JPWO2008059711A1 - Vector for analyzing promoter activity of higher plant and method for using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED To develop a knock-in method by homologous recombination for qualitatively and quantitatively analyzing a promoter in a higher plant. [MEANS FOR SOLVING PROBLEMS] The present invention is a vector for analyzing promoter activity of a higher plant, comprising the following elements from RB in the following order between RB and LB derived from T-DNA. (1) A first negative selection marker gene which is present so as to be expressed (2) A first homologous recombination region (3) comprising a base sequence of 500 to 6000 bp including the 3 ′ end of the target promoter in the host genome Reporter gene whose start codon is separated from the 3 ′ end of the promoter by a desired distance (4) Positive selectable marker gene that can be expressed (5) Following the first homologous recombination region in the host genome A second homologous recombination region (6) consisting of a 6000 bp nucleotide sequence (6) A second negative selection marker gene which may be the same as the first negative selection marker gene, which can be expressed and extracted using this vector By searching for promoters that are highly expressed in tissues that are easily accessible, useful protein genes and genes related to production of useful substances Connect, it is such that the mass production of useful proteins. [Selection figure] None

Description

  The present invention relates to a method for analyzing an endogenous promoter activity at an arbitrary position on a genome in a higher plant, a method for producing a genome-modified plant using an endogenous promoter, and a vector used therefor.

Conventionally, in order to observe and quantify promoter activity, a reporter gene such as a GUS (β-glucuronidase) gene is connected to a DNA fragment containing the promoter, and (1) an introduction method via T-DNA of Agrobacterium, (2) Incorporation into the genome of a higher plant by direct introduction methods such as PEG, electroporation, particle bombardment (or biolistic), etc. than when only one copy of the transgene is randomly inserted into the genome In many cases, transgenes that have undergone DNA rearrangement to form forward repeats or inverted repeats are inserted at random positions in the same site or multiple sites on a multi-copy genome, resulting in epigenetic Gene silencing (gene silencing) occurs, so the introduced promoter activity can be It fluctuates greatly for each transgenic plant (Non-patent Document 1).
Furthermore, when only one copy is inserted, the difference between the transgenic plants is relatively small, but a difference of about 2 to 4 times is observed due to the position effect due to the difference in the insertion site, and about 10% less transgenic. It has also been observed in plants where expression is reduced to 20-fold or less.
To solve this problem, site-specific recombination systems (eg Cre / lox system etc.) are used to introduce at a predetermined site on the genome to minimize differences between transgenic plants. In addition to the case where (1) only one copy is inserted, (2) when multiple copies are inserted, (3) one copy or multiple copies cause DNA rearrangement at the insertion site. (4) Gene silencing of the inserted gene due to multiple copies was also observed (Non-patent Document 2). When only one copy of (1) was inserted, approximately Since it is about 1/3 to 1/2, the above problem is improved to some extent by selecting them.

However, the reporter gene cannot be introduced at the original position of the gene, and it is impossible to observe and quantify the activity of the original promoter under natural conditions. In addition, in order to avoid silencing of the transgene and to make the transgene highly expressed, a gene silencing variant is used and a sequence of a nuclear matrix binding region (MA) is attached to both sides of the transgene. Although a method to increase the expression of the transgene has been proposed, it is unsuitable for promoter analysis because it uses mutations.
In addition to the above problems, when measuring promoter activity, a promoter fragment usually linked to a reporter gene (even if containing an intron sequence that can affect expression) is located about 1 kb to 3 kb upstream of the coding region. Although it is used, depending on the gene, there may be a sequence related to expression about 100 kb upstream of the transcription start point (Non-patent Document 3), and the effect of such a sequence is analyzed by connecting the reporter gene to a promoter. Is not possible with the method described above. Furthermore, since insertion occurs randomly as described above, even if a tissue-specific expression pattern can be qualitatively analyzed (Non-patent Document 4), quantitative analysis is impossible, so another means is used in combination. There is a need to.
In addition, the inventors have achieved high efficiency and high efficiency by gene targeting by homologous recombination based on a powerful positive / negative selection method in higher plants such as rice and a large-scale Agrobacterium T-DNA transformation method. A method for genome modification with high reproducibility has been developed (Patent Document 1).

International publication WO 03/020940 Mol. Breeding, 16: 79-91 (2005) Plant Biotechnol. J., 2: 169-179 (2004) Genetics, 162: 917-930 (2002) Plant Cell, 9: 355-365 (1997)

It is often performed in mouse ES cell targeting that the endogenous promoter activity is analyzed by linking (knocking in) the reporter gene to the original locus on the genome by gene targeting using homologous recombination ( For example, Development, 126: 3437-3447 (1999)).
However, in higher plants, where gene targeting by homologous recombination is considered not easy, there has been no successful analysis of promoter activity by directly connecting the reporter gene to the endogenous promoter at the original locus, but it is strong in the seed. The Arabidopsis seed storage protein CRUCIFERIN coding region is linked to a GFP reporter gene with an open reading frame, and the yeast RAD54 gene is overexpressed to increase homologous recombination activity, targeting green fluorescence as an indicator The report (Proc. Natl. Acad. Sci. USA, 102: 12265-12269 (2005)), which is used for the screening of the selected individuals, is the only report example. Is not disclosed whether it is applicable or not, and is reported in monocotyledon grains that are extremely important in agriculture No example, development of a knock-method by homologous recombination for analyzing promoters in higher plants qualitatively and quantitatively has been strongly desired.

The present invention further improves the already developed genome modification method (Patent Document 1), and connects a reporter gene such as GUS gene or GFP gene to the original locus on the genome (knock-in) to analyze promoter activity. Provide a method.
According to the present invention, since the reporter gene can be introduced at any position downstream of the promoter of the target gene, the activity inherent in the promoter can be analyzed. For example, even if a cis sequence that can influence the activity of the promoter is present at a position far from the promoter, the activity can be accurately measured using this technique. It is also possible to connect a reporter gene by aligning the reading frame within the coding region of the target gene, and analyze the expression and functional site of the target gene using the amount of gene product produced and the intracellular localization of the gene product as indicators. Is possible. Furthermore, it is highly likely that the original function and usefulness of the gene, which has not been conventionally found, will be found by this technique. In addition, using this method, for example, a gene useful for human beings is incorporated directly under the promoter of a gene that is expressed and accumulated in large quantities in seeds to produce crops such as rice containing a large amount of useful proteins in the seeds. Is also possible.

That is, the present invention has a promoter activity of a higher plant constituted by including the following elements in the following order from RB between RB (Right Border sequence) and LB (Left Border sequence) derived from T-DNA. This is an analysis vector.
(1) a first negative selectable marker gene which is present so as to be expressed (2) a first nucleotide sequence comprising 500 to 6000 bp comprising the 3 ′ end of the target promoter or the 5 ′ region of the target gene in the host genome Homologous recombination region (3) Reporter gene whose start codon is separated from the 3 ′ end of the target promoter by a desired distance (4) Positive selectable marker gene (5) The first selectable marker gene in the host genome Second homologous recombination region (6) consisting of a base sequence of 500 to 6000 bp following the homologous recombination region (6) A second negative selection that may be identical to the first negative selection marker gene, Marker gene

Furthermore,
(7) a first recognition sequence of a site-specific recombinase present between the reporter gene and the positive selection marker gene (8) a transcription termination region present downstream of the positive selection marker gene ( 9) It may have a second recognition sequence for a site-specific recombinase that is present between the transcription termination region and the second homologous recombination region.

The present invention also comprises the step of analyzing the promoter of this plant by modifying the genome of the plant using this vector and measuring the activity of the reporter gene in this plant. 'Selecting the interval between the terminal and the start codon of the reporter gene; preparing the vector having the interval and replacing the reporter gene with a gene to be expressed; and a plant using the vector A method for producing a genome-modified plant comprising the steps of:
Furthermore, the present invention is the above vector for transgene expression, wherein the reporter gene is replaced with a gene to be expressed.

According to the present invention, it is possible not only to accurately evaluate and quantify the time and tissue-specific expression activity of the endogenous promoter at the original locus on the genome, which could not be achieved by conventional methods, but has not been found so far. Accurate and accurate analysis of promoter tissue specificity and expression pattern.
It is also possible to grow plants that can monitor environmental changes by connecting a reporter gene that can monitor expression in living cells and plants, such as the GFP gene, to a promoter that is expressed in response to various environmental changes. is there. In this case, if the GFP gene is connected with the reading frame in the coding region of the target gene, it is possible to analyze the expression and activity of the target gene, the intracellular localization and accumulation dynamics of the gene product, and the like.
In addition, the gene to be linked to the promoter on the genome by the method of the present invention is not limited to the reporter gene, and it is also possible to connect a gene or cDNA that can confer a useful trait. It can be expressed only during the season and can impart a useful trait to the higher plant, which can greatly contribute to the breeding of the higher plant.
Furthermore, useful proteins can be mass-produced by searching for promoters that are highly expressed in tissues that are easy to extract and connecting useful protein genes and genes related to the production of useful substances.

  The present invention is a technique for analyzing promoter activity by introducing a reporter gene into an arbitrary place in the genome of a higher plant by homologous recombination. According to this method, a reporter gene is introduced at an arbitrary location, for example, directly below the promoter of the target gene, and the activity of the promoter is observed and quantified by the expression of the reporter gene. Depending on the type of reporter gene, the strength of the promoter activity can be compared by identifying the tissue that is expressed or quantifying the expression level. In addition, there is an artificial restriction enzyme site sequence (a sequence with a palindrome structure of several bases) that was used when constructing the transfer vector, although it does not exist in the genome at the joint between the reporter gene and the promoter sequence. However, in order to avoid this, it is possible to remove the artificial restriction enzyme site and eliminate the influence of this site so that the analysis of the promoter activity by the reporter gene can be performed efficiently. It is also possible to modify the sequence.

In the conventional method of introducing a reporter gene in order to analyze promoter activity, there are few cases where a promoter sequence and a reporter gene are randomly inserted into the genome in a single copy. As a result of transgenes with inverted repeats inserted at random positions in the same site or multiple sites on a multi-copy genome, epigenetic gene silencing (gene suppression) occurs, which affects promoter activity The effect of receiving could not be ignored.
However, in the method of the present invention, not only can the activity of the endogenous promoter be monitored at the original locus on the genome under natural conditions, but all the sequences that may affect the promoter activity are also observed under natural conditions. be able to.
Furthermore, it is known that not only the upstream region of a gene but also a cis sequence (for example, an intron) in the gene affects the gene expression (Plant Cell, 9: 355-365 (1997)). In this case, if the reporter gene is incorporated directly under the target gene and the cis sequence that may affect the expression of the gene is removed, it is expected that the original gene expression cannot be analyzed. In such a case, a reporter gene is incorporated after an intron or the like so as to leave an important cis sequence, and the reporter gene is connected to the coding region of the target gene by connecting the reporter gene, and the target gene protein and the reporter gene enzyme It is possible to analyze the intrinsic activity of the gene and its intracellular localization by expressing the fusion protein and monitoring its activity.
In addition, vectors for gene targeting for various knock-ins are very long and complex, and the reporter gene must be combined with the target gene and translation frame to express an effective reporter gene enzyme. Therefore, it is desirable to modify the sequence of the restriction enzyme site after the introduction vector is constructed using a restriction enzyme or the like. In such a case, a desired transfer vector can be easily constructed and modified by applying the λRed system (Trend Biochem. Sci., 26: 325-331 (2001)).
Furthermore, an enhancer included in a promoter (for example, rice actin gene promoter pAct) region for expressing a positive selection marker gene (for example, hygromycin-resistant hpt gene) integrated in the genome together with a reporter gene (GUS or GFP). It is also possible to influence the expression of the reporter gene (in this case). In this case, the site is located at two forward site-specific recombination sites that are forwardly introduced at both ends of the positive selection marker gene of pKIN2. The specific recombinant enzyme gene may be expressed and removed (Trends Biotechnol., 21: 550-555 (2003)) to analyze the resulting marker-free transgenic plant.

T-DNA is a part of the Ti plasmid held in Agrobacterium. When a plant is infected with Agrobacterium, the cell itself does not enter the plant cell, but Ti present in the cell body. The T-DNA region that is part of the plasmid is transferred into the plant cell. T-DNA is delimited by RB (right border sequence) and LB (left border sequence), and each border sequence consists of an incomplete repetitive sequence of about 25 bases.
The vector of the present invention includes a negative selection marker and a positive selection marker in order to efficiently select homologous recombinants from non-homologous recombinants. Positive selection is a method in which when cells transformed with a gene are selected, selection is performed under conditions where only the cells expressing the gene product survive. In this case, the transformed cells are selected under conditions that kill the cells expressing the gene product.
An example of a positive selection marker is a hygromycin resistance gene. Other examples include kanamycin resistance gene, imidazoline resistance gene, glyphosate resistance gene, phosphomannose-isomerase gene, blastoidin S resistance gene, bar gene, and glyphosate resistance gene.
The negative selection marker is toxic to plant cells and needs to be non-toxic to E. coli and Agrobacterium used to manipulate the vector, and the diphtheria toxin protein A chain gene is preferred. Other genes that can be used as negative selection markers include the codA gene, cytochrome P-450 gene, and barnase gene.
Although this negative selection marker gene is used on each of the LB side and the RB side, they may be different genes, but are preferably the same gene.
When selecting homologous recombinants from non-homologous recombinants, the transformant is selected by a positive selection marker and the transformant generated by other than the homologous recombination is lethal by a negative selection marker. It is possible to selectively pick up homologous recombinants except for non-homologous recombinants.

The first homologous recombination region is a sequence in the host genome containing the target promoter or target gene, and is the transcription start of the target gene at the 3 ′ end of the target promoter (in the present invention, upstream (5 ′ side) thereof). It consists of a base sequence containing the 5 ′ region of the target gene. This region preferably includes the 3 ′ end of the target promoter, but depending on the gene, a 5 ′ untranslated region or an intron containing a cis sequence may be longer than the first homologous recombination region. In such a case, the “3 ′ end of the target promoter” may not be included. In this case, the 5 ′ region of the target gene may be included. Even in this case, the distance between the 3 ′ end of the target promoter and the start codon of the reporter gene can be clearly grasped.
The size of this base sequence should just be a magnitude | size required in order to raise | generate a homologous recombination, and is 500-6000 bp normally, Preferably it is 2000-3500 bp.

  In order to connect the reporter gene to the original locus on the genome and analyze the endogenous promoter activity, it is necessary to place the reporter gene at a desired position. For this reason, the (translation) start codon of the reporter gene The position of the 3 ′ end of the promoter or the 5 ′ region of the target gene in the first homologous recombination region may be determined so as to be separated from the 3 ′ end of the promoter by a desired distance. For example, the 3 ′ end of the first homologous recombination region may be set to match the 3 ′ end of the target promoter or the sequence immediately preceding the start codon of the target gene following this 3 ′ end, In construction, the 3 ′ end of the first homologous recombination region may be connected to the start codon of the reporter gene without any gap. At this time, consideration is given to including either one of the start codons so that both the start codon of the target gene and the start codon of the reporter gene are not included in the vector to be constructed. The 5 'end or 3' end of the promoter may not be included in the first homologous recombination region.

There is no restriction | limiting in particular in a reporter gene, GUS gene, CAT gene, (beta) galactosidase gene, a luciferase gene, a thaumatin gene etc. can be selected suitably, and can be used.
The second homologous recombination region consists of a sequence in the host genome that contains the target promoter and that follows the first homologous recombination region. Similarly to the first homologous recombination region, the size of this base sequence may be a size necessary for causing homologous recombination, and is usually 500 to 6000 bp, preferably 2000 to 3500 bp.

In addition, after the host plant is transformed with the above vector, a site-specific recombination enzyme recognition sequence may be introduced in order to delete unnecessary regions. Site-specific recombinase catalyzes recombination between two short consensus DNA sequences (target sequences). For example, the following site-specific recombinant enzyme and a target sequence specific to this enzyme can be used.
(1) Cre recombinase (recombinase) or derivative thereof Cre protein catalyzes recombination between two 34-base long 1ox (wild-type loxP and mutant derivatives thereof) recognition sites. This 1-ox sequence has a unique structure in which two 13-base palindromic sequences are sandwiched by an 8-base nucleus sequence. This non-target land sequence of 8 bases gives direction to the 1 ox site. DNA strand breaks and recombination between 1 ox sites by the Cre enzyme occur after the first base of the 8 bases and before the last base of the nuclear sequence.
Examples of the target sequence 1ox include loxP, lox511, lox5171, lox2272, lox2372, loxm2 (also referred to as m2), loxFAS, lox71, lox66, and mutant derivatives thereof. The mutant derivative refers to a target sequence for site-specific recombination reaction in which a mutation is introduced into one or more bases with respect to a wild type loxP sequence or the like.
(2) F1p recombinase (recombinase) or derivative thereof This recombinase is a Flp recombinase taken from budding yeast. The activity of this enzyme is similar to or slightly inferior to Cre / lox. However, recently developed active Flp (F1pe) improves the efficiency of this enzyme and is equivalent to the efficiency of Cre. The 34 base consensus recombination sequence is called FRT. FRT has a structure similar to 1 ox, but the sequence is different.
Many derivatives of this Flp enzyme and its recognition sequence have also been made. Target sequences include FRT, F3, F5, FRT mutant -10, FRT mutant +10, and mutant derivatives thereof. The mutant derivative refers to a target sequence for site-specific recombination reaction in which a mutation is introduced at one or more bases with respect to a wild type FRT sequence or the like.
(3) PhiC31 integrase or its derivative PhiC31 integrase is derived from a bacterial virus of stress Myces fungus and functions in human cells. Examples of the target sequence include attP, attB, and mutant derivatives thereof. The mutant derivative refers to a target sequence for site-specific recombination reaction in which a mutation is introduced into one or more bases with respect to a wild-type attP sequence or the like. This system is an enzyme that causes recombination at 3 bases of ttg between attPP ′ and attBB ′.
Of these site-specific recombination enzymes and their target sequences, the Cre / lox system is preferred.

For example, when Cre recombinase is expressed in a homologous recombinant (cell or individual subjected to homologous recombination) using the gene construct of the present invention to which a Cre / lox recombination system has been added, the region where homologous recombination of the genome has occurred A sequence containing a positive selection marker gene sandwiched between two lox sequences can be deleted.
In order to express the Cre recombinase in the homologous recombinant and delete the region between the lox sequences, the Cre recombinase gene is crossed with another plant into which the Cre recombinase gene has been introduced, or the plant obtained by homologous recombination Can be realized by gene transfer.
In addition, the Cre recombinase gene is connected to an inducible inducible promoter system (Curr. Opin. Plant Biol., 6: 169-177 (2003)) by Dexamethasone, Tetracycline, Ecdysone, Estradiol, Ethanol, Copper, etc. Alternatively, the Cre recombinase gene can be expressed in tissues and tissues, and the positive selection marker gene and transcription termination can be deleted. Furthermore, in order to control gene expression, a transcription termination region, preferably a transcription termination region of an En / Spm type transposon, may be introduced.

By using the above-mentioned vector and modifying the genome of the plant according to a conventional method, a plant in which a reporter gene for promoter analysis is knocked in can be prepared. Examples of such plants include higher plants such as rice, Arabidopsis, tobacco, tomato, potato, petunia, rape, cotton, corn, barley, wheat, sweet potato, and soybean.
By measuring the activity of the reporter gene in this transformed plant, the activity of the endogenous promoter at any position in the plant genome can be analyzed.
As a result of the analysis, if it is found that the promoter is highly expressed or that the gene at a specific position is expressed only in a specific tissue and time, a vector is prepared by replacing the reporter gene of the same vector with the gene to be expressed. Then, by performing genome modification of the plant, a transformed plant in which the foreign gene is incorporated at an appropriate position downstream of the promoter can be produced. This plant can be used to produce useful proteins.

The following examples illustrate the invention but are not intended to limit the invention.
Example 1
The rice OsMET1a gene (AF462029) has a homologous region of about 3.1 kb on both the 5 ′ side (first homologous recombination region) and the 3 ′ side (second homologous recombination region) of the start codon ATG. As a reporter gene, a vector was constructed in which the start codon ATG of the GUS gene was arranged to match the original start codon ATG of the OsMET1a gene. The structure of this vector is shown in FIG. In this vector, DT-A (first negative selection marker gene), ATG 5 of OsMET1a gene, in order from RB between RB (Right Border sequence) and LB (Left Border sequence) derived from T-DNA. 3102 bp sequence (first homologous recombination region), GUS (reporter gene), lox (recognition sequence of site-specific recombinase), hpt (positive selection marker gene), En / Spm (transcription termination region) ), Lox (recognition sequence of site-specific recombination enzyme), 3090 bp sequence (second homologous recombination region) 3 ′ of ATG of OsMET1a gene, and DT-A (negative selection marker gene).

Using this vector, 107 g of callus was induced from about 3300 seeds at a time into callus obtained from Nipponbare (wild-type) rice seeds, and transformed with the above-mentioned vector. 284 surviving calli were obtained by negative selection. DNA was extracted from these transformed calli and examined for the presence or absence of amplified fragments of PCR reactions of about 3.3 kb and 3.5 kb on the 5 ′ side and 3 ′ side, respectively, and screening for PCR reaction of homologous recombinants And obtained 15 independent knocked-in calli in a single experiment.
For screening of the 5 ′ PCR reaction, M1aSc5′-F: 5 ′ TTGAAGGCTGAAGCTGACC 3 ′ (SEQ ID NO: 1) and GUS-R: 5 ′ ACGGGTTGGGGTTTCTACA 3 ′ (SEQ ID NO: 2) were used as primers. In the PCR reaction screening, loxPF: 5 ′ GTATAATGTATGCTATACGAAGTTATGTTT 3 ′ (SEQ ID NO: 3) and M1aSc3′-R: 5 ′ CCTTCCAGCCTTGTAGGTCTC 3 ′ (SEQ ID NO: 4) were used as primers.
As a result, as shown in FIG. 2, almost the same level of GUS gene expression was observed from the results of GUS staining of callus.

Comparative Example 1
For comparison, as shown in FIG. 3, T-DNA in which a GUS reporter gene was linked to a 3.1 kb promoter of OsMET1a, which was conventionally performed, was randomly inserted into the rice genome. Calligraphy resistant to hygromycin, a positive marker for selection, was selected. The promoter region was a region longer than the vector subjected to knock-in targeting. As a result, since the positive / negative selection method is not used, as shown in FIG. 4, the GUS reporter gene is randomly inserted and the copy number is not constant. It was.

Example 2
Considering the possibility that there are factors controlling expression in the intron (Plant Cell, 9: 355-365 (1997)), as shown in FIG. 5, the 2.6 kb intron of the OsMET1b gene (TPA BK001405) Construction of vectors having homologous regions of about 3.6 kb and 1.8 kb, respectively, on the 5 ′ side (first homologous recombination region) and 3 ′ side (second homologous recombination region) of the second downstream ATG codon did. The start codon ATG of the GUS gene is arranged to match the second start codon ATG of the OsMET1b gene. Therefore, the GUS gene is linked downstream of the long intron of the OsMET1b gene. Using this vector, three experiments were performed in the same manner as in Example 1 (in the case of OsMET1a gene).
Inducing 75g, 108g and 95g callus from about 2200, 2200 and 1100 seeds at a time respectively, 290, 114 and 276 by Agrobacterium-mediated transformation and positive / negative selection The surviving callus was obtained. DNA was extracted from these transformed calli and examined for the presence or absence of amplified fragments of PCR reactions of about 3.7 kb and 2.0 kb on the 5 ′ side and 3 ′ side, respectively. Southern blot analysis was performed, and two, one, and three knock-in-targeted calluses were obtained independently in three experiments.
For screening by PCR on the 5 ′ side, M1bSc5′-F: 5 ′ TGCTGATGTGGTGATTTTGG 3 (SEQ ID NO: 5) ′ and GUS-R: 5 ′ ACGGGTTGGGGTTTCTACA 3 ′ (SEQ ID NO: 6) were used as primers. In the screening by PCR reaction, loxPF: 5 ′ GTATAATGTATGCTATACGAAGTTATGTTT 3 ′ (SEQ ID NO: 7) and M1bSc3′-R: 5 ′ TGGAATCTTCAGGGAAATGG 3 ′ (SEQ ID NO: 8) were used as primers.

FIG. 6 shows the results of GUS staining of six callus targeted for knock-in. When the obtained knock-in-targeted callus is GUS-stained, all of them are stained as well.
Moreover, the result of the GUS dyeing | staining of a knock-in reproduction | regeneration plant body is shown in FIG. As a result of analysis by GUS staining of the re-differentiated seedlings, strong blue GUS staining was observed in root meristems and the like that are actively dividing, as in the case of the OsMET1a gene. It is expressed much stronger than OsMET1a, which is in good agreement with the results of RT-PCR analysis.

FIG. 2, FIG. 4 and FIG. 8 show the results of GUS staining of the callus that succeeded in knock-in targeting of the evaluated OsMET1a gene, each tissue of the regenerated plant, and the transformed callus randomly inserted by connecting the GUS gene to the OsMET1a promoter. Show.
The method of GUS staining is as follows.
Composition of X-Gluc stain (solution that becomes a substrate for GUS staining)
5mg X-Gluc
50μl dimetyl formamide
50 mM NaPO4 (pH 7.0)
0.5 mM Potassium ferricyanide
0.5mM Potassium ferrocyanide
Immediately before use, 15% methanol is added to the solution having the above composition, and the tissue is added and stained at 37 ° C. The staining time ranges from several minutes to at most overnight depending on the strength of GUS activity. Thereafter, in a green tissue, chlorophyll may be extracted with 70% to 100% ethanol to facilitate observation. In the case of callus related to the OsMET1a gene, all callus that succeeded in knock-in targeting (FIG. 2) were stained in the same manner, whereas in the case of randomly inserted transformed callus (FIG. 4), The variation is remarkable. Moreover, the result (FIG. 8) of the GUS dyeing | staining of the plant body which succeeded in the knock-in targeting of OsMET1a gene was shown. Since strong GUS staining was observed in tissues with high division such as apical meristem and root apical meristem, it seems to be a promoter that is specifically expressed at sites where cell division is active.

  The results of GUS staining of callus and regenerated plants that succeeded in knock-in targeting of the OsMET1b gene are shown in FIGS. The method of GUS staining was the same as in the case of the OsMET1a gene, and strong GUS staining was also observed in a tissue that was actively divided.

In order to compare the tissue-specific expression patterns of both OsMET1a and OsMET1b genes with the results of GUS staining of knock-in targeted plants, the expression patterns of both genes were analyzed by RT-PCR, and the results are shown in FIG. As shown in FIG. RNA was extracted from each tissue, and RT-PCR was performed according to the method of Morita et al. (Plant Cell Physiol., 47: 457-470 (2006)). The length of the amplified fragment after cDNA synthesis by the reverse transcription reaction and the conditions for amplification of the PCR reaction are as follows.
Amplified fragment of OsMET1a gene: 382 bp
Primer M1a3′-F: 5 ′ GAAGCTGTCCACAGGGCAGA 3 ′ (SEQ ID NO: 9)
Primer M1a3′-R: 5 ′ AAATGAGGGCGATGCAGTGAAG 3 ′ (SEQ ID NO: 10)
The PCR reaction was 94.0 ° C. for 1 minute, and (94 ° C. for 30 seconds, 62.0 ° C. for 30 seconds, 72.0 ° C. for 1 minute) was repeated 35 times, followed by treatment at 72 ° C. for 7 minutes.
Amplified fragment of OsMET1b gene: 380 bp
Primer M1b3′-F: 5 ′ ACTATCATCTGGCCAACTGGTGG 3 ′ (SEQ ID NO: 11)
Primer M1b3′-R: 5 ′ CCCTCGATCATCGGAGAAGG 3 ′ (SEQ ID NO: 12)
In the PCR reaction, 94.0 ° C. for 1 minute and (94 ° C. for 30 seconds, 60.0 ° C. for 30 seconds, 72.0 ° C. for 1 minute) were repeated 32 times, followed by treatment at 72 ° C. for 7 minutes.

  Although both OsMET1a and OsMET1b genes are expressed in the same tissue, the number of cycles for amplification of RT-PCR shows that the OsMET1b gene is expressed more strongly than the OsMET1a gene. In addition, the expression pattern of the OsMET1a gene is consistent with the result of GUS staining in FIG. 8, indicating the effectiveness of the promoter analysis of the present invention.

Example 3
In this example, the 5 ′ and 3 ′ homologous regions were cloned into the knock-in basic vector (pKIN2) (FIG. 11), and then the 5 ′ homologous region and the restriction enzyme site sequence of the reporter gene binding site were removed. Based on the method of Chaveroche et al. (Nucleic Acids Res., 28: e97 (2000)), arabinose is added to Escherichia coli into which pKOBEG plasmid has been introduced to induce homologous recombination in the fungus, and the target nucleotide sequence Replaced with Specifically, as shown in FIG. 12, E. coli having both a plasmid containing the restriction enzyme site SrfI and the pKOBEG plasmid is induced by homologous recombination with arabinose, and an artificial oligo DNA having no SrfI site is obtained. Transformed. The sequence of the oligo DNA used at this time is the sense strand 5 'ctccaaaaagtttggaggggcggtttaagaaggttcatctgacccccacaATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTCGACG3 tt CGCG 50-99th) is the target gene promoter sequence, capital letters (sense strands 51-99 and antisense strand 1-49 indicate sequences homologous to the GUS reporter gene), and artificially annealed. Then, it was introduced into E. coli as double-stranded DNA. Next, the following PCR reaction was performed to select a plasmid that had replaced the synthetic DNA.
For the PCR reaction, primer 1: 5 ′ aggttcatctgacccccacaATG 3 ′ (SEQ ID NO: 15) and primer 2: 5 ′ CCGCCCTGATGCTCCATCACTTC 3 ′ (SEQ ID NO: 16) were used, and PCR reaction (94.0 ° C. for 1 minute and (94.0 ° C.) 30 seconds, 68.1 ° C. 30 seconds, 72.0 ° C. 1 minute) was repeated 30 times.
The synthetic DNA is replaced with a plasmid, and there is no artificial foreign sequence at the binding site between the 5 'homology region including the promoter region and the reporter gene, and promoter activity can be measured and observed under more natural conditions. It became.

It is a schematic diagram of knock-in targeting for promoter analysis of OsMET1a gene. pUbi is the maize ubiquitin 1 promoter, DT-A is the gene for the diphtheria toxin protein A chain, GUS is the GUS gene for E. coli, tNOS is the nopaline synthase terminator, lox is the lox sequence of the bacteriophage Cre / lox recombination system, pAct Is the rice actin promoter, hpt is the hygromycin resistance gene, t35S is the cauliflower mosaic virus 35S terminator, En / Spm is the transcription termination region of the En / Spm type transposon, and p35S is the cauliflower mosaic virus 35S promoter. The sequence of 3102 bp on the 5 ′ side of the ATG of the OsMET1a gene and the sequence of 3090 bp on the 3 ′ side of the ATG represent a homologous recombination region. It is a figure which shows the result of GUS dyeing | staining of a knock in callus. It is a figure which shows the structure of the vector for the conventional promoter analysis which connected the GUS reporter gene to the 3.1 kb OsMET1a gene promoter. It is a figure which shows the result of the GUS dyeing | staining of a random transformation callus. It is a schematic diagram of knock-in targeting for promoter analysis of OsMET1b gene. It is a figure which shows the result of GUS dyeing | staining of six callus targeted for knock-in. It is a figure which shows the result of GUS dyeing | staining of a knock-in reproduction | regeneration plant body. It is a figure which shows the result of the GUS dyeing | staining of the knock-in reproduction | regeneration plant body of OsMET1a gene. As a result of the GUS staining of the three different plant bodies after redifferentiation, strong blue GUS staining was observed in vigorous tissues such as apical meristem and root meristem. It is a figure which shows the result of having analyzed the expression mode of both genes of OsMET1a and OsMET1b by RT-PCR. Structure of OsMET1a and OsMET1b genes and positions of primers for RT-PCR. It is a figure which shows the structure of a knockin basic vector (pKIN2). iUbi represents the first intron of corn ubiquitin 1, tNOS represents the nopaline synthetase terminator, iAct represents the first intron of rice actin, and iCat represents the first intron of the castor catalase gene, and the others are the same as in FIG. It is a figure which shows the method of removing the restriction enzyme site | part of the binding region of a homologous region and a reporter gene using (lambda) Red system. A synthetic double-stranded oligonucleotide that has the same sequence as the vector but does not have a restriction enzyme site, and a vector at a ratio of 3.3 × 10 ⁶ to 1 at a length of 100 bp on both sides of the restriction enzyme (SrfI) site to be removed. A modified vector is obtained using the λRed system (Nucleic Acids Res., 28: e97 (2000); Trend Biochem. Sci., 26: 325-331 (2001)). Screening was performed by colony PCR reaction, and finally the base sequence of the modified portion of the modified vector was determined and confirmed.

Claims (9)

A vector for analyzing promoter activity of a higher plant, comprising the following elements from RB in the following order between RB (Right Border sequence) and LB (Left Border sequence) derived from T-DNA.
(1) a first negative selectable marker gene which is present so as to be expressed (2) a first nucleotide sequence comprising 500 to 6000 bp comprising the 3 ′ end of the target promoter or the 5 ′ region of the target gene in the host genome Homologous recombination region (3) Reporter gene whose start codon is separated from the 3 ′ end of the target promoter by a desired distance (4) Positive selectable marker gene (5) The first selectable marker gene in the host genome Second homologous recombination region (6) consisting of a base sequence of 500 to 6000 bp following the homologous recombination region (6) A second negative selection that may be identical to the first negative selection marker gene, Marker gene Furthermore,
(7) a first recognition sequence of a site-specific recombinase present between the reporter gene and the positive selection marker gene (8) a transcription termination region present downstream of the positive selection marker gene ( 9) The vector according to claim 1, comprising a second recognition sequence for a site-specific recombinase that is present between the transcription termination region and the second homologous recombination region. The 3 'end of the first homologous recombination region is set to match the sequence immediately before the 3' end of the target promoter or the start codon of the target gene following the 3 'end. vector. The vector according to any one of claims 1 to 3, wherein the 3 'end of the first homologous recombination region is connected to the start codon of the reporter gene without any gap. A method for producing a plant in which a reporter gene for promoter analysis is knocked in, comprising modifying the genome of the plant using the vector according to any one of claims 1 to 4. A plant whose genome has been modified by the method according to claim 5. 6. A method for analyzing a promoter of a plant according to claim 5, comprising measuring the activity of the reporter gene. Analyzing a plant promoter by the method according to claim 7, selecting an interval between the 3 ′ end of the promoter and the start codon of the reporter gene from the analysis result, and having the interval; and A method for producing a genome-modified plant comprising the steps of preparing the vector according to claim 1 or 2 wherein a reporter gene is replaced with a gene to be expressed, and performing a genome modification of the plant using the vector. The vector according to claim 1 or 2 for transgene expression, wherein the reporter gene is replaced with a gene to be expressed.