JPWO2013150623A1 - Drug conjugate of anti-CDH3 (P-cadherin) antibody - Google Patents

Abstract

An object of the present invention is to provide an anti-CDH3 antibody drug conjugate that efficiently kills cancer cells expressing CDH3. According to the present invention, there is provided an immune complex comprising an antibody against CDH3 or a fragment thereof having CDH3 binding ability and a chemotherapeutic agent.

Description

  The present invention relates to drug conjugates of anti-CDH3 antibodies. The present invention further relates to methods of using anti-CDH3 antibody drug conjugates.

  Cancer is an important disease that accounts for the top causes of death, but its therapeutic needs have not yet been met. In recent years, in order to solve the problem of damaging normal cells of conventional chemotherapy, cancer treatment with molecular targeted drugs that design and treat drugs targeting specific molecules specifically expressed in cancer cells Has been actively studied.

  One of the targets is CDH3, which is a cell surface antigen. CDH3 is a membrane protein discovered as a molecule involved in allophilic cell adhesion in a calcium-dependent manner (Yoshida and Takeichi, Cell 28: 217-224, 1982). A protein having a cadherin repeat consisting of about 110 amino acid residues having high homology to each other is called a cadherin superfamily, and CDH3 belongs to its main member.

  In some types of cancer cells, cases of increased expression of CDH3 have been reported, and cancer treatment using antibodies against cancer cells having higher expression of CDH3 in cancer tissues than in normal tissues has been studied ( WO2002 / 097395 and WO2007 / 102525).

  As molecular target drugs, many antibody drugs have already been put on the market, and many of them have antibody-dependent cytotoxicity (ADCC) as the main mechanism of action. However, its medicinal effects are not always sufficient, and technological development aimed at a stronger antitumor effect is being promoted at the same time.

  One effective means for enhancing the antitumor ability of an antibody is to link the antibody with a drug (toxin) having strong toxicity. When administered alone to a patient, toxins can also damage normal tissues and cannot be an effective treatment. However, by linking with an antibody that binds to a tumor cell-specific antigen, it has the ability to kill only tumor cells without adversely affecting normal tissue. Such agents are called antibody drug conjugates (ADC). That is, the toxin does not show any toxicity when bound to the antibody. However, certain antibodies, when bound to the target antigen, are taken up into cells and degraded by lysosomes. Therefore, the antibody of that kind to which the toxin is bound is taken into the cell and decomposed inside the cell, so that the toxin is released, and the toxicity is expressed only inside the specific cell, and the cell is killed by the effect.

The drug components used in ADC include bacterial protein toxins such as diphtheria toxin, plant protein toxins such as ricin, low molecular weight toxins such as auristatin, maytansinoid, calikiamycin and derivatives thereof.

  In the ADC, the drug bound to the antibody circulates in the blood, and after it accumulates in the target tumor, it has a medicinal effect. Release of the drug outside the tumor site (withdrawal from the antibody) is not always preferable because there is a risk of causing side effects. That is, it is preferable that the drug bound to the antibody is designed to be released from the antibody after being taken into the cell. In recent years, Genentech has developed a drug (T-DM1) in which a toxin is bound to trastuzumab via a non-cleavable linker (SMCC) from this point of view. . Antibody drug conjugates linked to drug components via cleavable linkers are also developed. For example, ImmunoGen develops an antibody drug conjugate in which a drug and a HuN901 antibody are bound via a disulfide linker (SPP) for cancers that express the NCAM antigen.

  As described above, the concept of treating cancer with ADC is known. There is a need in the art for additional drugs to treat various cancers such as lung cancer and colon cancer. Particularly useful agents for this purpose include anti-CDH3 antibody drug conjugates that have significantly less toxicity but have beneficial therapeutic efficacy. These and other limitations or past problems can be solved by the present invention.

WO2002 / 097395 publication WO2007 / 102525

Yoshida and Takeichi, Cell 28: 217-224, 1982

  An object of the present invention is to provide an anti-CDH3 antibody drug conjugate that efficiently kills cancer cells expressing CDH3.

  As a result of intensive studies to solve the above-mentioned problems, the present inventors have found that an immune complex formed by linking an antibody against CDH3 and a chemotherapeutic agent has a strong cytotoxic activity against a cancer cell line expressing CDH3. As a result, the present invention has been completed.

That is, according to the present invention, there is provided an immune complex comprising an antibody against CDH3 or a fragment thereof capable of binding CDH3 and a chemotherapeutic agent.
Preferably, in the immune complex of the present invention, an antibody against CDH3 or a fragment thereof capable of binding CDH3 exhibits cytotoxicity against cells expressing CDH3.
Preferably, the antibody against CDH3 is an antibody produced by an antibody-producing cell obtained from an immune cell administered with CDH3 or a cell expressing CDH3 as an immunogen.

Preferably, the antibody is a monoclonal antibody.
Preferably, the antibody is chimerized.
Preferably, the antibody is humanized.
Preferably, the antibody is a human antibody.

Preferably, the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 48, 56 and 65 on the H chain, and the amino acid sequence set forth in SEQ ID NOs: 75, 82 and 86 on the L chain.
Preferably, the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 52, 60 and 70 in the H chain and the amino acid sequence set forth in SEQ ID NOs: 75, 82 and 91 in the L chain.
Preferably, the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 54, 62 and 72 in the H chain and the amino acid sequence set forth in SEQ ID NOs: 74, 81 and 93 in the L chain.
Preferably, the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 55, 63 and 73 in the H chain and the amino acid sequence set forth in SEQ ID NOs: 80, 85 and 94 in the L chain.
Preferably, the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 49, 64 and 66 on the H chain and the amino acid sequence set forth in SEQ ID NOs: 76, 84 and 89 on the L chain.

Preferably, the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 49, 58 and 68 on the H chain and the amino acid sequence set forth in SEQ ID NOs: 79, 82 and 90 on the L chain.
Preferably, the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 53, 61 and 71 on the H chain, and the amino acid sequence set forth in SEQ ID NOs: 75, 82 and 92 on the L chain.
Preferably, the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 51, 57 and 67 on the H chain, and the amino acid sequence set forth in SEQ ID NOs: 78, 83 and 88 on the L chain.
Preferably, the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 50, 59 and 69 on the H chain, and the amino acid sequence set forth in SEQ ID NOs: 77, 83 and 87 on the L chain.

Preferably, the antibody has an H chain consisting of an amino acid sequence having at least 90% sequence identity with the amino acid sequence of the H chain of the antibody of the present invention described above.
Preferably, CDH3 is mammalian CDH3.
Preferably, CDH3 is selected from primate CDH3.
Preferably, CDH3 is selected from human CDH3.
Preferably, CDH3 is CDH3 expressed on the surface of a cell.
Preferably, the antibody fragment having CDH3 binding ability is Fab, F (ab ′) ² or scFv.

Preferably, the chemotherapeutic agent is a cytotoxic substance.
Preferably, the cytotoxic substance is selected from maytansinoids and derivatives thereof.
Preferably, the cytotoxic substance is selected from auristatin and its derivatives.
Preferably, the maytansinoid and its derivatives are selected from DM1, DM3, DM4.

Preferably, the auristatin and its derivatives are selected from MMAE or MMAF.
Preferably, the cytotoxic agent is DM1.
Preferably, 1 to 10 DM1s are bound per molecule of an antibody against CDH3 or a fragment thereof having CDH3 binding ability.
Preferably, 3 to 8 DM1s are bound per molecule of an antibody against CDH3 or a fragment thereof having CDH3 binding ability.

Preferably, an antibody against CDH3 or a fragment thereof capable of binding CDH3 and the chemotherapeutic agent are bound via a linker.
Preferably, the binding of the antibody against CDH3 or a fragment thereof capable of binding CDH3 and the chemotherapeutic agent is via an intramolecular disulfide bond in the Fc region of the antibody.
Preferably, the antibody against CDH3 or a fragment thereof having CDH3 binding ability and the chemotherapeutic agent are those obtained by genetically modifying the Fc region of the antibody.
Preferably, the linker that binds the antibody against CDH3 or a fragment thereof having CDH3 binding ability and the chemotherapeutic agent is a bivalent reactive crosslinking reagent.

  Preferably, the linker is N-succinimidyl 4- (maleimidomethyl) cyclohexanecarboxylate (SMCC), N-succinimidyl-4- (N-maleimidomethyl) -cyclohexane-1-carboxy- (6-amidocaproate) ( LC-SMCC), κ-maleimidoundecanoic acid N-succinimidyl ester (KMUA), γ-maleimidobutyric acid N-succinimidyl ester (GMBS), ε-maleimidocaproic acid N-hydroxysuccinimide ester (EMCS), m- Maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), N- (α-maleimidoacetoxy) -succinimide ester (AMAS), succinimidyl-6- (β-maleimidopropionamido) hexanoate (SMPH), N-sul Cinimidyl 4- (p-maleimidophenyl) -butyrate (SMPB), and N- (p-maleimidophenyl) isocyanate (PMPI), 6-maleimidocaproyl (MC), maleimidopropanoyl (MP), p-aminobenzyloxy Carboxyl (PAB), N-succinimidyl 4 (2-pyridylthio) pentanoate (SPP) and N-succinimidyl (4-iodo-acetyl) aminobenzoate (SIAB), N-succinimidyl (4- (2-pyridylthio) butanoate Selected from the group consisting of (SPDB).

Preferably, the linker is cleaved by a protease.
Preferably, the linker comprises val-cit.
Preferably, the linker comprises PABA.

Furthermore, according to the present invention, there is provided a pharmaceutical composition comprising the immune complex of the present invention for treating cancer characterized by overexpression of CDH3.
Preferably, the pharmaceutical composition of the present invention has an anticancer effect.
Preferably, the cancer is colorectal cancer, non-small cell lung cancer, breast cancer, head and neck cancer, ovarian cancer, lung cancer, invasive bladder cancer, pancreatic cancer, brain metastatic cancer, thyroid cancer, head and neck squamous cell carcinoma, Esophageal squamous cell carcinoma, lung squamous cell carcinoma, cutaneous squamous cell carcinoma, melanoma, breast cancer, lung adenocarcinoma, cervical squamous cell carcinoma, pancreatic squamous cell carcinoma, colon squamous cell carcinoma, or gastric squamous cell carcinoma, prostate cancer, bone Selected from sarcoma or soft tissue sarcoma.

  The immunocomplex comprising an anti-CDH3 antibody and a chemotherapeutic agent provided by the present invention is more potent in cytotoxicity against a cancer cell line expressing CDH3 than an antibody that does not bind a chemotherapeutic agent. Shows activity. Therefore, when the immune complex of the present invention is administered to a patient having a cancer cell that expresses CDH3, a high anticancer effect can be expected. That is, the immune complex of the present invention is useful as an anticancer agent.

FIG. 1 shows the results of flow cytometry in which a human CDH3 forced expression cell line was reacted with a commercially available anti-human CDH3 antibody. A: CHO cells, B: CDH3 forced expression CHO cells. a: 0.01 mg / mL of anti-CDH3 antibody, b: 0.1 mg / mL of anti-CDH3 antibody, c: 1 mg / mL of anti-CDH3 antibody FIG. 2 shows typical flow cytometry results for 3 acquired antibodies and each cell line. A: CDH3 forced expression CHO cell, B: CHO cell, C: Lung cancer-derived cell line NCI-H358. a: anti-CDH3 antibody 0.01 mg / mL, b: anti-CDH3 antibody 0.1 mg / mL, c: anti-CDH3 antibody 1 mg / mL. FIG. 3 shows the expression results of CDH3 mRNA in various tumor tissues. A: Normal tissue, B: Various cancer tissues, C: Degree of pancreatic cancer differentiation FIG. 4 shows the expression results of CDH3 in various human tumor tissues. FIG. 5 shows the results of flow cytometry in which each CDH3 chimeric antibody was reacted. A: CHO cells, B: CDH3 forced expression CHO cells, C: Lung cancer-derived cell line NCI-H358 FIG. 6 shows the structure of DM1SMe. FIG. 7 shows the cytotoxicity test results of the CDH3 antibody drug conjugate. ADC: CDH3 antibody drug conjugate, Naked: drug-unbound CDH3 antibody. FIG. 8 shows animal test results using CDH3 antibody drug conjugates. ADC: CDH3 antibody drug conjugate, Naked: drug-unbound CDH3 antibody.

Hereinafter, the present invention will be described in more detail.
The immune complex of the present invention is provided as an anti-CDH3 antibody drug conjugate that efficiently kills cancer cells.

  As an antigen for preparing the antibody of the present invention, CDH3 or a partial peptide thereof can be used. As an example, soluble CDH3 protein or the like can be used, but is not limited thereto.

  The antibody used in the present invention may be a polyclonal antibody or a monoclonal antibody. The antibody of the present invention can be produced by any of various methods. Methods for producing antibodies are well known in the art [see, eg, Sambrook, J et al., Molecular Cloning, Cold Spring Harbor Laboratory Press (1989)].

(A) Production of Polyclonal Antibody In order to produce a polyclonal antibody, CDH3 or a partial peptide thereof is used as an antigen and administered to a mammal such as a rat, mouse, rabbit or the like. The dose of the antigen per animal is 0.1 to 100 mg when no adjuvant is used, and 1 to 100 μg when an adjuvant is used. Examples of adjuvants include Freund's complete adjuvant (FCA), Freund's incomplete adjuvant (FIA), and aluminum hydroxide adjuvant. Immunization is performed mainly by injecting intravenously, subcutaneously, intraperitoneally, or the like. The immunization interval is not particularly limited, and immunization is performed 1 to 10 times, preferably 2 to 5 times at intervals of several days to several weeks, preferably 2 to 5 weeks. Then, 6 to 60 days after the last immunization, the antibody titer is measured by enzyme immunoassay (ELISA (enzyme-linked immunosorbent assay) or EIA (enzyme immunoassay)), radioimmunoassay (RIA), etc. On the day when the maximum antibody titer is shown, blood is collected to obtain antiserum. When purification of antibody from antiserum is required, it should be purified by selecting a known method such as ammonium sulfate salting-out method, ion exchange chromatography, gel filtration, affinity chromatography, or a combination thereof. Can do.

(B) Production of monoclonal antibody In order to produce a monoclonal antibody, first, CDH3 or a partial peptide thereof is used as an antigen to a mammal such as a rat, mouse, rabbit or the like. The dose of the antigen per animal is 0.1 to 100 mg when no adjuvant is used, and 1 to 100 μg when an adjuvant is used. Examples of adjuvants include Freund's complete adjuvant (FCA), Freund's incomplete adjuvant (FIA), and aluminum hydroxide adjuvant. Immunization is performed mainly by injecting intravenously, subcutaneously or intraperitoneally. The immunization interval is not particularly limited, and immunization is performed 1 to 10 times, preferably 2 to 5 times at intervals of several days to several weeks, preferably 2 to 5 weeks. Then, antibody-producing cells are collected 1 to 60 days, preferably 1 to 14 days after the final immunization day. Examples of antibody-producing cells include spleen cells, lymph node cells, peripheral blood cells, etc., but spleen cells or local lymph node cells are preferred.

  In order to obtain a cell fusion hybridoma, cell fusion between antibody-producing cells and myeloma cells is performed. As myeloma cells to be fused with antibody-producing cells, generally available cell lines of animals such as mice can be used. The cell line used has drug selectivity and cannot survive in a HAT selection medium (including hypoxanthine, aminopterin, and thymidine) in an unfused state, but can survive only in a state fused with antibody-producing cells. Those having the following are preferred. Examples of myeloma cells include P3X63-Ag. 8). Examples include mouse myeloma cell lines such as U1 (P3U1) and NS-1.

Next, the myeloma cell and the antibody-producing cell are fused. Cell fusion is performed by using 1 × 10 ⁶ to 1 × 10 ⁷ antibody-producing cells and 2 × 10 ⁵ to 2 × 10 ^{6 in} animal cell culture media such as serum-free DMEM and RPMI-1640 media. 1 / ml myeloma cells are mixed (a cell ratio of antibody-producing cells to myeloma cells is preferably 5: 1), and a fusion reaction is performed in the presence of a cell fusion promoter. As the cell fusion promoter, polyethylene glycol having an average molecular weight of 1000 to 6000 daltons can be used. Alternatively, antibody-producing cells and myeloma cells can be fused using a commercially available cell fusion device utilizing electrical stimulation (for example, electroporation).

The target hybridoma is selected from the cells after cell fusion treatment. As a method for this, the cell suspension is appropriately diluted with, for example, fetal bovine serum-containing RPMI-1640 medium, then plated on a microtiter plate at about 3 × 10 ⁵ cells / well, a selective medium is added to each well, and thereafter appropriate. The culture is carried out with the selective medium changed. As a result, cells that grow from about 14 days after the start of culture in the selective medium can be obtained as hybridomas.

  Next, it is screened whether the target antibody exists in the culture supernatant of the hybridoma which has proliferated. Hybridoma screening is not particularly limited, and may be performed according to ordinary methods. For example, a part of the culture supernatant contained in a well grown as a hybridoma can be collected, and a hybridoma producing an antibody that binds to CDH3 can be screened by enzyme immunoassay, radioimmunoassay or the like. Cloning of the fused cells is performed by limiting dilution or the like, and finally, a hybridoma that is a monoclonal antibody-producing cell can be established.

As a method for collecting a monoclonal antibody from the established hybridoma, a normal cell culture method or ascites collection method can be employed. In the cell culture method, the hybridoma is cultured in an animal cell culture medium such as RPMI-1640 medium containing 10% fetal bovine serum, MEM medium, or serum-free medium under normal culture conditions (for example, 37 ° C., 5% CO ₂ concentration). The cells are cultured for 7 to 14 days, and antibodies are obtained from the culture supernatant.

In the case of the ascites collection method, about 1 × 10 ⁷ hybridomas are administered into the abdominal cavity of a myeloma cell-derived mammal and a homologous animal, and the hybridomas are proliferated in large quantities. And ascitic fluid is collected after 1-2 weeks. When antibody purification is required in the antibody collection method, known methods such as ammonium sulfate salting-out method, ion exchange chromatography, gel filtration, affinity chromatography are appropriately selected, or a combination thereof is used. Can be purified.

  The type of the antibody of the present invention is not particularly limited, and it is artificial for the purpose of reducing the foreign antigenicity against humans such as mouse antibody, human antibody, rat antibody, rabbit antibody, sheep antibody, camel antibody, avian antibody, etc. Any of a recombinant antibody modified into, for example, a chimeric antibody or a humanized antibody may be used. The recombinant antibody can be produced using a known method. A chimeric antibody is an antibody comprising a non-human mammal, for example, a mouse antibody heavy chain and light chain variable region and a human antibody heavy chain and light chain constant region, and a DNA encoding the murine antibody variable region. Can be obtained by ligating to the DNA encoding the constant region of a human antibody, incorporating it into an expression vector, introducing it into a host, and producing it. A humanized antibody is obtained by transplanting the complementarity determining region (CDR) of a mammal other than a human, for example, a mouse antibody, to the complementarity determining region of a human antibody, and its general gene recombination technique is also known. . Specifically, several oligonucleotides were prepared so that a DNA sequence designed to link CDRs of a mouse antibody and a framework region (FR) of a human antibody had an overlapping portion at the end. It is synthesized from nucleotides by PCR. It is obtained by ligating the obtained DNA with DNA encoding a human antibody constant region, then incorporating it into an expression vector, introducing it into a host and producing it (EP239400, International Publication WO96 / 02576, etc.) .

  Many host cell systems used for protein expression are of mammalian origin in antibody production systems. The producer can preferentially determine the particular host cell system that is most suitable for the gene product he wishes to express. Common host cell lines include CHO-derived cell lines (Chinese hamster ovary cell line), CV1 (monkey kidney line), COS (derivative of CV1 that carries SV40T antigen), SP2 / 0 (mouse myeloma), P3x63-Ag3 .653 (mouse myeloma), and 293 (human kidney), 293T (a derivative of 293 that carries the SV40T antigen), but is not limited thereto. Host cell lines can be obtained from commercial institutions, the American Tissue Culture Collection (ATCC), or from published publication agencies.

  The host cell system is preferably either a CHO-derived cell line deficient in expression of the dgfr gene or SP2 / 0 (Urland, G. et al., Effect of gamma rays at the dihydrofolate reductases locus: deletions and inversions. Cell.Mol.Genet.Vol.12, 1986, p5555-566, and Schulman, M. et al., Abetter cell line for making hybridomas, specific antigens, 27. ). Most preferably, the host cell line is DHFR deficient CHO.

  Transfection of the plasmid into the host cell can be accomplished using any technique. Specific methods include transfection (including calcium phosphate method, DEAE method, lipofection, and electroporation), a method of introducing DNA using an envelope such as Sendai virus, microinjection, retrovirus virus, adeno Examples include, but are not limited to, infection with viral vectors such as viruses (see Current Protocols in Molecular Biology, Chapter 9 Introduction of DNA into Mammalian Cells, John Wiley and Ins.). Most preferred is the introduction of the plasmid into the host by electroporation.

  A method for obtaining a human antibody is also known. For example, human lymphocytes are sensitized in vitro with a desired antigen or cells expressing the desired antigen, the sensitized lymphocytes are fused with human myeloma cells such as U266, and the desired human antibody having binding activity to the antigen (See Japanese Patent Publication No. 1-59878). Further, a desired human antibody can be obtained by immunizing a transgenic animal having all repertoires of human antibody genes with a desired antigen (WO93 / 12227, WO92 / 03918, WO94 / 02602, WO94 / 25585). WO96 / 34096, WO96 / 33735). Furthermore, a technique for obtaining a human antibody by panning using a human antibody library is also known. For example, the variable region of a human antibody is expressed as a single chain antibody (scFv) on the surface of the phage by the phage display method, and a phage that binds to the antigen can be selected. By analyzing the gene of the selected phage, the DNA sequence encoding the variable region of the human antibody that binds to the antigen can be determined. If the DNA sequence of scFv that binds to the antigen is clarified, an appropriate expression vector can be prepared from the sequence to obtain a human antibody. These methods are already well known, and WO92 / 01047, WO92 / 20791, WO93 / 06213, WO93 / 11236, WO93 / 19172, WO95 / 01438, and WO95 / 15388 can be referred to.

These antibodies may be monovalent antibodies, bivalent antibodies, and multivalent antibodies as long as they recognize CDH3, and may be low molecular weight antibodies such as antibody fragments (fragments) or modified antibodies. Good. In addition, an Fc part may be fused to an antibody fragment or a low molecular weight antibody, for example, Fab, Fab ′, F (ab ′) ₂ , Fv, ScFv (single chain Fv), Diabody, and the like. In order to obtain such antibodies, a gene encoding these antibodies may be constructed, introduced into an expression vector, and then expressed in an appropriate host cell.

  These antibodies can be used by binding various molecules such as polyethylene glycol (PEG). Such a modified antibody can be obtained by chemically modifying the obtained antibody. Antibody modification methods are known to those skilled in the art.

  In the immune complex of the present invention, a chemotherapeutic agent can be further bound to the above-described antibody and used as a cytotoxic agent. The immune complex of the present invention can injure cancer cells, for example, by contacting with a cancer cell expressing CDH3.

  A preferred embodiment of the immune complex of the present invention is a so-called ADC in which a cytotoxic substance such as a drug is bound to an antibody.

Examples of chemotherapeutic agents used in the present invention include, for example, duocarmycin, duocarmycin analogs and derivatives, CC-1065, duocarmycin analogs based on CBI, and duocarmycins based on MCBI. Analogs, duocarmycin analogs based on CCBI, doxorubicin, doxorubicin conjugate, morpholino-doxorubicin, cyanomorpholino-doxorubicin, dolastatin, dresstatatin-10, combretastatin, calicheamicin, maytansine, maytansine Analog, DM1, DM2, DM3, DM4, DMI, auristatin E, auristatin EB (AEB), auristatin EFP (AEFP), monomethyl auristatin E (MMAE), mono Tyrauristatin F (MMAF), 5-benzoylvaleric acid AE ester (AEVB), tubulin, disorazole, epothilone, paclitaxel, docetaxel, SN-38, topotecan, lysoxine, echinomycin, colchicine, vinblastine, vindesine, estramustine , Semadotin, eluterobin, methotrexate, methotterin, dichloromethotrexate, 5-fluorouracil, 6-mercaptopurine, cytosine arabinoside, melphalan, leurosin, leurocidine, actinomycin, daunorubicin, daunorubicin conjugate, mitomycin C, mitomycin A, carminomycin, aminopterin, tarisomycin, podophyllotoxin, podophyllotoxin derivative, et Poshido, etoposide phosphate, vincristine, taxol, taxotere retinoic acid, butyric acid, N ⁸ - can be exemplified acetyl spermidine and camptothecin like, but is not limited thereto.

  The ADC in the present invention can be prepared by a known method by binding the chemotherapeutic agent and the antibody. The antibody and the chemotherapeutic agent may be directly bonded via a linking group or the like possessed by themselves, or may be indirectly bonded via a linker or other substance.

  Examples of the linking group when the chemotherapeutic agent is directly bonded include a disulfide bond using SH group and a bond via maleimide. For example, the intramolecular disulfide bond in the Fc region of the antibody and the disulfide bond of the drug are reduced, and both are bonded by a disulfide bond. There is also a method via maleimide. Another method is to introduce cysteine into the antibody by genetic engineering.

  It is also possible to bind the antibody and the chemotherapeutic agent indirectly through another substance (linker). The linker preferably has one or more functional groups that react with the antibody or the chemotherapeutic agent or both. Examples of functional groups include amino groups, carboxyl groups, mercapto groups, maleimide groups, pyridinyl groups, and the like.

  Examples of linkers include N-succinimidyl 4- (maleimidomethyl) cyclohexanecarboxylate (SMCC), N-succinimidyl-4- (N-maleimidomethyl) -cyclohexane-1-carboxy- (6-amidocaproate) (LC -SMCC), κ-maleimidoundecanoic acid N-succinimidyl ester (KMUA), γ-maleimidobutyric acid N-succinimidyl ester (GMBS), ε-maleimidocaproic acid N-hydroxysuccinimide ester (EMCS), m-maleimide Benzoyl-N-hydroxysuccinimide ester (MBS), N- (α-maleimidoacetoxy) -succinimide ester (AMAS), succinimidyl-6- (β-maleimidopropionamido) hexanoate (SMPH), N-succin Midyl 4- (p-maleimidophenyl) -butyrate (SMPB), and N- (p-maleimidophenyl) isocyanate (PMPI), 6-maleimidocaproyl (MC), maleimidopropanoyl (MP), p-aminobenzyloxy Carboxyl (PAB), N-succinimidyl 4 (2-pyridylthio) pentanoate (SPP) and N-succinimidyl (4-iodo-acetyl) aminobenzoate (SIAB), N-succinimidyl (4- (2-pyridylthio) butanoate (SPDB) and the like, but are not limited thereto, and this linker is, for example, a peptide linker such as valine-citrulline (Val-Cit), alanine-phenylalanine (ala-phe), Or use the linkers listed above in combination in a timely manner. You may do it.

  With regard to the method of binding a chemotherapeutic agent and an antibody, for example, Cancer Research; 68 (22) 9280 (2008), Nature Biotechnology; 26 (8) 925 (2008), Bio Conjugate Chemistry; 19, 1673 (2008), Cancer Research: 68 (15) 6300 (2008), or according to the method described in JP-T-2008-516896.

  As another embodiment of the present invention, a so-called immunotoxin in which a toxin (toxin) is chemically or genetically bound to an antibody can be mentioned.

  Examples of the toxin used in the present invention include diphtheria toxin A chain, Pseudomonas endotoxin, lysine chain; sugar-free ricin A chain Gelonin saporin and the like.

  Since the immune complex of the present invention exhibits high cytotoxic activity, it can be used as a cytotoxic agent. Furthermore, the antibody of the present invention can be used as a therapeutic agent for diseases with high CDH3 expression. The cytotoxic agent and therapeutic agent for a disease that highly expresses CDH3 of the present invention can injure cancer cells, for example, by contacting with cancer cells expressing cadherin. Human CDH3 high expression diseases include colorectal cancer, non-small cell lung cancer, breast cancer, head and neck cancer, ovarian cancer, lung cancer, invasive bladder cancer, pancreatic cancer, brain metastatic cancer, thyroid cancer, head and neck squamous cell carcinoma Esophageal squamous cell carcinoma, lung squamous cell carcinoma, skin squamous cell carcinoma, melanoma, breast cancer, lung adenocarcinoma, cervical squamous cell carcinoma, pancreatic squamous cell carcinoma, colon squamous cell carcinoma, or gastric squamous cell carcinoma, prostate cancer, Examples include osteosarcoma or soft tissue sarcoma.

  The immune complex of the present invention can be used as a pharmaceutical composition by appropriately combining pharmaceutically acceptable carriers, excipients, diluents and the like as necessary. The pharmaceutical composition of the present invention can be formulated, for example, as an injection. The dosage of the pharmaceutical composition of the present invention depends on the patient's symptom level, age and body weight, administration method, etc., and the weight of the antibody as the active ingredient is usually in the range of about 10 ng to about 100 mg / kg body weight. It is.

  The following examples further illustrate the present invention, but the present invention is not limited to the examples.

Example 1 Establishment of a CDH3-expressing CHO cell line In order to obtain a cell line for screening an anti-CDH3 antibody, a CHO cell expressing full-length CDH3 was established.
(1) Preparation of CDH3 gene expression vector In order to insert the full-length human CDH3 DNA shown in SEQ ID NO: 1 into the mammalian expression vector pEF4 / myc-HisB (Invitrogen), two types of restriction enzymes KpnI (Takara Bio) and XbaI (Takara) Biotechnology) at 37 ° C. for 1 hour, and then inserted into pEF4 / myc-HisB similarly treated with KpnI and XbaI using T4 DNA ligase (Promega) according to a conventional method, and the expression vector pEF4-CDH3-myc-His was inserted. Obtained.

(2) Acquisition of a stable expression strain of CDH3 According to the protocol of FuGENE (registered trademark) 6 transfection reagent (Roche Diagnostics), 8 × 10 ⁵ CHO cells were seeded in a 10 cm dish on the day before transfection. After overnight culture, 8 μg of the expression vector pEF4-CDH3-myc-His and 16 μL of FuGENE6 reagent were mixed in 400 μL of serum-free RPMI1640 medium (SIGMA-ALDRICH), left at room temperature for 15 minutes, added to the cell culture solution, Was performed. The day after transfection, cloning was performed by a limiting dilution method using a selection reagent (Zeocin (registered trademark)).

  Clone selection of CDH3 full-length expression CHO is performed by Western blotting using an anti-c-Myc monoclonal antibody (SANTA CRUZ BIOTECHNOLOGY). As a result, the CDH3 full-length expression CHO cell line with high expression and good growth ( EXZ1501) was obtained. FIG. 1 shows the measurement results of this cell line and a commercially available anti-CDH3 antibody (R & D SYSTEMS) using a flow cytometer.

Example 2 Production of Soluble CDH3 Antigen Soluble CDH3 (sCDH3) protein lacking the C-terminal transmembrane region was prepared for use as an immunogen for producing anti-CDH3 antibody.
(1) Preparation of soluble CDH3 antigen expression vector Forward designed to amplify a portion corresponding to CDH3 extracellular region (corresponding to 1-654 of SEQ ID NO: 2, hereinafter referred to as sCDH3 cDNA) using CDH3 full-length cDNA as a template A PCR reaction was carried out using a primer (SEQ ID NO: 3: CGCGGGTACCATGGGGCTCCCTCGT) and a reverse primer (SEQ ID NO: 4: CCGTCTAGATAAACCCCCTTCCAGGGTCC). The reaction was carried out using KOD-Plus (Toyobo Co., Ltd.) under the reaction conditions of 94 ° C.-15 seconds, 55 ° C.-30 seconds, 68 ° C.-90 seconds, 30 cycles.

 Thereafter, a gel fragment containing a target size band of about 2.0 kbp was cut out by agarose gel electrophoresis, and the target sCDH3 cDNA was obtained using a QIA (registered trademark) quick gel extraction kit (Qiagen).

 In order to insert this sCDH3 cDNA into the expression vector pEF4 / myc-HisB, it was treated with two types of restriction enzymes KpnI and XbaI, followed by pEF4 / myc-HisB similarly treated with KpnI and XbaI using T4 DNA ligase. The insertion was performed according to the method to obtain the expression vector pEF4-sCDH3-myc-His.

(2) Expression of soluble CDH3 protein According to the protocol of FuGENE6 transfection reagent, 8 × 10 ⁵ CHO cells were seeded on a 10 cm dish on the day before transfection, cultured overnight, and then 8 μg of expression vector pEF4-sCDH3. -Myc-His and 16 μL of FuGENE6 reagent were mixed in 400 μL of serum-free RPMI 1640 medium, left at room temperature for 15 minutes, and added to the cell culture medium for transfection. The day after transfection, cloning was performed by a limiting dilution method using a selection reagent (Zeocin).

Soluble CDH3-expressing CHO cells were selected by Western blotting using an anti-c-Myc monoclonal antibody (SANTA CRUZ BIOTECHNOLOGY). As a result of selecting a cell line with a large amount of secretion into the culture supernatant and good growth, a soluble CDH3-expressing CHO cell line (EXZ1702) was obtained. The selected soluble CDH3-expressing CHO cell line (EXZ1702) uses three roller bottles with a culture area of 1,500 cm ² and 333 mL of serum-free medium CHO-S-SFM-II (Invitrogen) per roller bottle. The culture supernatant was collected for 72 hours. The obtained culture supernatant is soluble by affinity chromatography using a HisTrap (registered trademark) HP column (GE Healthcare Bioscience) and gel filtration chromatography using a Superdex (registered trademark) 200 pg column (GE Healthcare Bioscience). Type CDH3 protein was obtained.

Example 3 Preparation of anti-CDH3 monoclonal antibody (1) Preparation of monoclonal antibody using soluble CDH3 protein as immunogen 50 μg of soluble CDH3 protein dissolved in physiological saline and Titer-MAX Gold (registered trademark) (Titer Max) was mixed in an equal amount, and MRL / lpr mice (Japan SLC Co., Ltd.) were injected intraperitoneally and subcutaneously to perform initial immunization. The second and subsequent immunizations were performed by mixing the soluble CDH3 protein equivalent to the amount of 25 μg protein and Titer-MAX Gold prepared in the same manner and injecting them intraperitoneally and subcutaneously. Three days after the final immunization, spleen cells were aseptically prepared from the mice, and cell fusion with mouse myeloma cells SP2 / O-Ag14 or P3-X63-Ag8.653 was performed by the polyethylene glycol method according to a conventional method.

(2) Selection of anti-CDH3 antibody-producing hybridoma Anti-CDH3 antibody was selected by flow cytometry using a CHO cell line (EXZ1501) that expresses full-length CDH3.

That is, a CHO cell line (EXZ1501) expressing full-length CDH3 was treated with 2 mM EDTA-PBS, peeled from the culture plate, and then suspended in a FACS solution so as to be 1 × 10 ⁶ cells / mL. This cell suspension was seeded in a 96-well plate at 50 μL / well, the hybridoma culture supernatant was added, reacted at 4 ° C. for 60 minutes, washed twice with FACS solution (200 μL / well), and then AlexaFluor 488. Labeled anti-mouse IgG • goat F (ab ′) ₂ (Invitrogen) was added and reacted at 4 ° C. for 30 minutes. Thereafter, the cells were washed twice with a FACS solution, followed by flow cytometry, and hybridomas that were found to react with CDH3-expressing CHO cells were selected.

  Typical antibodies obtained from the hybridoma and CDH3-expressing CHO cells (EXZ1501), the parental CHO cells, and the human bronchioloalveolar carcinoma cell line NCI-H358 that has been confirmed to be highly expressed The reaction results are shown in FIG. It was confirmed that all the selected hybridomas reacted with CDH3-expressing CHO cells (EXZ1501) and NCI-H358, but not with CHO cells.

Example 4 Expression of CDH3 mRNA in Normal Tissue and Cancer Tissue Total RNA was prepared from normal human tissue and various cancer tissues from a sample collected by laser microdissection (Laser Capture Microdetection) using ISOGEN (Nippon Gene) according to a standard method. did. Gene expression of each 10 ng of RNA was analyzed using GeneChip U-133B (Affymetrix) according to Expression Analysis Technical Manual (Affymetrix). When an average expression score of all genes was set to 100 and a gene whose expression is enhanced in cancer cells was searched for, CDH3 expression was limited in normal human tissues, and expression was high in lung cancer, colon cancer and pancreatic cancer (Fig. 3A, B). Further, when the expression of CDH3 mRNA in pancreatic cancer tissues having different degrees of differentiation was examined, tissues with high expression were recognized regardless of the degree of differentiation (FIG. 3C).

Example 5 Expression of CDH3 protein in cancer tissue by immunohistochemical staining In order to confirm the expression of CDH3 protein in cancer clinical specimens, immunostaining was performed on a cancer specimen tissue array.
The cancer cell tissue array is manufactured by Shanghai Outdo Biotech Co., Ltd., pancreatic cancer (adenocarcinoma), lung cancer (adenocarcinoma), lung cancer (squamous cell carcinoma) and colon cancer (glandular gland). Cancer).

Each tissue array slide was deparaffinized and activated with 10 mM Tris 1 mM EDTA (pH 9.0) at 95 ° C. for 40 minutes. After inactivation of endogenous peroxidase using a blocking reagent attached to ENVISION + Kit (Dako), anti-CDH3 antibody 610227 (BD BIOSCIENCE) and anti-HBs antibody Hyb-3423 as a negative control at a concentration of 5 μg / mL The reaction was allowed to proceed overnight at 4 ° C. After washing off the antibody solution, it was reacted with the polymer secondary antibody reagent attached to ENVISION + Kit for 30 minutes at room temperature. Color was developed with a color reagent attached to ENVISION + Kit, and nuclear staining was performed with a hematoxylin-eosin solution.
The results are shown in FIG. Cancer cells were stained with anti-CDH3 antibody and normal cells were not stained.

Example 6 Purification of RNA from Hybridoma From mouse hybridoma cells producing CDH3 antibody, RNA present in the cytoplasm was isolated from Gough, Rapid and quantitative preparation of cytoplasmic RNA from small numbers of cells, Analytical Biochemisty, 173, p93-95 (1988). ) (But instead of the lysis buffer described in this article, another TNE buffer 25 mM Tris-HCl, pH 7.5; 1% NP-40; 150 mM NaCl; 1 mM EDTA) , pH 8.0 was used). As a specific operation method, 5 × 10e6 hybridoma cells were suspended in 0.2 mL of TNE buffer to dissolve the cell membrane, and then cell nuclei were removed by centrifugation. About 0.2 mL of cytoplasmic supernatant obtained was added 0.2 mL of extraction buffer (10 mM Tris-HCl, pH 7.5; 0.35 M NaCl; 1% (w / v) SDS; 10 mM EDTA, pH 8.0; 7 M urea) was added. This mixture was extracted with phenol and chloroform, and glycogen (Roche, Cat No. 901393) was added to the obtained RNA solution as a carrier, followed by precipitation with ethanol. Next, the RNA precipitate was dissolved by adding 10-50 microliters of sterile distilled water so that the cytoplasmic RNA concentration was 0.5-2 microgram / microliter.

Example 7 Preparation of cDNA library from RNA prepared from hybridoma In order to synthesize single-stranded cDNA, 0.5 to 3 micrograms of cytoplasmic RNA prepared as described above was added to 50 mM Tris-HCl, pH 8.3. Prepare a 20 microliter reaction mixture containing 75 mM KCl; 3 mM MgCl ₂ ; 10 mM DTT, 100 nanogram random primer, 0.5 mM dNTP, 200 units Superscript II (reverse transcriptase, Invitrogen); Incubated at 42 ° C for 50 minutes. The cDNA library thus synthesized was directly used as a template for the polymerase chain reaction (PCR) method.

Example 8 Amplification of Gene Encoding Anti-CDH3 Antibody Variable Region by PCR Method All primers used in the experiment were synthesized by Hokkaido System Science Co., Ltd.
A. A primer used for amplifying a gene encoding the variable region of the mouse light chain by PCR. A DNA primer having homology with the FR1 portion at the 5 ′ end and a homology with the J chain gene in the mouse L chain at the 3 ′ end Two types of primer set (1) having a chain, or a primer set (2) having homology with the L chain signal portion (7 set primer) at the 5 ′ end and the KC portion (KVL antisense primer) at the 3 ′ end The mouse immunoglobulin light chain variable region DNA was isolated from the cDNA by polymerase chain reaction using the primer set. The primer sequences were as follows:

(1) Mouse L chain variable region cloning 4 set sense primer “Page Display-A Laboratory Manual-, Barbars Burton Scott Silverman” 17 species of Prime Primer using Reverse 9.5 with reference to PROTOCOL 9.5 and Reverse Primer system .

VK sense (FR1 portion) A mixture of the following 17 primers was used as a VK sense primer.
5′-GAYATCCAGCTGACTCAGCC-3 ′ (degeneracy 2): SEQ ID NO: 5
5′-GAYATTGTTCTCWCCCAGTC-3 ′ (degeneracy 4): SEQ ID NO: 6
5′-GAYATTGTGMTMACTCAGTC-3 ′ (degree of degeneracy 8): SEQ ID NO: 7
5′-GAYATTTGTGYTRACACAGTC-3 ′ (degeneracy 8): SEQ ID NO: 8
5′-GAYATTGTRATGACMCAGTC-3 ′ (degree of degeneracy 8): SEQ ID NO: 9
5′-GAYATTTMAGATRAMCCAGTC-3 ′ (degree of degeneracy 16): SEQ ID NO: 10
5′-GAYATTCAGATGAYDCAGTC-3 ′ (degeneracy 12): SEQ ID NO: 11
5′-GAYATYCAGATGACACAGAC-3 ′ (degree of degeneracy 4): SEQ ID NO: 12
5′-GAYATTGTTTCTCAWCCAGTC-3 ′ (degree of degeneracy 4): SEQ ID NO: 13
5′-GAYATTGWCGSTACCAATC-3 ′ (degree of degeneracy 8): SEQ ID NO: 14
5′-GAYATTSTRATGACCCARTC-3 ′ (degeneracy 16): SEQ ID NO: 15
5'-GAYRTTTGATGACCCARAC-3 '(degeneracy 16): SEQ ID NO: 16
5′-GAYATTGTGATGACBCAGKC-3 ′ (degeneracy 12): SEQ ID NO: 17
5′-GAYATTGTGATAACYCAGGA-3 ′ (degree of degeneracy 4): SEQ ID NO: 18
5′-GAYATTGTGATGACCCCAGWT-3 ′ (degree of degeneracy 4): SEQ ID NO: 19
5′-GAYATTGTGATGACACAACC-3 ′ (degree of degeneracy 2): SEQ ID NO: 20
5′-GAYATTTTGCTGACTCAGTC-3 ′ (degeneracy 2): SEQ ID NO: 21

J antisense (4 sets primer)
J1 / J2 antisense primer (1)
5′-GGSACCAARCTGGAAATMAA-3 ′ (degeneracy: 8): SEQ ID NO: 22
J4 antisense primer (2)
5′-GGGACAAAGTTGGGAAATAAA-3 ′: SEQ ID NO: 23
J5 antisense primer (3)
5′-GGGACCAAGCTGGAGCTGAAA-3 ′: SEQ ID NO: 24
J1 / J2, J4, J5 antisense primer mixture (4)

(2) Mouse L chain variable region cloning 7 set primer VK sense (signal peptide part)
The base sequence of this primer was modified to remove the restriction enzyme site based on Novagen mouse Ig-primer set (Novagen; Merck, Cat. No. 69831-3).

A set sense primer 5′-ATGRAGWCACAKWCYCYGGGTCTTT-3 ′: SEQ ID NO: 25
B set sense primer 5′-ATGGAGACAGACACACTCCCTGCTAT-3 ′: SEQ ID NO: 26
C set sense primer 5′-ATGGAGWCAGACACACTSCTGYTATGGGGT-3 ′: SEQ ID NO: 27
D Set Sense Primer (Use a mixture of the following two types of primers)
5′-ATGAGRGCCCCTGCTCCAGWTTTYTTGIGITCTT-3 ′: SEQ ID NO: 28
5′-ATGGGCWTCAAGATGRAGTCACAKWYYCWGG-3 ′: SEQ ID NO: 29
E Set Sense Primer (Use a mixture of the following 3 types of primers)
5′-ATGAGTTGCYCYCACTCAGGTCCTGGSGTT-3 ′: SEQ ID NO: 30
5′-ATGTGGGGGAYCGKTTTYAMMCTTTCAATTG-3 ′: SEQ ID NO: 31
5′-ATGGAAGCCCCAGCTCAGCTCTCTCTCC-3 ′: SEQ ID NO: 32
F set sense primer (use the following 4 types of primer mixture)
5′-ATGAGIMMKTCIMTCAITTCYTGGG-3 ′: SEQ ID NO: 33
5′-ATGAKGTHCYCIGCTCAGYTYCTIRG-3 ′: SEQ ID NO: 34
5′-ATGGTRTCCWCASTCCAGTTCCTTG-3 ′: SEQ ID NO: 35
5′-ATGTATATAGTTTTGTTGTCTATTTTCT-3 ′: SEQ ID NO: 36
G set sense primer (use the following 4 types of primer mixture)
5′-ATGAAGTTGCCCGTTAGGCTGTTGGTGCT-3 ′: SEQ ID NO: 37
5′-ATGGATTTWCARGTGGCAGATTTWCAGCTT-3 ′: SEQ ID NO: 38
5′-ATGGTYCTYATVTCCCTGCTGTTCTGG-3 ′: SEQ ID NO: 39
5′-ATGGTYCTYATVTTRCTGCTGCTCATGG-3 ′: SEQ ID NO: 40
KVL antisense primer 5′-ACTGGATGGTGGGGAAGATGGA-3 ′: SEQ ID NO: 41

B. Primer used to amplify the gene encoding mouse H chain V region by PCR method. Primer having homology with mouse H chain signal part (4 sets primer) at 5 'end and homology with KC part at 3' end Polymerase chain reaction using a primer having a homology with the FR1 portion at the 5 ′ end and two primer sets having a homology with the mouse H chain constant region (IGHC) at the 3 ′ end Thus, mouse immunoglobulin heavy chain variable region DNA was isolated from the cDNA. The primer sequences were as follows:

(3) Mouse H chain variable region cloning primer VH sense (signal part: 4 set primers)
This primer was obtained from Table 2.1 of Current Protocols in Immunology (John Wiley and Sons, Inc.), Unit 2.12 Cloning, Expression, and Modification of Antibody V Regions.
5′-ATGGRATGSAGCTGKGTMATSCTCTT-3 ′ (degeneracy: 32): SEQ ID NO: 42
5′-ATGRACTTCGGGGYTGAGCTKGGTTTTT-3 ′ (degeneracy: 8): SEQ ID NO: 43
5′-ATGGCTGTCTTGGGGCTGCTCTTTCT-3 ′: SEQ ID NO: 44
5′-ATGGRCACGRCCTTACWTYY-3 ′ (degeneracy: 32): SEQ ID NO: 45

(4) Mouse H chain variable region cloning primer VH sense (FR1 part)
Tan et al., “Superhumanized” Antibodies: Reduction of Immunogenic Potential by Complementarity-Determining Region Grafting with Human Germline Sequences: Application to an Anti-CD281, Journal of Immunology 169 (2002) p1119-1125 Modified and designed.
5′-SAGGTSMARKTCSAGAGSAGTCWGG-3 ′ (Degeneracy: 256): SEQ ID NO: 46
VH antisense (antisense primer common to 3 and 4)
The nucleotide sequence was designed to be degenerate so that it could be annealed with all mouse IgG isoforms.
5′-CASCCCCCATCDGTCTATCC-3 ′ (degeneracy: 6): SEQ ID NO: 47

Example 9 Production of Transient Expression Vector of Chimeric Anti-CDH3 Immunoglobulin Production of Expression Plasmid: Anti-CDH3 mouse monoclonal antibody L chain, H by PCR using DNA Engineer (Peltier Thermal Cycler, MJ Research, Bio-Rad) The variable region of each strand was amplified using the primers shown in Example 8. The amplified DNA fragment was incorporated into a subcloning vector pGEM (Promega), and the nucleotide sequence was determined using T7 and SP6 universal primers of this vector.

  Table 1 shows the sequences obtained by converting the portion corresponding to the CDR out of the base sequences determined at that time into amino acids.

  Search the light chain and light chain variable region sequences of the chimeric anti-CDH3 antibody using IMGT / V-QUEST Search page (http://img.cines.fr/IMGT_vquest/vquest?libret=0 & Option = mouseIg) It was confirmed that the antibody gene could be cloned. Next, the genes encoding the V regions of the L chain and H chain of the cloned anti-CDH3 antibody are the genes encoding the human Ck region for the chimeric L chain expression vector and human Cg1 for the chimeric H chain expression vector. Genes connecting the genes encoding the regions were designed, and these L-chain and H-chain chimeric antibody genes were artificially synthesized in full length by GenScript. In that case, optimization of codon usage was made so that gene expression in CHO producing cells was advantageous (Kim et al., Codon optimization for high-level expression of human erythropoietin (EPO) in mammalian cells, 99, Gene 3, Gene 3 301). Specifically, in the case of the L chain, a DNA sequence essential for efficient translation (Kozak, M., J., At least six nucleotides preceding the AU initiator codon enhancement translation in Mammalian cell. 196, p947-950, 1987), signal peptide of mouse IGKV (k chain variable region) gene, V region of L chain of anti-CDH3 antibody, human KC (k chain constant region) in this order, and both ends thereof A restriction enzyme site (NheI on the 5 ′ side and EcoRI on the 3 ′ side) was added. A chimeric H chain was prepared in the same manner. These artificially synthesized genes were cleaved with NheI and EcoRI and incorporated into the NheI and EcoRI sites of the expression vector pCAGGS to obtain anti-CDH3 chimeric antibody L chain expression vector pCAGGS-IGK, and heavy chain expression vector pCAGGS-IGH.

Example 10 Production of Stable Expression Vector of Chimeric Anti-CDH3 Immunoglobulin Dihydrofolate with poly A signal linked to CMV promoter sequence for high-level expression of engineered antibody gene using CHO cells An expression vector incorporating the reductase (dhfr) gene was prepared.
In order to produce a cell line capable of stably expressing a chimeric antibody, a pCAGGS expression vector incorporating the dhfr gene was prepared. Specifically, a dhfr gene having a CMV promoter and a poly A signal is incorporated into the transient expression vectors pCAGGS-IGH and pCAGGS-IGK. A CMV promoter, a mouse dhfr gene having a Kozak sequence, and an SV40 polyA signal are each amplified by the PCR method, a mixture of these genes is connected by the PCR method, and HindIII sites are added to both ends to form a HindIII-CMV promoter-Kozak A gene fragment called -dhfr-polyA-HindIII was obtained. This fragment was incorporated into the HindIII site of pCAGGS-IGH or pCAGGS-IGK to obtain pCAGGS-IGH-CMVp-dhfr-A and pCAGGS-IGK-CMVp-dhfr-A. These expression vectors were able to express the chimeric antibody with the CAG promoter and the dhfr gene with the CMV promoter, and could efficiently produce the chimeric antibody using gene amplification.

Example 11 Establishment of chimeric anti-CDH3 producing CHO cell line CHO dhfr (-) cells (G. Urlaub et al., Isolation of Chinese hamster cell mutants deficient in dihydrofolate reductase activity, Proc. Natl. Acad. Sci. USA 77, p4216-4220 , 1980), pCAGGS-IGK-CMV- for expressing a chimeric anti-CDH3 light chain, that is, the plasmid was cut from PvuI in the ampicillin resistance gene into a linear plasmid from the circular plasmid. Cotransformed with the dhfr-A vector and the pCAGGS-IGH-CMV-dhfr-A vector to express the chimeric anti-CDH3 heavy chain. Electroporation was performed with Amaxa manufactured by Lonza. DNA (0.002 mg / sample for each L chain and H chain plasmid) was added to 3 × 10e3 cells in 0.1 mL Amaxa electroporation CHO buffer and pulsed.

  Electroporated cells were added to Iscove's Modified Dulbecco medium (IMDM) containing 10% dialyzed FBS and without HT (H, hypoxanthine: T, thymidine). Three days after gene transfer, medium was changed to IMDM containing 10% dialyzed FBS, 2 mM L-glutamine, and HT, and neo + transformed cells were selected with 1 mg / mL G418, and a chimeric antibody-producing positive cell line clone Got. Next, gene amplification was performed using clones selected with G418. After amplification in two rounds of 0.25 mM, 1 mM methotrexate (MTX), a cell line producing about 50-100 mg of chimeric CDH3 antibody per liter could be established.

Example 12 Quantification of Chimeric Antibody by Enzyme Immunoassay (ELISA) The culture supernatant of a gene-introduced CHO cell was measured by ELISA to confirm that a chimeric antibody was produced. To detect the chimeric antibody, the plates were coated with goat anti-human IgG (H + L) (absorbed against mouse, rabbit, bovine, mouse IgG) (Cosmo Bio: AQI, Cat A-110UD). After blocking, the culture supernatant from anti-CDH3 chimeric antibody-producing CHO cells was serially diluted and added to each well. After incubation and washing of the plate, goat anti-human IgG (H + L) (absorbed for mouse, rabbit, bovine, mouse IgG) -HRP (Cosmo Bio: AQI, Cat. A-110PD) was added. Subsequent to incubation and washing, substrate buffer was added. After further incubation, the reaction was stopped and the absorbance at 450 nm was measured. Purified human IgG was used as a standard.

Example 13 Binding activity of chimeric antibody Antibodies having the CDR sequences of the combinations shown in Table 2 were prepared by the methods shown in Examples 10 and 11, and the binding activity was evaluated by flow cytometry.

Each cell line to be reacted (CHO cell, CDH3 forced expression CHO cell and NCI-H358 cell line in which high expression of CDH3 is confirmed) was treated with 2 mM EDTA-PBS, and then detached from the culture plate. It suspended in the FACS solution so that it might become 10 < ⁶ > piece / mL. This cell suspension was seeded in a 96-well plate at 50 μL / well, the purified chimeric antibody was added at 10 ug / mL, and reacted at 4 ° C. for 60 minutes. After washing twice with FACS solution (150 μL / well), 4 μg / ml of AlexaFluor 488-labeled anti-human IgG • goat F (ab ′) ₂ (Invitrogen) was added and reacted at 4 ° C. for 30 minutes. Then, after washing twice with the FACS solution, flow cytometry was performed. As a result, strong reactivity of the chimeric antibody to the CDH3-expressing cell line was observed (FIG. 5).

  CDR-H1, H2 and H3 represent the respective antibody H chains, and CDR-L1, L2 and L3 represent the CDR sequences constituting the respective antibody L chains.

Example 14 Drug Synthesis DM1SMe (Figure 6) was prepared as previously described in US Patent Nos. 5,208,020 and 6,333,410B1.

Example 15 Preparation of drug-bound antibody Reduction treatment of binding agent 0.78 mg of DM1SMe dissolved in 300 uL of EtOH, 180 uL of 50 mM potassium phosphate buffer (pH 7.5), 20 uL of TCEP Solution (Bond Breaker, Thermo Fisher Scientific) were mixed, and under a nitrogen atmosphere, The reaction was carried out at room temperature for 30 minutes or more to reduce the drug.
The reducing agent was purified using HPLC, and then the solvent was distilled off and dissolved in dimethylacetamide so as to be 10 mg / mL.

2. Preparation of maleimidated antibody Sulfo-SMCC (PIERCE) in an amount of 30-fold molar ratio was added to 1 mg / mL anti-CDH3 chimeric antibody and reacted at 30 ° C. for 1 hour.
In order to remove excess crosslinking agent, desalting treatment (ZebaSpinColumn, Thermo Fisher Scientific) was performed using a desalting column equilibrated with 50 mM potassium phosphate, 50 mM NaCl, 2 mM EDTA (pH 6.5).

3. Modification of antibody with drug 1 mg / mL of maleimidated anti-CDH3 chimeric antibody and reducing drug equivalent to 1.7 times the number of bound maleimide groups in 50 mM potassium phosphate, 50 mM NaCl, 2 mM EDTA (pH 6.5) And allowed to react overnight at room temperature. Thereafter, excess drug was removed by gel filtration.

Example 16 Quantification of antibody drug binding amount The number of drug bonds per antibody was determined by measuring absorbance at 252 nm and 280 nm. The determination method is described in non-patent literature (Widdison, WC, Wilhelm, SD, Cavanagh, EE, et al. (2006) Semisynthetic maytansine analogues for the targeted treatment of cancer. J. Med. Chem., 49, 4392-4408). The extinction coefficients εAb ₂₈₀ = 223,000 M ⁻¹ cm ⁻¹ , εAb ₂₅₂ = 82,510 M ⁻¹ cm ⁻¹ , εDM1 ₂₈₀ = 5,180 M ⁻¹ cm ⁻¹ , εDM1 ₂₅₂ = 26,160 M ⁻¹ cm ⁻¹ were used.

Example 17 Cytotoxicity Test The cytotoxicity and specificity of drug-bound antibodies were evaluated using a cell proliferation assay reagent (Dojindo Laboratories, Cell counting assay kit-8) using WST-8 as a chromogenic substrate.
That is, human breast cancer cell line HCC1954 confirmed to have high expression of CDH3 and drug-bound antibody (ADC) or antibody not bound (Naked) in an arbitrary amount coexisted at 37 degrees for 3 days, Incubated in a 5% CO ₂ environment. Thereafter, the absorbance of A450 / 620 was measured after adding the cell proliferation measurement reagent and allowed to stand, and the relative value when the absorbance value obtained from the well in which only the cancer cell line was not added with the antibody was taken as 100% was used as the cell viability. Expressed as a rate (Figure 7). Antibody No. 067-17C was used as the antibody used in the figure, and for ADC, the number of drugs introduced per antibody was calculated by the method described in Example 16. As a result, 4.05 per antibody molecule was calculated. It was estimated that one drug was introduced.

Example 18 Cytotoxicity test (comparison for each antibody)
The cytotoxicity of the drug-bound antibody was evaluated using the obtained plurality of anti-CDH3 antibodies.
The measurement was in accordance with the method described in Example 17. That is, human breast cancer cell line HCC1954 and drug-binding antibody (ADC) were allowed to coexist and incubated at 37 ° C. for 3 days in a 5% CO ₂ environment. The ADC concentration at that time was 0.01 ug / mL. Thereafter, the absorbance of A450 / 620 was measured after adding the cell proliferation measurement reagent and allowed to stand, and the relative value when the absorbance value obtained from the well in which only the cancer cell line was not added with the antibody was taken as 100% was used as the cell viability. Expressed as a rate. The number of drugs per molecule of each antibody antibody was estimated by the method described in Example 16 (Table 3).
As the negative control antibody, an antibody that was confirmed not to react with HCC1954 was used.

Example 19 Animal Test The in vivo tumor reduction effect of the drug-bound antibody was confirmed in a xenograft model transplanted with the breast cancer cell line HCC1954. Administration was performed by dissolving anti-asialo GM1 antibody (WAKO 014-09801) in 1 mL of Otsuka distilled water, adding 4 mL of Otsuka saline to a total volume of 5 mL, and then intraperitoneally administering this solution per mouse. HCC1954 was cultured using 10% FBS-containing RPMI1640 medium, and transplanted to 5 × 10 ⁶ mice / mouse subcutaneously on the right flank of SCID mice (female, CLEA Japan).

The in vivo test was 5 animals in each group, and 15 mg / kg was administered from the tail vein. Administration was started when the average tumor diameter reached 100-150 mm3, and one week later, the same amount was further administered twice in total.
As the antibodies used in the figure, antibody numbers 067-12C, 067-23C and 067-27C were used, and for ADC, the number of drugs introduced per antibody was calculated by the method described in Example 16. It was estimated that 3-4 drugs were introduced per molecule.
The change in tumor size is shown in FIG.

Claims (41)

An immune complex comprising an antibody against CDH3 or a fragment thereof capable of binding CDH3 and a chemotherapeutic agent. 2. The immune complex according to claim 1, wherein the antibody against CDH3 or a fragment thereof having CDH3 binding ability exhibits cytotoxicity against cells expressing CDH3. The immune complex according to claim 1 or 2, wherein the antibody against CDH3 is an antibody produced by an antibody-producing cell obtained from an immune cell administered with CDH3 or a cell expressing CDH3 as an immunogen. The immune complex according to any one of claims 1 to 3, wherein the antibody is a monoclonal antibody. The immune complex according to any one of claims 1 to 4, wherein the antibody is chimerized. The immune complex according to any one of claims 1 to 4, wherein the antibody is humanized. The immune complex according to any one of claims 1 to 4, wherein the antibody is a human antibody. The antibody according to claim 1 or 2, wherein the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 48, 56, and 65 in the H chain, and the amino acid sequence set forth in SEQ ID NOs: 75, 82, and 86 in the L chain. Immune complex. 3. The antibody according to claim 1, wherein the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 52, 60, and 70 in the H chain, and the amino acid sequence set forth in SEQ ID NOs: 75, 82, and 91 in the L chain. Immune complex. The antibody according to claim 1 or 2, wherein the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 54, 62, and 72 in the H chain, and the amino acid sequence set forth in SEQ ID NOs: 74, 81, and 93 in the L chain. Immune complex. The antibody according to claim 1 or 2, wherein the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 55, 63, and 73 in the H chain, and the amino acid sequence set forth in SEQ ID NOs: 80, 85, and 94 in the L chain. Immune complex. The antibody according to claim 1 or 2, wherein the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 49, 64, and 66 in the H chain, and the amino acid sequence set forth in SEQ ID NOs: 76, 84, and 89 in the L chain. Immune complex. The antibody according to claim 1 or 2, wherein the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 49, 58, and 68 in the H chain, and the amino acid sequence set forth in SEQ ID NOs: 79, 82, and 90 in the L chain. Immune complex. The antibody according to claim 1 or 2, wherein the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 53, 61, and 71 in the H chain, and the amino acid sequence set forth in SEQ ID NOs: 75, 82, and 92 in the L chain. Immune complex. The antibody according to claim 1 or 2, wherein the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 51, 57, and 67 in the H chain, and the amino acid sequence set forth in SEQ ID NOs: 78, 83, and 88 in the L chain. Immune complex. The antibody according to claim 1 or 2, wherein the antibody comprises the amino acid sequence set forth in SEQ ID NOs: 50, 59, and 69 in the H chain, and the amino acid sequence set forth in SEQ ID NOs: 77, 83, and 87 in the L chain. Immune complex. The antibody according to any one of claims 1 to 2, wherein the antibody has an H chain consisting of an amino acid sequence having at least 90% sequence identity with the amino acid sequence of the H chain of the antibody according to any one of claims 8 to 16. Immune complex. The immune complex according to any one of claims 1 to 3, wherein CDH3 is mammalian CDH3. 4. The immune complex according to any one of claims 1 to 3, wherein CDH3 is selected from primate CDH3. 4. The immune complex according to any one of claims 1 to 3, wherein CDH3 is selected from human CDH3. The immune complex according to any one of claims 1 to 3, wherein CDH3 is CDH3 expressed on the surface of a cell. The immune complex according to any one of claims 1 to 21, wherein the antibody fragment having CDH3 binding ability is Fab, F (ab ') ² or scFv. The immune complex according to any one of claims 1 to 22, wherein the chemotherapeutic agent is a cytotoxic substance. 24. The immune complex according to claim 23, wherein the cytotoxic substance is selected from maytansinoids and derivatives thereof. 24. The immune complex of claim 23, wherein the cytotoxic agent is selected from auristatin and its derivatives. The immune complex according to claim 24, wherein the maytansinoid and its derivative are selected from DM1, DM3, DM4. 26. The immune complex according to claim 25, wherein the auristatin and its derivatives are selected from MMAE or MMAF. 24. The immune complex according to claim 23, wherein the cytotoxic agent is DM1. 29. The immune complex according to claim 28, wherein 1 to 10 DM1 are bound per molecule of an antibody against CDH3 or a fragment thereof capable of binding to CDH3. 29. The immune complex according to claim 28, wherein 3 to 8 DM1 are bound per molecule of an antibody against CDH3 or a fragment thereof having CDH3 binding ability. The immune complex according to any one of claims 1 to 30, wherein the antibody against CDH3 or a fragment thereof having CDH3 binding ability and the chemotherapeutic agent are bound via a linker. The immune complex according to any one of claims 1 to 30, wherein the binding of the antibody against CDH3 or a fragment thereof having CDH3 binding ability and the chemotherapeutic agent is via an intramolecular disulfide bond in the Fc region of the antibody. . 31. The binding of an antibody against CDH3 or a fragment thereof having CDH3 binding ability and a chemotherapeutic agent is obtained by modifying the Fc region of the antibody by genetic engineering. Immune complex. 32. The immune complex according to claim 31, wherein the linker that binds an antibody against CDH3 or a fragment thereof having CDH3 binding ability and a chemotherapeutic agent is a bivalent reactive crosslinking reagent. The linker is N-succinimidyl 4- (maleimidomethyl) cyclohexanecarboxylate (SMCC), N-succinimidyl-4- (N-maleimidomethyl) -cyclohexane-1-carboxy- (6-amidocaproate) (LC-SMCC) ), Κ-maleimidoundecanoic acid N-succinimidyl ester (KMUA), γ-maleimidobutyric acid N-succinimidyl ester (GMBS), ε-maleimidocaproic acid N-hydroxysuccinimide ester (EMCS), m-maleimidobenzoyl- N-hydroxysuccinimide ester (MBS), N- (α-maleimidoacetoxy) -succinimide ester (AMAS), succinimidyl-6- (β-maleimidopropionamido) hexanoate (SMPH), N-succinimid 4- (p-maleimidophenyl) -butyrate (SMPB), and N- (p-maleimidophenyl) isocyanate (PMPI), 6-maleimidocaproyl (MC), maleimidopropanoyl (MP), p-aminobenzyloxycarbon Yl (PAB), N-succinimidyl 4 (2-pyridylthio) pentanoate (SPP) and N-succinimidyl (4-iodo-acetyl) aminobenzoate (SIAB), N-succinimidyl (4- (2-pyridylthio) butanoate ( 32. The immune complex of claim 31, wherein the immune complex is selected from the group consisting of SPDB). 32. The immune complex of claim 31, wherein the linker is cleaved by a protease. 32. The immune complex of claim 31, wherein the linker comprises val-cit. 32. The immune complex of claim 31, wherein the linker comprises PABA. 39. A pharmaceutical composition comprising an immune complex according to any one of claims 1 to 38 for treating a cancer characterized by overexpression of CDH3. 40. The pharmaceutical composition according to claim 39, which has an anticancer effect. The cancer is colorectal cancer, non-small cell lung cancer, breast cancer, head and neck cancer, ovarian cancer, lung cancer, invasive bladder cancer, pancreatic cancer, brain metastatic cancer, thyroid cancer, head and neck squamous cell carcinoma, esophageal squamous cell carcinoma Cancer, lung squamous cell carcinoma, skin squamous cell carcinoma, melanoma, breast cancer, lung adenocarcinoma, cervical squamous cell carcinoma, pancreatic squamous cell carcinoma, colon squamous cell carcinoma, or gastric squamous cell carcinoma, prostate cancer, osteosarcoma or soft tissue 41. A pharmaceutical composition according to claim 39 or 40, selected from sarcomas.