JPWO2006132270A1 - Herbicide resistance gene - Google Patents

Abstract

An object of the present invention is to provide p-hydroxyphenylpyruvate dioxygenase having high resistance to herbicides. The present invention provides the following gene (a) or (b): (a) a herbicide-resistant p-, comprising a polynucleotide comprising the first to first 1293 bases of the base sequence represented by SEQ ID NO: 1. A gene encoding a hydroxyphenylpyruvate dioxygenase enzyme; (b) hybridizing under stringent conditions with a polynucleotide comprising the 1st to 1293th bases of the base sequence represented by SEQ ID NO: 1 and herbicide resistance A gene comprising a polynucleotide encoding a natural p-hydroxyphenylpyruvate dioxygenase enzyme.

Description

  The present invention relates to an herbicide resistant enzyme, in particular an enzyme resistant to a herbicide targeting p-hydroxypyruvate dioxygenase.

  p-Hydroxypyruvate dioxygenase (hereinafter referred to as HPPD) catalyzes the formation of homogentisic acid (2,5-dihydroxyphenylacetic acid) from p-hydroxyphenylpyruvate (hereinafter referred to as HPP) and molecular oxygen To do. In plants, this enzyme is involved in biosynthesis of plastoquinone, α-tocopherol (vitamin E) and the like (FIG. 1). Furthermore, this enzyme has recently been found to be a molecular target for several herbicides.

  The full-length or partial sequence of a gene encoding plant HPPD (hereinafter also referred to as HPPD gene) is carrot, Arabidopsis thaliana, barley, maize, rice, pheasant, avena, wheat, velvet millet, shin-no-iga, ryegrass, red-necked rush, It has been clarified in Akino nookorogusa, ohoshiba and sorghum (Non-patent Document 1).

  Herbicides that inhibit HPPD inhibit plastoquinone biosynthesis in plants, resulting in carotenoid loss, chloroplast development arrest and whitening. Moreover, it is thought that the fall of the plastoquinone content in a plant also affects a photosynthetic electron transport system and causes the plant growth suppression symptom.

  Tocopherol, another product of the plastoquinone biosynthetic system, acts as a free radical scavenger. Thus, a decrease in tocopherol content in plants causes lipid peroxidation, which leads to necrotic symptoms. Moreover, it is thought that the fall of a tocopherol content causes the fall of the photosynthetic capability of a plant.

  HPPD inhibitors are thought to kill weeds by such various actions. HPPD is therefore very effective as a molecular target for potent herbicides.

  Herbicides that inhibit HPPD are classified according to chemical structure into four systems: triketone (cyclohexanedione), isoxazole, pyrazole, and bicyclooctanedione (BOD). Among these, pyrazole pyrazoles are known to have high herbicidal activity. Pyrazolate is hydrolyzed to form detosylpyrazolate (hereinafter referred to as DTP) which is an active body as its herbicide (FIG. 2). Bicyclooctanedione (BOD) -based benzobicyclones are hydrolysates as active bodies.

  Enzymes resistant to herbicides targeting HPPD have been reported (Patent Documents 1 and 2). The degree of herbicide resistance of the HPPD disclosed in Patent Document 1 is 2-4.5 times as low as that of conventionally known HPPD. The HPPD disclosed in Patent Document 2 is also considered to be only several times more resistant than the conventionally known HPPD, and the HPPD is a mutant enzyme in which a mutation is introduced into wild-type HPPD. There is no known plant-derived HPPD that has high herbicide resistance without introducing mutations.

  In addition, conventionally known methods for producing HPPD-resistant plants are to increase the amount of enzyme and impart resistance by overexpressing HPPD in the plant body. A method for producing a herbicide-resistant plant by using a wild-type enzyme derived from a plant whose enzyme itself has high herbicide resistance has not been successful.

Furthermore, since the HPPD gene is useful as a gene for biosynthesis of tocopherol and plastoquinone, it is useful not only for the production of herbicide-resistant plants but also for the production of useful compounds such as tocopherol and plastoquinone. It is also useful as a gene.
Special table 2004-528821 gazette JP 2001-522608 A Plant growth regulation, vol.27, No.2, p146-155, 2002

  An object of the present invention is to provide HPPD having extremely high herbicide resistance.

  The inventors of the present invention have found that cultured cells of urene have resistance to DTP (detosylpyrazolate), which is an active body of pyrazolate, and have isolated the HPPD gene from urene. The present inventors further expressed the HPPD gene in Escherichia coli and measured the activity thereof, and as a result, it was revealed that the resistance to DTP is about 500 times higher than that of conventionally known HPPD. The HPPD also showed high resistance to the hydrolyzate of benzobicyclone.

That is, the present invention
The following genes (a) or (b) are provided:
(A) a gene encoding a herbicide-resistant p-hydroxyphenylpyruvate dioxygenase enzyme, comprising a polynucleotide comprising the first to 1293 bases of the base sequence represented by SEQ ID NO: 1;
(B) hybridizes under stringent conditions with a polynucleotide comprising the first to 1293 bases of the base sequence represented by SEQ ID NO: 1, and encodes a herbicide-resistant p-hydroxyphenylpyruvate dioxygenase enzyme A gene comprising a polynucleotide to be

  The open reading frame (ORF) of the herbicide-resistant HPPD according to the present invention consists of base numbers 1-1290. Accordingly, the present invention provides a gene consisting of nucleotides 1 to 1290 of SEQ ID NO: 1. The coding region containing 3 bases of the ORF and stop codon consists of nucleotides 1 to 1293. As long as the present invention includes a region corresponding to nucleotide numbers 1 to 1290 of SEQ ID NO: 1, any gene is included in the range.

  The present invention also relates to a gene comprising a polynucleotide that hybridizes with a polynucleotide comprising the first to 1293 bases of the base sequence represented by SEQ ID NO: 1 under stringent conditions and encodes a herbicide-resistant HPPD. provide. In the present invention, stringent hybridization conditions refer to hybridization conditions of 6M urea, 0.4% SDS, 0.5x SSC or equivalent stringency.

  The present invention also comprises a nucleotide sequence in which one or several bases or base pairs are deleted, substituted or added in the polynucleotide comprising the first to 1293 bases of the base sequence represented by SEQ ID NO: 1, Also provided is a gene comprising a polynucleotide encoding a herbicide resistant HPPD. Here, “one or several bases or base pairs” refers to a number of bases that can be substituted, deleted, inserted, and / or added by a known mutagenesis method such as site-directed mutagenesis. It means base pair.

  The present invention also provides a polynucleotide having a homology of 70% or more at the nucleotide level with a polynucleotide comprising the first to 1293 bases of the base sequence represented by SEQ ID NO: 1, and encoding a herbicide-resistant HPPD. Genes containing are also provided. The nucleotide sequence homology is preferably 75% or more, more preferably 80% or more, 85% or more, 90% or more, and still more preferably 92% or more, 95% or more, 98% or more. Sequence identity can be determined by FASTA search (Pearson W.R. and D.J. Lipman (1988) Proc. Natl. Acad. Sci. USA. 85: 2444-2448) or BLASTN search.

The present invention further provides the following (c) or (d) p-hydroxyphenylpyruvate dioxygenase enzyme:
(C) a herbicide-resistant p-hydroxyphenylpyruvate dioxygenase enzyme consisting of the amino acid sequence represented by SEQ ID NO: 2,
(D) A p-hydroxyphenylpyruvate dioxygenase enzyme consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having herbicide resistance.

  The above “one or several amino acids” means a number of amino acids that can be substituted, deleted, inserted, and / or added by a known mutant protein production method such as site-directed mutagenesis. The mutant protein includes a protein having a mutation artificially introduced by a known mutant protein production method and the like, and a protein having a mutation in comparison with a naturally-occurring isolated sequence number 2 .

  The present invention relates to a protein comprising the amino acid sequence represented by SEQ ID NO: 2, an amino acid sequence obtained by deleting, substituting or adding one or several amino acids in the amino acid sequence represented by SEQ ID NO: 2, and a herbicide Provided are a protein that acts as a resistant HPPD and a protein that exhibits 72% or more homology at the amino acid level with a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 and acts as a herbicide-resistant HPPD. The present invention further provides a protein encoded by the HPPD gene of the present invention. Here, the term “one or several amino acids” has the same meaning as described above. The homology of amino acid sequences is preferably 75% or more, more preferably 80% or more, 85% or more, 90% or more, and still more preferably 95% or more, 98% or more. Sequence identity can be determined by FASTA search (Pearson W.R. and D.J. Lipman (1988) Proc. Natl. Acad. Sci. USA. 85: 2444-2448) or BLASTP search.

  The herbicide-resistant HPPD of the present invention exhibits herbicide resistance against herbicides targeting HPPD, for example, pyrazole pyrazolate (its active body, DTP) and bicyclooctanedione benzobicyclone. It is useful to give to.

Preferably, the herbicide-resistant HPPD provided by the present invention is detosylpyrazolate (DTP) with an IC ₅₀ for the HPPD of 4.05 μM or more, such as 4.05 to 10.03 μM.
Preferably, the herbicide resistant HPPD provided by the present invention is derived from auren.

  The present invention also provides a recombinant vector containing the HPPD gene of the present invention, a transformed plant cell containing the recombinant vector, and a transformed plant containing the transformed plant cell.

  Specific examples of the plant to be transformed include soybean, rice, rapeseed, cotton, potato, tomato, tobacco, barley, wheat, corn and the like, preferably soybean and rice.

Furthermore, the present invention provides a method for producing an HPPD-inhibiting herbicide-resistant plant, comprising a step of transforming a plant cell with an HPPD gene, and a step of redifferentiating the transformed plant cell to obtain a plant body.
Here, the term “transformed plant” includes all transformed plants, plant organs, plant tissues, and plant cultured cells.

  The present invention also relates to a method for controlling weeds in a field where a transformed plant is cultivated, and an HPPD inhibitor effective in controlling the target weed without substantially changing the transformed plant. A method is provided that includes applying a herbicide to a field. Preferably, the HPPD-inhibiting herbicide is pyrazolate and benzobicyclone.

  Using the HPPD gene of the present invention, it is possible to impart resistance to plants against herbicides that inhibit HPPD. Since herbicides that inhibit HPPD are known as non-selective inhibitors, the HPPD gene of the present invention can confer herbicide resistance to a wide range of crops. In addition, since HPPD is an important enzyme in plastoquinone and tocopherol biosynthesis systems, the HPPD gene of the present invention may be useful for metabolic engineering of these useful compound biosynthesis systems.

  Further, the present invention is expected to reduce the weeding work. Furthermore, the recombinant microorganism or recombinant plant containing the HPPD gene of the present invention may be useful in the production of useful vitamins such as tocopherol / plastoquinone.

FIG. 1 shows HPPD-catalyzed reaction and inhibition of plastoquinone biosynthesis. FIG. 2 is a diagram showing the structure of an HPPD inhibitor. a: Pyrazolate is hydrolyzed to form active detosyl pyrazolate (DTP). b: Triketone type HPPD inhibitor. FIG. 3 is a diagram showing the effect of DTP on the growth of cultured tobacco cells. In tobacco, DTP showed significant growth inhibition. FIG. 4 is a graph showing the effect of DTP on the growth of cultured auren cells. DTP had no inhibitory effect on the aurene. FIG. 5 is a diagram showing a partial comparison between HPPD isolated from Ouren and HPPD sequences isolated from other species. In the figure, triangles indicate iron binding residues. The active site is indicated by a frame. FIG. 6 is a diagram showing a phylogenetic tree of HPPD. FIG. 7 is a diagram showing SDS-PAGE of Ouren HPPD expressed in E. coli. Lane 1: molecular weight marker, lane 2: control vector (pET-21d), lane 3: HPPD. Arrow indicates predicted production of recombinant HPPD. FIG. 8 is a diagram showing LC-MS analysis of a reaction product by recombinant HPPD. FIG. 9 is a diagram showing the inhibitory effect of pyrazolate and DTP on HPPD derived from carrot cultured cells. The activity in the absence of inhibitor is 4.9 nmol homogentisic acid / min / mg protein. ○ indicates pyrazolate, and ● indicates DTP. From this figure, it can be seen that the IC ₅₀ of DTP against HPPD of carrot is 13 nM (Hiroshi Matsumoto et al., 2002). FIG. 10 is a diagram showing the effect of DTP on our HPHP. The enzyme activity without an inhibitor was 3.8 nmol / min / mg protein. From the inhibition curve, it can be seen that the IC ₅₀ of Ouren HPPD is 6.75 μM (about 500 times that of carrot). FIG. 11 is a diagram showing the effect of a benzobicyclone hydrolyzate on Ouren HPPD. From the inhibition curves, _{IC 50} of Coptis HPPD is found to be 1.2 .mu.M.

In the present invention, the herbicide resistance HPPD, herbicide the HPPD as target, such as the DTP, _{IC 50} against HPPD is conventionally known from carrots are HPPD (Garcia, I et al. , Biochemical Journal ( 1997) vol. 325, 761-769) means an HPPD that is 10 times or more, preferably 50 times or more, more preferably 100 times or more, and even more preferably 500 times or more the IC ₅₀ . Here, IC ₅₀ is the concentration of a herbicide that inhibits HPPD enzyme activity by 50%, such as DTP. Therefore, even when a herbicide at a concentration substantially sufficient to kill plants such as weeds not containing HPPD of the present invention is applied, the plant having HPPD of the present invention, preferably useful for agriculture. The crop does not die. Therefore, the herbicide resistant HPPD of the present invention makes it possible to weed only weeds without killing useful crops.

The present invention is described in further detail below.
HPPD gene of the present invention The present invention provides a herbicide-resistant HPPD gene.
The present inventors isolated the HPPD gene from cultured cells of Coptis japonica belonging to the family Ranunculaceae and sequenced it (SEQ ID NO: 1).

  The HPPD gene of the present invention is preferably a polynucleotide consisting of bases 1 to 1293 of the base sequence shown in SEQ ID NO: 1, but may be any gene as long as a part corresponding to this part is included. . A polynucleotide having the base sequence shown in SEQ ID NO: 1 can be obtained from a cDNA library prepared by a conventionally known method from cultured aurene cells.

  The present invention also encompasses a gene that encodes a protein that is functionally equivalent to the protein that acts as the herbicide-resistant HPPD of SEQ ID NO: 2. As used herein, “a protein functionally equivalent to a protein acting as a herbicide-resistant HPPD” has a biological function equivalent to that of the protein of SEQ ID NO: 2, that is, has an HPPD enzyme activity, and It means a protein exhibiting defined herbicide resistance.

  The gene of the present invention includes, for example, a mutant, derivative or variant encoding a protein comprising an amino acid sequence in which one or several amino acids are substituted, deleted, added and / or inserted in the amino acid sequence of SEQ ID NO: 2. And homologs.

  Methods for preparing genes encoding proteins with altered amino acid sequences are well known to those skilled in the art, for example, site-directed mutagenesis (Kramer, W. & Fritz, H.-J. Methods in Enzymology, 154: 350-367 (1987)). In addition, the amino acid sequence of the encoded protein may be mutated in nature due to the mutation of the base sequence. Thus, a gene encoding a protein having an amino acid sequence in which one or several amino acids are substituted, deleted or added in the amino acid sequence encoding HPPD (SEQ ID NO: 2) of the present invention may be a natural one. As long as it encodes a protein having the same function as the herbicide-resistant HPPD of SEQ ID NO: 2, it is included in the gene of the present invention. In addition, there are cases where amino acid in a protein does not change due to a mutation in the base sequence (degenerate mutation). Such degenerate mutants are also included in the gene of the present invention. The number of bases mutated in comparison with the sequence of SEQ ID NO: 1 in the DNA constituting the HPPD gene of the present invention is within 30 amino acids, preferably within 20 amino acids, more preferably within 10 amino acids, more preferably at the amino acid level. Causes mutations within 5 amino acids (eg, within 3 amino acids, within 2 amino acids).

  The method for obtaining the HPPD gene of the present invention is not particularly limited, and conventionally known methods are employed. For example, the gene may be excised from a genomic DNA, cDNA library or the like with an appropriate restriction enzyme and purified. That is, the herbicide-resistant HPPD gene of the present invention includes genomic DNA, cDNA, and chemically synthesized DNA. Methods for preparing genomic DNA and cDNA are well known to those skilled in the art. The genomic DNA encoding the HPPD of the present invention is obtained by, for example, extracting genomic DNA from a plant cell or tissue, creating a genomic library (as a vector, plasmid, phage, cosmid, BAC, PAC, etc. can be used) It can be prepared by a method of screening the library (for example, colony hybridization or plaque hybridization) using a probe prepared based on the DNA encoding the protein of the present invention (SEQ ID NO: 1). .

  In addition, the HPPD gene of the present invention can be prepared by a method in which a primer specific to the sequence of SEQ ID NO: 1 is prepared and PCR is performed using this primer. The cDNA encoding the HPPD of the present invention is synthesized, for example, based on mRNA extracted from plant cells or tissues, and inserted into a vector such as λZAP to prepare a cDNA library. Can be prepared by the method of screening (for example, colony hybridization or plaque hybridization) or by the PCR method.

  The herbicide-resistant HPPD gene of the present invention can be used for mass production of useful vitamins such as tocopherol / plastoquinone by, for example, enhancing the tocopherol / plastoquinone biosynthesis pathway.

Method for Isolating Full-Length cDNA of Gene Encoding Herbicide-Resistant HPPD The HPPD gene of the present invention is derived from cultured aurene cells. Therefore, it is possible to clone the full-length cDNA of the herbicide-resistant HPPD gene from plants other than the auren using the HPPD gene derived from the auren. As a cloning method in this case, a conventionally known method can be used and is not particularly limited. Here, whether or not the obtained gene encodes a protein having a function as a herbicide-resistant HPPD can be determined as generally performed by those skilled in the art. First, whether or not the protein encoded by the obtained gene has an HPPD enzyme activity that catalyzes the production of homogentisic acid from HPP and oxygen can be confirmed by an enzyme activity measurement method well known to those skilled in the art. It can then be determined by measuring HPPD enzyme activity in the presence of various concentrations of herbicide, eg, DTP, and determining the concentration of herbicide that inhibits the enzyme activity by 50% (IC ₅₀ ). Measurement of HPPD enzyme activity and evaluation of IC ₅₀ against DTP can be performed as described in the Examples.

  The gene of the present invention can be isolated from many plants according to a conventional method. The gene of the present invention can also be obtained by chemical synthesis by a general method such as the phosphite triester method (H. Hunkapiller et al., Nature, vol. 310, p. 105-111, 1984). it can.

  Specifically, when an HPPD gene is obtained from a plant in which at least a part of the genome is stored in a database, a base sequence homologous to the base sequence of the polynucleotide of the present invention may be searched from the database. . For example, a base sequence homology search using an algorithm such as BLASTN can be preferably used.

  In addition, when an HPPD gene is obtained from a plant whose genome is not stored in a database, for example, a hybridization method using a conventionally known DNA library can be used. Specifically, a step of preparing a genomic library or cDNA library using an appropriate cloning vector, and hybridization using at least a part of the polynucleotide of SEQ ID NO: 1 as a probe, And a method of detecting a fragment to soy. Thus, the HPPD gene of the present invention is also useful as a probe. The region used for the probe preferably contains a sequence specific to the HPPD gene. The length of the polynucleotide used as the probe is preferably 100 bp or more.

  More specifically, in order to prepare the herbicide resistant HPPD gene of the present invention, methods well known to those skilled in the art include hybridization techniques (Southern, EM Journal of Molecular Biology, 98, 503 (1975)). ) And polymerase chain reaction (PCR) technology (Saiki, RK et al. Science, 230, 1350-1354 (1985), Saiki, RK et al. Science, 239, 487-491 (1988)). That is, using the HPPD gene of the present invention (SEQ ID NO: 1) or a part thereof as a probe, and using an oligonucleotide that specifically hybridizes to the gene as a primer, a gene having high homology with the gene is isolated from a plant cell. Can be separated. A gene encoding a protein having a function equivalent to that of the herbicide-resistant HPPD of the present invention that can be isolated by a hybridization technique or a PCR technique is also included in the present invention.

  In order to isolate such a gene, the hybridization reaction is preferably carried out under stringent conditions. In the present invention, stringent hybridization conditions refer to conditions of 6M urea, 0.4% SDS, 0.5x SSC, or equivalent stringency hybridization conditions as described above. By using conditions with higher stringency, such as 6M urea, 0.4% SDS, and 0.1x SSC, genes with higher homology can be efficiently isolated. The isolated gene is considered to have high homology with the amino acid sequence of the protein of the present invention (SEQ ID NO: 2) at the amino acid level. Here, high homology refers to sequence identity of at least 72% or more, more preferably 75% or more, more preferably 80% or more (for example, 85% or more) at the amino acid level. Sequence identity can be determined by FASTA search (Pearson W.R. and D.J. Lipman (1988) Proc. Natl. Acad. Sci. USA. 85: 2444-2448) or BLASTP search.

Method for producing transformed cell A method for producing a transformed plant that expresses the gene of the present invention comprises inserting the HPPD gene of the present invention into an appropriate vector and introducing it into a plant cell. Regenerating transformed plant cells.

  The transformed cell of the present invention is a cell into which the HPPD gene or recombinant vector of the present invention has been introduced. Here, “the gene or the recombinant vector is introduced” means that the gene or the recombinant vector is introduced into the host so that it can be expressed by the action of a promoter, for example, by a known genetic manipulation technique. .

  The transformed cell of the present invention can be obtained by directly introducing the HPPD gene of the present invention into a host or by introducing a vector incorporating the gene into the host. The host is not particularly limited, and examples include plants for preparing herbicide-resistant plants, and microorganisms such as yeast and Escherichia coli for biosynthesis of useful vitamins. The transformation may be transient, but preferably the HPPD gene is stably integrated.

  When the obtained gene is introduced into a plant, it is used by linking to a promoter capable of causing expression in the plant. Examples of such a promoter include cauliflower mosaic virus 35S promoter (CaMV35S promoter), nopaline synthetase promoter, ribulose diphosphate carboxylase / oxygenase small subunit promoter, and the like.

  Various methods known to those skilled in the art may be used to produce the transformed cells of the present invention. Examples of such methods include polyethylene glycol method, electroporation method, Agrobacterium-mediated method, particle gun method and the like. Plant regeneration from transformed plant cells can be performed by methods known to those skilled in the art depending on the type of plant cell (see Toki et al., Plant Physiol. 100: 1503-1507 (1995)). ). For example, as a method for producing a transformed plant body, a gene is introduced into a protoplast by polyethylene glycol and the plant body is regenerated (Datta, SK (1995) In Gene Transfer To Plants (Potrykus I and Spangenberg Eds.) Pp66- 74), gene transfer to protoplasts by electric pulses to regenerate plants (Toki et al (1992) Plant Physiol. 100, 1503-1507), gene transfer directly to cells by particle gun method, A method for regenerating plants (Christou et al. (1991) Bio / technology, 9: 957-962.) And a method for regenerating plants by introducing genes into plant material via Agrobacterium (Hiei et al. (1994 ) Plant J. 6: 271-282.).

  Once a transformed plant into which the gene of the present invention has been introduced into the genome is obtained, offspring can be obtained from the plant by sexual reproduction or asexual reproduction. It is also possible to mass-produce the plant body using propagation material (eg, seeds, fruits, cuttings, tubers, tuberous roots, strains, callus, protoplasts, etc.) obtained from the plant body, its descendants or clones. . The present invention also includes plant cells into which the gene of the present invention has been introduced, plants containing the cells, progeny and clones of the plants, and propagation materials derived therefrom.

  Examples of vectors that can be used in the present invention include vectors conventionally used for transformation of microorganisms and plants. Such vectors include, in addition to the gene of the present invention or a fragment thereof, a constitutive or inducible promoter that enables gene expression, a drug resistance gene that facilitates selection of transformants, and an Agrobacterium binary vector. A replication start point used in the system may be included.

  More specifically, when introduced into microorganisms such as E. coli, pBluescript vectors, pET vectors, and the like can be used. The vector used for the transformation of plant cells is not particularly limited as long as the transgene can be expressed in the cells. For example, a vector having a promoter (for example, 35S promoter of cauliflower mosaic virus) that induces constitutive gene expression in plant cells or an inducible promoter (eg, ethylene-responsive PR5d promoter, water stress-inducible rd29A promoter, etc.) It is also possible to use a vector. Examples of the drug resistance gene include ampicillin resistance gene, kanamycin resistance gene, hygromycin resistance gene and the like.

  Examples of the replication origin include replication origins derived from Ti or Ri plasmids. DNA linked to a promoter can be directly introduced into plant cells using a microinjection method, electroporation method, polyethylene glycol method, fusion method or the like. In addition, the DNA can be incorporated into a plasmid vector for gene introduction into a plant and indirectly introduced into a plant cell via a virus or bacterium capable of infecting the plant. As such viruses, for example, cauliflower mosaic virus, gemini virus, tobacco mosaic virus, brom mosaic virus and the like can be used. As bacteria, Agrobacterium tumefaciens (hereinafter referred to as A. tumefaciens), Agrobacterium -Rhizogenes etc. can be used. Examples of plasmids used for gene introduction into plants by the Agrobacterium method using A. tumefaciens include pBI101 and pBI121 (both from Clontech).

  Plant cells into which a vector is introduced in the present invention include various forms of plant cells, such as suspension culture cells, protoplasts, leaf sections, and callus.

  According to the method for producing an HPPD-inhibiting herbicide-resistant plant comprising the steps of transforming a plant cell with an HPPD gene of the present invention, and regenerating the transformed plant to obtain a plant body, Plants having drug resistance can be obtained.

  Further, according to the present invention, auren and other various plants (for example, poppy family (Hanabiso peri, poppy), grass family (rice, corn), solanaceous plant (tomato, potato), legume (soybean), etc.) Therefore, it is also possible to mass-produce tocopherol / plastoquinone.

Protein of the present invention, gene encoding the same and method of use thereof The protein of the present invention includes a protein consisting of the amino acid sequence represented by SEQ ID NO: 2, one or several amino acids in the amino acid sequence represented by SEQ ID NO: 2 72% or more homology at the amino acid level with a protein consisting of an amino acid sequence deleted, substituted or added and acting as a herbicide-resistant HPPD enzyme, or a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 And a protein that acts as a herbicide-resistant HPPD enzyme.

  In addition, the protein of the present invention may be fused with a known tag such as HA or Flag for facilitating protein purification or detection at the terminal or with a heterologous protein. The protein of the present invention may be subjected to various modifications such as N-glycosylation.

  The protein according to the present invention may be obtained by recombinant production as described below, or may be isolated and purified from various sources including plant cells.

  A general method for preparing recombinant HPPD is to purify the expressed protein by inserting the HPPD gene of the present invention into an appropriate expression vector, introducing the vector into an appropriate cell, and culturing transformed cells. Including. The recombinant protein may be expressed as a fusion protein with another protein for the purpose of facilitating purification or the like. Examples of fusion proteins include fusion proteins with maltose-binding proteins (vector pMAL series released by New England BioLabs, USA) and fusion proteins with glutathione-S-transferase (GST) (vector pGEX series released by Amersham Pharmacia Biotech). And fusion proteins with histidine tags (Novagen's pET series). The host cell is not particularly limited as long as it is a cell suitable for expression of a recombinant protein, and examples thereof include E. coli, yeast, animal cells, plant cells, and insect cells. Various methods known to those skilled in the art can be used for introducing a vector into a host cell. For example, for introduction into E. coli, introduction methods using calcium ions (Mandel, M. & Higa, A. Journal of Molecular Biology, 53, 158-162 (1970), Hanahan, D. Journal of Molecular Biology, 166 557-580 (1983)). The recombinant protein expressed in the host cell can be purified and recovered from the host cell or its culture supernatant by methods known to those skilled in the art. When the recombinant protein is expressed as a fusion protein with a maltose binding protein or the like, it can be easily recovered by affinity purification.

  If the obtained recombinant protein is used, an antibody that binds to the protein can be prepared. For example, a polyclonal antibody can be prepared by immunizing an animal such as a rabbit with the purified protein of the present invention or a part thereof, and collecting blood after a certain period of time. The monoclonal antibody is obtained by fusing an antibody-producing cell of an animal immunized with the protein or a part thereof with a bone tumor cell, and isolating a single clone cell (hybridoma) that produces the target antibody. It can be prepared by obtaining an antibody from The antibody thus obtained can be used for purification and detection of the protein of the present invention. The present invention includes antibodies that bind to the proteins of the present invention.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further in detail, this invention is not restrict | limited to these Examples.

  The present inventors have found that our auricular cultured cells are more resistant to DTP than tobacco cultured cells. FIG. 3 is a graph showing the growth of tobacco cultured cells in the presence of DTP, and FIG. 4 is a graph showing the growth of cultured aurene cells in the presence of DTP.

  Based on this finding, the present inventors isolated full-length cDNA encoding HPPD from Ouren cells. The inventors provide the nucleotide sequence of HPPD cDNA derived from Ouren. The nucleotide sequence (1293 bp) encodes a protein of 430 amino acid residues with a molecular weight of 47.3 kDa and has a specific C-terminal region similar to HPPD from other species.

The recombinant HPPD gene expressed in E. coli converted p-hydroxyphenylpyruvate (HPP) to homogentisic acid. This indicates that this gene encodes a functional HPPD. Enzymatic analysis of recombinant HPPD showed that the IC ₅₀ value for DTP (which is the active body of the herbicide pyrazolate) was 6.75 μM and the Km value for HPP was 43 μM. This IC ₅₀ value is dramatically higher than the values reported for HPPD derived from various plants, and the herbicide resistance of the HPPD of the present invention is higher than that of HPPD derived from a conventionally known plant (carrot). It was about 500 times higher. The IC ₅₀ value for the hydrolyzate of the herbicide benzobicyclon was 1.2 μM.

Experimental Procedure Plant material Auricular cultured cells (156-SMT) and tobacco NII cells were used. Ouren cells were cultured in LS (Linsmaier-Skoog) liquid medium containing 10 μM naphthalene acetic acid and 0.01 μM 6-benzyladenine. Tobacco cells were cultured in LS liquid medium containing 10 μM NAA and 1 μM kinetin. Suspended cultured cells in a 100 ml Erlenmeyer flask, 20 ml medium in a rotary shaking incubator, 90 rpm, 25 ° C, Ouren cells in the dark, tobacco cells 3000 lux, 16-hour light conditions Maintained. The herbicide DTP was added as a methanol solution at various concentrations to the liquid medium. Cultured cell growth was measured as total tissue fresh weight in one 100 ml Erlenmeyer flask after 3 weeks treatment with DTP.

Reagents p-Hydroxypyruvic acid was purchased from Aldrich. Homogentisic acid was purchased from Sigma. DTP was acquired from Sankyo Pharmaceutical. The benzobicyclone hydrolyzate was obtained from SDS Biotech.

Isolation of full-length cDNA of HPPD from our cDNA library A cDNA library was prepared from our cultured cells and sequenced. 1014 ESTs were sequenced and their function was estimated using a BLASTX search (http; // www.ncbi.nih.gov/BLAST. (E. Dubouzet et. Al)). By a BLASTX search, we found an EST clone encoding HPPD. In order to obtain further sequence information of this clone, it was decided to determine the full-length cDNA sequence.

  5'RACE was performed using GeneRacer kit (Invitrogen) to isolate the full length cDNA of HPPD from ouren. A gene-specific reverse primer (5'CATGCGTAGCGACACATCGCGCGGGGT3 ') was designed based on the nucleotide sequence of EST found earlier. The PCR fragment was isolated and subcloned into the pGEM T easy vector (Promega) and its nucleotide sequence determined.

Alignment analysis of putative protein sequences The putative protein sequences were aligned using Clustal W and Boxshade (www.ch.embnet.org/software/BOX form.html.). Clustal W was also used to calculate the phylogenetic tree.

Construction of Expression Vector pET21d Containing Ouren HPPD Gene Using PCR amplification of full-length Ouren HPPD cDNA, an expression vector for Escherichia coli for mature Ouren HPPD not containing transit peptide was constructed in pET21d. The following oligonucleotides were used for PCR:
Forward primer, 5'TACTAA CCATGG TTCCCAGCACAGCCTCCA3 '(SEQ ID NO: 3) (this included an NcoI restriction site containing the ATG translation initiation codon (underlined);
Reverse primer, 5'TAT GAATTC TCAAATGCAACTATGCAGCAACA3 '(SEQ ID NO: 4) (complementary to the 3' end of the cDNA, and an EcoRI restriction site was included 6 bp after the TGA stop codon (underlined).

  PCR was performed under the following conditions: initial denaturation step, 2 minutes, 94 ° C; 15 cycles of 15 seconds, 94 ° C denaturation, 30 seconds, 56 ° C annealing, 2 minutes, 68 ° C DNA extension 30 cycles And the final extension at 68 ° C. for 5 minutes, using KOD-plus DNA polymerase (Toyobo). The PCR fragment was subcloned into the pET21d vector (Novagen) cut with NcoI and EcoRI restriction enzymes. Ouren HPPD cDNA fragment was placed under the control of T7 polymerase promoter in pET21d. Both strands of the DNA insert were sequenced to confirm that no mutations were introduced during PCR amplification.

Expression of recombinant auren HPPD in Escherichia coli An auren HPPD expression plasmid (pET21d) was introduced into E. coli BL21 (DE3). These recombinant E. coli cells were cultured in 100 ml of LB medium containing 100 mM ampicillin at 30 ° C. and 120 rpm. IPTG (isopropyl-β-D-thiogalactoside) was added to a final concentration of 1 mM when the OD ₆₀₀ of E. coli reached 0.6. The cells were further cultured at 30 ° C. for 8 hours.

  Cells were harvested by centrifugation at 14,000 rpm for 5 minutes at 4 ° C. The pellet was resuspended in 5 ml extraction buffer (50 mM Tris-HCI, 10% glycerol, 5 mM 2-mercaptoethanol) and sonicated with Handy Sonic (UR-ZOP, TOMY SEIKO co. LTD) 5 for 15 seconds x 6 times). The crude extract was centrifuged at 14,000 rpm for 5 minutes to obtain a cell-free supernatant. The precipitated protein was removed by centrifugation at 14,000 rpm for 5 minutes. The supernatant was desalted with a PD-10 column (Amersham Bioscineces) and used to measure HPPD enzyme activity.

Electrophoretic analysis of proteins Recombinant proteins were separated by SDS-polyacrylamide gel electrophoresis containing 10% acrylamide. Protein samples were treated with 2XSDS-PAGE sample solution (0.125 M Tris-HCl, pH 6.8, 20% glycerol, 10% 2-mercaptoethanol, 4% SDS). The developed gel was stained with Coomassie Brilliant Blue R-250. The protein concentration was measured by the Bradford method using bovine serum albumin as a standard.

Enzyme activity assay of recombinant auren HPPD HPPD activity was measured by HPLC and LC-MS. The 100 μL standard enzyme reaction mixture consisted of: 100 mM potassium phosphate buffer, pH 6.5, 50 mM ascorbic acid, 10 μL (37.18 μg of desalted protein) enzyme preparation and 200 μM p-hydroxy. Phenylpyruvic acid (pH 7.7). However, the concentration of p-hydroxyphenylpyruvic acid was various concentrations of 2 μM-200 μM in the measurement of kinetic parameters.

  Herbicide DTP was added to the solution as a solution of 0.5% dimethyl sulfoxide (DMSO). The reaction mixture was incubated for 5 minutes at 30 ° C. The reaction was stopped by the addition of trichloroacetic acid (final concentration 2%). After the protein precipitated, the reaction product was quantified using reverse phase HPLC (equipped with Shimadzu LC-10A system).

  TCA supernatant (50 μl or 20 μl) was injected onto a Cl8 column and eluted at a flow rate of 0.8 mL / min. The mobile phase was 10 mM acetic acid-methanol (85:15 [Vol / Vol]). The assay for HPPD activity was based on the determination of the amount of homogentisic acid formed by HPLC and UV absorbance at 280 nm. Homogentisic acid was quantified by measuring the peak area. Using the calibration curve, the peak area was converted into the amount of homogentisic acid. The formation of the product homogentisic acid was confirmed by LC-MS (LC-MS-2010, Shimadzu Corporation, negative mode, solvent 20 mM ammonium acetate pH 5.5, flow rate 0.5 m1 / min).

  The kinetic constant of the crude enzyme was determined by varying the substrate concentration. The data was fitted to the Michaelis-Menten equation by nonlinear least square iteration using KaleidaGraph (Synergy Software, Reading, PA).

HPPD inhibition experiment using benzobicyclone hydrolyzate The HPPD inhibition experiment using benzobicyclone hydrolyzate was performed in the same manner as the above inhibition experiment using DTP, except for the following points.
30 concentrations of inhibitor benzobicyclon hydrolyzate and enzyme solution (100 mM potassium phosphate buffer, pH 6.5, 50 mM ascorbic acid, 10 μL (37.18 μg of desalted protein) enzyme preparation) at various concentrations. Incubate at 5 ° C for 5 minutes to sufficiently react the inhibitor with the enzyme, then add the substrate (200 µM p-hydroxyphenylpyruvic acid (pH 7.7)) to the enzyme solution and carry out the enzyme reaction for 10 minutes. It was. The formation of the product homogentisic acid was confirmed by LC-MS (LC-MS-2010, Shimadzu Corporation, negative mode, solvent 20 mM ammonium acetate pH 5.5, flow rate 0.5 m1 / min).

Results Inhibition of growth of cultured cells by DTP The inhibition of growth of cultured cells of tobacco and auren by DTP was examined. DTP showed significant growth inhibition on cultured tobacco cells, and 3, 30, and 100 μM DTP reduced the cell weight to 50.8, 23.8, and 5.5%, respectively (FIG. 3). On the other hand, DTP showed almost no inhibition of growth at a concentration of up to 100 μM against cultured aurene cells (FIG. 4). Therefore, it was clarified that cultured cells of the auren are resistant to DTP, a herbicide targeting HPPD. This suggested that the HPPD of our auricular cultured cells is herbicide resistant.

Sequence analysis of HPPD-like clones
A cDNA library was prepared from aoren cells producing large amounts of alkaloids, and 1014 ESTs were obtained. A BLAST search (hppt: //www.ncbi.nlmgov/blast/) indicated that these sequenced clones contained HPPD clones. The cDNA insert in this HPPD clone was approximately 1539 bp in length and had a poly (A) tail at its 3 ′ end. Several amino acid domains were highly conserved between the deduced amino acid sequence of the DNA insert of the Auren HPPD clone and the Arabidopsis sequence, and these two domain sequences showed 80% identity to each other. From these results, the present inventors speculated that the insert of Ouren HPPD is a partial cDNA encoding the C-terminal part of HPPD. To examine whether it was a full-length cDNA, we isolated the full-length cDNA by 5'RACE using cDNA-specific primers and total RNA isolated from cultured aurene cells.

  The isolated auren HPPD was 2183 bp long and contained an ORF encoding a 430-amino acid polypeptide (molecular weight 47.3 kDa). The ORF of Ouren HPPD was sandwiched between a 208 bp 5 'untranslated region and a 3' untranslated region containing 194 bp poly (A).

  Alignment of Ouren HPPD with other species of HPPD (FIG. 5) showed a high identity with HPPD of other plants, with the highest identity with Arabidopsis, 71.0%. The identity with human (30.5%) and S. avermilitis (32.4%) was low. Various species of HPPD sequences, including aurene, were highly conserved in the C-terminal region of the protein. Amino acid residues believed to be active sites of proteins from corn and Arabidopsis were also present in the auren HPPD sequence. And, like HPPD from other plants, our HPHP also had an N-terminal extension of the amino acid, but this extension in ours was shorter than in other plants. Plant HPPD is believed to differ significantly at the N-terminus from bacterial and mammalian HPPD in that it has an extension of at least 30 amino acids. These residues may be targeting signals to the intracellular compartment, i.e. transport signals to the chloroplast.

  Phylogenetic trees have shown that both prokaryotic and eukaryotic forms of HPPD are members of the same protein family. Ouren HPPD, Arabidopsis HPPD and A. theophrasti HPPD are in the same cluster (Figure 6).

Expression of the full-length cDNA of HPPD in E. coli The amino acid sequence suggested that the isolated cDNA encodes Ouren HPPD. In order to confirm the identity of this clone, a recombinant protein was produced in E. coli. In order to examine the activity of HPPD, the present inventors constructed an expression vector that produces a recombinant protein in E. coli. In order to produce a mature polypeptide, the present inventors introduced an NcoI site into the cDNA so as to match the start codon in the expression vector pET-21d for E. coli. This construct was then introduced into E. coli cells to induce the production of recombinant protein. The crude E. coli enzyme extract was desalted with a PD-10 column, and the desalted solution was used for detection of HPPD activity. SDS / PAGE analysis clearly showed that transgenic expression was induced. The subunit molecular weight was estimated to be approximately 51 kDa (FIG. 7).

  E. coli carrying the pET-HPPD construct showed a dark brown color in both liquid and solid media, whereas E. coli carrying an empty pET-21d vector did not show such a dark brown color (data not shown) ). Similar dark brown coloration has been observed with HPPD of other origins. This dye is the product of oxidative polymerization of homogentisic acid synthesized by recombinant HPPD. When the reaction mixture was subjected to HPLC analysis, it was clearly shown that the recombinant E. coli enzyme crude extract produced a compound that behaved exactly the same as the homogentisic acid standard (FIG. 8). The control E. coli lysate containing the empty pET-21d vector did not produce this peak at the same position.

  These results indicated that the isolated auren HPPD cDNA encodes a functional HPPD. LC-MS analysis confirmed that homogentisic acid was produced from p-hydroxyphenylpyruvic acid by the recombinant Escherichia coli enzyme crude extract.

Characterization of recombinant HPPD Since HPPD activity was confirmed, we further characterized the enzymatic properties of HPPD using desalted recombinant enzyme.
First, we optimized the pH conditions for the HPPD reaction using p-hydroxyphenylpyruvic acid as a substrate. Enzymatic assays at various pHs revealed that the optimum pH for the conversion reaction of HPP to homogentisic acid was approximately 6.5. Time course studies revealed that homogentisic acid accumulation was linear for at least 10 minutes in the presence of 10 μl demineralizing enzyme (37.2 μg protein) and 200 μM p-hydroxyphenylpyruvic acid. The optimum temperature was 30 ° C.

  Next, the substrate affinity of the recombinant HPPD was measured by HPLC analysis using HPP as a substrate. When the substrate concentration was varied, the reaction followed the Michaelis-Menten-type kinetics. The kinetic parameter, Km, was estimated to be 43.2 μM, which was higher than reported for HPPD from other plants.

Inhibition of HPPD activity by DTP DTP is known to act as an HPPD inhibitor. Matsumoto et al. (2002) showed that DTP inhibits HPPD with an IC ₅₀ value of 13 nmol / L by HPPD assay using highly active extracts from carrot cultured cells (FIG. 9). .

In order to detect the effect of DTP on recombinant auren HPPD, we added various concentrations of DTP in 0.5% dimethyl sulfoxide (DMSO) to the enzyme reaction, followed by the enzyme. DTP showed inhibition against recombinant auren HPPD at a higher concentration than carrot cell extract. DTP inhibited Ouren HPPD with an IC ₅₀ value of 6.75 μM (FIG. 10). This indicates that our HPLD is about 500 times more resistant to the active body DTP of the herbicide pyrazolate than the carrot HPPD.

HPPD inhibition experiment using benzobicyclon hydrolyzate In order to detect the effect of benzobicyclon hydrolyzate on recombinant aurene HPPD, we performed enzymatic reactions with various concentrations of benzobicyclon hydrolyzate solution. After adding to the solution, p-hydroxyphenylpyruvic acid as a substrate was added. The enzyme activity was expressed as a relative activity based on the peak area of homogentisic acid, with the activity without the inhibitor benzobicyclone hydrolyzate as 100%. The benzobicyclone hydrolyzate inhibited our HPHP with an IC ₅₀ value of 1.2 μM (FIG. 11).

  The HPPD of the present invention exhibits herbicide resistance and is very useful. The HPPD and HPPD genes of the present invention can be used for the production of plastoquinone / tocopherol.

Claims (14)

The following gene (a) or (b):
(A) a gene encoding a herbicide-resistant p-hydroxyphenylpyruvate dioxygenase enzyme, comprising a polynucleotide comprising the first to 1293 bases of the base sequence represented by SEQ ID NO: 1;
(B) hybridizes under stringent conditions with a polynucleotide comprising the first to 1293 bases of the base sequence represented by SEQ ID NO: 1, and encodes a herbicide-resistant p-hydroxyphenylpyruvate dioxygenase enzyme A gene comprising a polynucleotide to be   A gene encoding a herbicide-resistant p-hydroxyphenylpyruvate dioxygenase enzyme comprising a polynucleotide comprising the first to 1293th bases of the base sequence represented by SEQ ID NO: 1. De tosyl pyrazolate of the p- hydroxyphenylpyruvate dioxygenase _{IC 50} for the enzyme is above 4.05MyuM, according to claim 1 or 2 gene.   The gene according to any one of claims 1 to 3, wherein the gene is derived from auren. The following (c) or (d) p-hydroxyphenylpyruvate dioxygenase enzyme:
(C) a herbicide-resistant p-hydroxyphenylpyruvate dioxygenase enzyme consisting of the amino acid sequence represented by SEQ ID NO: 2,
(D) A p-hydroxyphenylpyruvate dioxygenase enzyme consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having herbicide resistance.   A herbicide-resistant p-hydroxyphenylpyruvate dioxygenase enzyme consisting of the amino acid sequence represented by SEQ ID NO: 2. De tosyl pyrazolate of the p- hydroxyphenylpyruvate dioxygenase IC ₅₀ for the enzyme is above 4.05MyuM, claim 5 or 6 of p- hydroxyphenylpyruvate dioxygenase enzyme.   The p-hydroxyphenylpyruvate dioxygenase enzyme according to any one of claims 5 to 7, which is derived from aurene.   A recombinant vector comprising the gene according to any one of claims 1 to 4.   A transformed plant cell comprising the recombinant vector of claim 9.   A transformed plant comprising the transformed plant cell of claim 10.   A p-hydroxyphenylpyruvate dioxygenase-inhibiting herbicide comprising the steps of transforming a plant cell with the gene of any one of claims 1 to 4 and re-differentiating the transformed plant cell to obtain a plant body A method for producing resistant plants.   12. A method for controlling weeds in a field where a transformed plant according to claim 11 is cultivated, wherein an effective amount of p-hydroxy is used to control the target weed without substantially changing the transformed plant. Applying a phenylpyruvate dioxygenase-inhibiting herbicide to a field. 14. The method of claim 13, wherein the p-hydroxyphenylpyruvate dioxygenase inhibitor herbicide is pyrazolate.

Images