Further, the immunoglobulin Fc region of the present invention contains not only a natural amino acid sequence but also a sequence derivative thereof. Amino acid sequence derivatives mean that one or more amino acid residues in a natural amino acid sequence have a different sequence due to deletion, insertion, non-conservative or conservative substitution, or a combination thereof.

For example, in the case of IgG Fc, amino acid residues 214-238, 297-299, 318-322 or 327-331 amino acids known to be important for binding are available as suitable sites for modification.

Further, the site where a disulfide bond can be formed may be removed, some amino acids at the N-terminal of the natural Fc may be removed, or a methionine residue may be added to the N-terminal of the natural Fc. Various kinds of derivatives are possible. Further, in order to eliminate the effector function, the complement binding site, for example, the C1q binding site may be removed, or the ADCC (antibody dependent cellular cytotoxicity) site may be removed. Techniques for producing such sequence derivatives of immunoglobulin Fc regions are disclosed in International Patent Publication No. WO 97/34631, International Patent Publication No. 96/32478 and the like.

Amino acid exchanges in proteins and peptides that do not totally alter the activity of the molecule are known in the art (H. Neurath, RL Hill, The Proteins, Academic Press, New York, 1979). The most commonly occurring exchanges are the amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, The / Phe, Ala. Exchange between / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, Asp / Gly. In some cases, it may be modified by phosphorylation, sulfation, acrylicization, saccharification, methylation, farnesylation, acetylation, amidation and the like.

The Fc derivative described above may exhibit biological activity equivalent to that of the Fc region of the present invention, and may have increased structural stability of the Fc region with respect to heat, pH and the like.

Such Fc regions may also be obtained from in vivo isolated native forms of animals such as humans, cows, goats, pigs, mice, rabbits, hamsters, rats or guinea pigs and transformed animal cells. Alternatively, it may be a recombinant type obtained from a microorganism or a derivative thereof. Here, the method of obtaining from the natural form may be a method of separating the whole immunoglobulin from a living body of a human or an animal and then treating the whole immunoglobulin with a proteolytic enzyme. When treated with papain, it is cleaved into Fab and Fc, and when treated with pepsin, it is cleaved into pF'c and F (ab) 2. Fc or pF'c can be separated using size-exclusion chromatography or the like. In a more specific embodiment, it is a recombinant immunoglobulin Fc region obtained from a human or mouse-derived Fc region from a microorganism.

Further, the immunoglobulin Fc region may be in a form in which a natural sugar chain, a sugar chain increased as compared with the natural type, a sugar chain decreased as compared with the natural type, or a sugar chain is removed. For increasing or decreasing or removing such immunoglobulin Fc sugar chains, conventional methods such as chemical methods, enzymatic methods and genetic engineering methods using microorganisms can be used. Here, the immunoglobulin Fc region from which the sugar chain has been removed in Fc has a markedly reduced binding force to complement (c1q), and antibody-dependent cytotoxicity or complement-dependent cytotoxicity is reduced or eliminated. Therefore, it does not induce unnecessary immune reactions in the body. In this regard, the form more consistent with the original purpose of the drug as a carrier should be the glycosylated or non-glycanized immunoglobulin Fc region.

In the present invention, "Glycosylation" refers to an Fc region from which sugar has been removed by an enzyme, and non-glycosylation refers to a prokaryotic animal, and in a more specific embodiment, a bacillus. It means an Fc region that is produced and is not glycosylated.

On the other hand, the immunoglobulin Fc region may be derived from animals such as humans or cows, goats, pigs, mice, rabbits, hamsters, rats and guinea pigs, and as a preferred example, humans or mice.

The immunoglobulin Fc region of the present invention is an IgG, IgA, IgD, IgE, IgM-derived Fc region, a heavy chain invariant region 2 (CH2), a heavy chain invariant region 3 (CH3), a hinge, a fragment thereof, or a fragment thereof. It may be a combination or a hybrid Fc containing these combinations.

On the other hand, in the present invention, "combination" means a single-chain immunoglobulin Fc region, a heavy chain invariant region 2 (CH2) or a heavy chain invariant region 3 (CH3) of the same origin when forming a dimer or a multimer. It means that the polypeptide encoding the above forms a bond with a single chain polypeptide of a different origin. That is, a dimer or multimer from two or more fragments selected from an Fc region derived from IgG, IgA, IgM, IgD or IgE, heavy chain invariant region 2 (CH2) or heavy chain invariant region 3 (CH3). It can be manufactured.

In the present invention, the "hybrid Fc" can be derived from a combination of human IgG subclasses or a combination of human IgD and IgG. In one embodiment, the hybrid Fc can include, for example, an IgD hinge region and a CH2 N-terminal region + IgG4 CH2 and CH3 regions, eg, identical to the hybrid Fc form disclosed in Korean Registered Patent No. 0897938. Can be borrowed from and used as a reference herein. In the present invention, when the hybrid Fc binds to a biologically active molecule, polypeptide, etc., it not only increases the serum half-life of the biologically active molecule, but also contains a nucleotide encoding an Fc-polypeptide fusion protein. When expressed, it has the effect of increasing the expression level of the polypeptide.

As an example of the present invention, the immunoglobulin Fc region is an Fc region derived from IgG, IgA, IgM, IgD or IgE, or a heavy chain invariant region 2 (CH2) derived from the IgG, IgA, IgM, IgD or IgE. ) And the heavy chain invariant region 3 (CH3), but is not limited to this.

As an example of the present invention, the immunoglobulin Fc region is the IgG or IgM-derived Fc region most abundant in human blood, or the IgG or IgM-derived heavy chain invariant region 2 (CH2) and heavy chain invariant region 3 ( CH3) can be included, as another example, an IgG-derived Fc region known to improve the half-life of a ligand-binding protein, or the IgG-derived heavy chain invariant region 2 (CH2) and heavy chain. An invariant region 3 (CH3) can be included, and as yet another example, a heavy chain invariant region 2 (CH2) derived from IgG1, IgG2, IgG3 or IgG4, or said IgG1, IgG2, IgG3 or IgG4. ) And heavy chain invariant region 3 (CH3), and as yet another example, heavy chain invariant region 2 (CH2) and heavy chain invariant region 3 (CH3) derived from IgG1 or IgG2 can be included.

In the present invention, as a preferred example, the immunoglobulin Fc region comprises a heavy chain invariant region 2 (CH2) and a heavy chain invariant region 3 (CH3) derived from human IgG1 represented by SEQ ID NO: 5 or contains SEQ ID NO: 6. Can include, but is not limited to, a heavy chain invariant region 2 (CH2) and a heavy chain invariant region 3 (CH3) derived from mouse IgG2 represented by (see Table 3 below).

As an example of the invention, the immunoglobulin Fc region can include a hinge region from IgG, IgA, IgM, IgD, IgE, or Abatacept, as another example, from IgG, IgD or abatacept. It can include, but is not limited to, a hinge region from IgG1, IgG2, IgG3, IgG4, IgD or abatacept.

In the present invention, as a preferred example, the immunoglobulin Fc region is represented by a hinge region derived from human IgG1 represented by SEQ ID NO: 7; a hinge region derived from mouse IgG2 represented by SEQ ID NO: 8; The fusion protein finally produced by including one or more selected from the group consisting of the hinge region derived from human IgD; and the hinge region of avatarcept represented by SEQ ID NO: 10 (see Table 4 below). Structural flexibility can be increased and the productivity and stability of the fusion protein can be significantly improved, but not limited to.

In the present invention, when the extracellular domain of the Lrig-1 protein and the Fc region are linked via a linker, the linker is linked to the N-terminal, C-terminal or free radical of the Fc fragment, and Lrig- One protein is linked to the N-terminus, C-terminus or free radical of the extracellular domain. If the linker is a peptide linker, ligation can occur at any site. For example, the linker is linked to the C-terminus of the extracellular domain of the Lrig-1 protein and the N-terminus of the Fc region of the immunoglobulin, or the C-terminus of the Fc region of the immunoglobulin and the Lrig-1. It is linked to the N-terminus of the extracellular domain of the protein.

In the present invention, the "linker" reduces the interfering effect between the extracellular domain of the Lrig-1 protein in the fusion protein and the immunoglobulin Fc region, and the extracellular domain of the Lrig-1 protein in the target cell. Can enhance the desired activity of. Further, in the present invention, the linker can contain a sequence that can be cleaved by an enzyme that is overexpressed in the tissue or cell of the target disease. When cleaved by an overexpressing enzyme as described above, it is possible to effectively prevent the activity of the polypeptide from being reduced by the Fc moiety.

As an example of the invention, the linker preferably has 1-100 amino acids, but is not limited to any that can separate the extracellular domain of the Lrig-1 protein from the immunoglobulin Fc region. It may be a peptide. The amino acid sequence constituting the linker is not particularly limited, but preferably contains glycine (G) and serine (S), or contains them repeatedly or in a random pattern. As an example, the linker can include at least one of the peptide linker represented by SEQ ID NO: 11; and the peptide linker represented by SEQ ID NO: 12; or (GGGGS) _N (N is 1 or more). By including an amino acid sequence (preferably an integer of 1 to 20) (see Table 5 below), the stability of the intracellular active substance can be enhanced and the productivity can be further improved.

Further, in the present invention, as an example of the linker, a peptide linker consisting of 33 amino acids located at the 282-314th portion of human albumin, which is most abundant in blood, more preferably the 292nd-304th portion. It may be a peptide linker consisting of 13 amino acids located in, or such a part is a part exposed to the outside in a three-dimensional structure and can induce an immune reaction in the body. This is the part where the sex is minimized. However, the present invention is not limited to this.

Furthermore, in the present invention, when the linker and Fc region are separately expressed and then bound to each other, the linker may be a cross-linking agent known in the art. The cross-linking agent is, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydrooxysuccinimide ester such as 4-azidosalicylic acid, 3,3'-dithiobis (succinimidyl). It may be an imide ester containing a succinimidazole such as propionate), and a dual functional maleimide such as bis-N-maleimide-1,8-octane, but is not limited thereto. not.

An example of the fusion protein provided in the present invention is the extracellular domain of the Lrig-1 protein represented by SEQ ID NO: 1; the hinge region represented by any one of SEQ ID NOs: 7 to 10; the table represented by SEQ ID NO: 5. It may be a fusion protein containing a heavy chain invariant region 2 (CH2) and a heavy chain invariant region 3 (CH3) derived from human IgG1 (see Table 6 below). The fusion proteins represented by SEQ ID NOs: 13-16 in Table 6 below may be encoded by the nucleic acid sequences represented by SEQ ID NOs: 17-20 in Table 7 below (see Table 7 below).

An example of the fusion protein provided in the present invention is the extracellular domain of the Lrig-1 protein represented by SEQ ID NO: 3; the hinge region represented by any one of SEQ ID NOs: 7 to 10; the table represented by SEQ ID NO: 5. It may be a fusion protein containing a heavy chain invariant region 2 (CH2) and a heavy chain invariant region 3 (CH3) derived from human IgG1 (see Table 8 below). The fusion proteins represented by SEQ ID NOs: 21-24 in Table 8 below may be encoded by the nucleic acid sequences represented by SEQ ID NOs: 25-28 in Table 9 below (see Table 9 below).

Another example of the fusion protein provided in the present invention is the extracellular domain of the Lrig-1 protein represented by SEQ ID NO: 3; the hinge region represented by any one of SEQ ID NOs: 7 to 10; SEQ ID NO: 6 It may be a fusion protein containing a heavy chain invariant region 2 (CH2) and a heavy chain invariant region 3 (CH3) derived from mouse IgG2 represented by (see Table 10 below). The fusion proteins represented by SEQ ID NOs: 29 to 32 in Table 10 below may be encoded by the nucleic acid sequences represented by SEQ ID NOs: 33 to 36 in Table 11 below (see Table 11 below).

Still another example of the fusion protein provided in the present invention is the extracellular domain of the Lrig-1 protein represented by SEQ ID NO: 1; the linker represented by SEQ ID NO: 11; any one of SEQ ID NOs: 7-10. The hinge region represented by; may be a fusion protein containing a heavy chain invariant region 2 (CH2) and a heavy chain invariant region 3 (CH3) derived from human IgG1 represented by SEQ ID NO: 5 (see Table 12 below). .. The fusion proteins represented by SEQ ID NOs: 37-40 in Table 12 below may be encoded by the nucleic acid sequences represented by SEQ ID NOs: 41-44 in Table 13 below (see Table 13 below).

Still another example of the fusion protein provided in the present invention is the extracellular domain of the Lrig-1 protein represented by SEQ ID NO: 3; the linker represented by SEQ ID NO: 11; any one of SEQ ID NOs: 7-10. The hinge region represented by; may be a fusion protein containing a heavy chain invariant region 2 (CH2) and a heavy chain invariant region 3 (CH3) derived from human IgG1 represented by SEQ ID NO: 5 (see Table 14 below). .. The fusion proteins represented by SEQ ID NOs: 45-48 in Table 14 below may be encoded by the nucleic acid sequences represented by SEQ ID NOs: 49-52 in Table 15 below (see Table 15 below).

Still another example of the fusion protein provided in the present invention is the extracellular domain of the Lrig-1 protein represented by SEQ ID NO: 3; the linker represented by SEQ ID NO: 11; any one of SEQ ID NOs: 7-10. The hinge region represented by; may be a fusion protein containing a heavy chain invariant region 2 (CH2) and a heavy chain invariant region 3 (CH3) derived from mouse IgG2 represented by SEQ ID NO: 6 (see Table 16 below). .. The fusion proteins represented by SEQ ID NOs: 53 to 56 in Table 16 below may be encoded by the nucleic acid sequences represented by SEQ ID NOs: 57 to 60 in Table 17 below (see Table 17 below).

Yet another example of the fusion protein provided in the present invention is the extracellular domain of the Lrig-1 protein represented by SEQ ID NO: 1; the linker represented by SEQ ID NO: 12; the linker represented by SEQ ID NO: 11; the sequence. A fusion protein containing a heavy chain invariant region 2 (CH2) and a heavy chain invariant region 3 (CH3) derived from human IgG1 represented by SEQ ID NO: 5; a hinge region represented by any one of Nos. 7 to 10. May be (see Table 18 below). The fusion proteins represented by SEQ ID NOs: 61-64 in Table 18 below may be encoded by the nucleic acid sequences represented by SEQ ID NOs: 65-68 in Table 19 below (see Table 19 below).

Yet another example of the fusion protein provided in the present invention is the extracellular domain of the Lrig-1 protein represented by SEQ ID NO: 3; the linker represented by SEQ ID NO: 12; the linker represented by SEQ ID NO: 11; the sequence. A fusion protein containing a heavy chain invariant region 2 (CH2) and a heavy chain invariant region 3 (CH3) derived from human IgG1 represented by SEQ ID NO: 5; a hinge region represented by any one of Nos. 7 to 10. May be (see Table 20 below). The fusion proteins represented by SEQ ID NOs: 69-72 in Table 20 below may be encoded by the nucleic acid sequences represented by SEQ ID NOs: 73-76 in Table 21 below (see Table 21 below).

Yet another example of the fusion protein provided in the present invention is the extracellular domain of the Lrig-1 protein represented by SEQ ID NO: 3; the linker represented by SEQ ID NO: 12; the linker represented by SEQ ID NO: 11; the sequence. A fusion protein comprising a heavy chain invariant region 2 (CH2) and a heavy chain invariant region 3 (CH3) derived from mouse IgG2 represented by SEQ ID NO: 6; a hinge region represented by any one of Nos. 7 to 10. You may (see Table 22 below). The fusion proteins represented by SEQ ID NOs: 77-80 in Table 22 below may be encoded by the nucleic acid sequences represented by SEQ ID NOs: 81-84 in Table 23 below (see Table 23 below).

The fusion protein provided in the present invention interacts with a ligand for the Lrig-1 protein present in the effector T cells to form a regulatory T cell (Treg cell) and an effector T cell containing the Lrig-1 protein on the surface. By inhibiting the interaction with, the activity of regulatory T cells is suppressed, the activity of effector T cells is maintained or increased, and the growth of solid cancer cells among cancer cells is effectively suppressed. be able to.

According to another embodiment of the present invention, there is provided a nucleic acid molecule encoding the fusion protein provided in the present invention.

The nucleic acid molecule of the present invention comprises all of the nucleic acid molecules in which the amino acid sequence of the fusion protein provided in the present invention is translated into a polynucleotide sequence, as is known to those of skill in the art. Therefore, various polynucleotide sequences by ORF (open reading frame) can be produced, and this is also included in the nucleic acid molecule of the present invention.

As a preferred example of the present invention, the nucleic acid molecules are represented by SEQ ID NOs: 17-20, 25-28, 33-36, 41-44, 49-52, 57-60, 65-68, 73-76 and 81-84. It may be represented by any one, but is not limited to this.

According to still another embodiment of the present invention, there is provided an expression vector into which the isolated nucleic acid molecule provided in the present invention is inserted.

In the present invention, the "vector" is the nucleic acid molecule capable of transporting another nucleic acid to which one nucleic acid molecule is linked. A type of vector is a "plasmid" that refers to a round double-stranded DNA to which additional DNA segments can be ligated. Another type of vector is a phage vector. Yet another type of vector is a viral vector, which allows additional DNA segments to ligate to the viral genome. Some vectors are capable of autonomous replication in the host cell into which they have flowed (eg, a bacterial vector is an episomal mammalian vector with a bacterial replication origin). Other vectors (eg, non-episome mammalian vectors) integrate into the host cell's genome as it flows into the host cell, thereby replicating with the host genome. Not only that, certain vectors can direct the expression of genes to which they are linked at the working level. Such vectors are referred to herein as "recombinant expression vectors" or simply "expression vectors". In general, expression vectors useful in recombinant DNA techniques often exist in the form of plasmids. As used herein, a "plasmid" and a "vector" can be used interchangeably because the plasmid is the most commonly used form of the vector.

In the present invention, specific examples of the expression vector include commercially widely used pCDNA vectors, F, R1, RP1, Col, pBR322, ToL, Ti vectors; cosmid; lambda, lambdoid, M13, Phages such as Mu, p1 P22, Qμ, T-even, T2, T3, T7; all but not limited to, but not limited to, all known to those of skill in the art as expression vectors. The expression vector can be used in the present invention, and the selection of the expression vector depends on the nature of the target host cell. Upon introduction of the vector into the host cell, it is performed by, but not limited to, calcium phosphate transfection, viral infection, DEAE-dextran regulated transfection, lipofectamine transfection or electroporation. An expression vector to be used and an introduction method suitable for the host cell can be selected and used. Preferably, the vector contains, but is not limited to, one or more selection markers, which can be selected by the presence or absence of production of the product using a vector that does not contain the selection marker. The selection of the sorting marker is sorted by the host cell of interest, which utilizes methods already known to those of skill in the art, and thus the present invention does not limit this.

The nucleic acid molecule of the present invention can be fused by inserting a tag sequence onto an expression vector to facilitate purification. The tags include, but are not limited to, hexa-histidine tags, hemagglutinin tags, myc tags or flag tags, and any tags known to those of skill in the art that facilitate purification can be used in the present invention. Is.

According to still another embodiment of the present invention, there is provided a host cell line trait-infected with the expression vector provided in the present invention.

In the present invention, said "host cell" includes an individual cell or cell culture that may or was a recipient of a vector for incorporation of a polypeptide insert. .. Host cells include progeny of a single host cell, which progeny is not necessarily exactly the same as the original parent cell (morphologically or genomic DNA complement) due to natural, accidental or deliberate mutations. It does not have to be). Host cells include cells that have been plasma-injected in the body with the polypeptide of the present application.

In the present invention, the host cell can include a mammal, a plant, an insect, a fungus, or a cell of cellular origin, for example, a bacterial cell such as a phylum, streptomyces, salmonella typhimurium; yeast cell. , Fungal cells such as Pikia pastris; Insect cells such as Drosophila, Spodoptera Sf9 cells; CHO (Chinese hamster ovary cells), SP2 / 0 (mouse bone ulcer), Human lymphoblastoid. , NSO (mouse myeloma), 293T, Bows melanoma cells, HT-1080, BHK (Baby Hamster Kidney cells), HEK (Human Embryonic Kidney cells) or PERC. 6 (human retinal cells) animal cells; or plant cells, but not limited to, any cell that can be used as a host cell line known to those of skill in the art is available.

According to still another embodiment of the present invention, there is provided a pharmaceutical composition for preventing or treating cancer, which comprises the fusion protein provided in the present invention as an active ingredient.

In the present invention, said "cancer" refers to or refers to a physiological condition characterized by cell growth that is typically unregulated in mammals. In the present invention, the cancer to be prevented, ameliorated or treated may be a solid cancer consisting of a mass formed by abnormal cell growth in a solid organ, and depending on the site of the solid organ, gastric cancer, liver cancer, etc. It may be collagen cell carcinoma, ovarian cancer, large sickle cancer, head and neck cancer, bladder cancer, renal cell carcinoma, breast cancer, metastatic cancer, prostate cancer, pancreatic cancer, melanoma or lung cancer, and is preferable. Alternatively, it may be large-scale cancer, but is not limited to this.

On the other hand, in the present invention, "prevention" can include without limitation any act of blocking, suppressing or delaying the symptoms of a disease using the pharmaceutical composition of the present invention.

Further, in the present invention, "treatment" can be included without limitation as long as the symptoms of the disease are improved or advantageous by using the pharmaceutical composition of the present invention.

In the present invention, the pharmaceutical composition is characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition is intended for humans. Can be done.

In the present invention, the pharmaceutical composition is not limited to these, but oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, etc., respectively, by ordinary methods. And can be used in the form of sterile injection solutions. The pharmaceutical composition of the present invention can include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers use binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc. for oral administration. In the case of an injection, a buffer, a preservative, a soothing agent, a solubilizer, an isotonic agent, a stabilizer, etc. can be mixed and used, and in the case of local administration. , Bases, excipients, lubricants, preservatives, etc. can be used. The dosage form of the pharmaceutical composition of the present invention can be variously produced by mixing with a pharmaceutically acceptable carrier as described above. For example, for oral administration, it can be produced in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be produced in unit dosing ampoules or multiple dosage forms. .. In addition, it can be formulated into a solution, suspension, tablet, capsule, sustained-release preparation, or the like.

On the other hand, examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium. Diluent, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil and the like can be used. Further, a filler, an anti-aggregating agent, a lubricant, a wetting agent, a fragrance, an emulsifier, an antiseptic and the like may be additionally contained.

In the present invention, the administration route of the pharmaceutical composition is not limited to these, but is limited to oral cavity, intravenous, intramuscular, intraarterial, intraosseous, intradural, intracardiac, transdermal, subcutaneous, and intraperitoneal. Includes intranasal, intestinal, topical, sublingual or rectal. Oral or parenteral drops are preferred.

In the present invention, the "parenteral" includes subcutaneous, intracutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intradural, intralesional and intracranial injection or infusion techniques. The pharmaceutical compositions of the present invention can also be administered in the form of suppositories for rectal administration.

The pharmaceutical composition of the present invention relates to the activity, age, body weight, general health, sex, formula, administration time, route of administration, excretion rate, drug formulation and specific disease to be prevented or treated of the specific compound used. It can be varied in various ways due to various factors including severe illness, and the dose of the pharmaceutical composition varies depending on the patient's condition, body weight, degree of illness, drug form, route of administration and duration, and is appropriately selected by those skilled in the art. It is possible and can be administered 0.0001-50 mg / kg or 0.001-50 mg / kg daily. The administration may be performed once a day or in several divided doses. The dosage does not limit the scope of the invention in any way. The pharmaceutical composition according to the present invention can be formulated into pills, sugar-coated tablets, capsules, liquids, gels, syrups, slurries, and suspensions.

Still another embodiment of the invention relates to a method for preventing or treating cancer, comprising the step of administering to an individual the fusion protein according to the invention or a composition comprising the same.

The fusion protein of the present invention interacts with a ligand for the Lrig-1 protein present in the effector T cell to interact between the control T cell containing the Lrig-1 protein on the surface and the effector T cell. By inhibiting, the activity of regulatory T cells can be suppressed, the activity of effector T cells can be maintained or increased, and the growth of solid cancer cells among cancer cells can be effectively suppressed.

In the present invention, the "individual" is an individual suspected of developing cancer, and the individual suspected of developing cancer is a mammal including a mouse including a human who has developed or may develop the disease, a domestic animal, and the like. However, an individual that can be treated with the fusion protein of the present invention or the composition containing the same is included without limitation.

The method of the present invention can include administering a fusion protein or a composition comprising it in a pharmaceutically effective amount. A suitable total daily dose can be determined by the treating physician within the correct medical judgment and can be administered in single or divided doses. However, for the purposes of the present invention, the specific therapeutically effective amount for a specific patient includes the type and degree of the reaction to be achieved, and in some cases, whether or not another preparation is used. Including the composition, patient's age, weight, general health, gender and diet, administration time, route of administration and rate of secretion of the composition, duration of treatment, and drugs used or co-used with the specific composition. It is preferable to apply differently depending on various factors and similar factors well known in the pharmaceutical field.

On the other hand, the method for preventing or treating the cancer may be, but is not limited to, a combination therapy further comprising administering a compound or substance having therapeutic activity for one or more cancer diseases.

In the present invention, the "combination" should be understood to indicate simultaneous, individual or sequential administration. If the administrations are sequential or individual, the interval between secondary component administrations should be such that the favorable effects of the combination are not lost.

In the present invention, the dose of the fusion protein may be, but is not limited to, about 0.0001 μg to 500 mg / kg body weight of the patient.

The fusion protein provided in the present invention interacts with a ligand for the Lrig-1 protein present in the effector T cell to interact between the regulatory T cell and the effector T cell containing the Lrig-1 protein on the surface. By inhibiting the action, the activity of regulatory T cells can be suppressed, the activity of effector T cells can be maintained or increased, and the growth of solid cancer cells among cancer cells can be effectively suppressed.

It is a figure which shows the structure of the Lrig-1 protein by one Example of this invention. It is a figure which shows the structure of the Lrig-1 protein by one Example of this invention. It is a figure which shows the result of having predicted the antigenic determinant (epitope) of Lrig-1 protein by one Example of this invention. It is a figure which shows the result of having predicted the antigenic determinant (epitope) of Lrig-1 protein by one Example of this invention. It is a figure which shows the expression degree of Lrig-1 mRNA by one Example of this invention. It is a figure which shows the expression degree of Lrig-1 mRNA by one Example of this invention. It is a figure which shows the expression degree of Lrig-1 mRNA by one Example of this invention. It is a figure which shows the expression degree of Lrig-1, Lrig-2 and Lrig-3 mRNA by one Example of this invention. It is a figure which shows the comparison result of the expression level of the Lrig-1 protein in the regulatory T cell and the non-regulatory T cell by one Example of this invention. It is a figure which shows the expression of Lrig-1 protein on the surface of the regulatory T cell by one Example of this invention. It is a figure which shows the effect which inhibits the inhibitory ability of a regulatory T cell on the effector T cell of the fusion protein by one Example of this invention. FIG. 5 shows a subset of T cells in which a ligand recognized by a fusion protein according to an embodiment of the invention is present. It is a design drawing of the cancer treatment experiment using the fusion protein by one Example of this invention. It is a figure which shows the result of having analyzed the cancer therapeutic effect using the fusion protein by one Example of this invention. It is a figure which shows the result of having analyzed the cancer therapeutic effect using the fusion protein by one Example of this invention.

According to one embodiment of the invention, it relates to a fusion protein comprising an extracellular domain and an immunoglobulin Fc region of a Lrig-1 (leucine-rich and immunoglobulin-like domines1) protein.

As an example of the present invention, the immunoglobulin Fc region is an Fc region derived from IgG, IgA, IgM, IgD or IgE, or a heavy chain invariant region 2 (CH2) derived from the IgG, IgA, IgM, IgD or IgE. ) And the heavy chain invariant region 3 (CH3), but is not limited to this.

As an example of the present invention, the immunoglobulin Fc region can include, but is not limited to, a hinge region derived from IgG, IgA, IgM, IgD, IgE, or Abatacept.

In the present invention, the extracellular domain of the Lrig-1 protein can be linked to the N-terminal or C-terminal of the immunoglobulin Fc region via a linker, but is not limited thereto.

According to another embodiment of the present invention, the present invention relates to a pharmaceutical composition for preventing or treating cancer, which comprises the fusion protein of the present invention as an active ingredient.

The fusion protein provided in the present invention interacts with a ligand for the Lrig-1 protein present in the effector T cell to interact between the regulatory T cell and the effector T cell containing the Lrig-1 protein on the surface. By inhibiting the action, the activity of regulatory T cells can be suppressed, the activity of effector T cells can be maintained or increased, and the growth of solid cancer cells among cancer cells can be effectively suppressed.

Hereinafter, the present invention will be described in more detail through examples. These examples are merely for the purpose of explaining the present invention more specifically, and it is a person having ordinary knowledge in the art that the scope of the present invention is not limited by these examples by the gist of the present invention. Will be self-explanatory.

[Preparation Example 1] Cultivation of T cell subtype cells In order to confirm whether the Lrig-1 protein is expressed only in regulatory T cells (Treg), Th0, Th1, which are T cell subtypes (subsets), Th2, Th17 and iTreg were prepared. The iTreg means a cell in which differentiation is artificially induced in a medium containing the following composition, unlike the naturally separated nTreg.

The T cell subtype is first isolated from naive T cells obtained from the spleen of a rat, and then an RPMI1640 (Invitrogen Gibco, Grand Island, NY) nutrient medium containing 10% fetal bovine serum (FBS; hyclone, logan, UT). Each of the components shown in Table 24 below was further added to each cell, and differentiation was induced into each cell by culturing in a 5% CO ₂ incubator at 37 ° C. for 72 hours.

[Example 1] Analysis of Lrig-1 structure In order to prepare a fusion protein containing the extracellular domain of Lrig-1 protein, which is a surface protein of regulatory T cells, a three-dimensional solid of the extracellular domain of Lrig-1 protein is produced. Predicted the structure.

First, in order to confirm the structure of the extracellular domain (ECD) of the Lrig-1 protein for predicting the base sequence of the antigenic determinant (epitope), Uniprot (http://www.uniprot.org) and After predicting the three-dimensional structure using the RCSB Protein Data Bank (http://www.rcsb.org/pdb) tool, the results are shown in FIGS. 1 and 2.

As shown in FIG. 1, among the extracellular domains of the Lrig-1 protein, a total of 15 leucine-rich regions (LEucine-rich regions) of LRR1 to LRR15 are contained in the Lrig-LRR domain (amino acid sequences 41 to 494). Were present. Each of the LRR domains was composed of 23 to 27 amino acids, and 3 to 5 leucines were present.

Further, as shown in FIG. 2, among the extracellular domains of the Lrig-1 protein, three immunoglobulin-like domains (Immunoglobulin-like domain) were present in the amino acid sequences 494 to 781 of the Lrig-1 protein.

[Example 2] Prediction of amino acid sequence of Lrig-1 antigenic determinant (epitope) The prediction of the base sequence is performed by Ellipro server (http://http: //) which is an antigenic determinant prediction software based on the structure of Lrig-1 protein. Tools.iedb.org/ellipro/) was used. The Ellipro search engine used the equivalent of a search engine known to be the most reliable of the algorithms for predicting existing antigenic determinants.

After inputting the extracellular domain analyzed in Example 1 into the antigenic determinant prediction software, the predicted continuous or discontinuous amino acid sequences of the predicted antigenic determinants are shown in FIGS. 3 and 4.

As shown in FIGS. 3 and 4, a total of 22 amino acid sequences of continuous antigenic determinants were predicted, and a total of 8 amino acid sequences of discontinuous antigenic determinants were predicted.

[Example 3] Confirmation of specific expression of Lrig-1 mRNA in regulatory T cells It was verified whether the Lrig-1 protein can act as a biomarker specific to regulatory T cells.

For the above verification, CD4 ⁺ T cells were isolated from the murine spleen through CD4 beads using a magnet-activated cell sorting (MACS). Subsequently, regulatory T (CD4 ⁺ CD25 ⁺ T) cells and non-regulatory T (CD4 ⁺ CD25 ^- T) cells were separated using a fluorescently active cell classifier (FACS) using the CD25 antibody. After each cell and the cell differentiated in Preparation Example 1 extract mRNA using Trizol, genomic RNA is obtained from gDNA by a protocol provided by a trader using a gDNA extraction kit (Qiagen). Removed. The gDNA-removed mRNA was synthesized into cDNA using the BDsplint cDNA Synthesis Kit (Clonetech).

Real-time PCR (real time PCR) was performed to quantitatively confirm the expression level of Lrig-1 mRNA in the cDNA.

The real-time PCR was carried out using SYBR Green (Molecular Genes) under the conditions of 40 cycles of 95 ° C. for 3 minutes, 61 ° C. for 15 seconds, 72 ° C. for 30 seconds, according to a protocol provided by the supplier, as shown in Table 25 below. The relative gene expression level was calculated using the ΔCT method and standardized using HPRT, and the results are shown in FIGS. 5 to 8.

As shown in FIG. 5, the expression of Lrig-1 is 18.1 times higher in regulatory T cells (CD4 ⁺ CD25 ⁺ T cell) than in non-regulatory T cells (CD4 ⁺ CD25 ^- T cell). I understand. This was about 10 times higher in expression level when compared with the conventionally known markers of regulatory T cells, Lag3 and Ikzf4.

Also, as shown in FIGS. 6 and 7, regulatory T cells are naturally isolated as compared to other types of immune cells, especially as induced regulatory T cells (iTreg). The expression of Lrig-1 mRNA was remarkably high in (nTreg).

Furthermore, as shown in FIG. 8, the expression of Lrig-1 was the highest among the Lrig-1, Lrig-2 and Lrig-3 corresponding to the Lrig family.

Through the above results, it can be seen that the Lrig-1 protein according to the present invention is specifically expressed in regulatory T cells, particularly naturally occurring regulatory T cells.

[Example 4] Confirmation of specific expression of Lrig-1 protein in regulatory T cells It was confirmed whether the Lrig-1 protein expressed from Lrig-1 mRNA is specifically expressed only in regulatory T cells.

Using a FOXP3-RFP-injected (knock-in) mouse in which RFP (red fluorescent protein) is bound to the FOXP3 promoter, which is a regulatory T cell-specific transcription factor, from the spleen of the mouse, a magnet-activated cell classifier with CD4 beads ( CD4 ⁺ T cells were isolated using a magnet-activated cell sorting (MACS). Subsequent use of the RFP protein was obtained by separating regulatory T cells (CD4 ⁺ RFP ⁺ T cell) and non-regulatory T cells (CD4 ⁺ RFP ^- T cell) through a fluorescently active cell classifier (FACS). .. The purchased Lrig-1 antibody and the negative control group were stained with isotypes for each of the cells, and the expression level of Lrig-1 was measured with a fluorescent active cell classifier, and the results are shown in FIG.

As shown in FIG. 9, in the case of non-regulatory T cells represented by the dotted line, the expression level of Lrig-1 was almost the same as that in the negative control group, but in the case of regulatory T cells, the expression of Lrig-1 was shown. There were many high-level cells.

From the above results, it can be seen that the Lrig-1 protein according to the present invention is specifically expressed in regulatory T cells.

[Example 5] Confirmation of Lrig-1 protein-specific expression on the surface of regulatory T cells In order for the Lrig-1 protein to be a target for cell therapy, it is more effective if it is expressed on the surface of regulatory T cells. Since target treatment is possible, it was confirmed whether or not the Lrig-1 protein is expressed on the surface.

Each differentiated T cell subtype of Preparation Example 1 was stained with anti-CD4-APC and anti-Lrig-1-PE antibodies and used with a fluorescently activated cell sorter (Fluorescense-Activated Cell Sorter; FACS). The expression level of Lrig-1 was measured on each cell surface, and the results are shown in FIG.

As shown in FIG. 10, the amount of Lrig-1 expression in activated T cells, Th1 cells, Th2 cells, Th17 cells and Naive T cells is 0.77 to 15.3. In contrast to the expression in T cells (iTreg) in which differentiation was induced, the expression was as high as 83.9.

Through the above results, it can be seen that the Lrig-1 protein according to the present invention is not only specifically expressed in regulatory T cells (Treg), but is also highly expressed particularly on the surface of the regulatory T cells.

[Production example] Preparation of fusion protein 1. Preparation of Expression Vector In order to produce the fusion protein according to the present invention, each nucleic acid sequence encoding each fusion protein in Table 26 below was synthesized. NheI and EcoRI restriction enzyme sequences are added to the 5'end and 3'end of the nucleic acid sequence, respectively, and the Kozak's sequence (GCCACC) is added after the 5'end restriction enzyme sequence, and the start for protein translation. A mouse IgG kappa light chain signal peptide (ATGGAAACCGATACTCTGCTGCTGTGGGTGTGCTGCTGCTGTGGGGTGCCAGGCTCTACCGGG) that secretes codons and expressed proteins extracellularly was inserted. Hereinafter, in the nucleic acid sequences encoding each fusion protein in Table 26 below, the extracellular domain of the human-derived Lrig-1 protein; selectively the linker; the hinge region; the heavy chain invariant region 2 (CH2) derived from human IgG1 and the weight. A stop codon was inserted after the nucleic acid sequence encoding the chain invariant region 3 (CH3) ;. The nucleic acid sequence encoding the fusion protein of the present invention was cloned into a pcDNA3.1 (+) expression vector using two restriction enzyme sequences, NheI and EcoRI.

2. 2. Purification of fusion protein Using polyethyleneimine in 293F cells. After transforming the expression vector prepared in 1 above, the cells were cultured under 37 ° C. and 8% CO ₂ conditions for 6 days. The culture supernatant was filtered, poured into a protein A resin, and then washed with 1X PBS. After elution with a 0.1 M glycine solution having a pH of 3.5, a 1 M TRIS solution having a pH of 9.0 was added to the obtained solution to neutralize the pH. After that, the solution was dialyzed to a PBS solution state, and then concentrated and used.

[Example 6] Effect of the fusion protein according to the present invention on the inhibitory ability of controllable T cells on effector T cells The fusion protein represented by SEQ ID NO: 21 according to the present invention produced in Production Example 5 (in SEQ ID NO: 25). (Preparation using the represented nucleic acid sequence) binds to a ligand for the Lrig-1 protein and inhibits the interaction between the ligand and the controlling T cell, thereby finally being an effector of the controlling T cell. The following experiments were performed to confirm whether the ability to suppress proliferation of T cells was reduced. Specifically, the fusion protein of Production Example 5 was added under the condition of co-culturing regulatory T cells and effector T cells, and changes in the growth inhibitory ability of regulatory T cells with respect to effector T cells were confirmed. The results are shown in FIG.

As shown in FIG. 11, it was confirmed that the treatment of the fusion protein according to the present invention reduced the ability of regulatory T cells to suppress proliferation of effector T cells.

Thereby, the fusion protein according to the present invention interacts with the ligand for the Lrig-1 protein and inhibits the interaction between the regulatory T cells containing the Lrig-1 protein on the surface and the ligand. It was found that the activity of regulatory T cells was suppressed and the activity of effector T cells was maintained or increased.

[Example 7] Confirmation of distribution of Lrig-1 ligand recognized by the fusion protein according to the present invention As is clear from the above Example 6, it is represented by SEQ ID NO: 21 according to the present invention prepared in the above Production Example 5. Since it can be seen that the fusion protein (prepared using the nucleic acid sequence represented by SEQ ID NO: 25) can recognize the Lrig-1 ligand, controllable T cells are used to excavate the immune cells in which the Lrig-1 ligand is present. After inducing differentiation of activated T cells, Th1 cells, Th2 cells or Th17 cells from the target naive T cells of the above-mentioned Production Example 5, the fusion protein (primary antibody) and anti-antibody of Production Example 5 are used. -Stained with human-PE antibody (secondary antibody). The expression level of the fusion protein was measured on each cell surface using a fluorescently activated cell sorter (FACS), and the results are shown in FIG. 12.

As shown in FIG. 12, the fusion protein according to the invention barely stains the antigens on the surface of naive T cells (0.71%) and activated T cells, Th1 cells, Th2 cells and Th17. More than 96% of the antigen on the surface of the cells was stained.

This revealed that the ligand for Lrig-1 is a surface protein induced by stimulation of the T cell receptor.

[Example 8] Cancer therapeutic effect of fusion protein according to the present invention The fusion protein represented by SEQ ID NO: 21 according to the present invention produced in Production Example 5 (preparation using the nucleic acid sequence represented by SEQ ID NO: 25). In order to confirm the therapeutic effect on solid cancer, as shown in FIG. 13, B16F10 melanoma cells (melanoma cells) were subcutaneously injected into mice or the like in an amount of 3 × 10 ⁵ cells, and then 4 days, 8 days, 12 days. On the day, the fusion protein of Production Example 5 was intraperitoneally injected in an amount of 200 ug. After transplantation of the melanoma cells, the change in tumor volume over time was measured, and the results are shown in FIG.

As shown in FIG. 14, it was confirmed that when the fusion protein according to the present invention was treated, the size of the melanoma tumor was significantly reduced as compared with the negative control group which was not treated at all.

[Example 9] Cancer therapeutic effect of fusion protein according to the present invention The fusion protein represented by SEQ ID NO: 78 according to the present invention produced in Production Example 34 (prepared using the nucleic acid sequence represented by SEQ ID NO: 82). In order to confirm the therapeutic effect on solid cancer, CT-26 large-sized cancer cells were subcutaneously injected into mice or the like in an amount of ³ × 105 cells, and then on the 4th, 8th, and 12th days, the above-mentioned production example 34. The fusion protein was injected intraperitoneally in an amount of 200 ug. After the transplantation of the large cancer cells, the volume change of the tumor with the passage of time was measured, and the result is shown in FIG.

As shown in FIG. 15, it was confirmed that when the fusion protein according to the present invention was treated, the size of the large cancer tumor was significantly reduced as compared with the negative control group in which no treatment was performed.

Thereby, the fusion protein containing the extracellular domain and immunoglobulin Fc region of the Lrig-1 protein according to the present invention can be used for regulatory T cells by inhibiting the interaction between regulatory T cells and effector T cells. It can be seen that the activity can be suppressed, the activity of effector T cells can be maintained or increased, and the growth of solid cancer cells among cancer cells can be effectively suppressed.

Although the present invention has been described in detail above, the scope of rights of the present invention is not limited to this, and various modifications and modifications can be made without departing from the technical idea of the present invention described in the claims. It will be obvious to those who have ordinary knowledge in the art.

The present invention relates to a novel fusion protein comprising an extracellular domain of a Lrig-1 protein and an immunoglobulin Fc region, and uses thereof for the prevention or treatment of cancer.

Claims (20)

A fusion protein containing the extracellular domain and immunoglobulin Fc region of the Lrig-1 (leucine-rich and immunoglobulin-like domines1) protein. The fusion protein according to claim 1, wherein the extracellular domain of the Lrig-1 protein is represented by SEQ ID NO: 1 or 3. The fusion protein according to claim 1, wherein the immunoglobulin Fc region comprises 1 to 4 domains selected from the group consisting of CH1, CH2, CH3 and CH4 domains. The immunoglobulin Fc region is an IgG, IgA, IgD, IgE or IgM-derived Fc region, a heavy chain invariant region 2 (CH2), a heavy chain invariant region 3 (CH3), a hinge, a fragment thereof, a combination thereof, or a combination thereof. The fusion protein according to claim 1, which is a hybrid Fc comprising a combination. The fusion protein according to claim 1, wherein the immunoglobulin Fc region comprises CH2 and CH3 domains derived from IgG, IgA, IgD, IgE or IgM. The fusion protein of claim 1, wherein the immunoglobulin Fc region comprises CH2 and CH3 domains derived from IgG1, IgG2, IgG3 or IgG4. The fusion protein according to claim 1, wherein the immunoglobulin Fc region comprises a hinge region. The fusion protein of claim 7, wherein the immunoglobulin Fc region comprises a hinge region derived from IgG, IgA, IgM, IgD, IgE, or Abatacept. The fusion protein of claim 7, wherein the hinge region comprises a hinge region derived from IgG1, IgG2, IgG3, IgG4, IgD or Abatacept. The fusion protein of claim 1, wherein the immunoglobulin Fc region comprises CH2 and CH3 represented by SEQ ID NO: 5 or 6. The fusion protein of claim 1, wherein the immunoglobulin Fc region comprises a hinge region represented by any one of SEQ ID NOs: 7-10. The fusion protein of claim 1, wherein the extracellular domain of the Lrig-1 protein is directly linked to the N-terminus or C-terminus of the immunoglobulin Fc region. The fusion protein according to claim 1, wherein the extracellular domain of the Lrig-1 protein is linked to the N-terminal or C-terminal of the immunoglobulin Fc region via a linker. The fusion protein according to claim 13, wherein the linker is at least one of a peptide linker represented by SEQ ID NO: 11; and a peptide linker represented by SEQ ID NO: 12. A nucleic acid molecule encoding the fusion protein according to any one of claims 1 to 14. An expression vector into which the nucleic acid molecule according to claim 15 is inserted. A host cell line phenotypically infected with the expression vector according to claim 16. A pharmaceutical composition for preventing or treating cancer, which comprises the fusion protein according to any one of claims 1 to 14 as an active ingredient. The pharmaceutical composition according to claim 18, wherein the cancer is a solid cancer. The cancer is gastric cancer, liver cancer, glial cell tumor, ovarian cancer, large sickle cancer, head and neck cancer, bladder cancer, renal cell carcinoma, breast cancer, metastatic cancer, prostate cancer, pancreatic cancer, melanoma or lung cancer. Item 18. The pharmaceutical composition according to Item 18.