JPWO2006132022A1 - Simple detection method for methylcytosine - Google Patents

Abstract

Provided is a simple method capable of determining whether a target base in a test DNA is cytosine or methylcytosine. A method for detecting methylation of cytosine in a DNA sample, comprising a first step of hybridizing a DNA sample and a guide probe so that the target cytosine or methylcytosine forms a bulge structure or mismatch, and a bulge structure or A method for detecting methylcytosine comprising a second step of inducing a reaction specific to cytosine or methylcytosine forming a mismatch and detecting methylation based on the presence or absence of this reaction.

Description

  The present invention relates to a methyl cytosine detection method for determining whether a target base in a DNA sample is cytosine or methyl cytosine, and a probe, kit, nucleic acid chip, and methyl cytosine detection device used therefor.

  Epigenetics consists of DNA methylation that physiologically modifies the genome, chromatin, which is a complex of DNA and protein, and post-translational modification of many proteins that make up chromatin. I have control.

  Regarding the modification of histones in chromatin, chromatin structural conversion by histone modification plays an important role in the induction of transcription. For example, acetylation by histone acetylase triggers chromatin remodeling, and transcription by basic transcription factors and RNA polymerase begins. Histone methylation and phosphorylation also cause transcriptional control, silencing, and chromatin condensation.

  In many eukaryotes, 60 to 90% of CpG dinucleotides in the genome undergo methylation at the 5th carbon atom of cytosine. Methylated CpG is found in heterochromatin and transposons containing many repetitive sequences, and is thought to suppress the activation of viruses and transposons. CpG methylation and histone modification are coordinated with each other.

  Exceptionally, the CG rich region (CpG island) in the promoter region of many genes is not methylated. Furthermore, as an exception, CpG islands are methylated in the imprinted gene, the female inactivated X chromosome. CpG islands are also methylated in the promoter region of a tumor suppressor gene in cancer cells. Therefore, methylation of cytosine can be used as a marker for cancer occurrence, recurrence, and metastasis, and there is a need for a simple method for detecting whether cytosine in a gene is methylated.

  In Patent Documents 1 and 2, DNA samples are treated with bisulfite to change unmethylated cytosine to uracil, and then PCR is performed using primers that preferentially amplify methylated cytosine over uracil. It teaches how to determine whether cytosine has been methylated by detecting the presence or absence of amplification. However, since this method changes the cytosine that occupies the majority instead of methylcytosine, the conversion efficiency of all cytosines affects the determination result, and the determination accuracy decreases accordingly.

  Patent Document 3 teaches a method for determining the DNA methylation rate by contacting an antibody that specifically binds to 5-methylcytosine with single-stranded DNA and measuring the amount of antibody bound to the DNA strand. ing. However, this method requires preparation of antibodies and amplification of DNA samples by PCR, which is troublesome.

Non-Patent Document 1 teaches that it is possible to detect whether or not a mismatch exists in double-stranded DNA by oxidizing a double-stranded DNA sample with potassium permanganate and hydroxylamine and then treating with piperidine. Yes. This method requires hydroxylamine (see FIGS. 2 and 3). However, this method can only detect the presence of mismatches and cannot distinguish between cytosine and methylcytosine in DNA samples.
Special table 2004-527241 Special table 2004-500892 Special table 2004-347508 Chinh Bui et al., “Chemical cleavage reactions of DNA on solid support: application in mutation detection”, BMC Chemical Biology, 2003, Vol.3

  An object of the present invention is to provide a simple method capable of determining whether a target base in a DNA sample is cytosine or methylcytosine, and a probe, kit, nucleic acid chip, and methylcytosine detection apparatus used therefor. .

In order to solve the above-mentioned problems, the present inventors have conducted research and obtained the following knowledge.
(i) In order to distinguish between methylcytosine and cytosine, if a specific reaction is induced to methylcytosine or cytosine and the presence or absence of the reaction is detected, it is determined whether the target base is cytosine or methylcytosine. Can be determined. However, such a reaction is caused equally with respect to the base of each nucleotide in the DNA sample, and the reaction cannot be caused only with respect to the target base in question whether it is cytosine or methylcytosine.
(ii) Therefore, if a DNA sample is hybridized with a guide probe (bulge-forming probe) complementary to both adjacent regions except for the nucleotide having the target base, only the nucleotide having the target base can be removed from the double helix. A bulge structure that protrudes to the outside is formed, and other nucleotides in the DNA sample are buried in the double helix structure, so that the reaction can be caused only by the target base.

In addition, if a guide probe (mismatch forming probe) in which only the target base and the corresponding base are mismatched is hybridized with the DNA sample, the base pair including the nucleotide having the target base is loosened in the double helix. Since it takes a structure and other nucleotides in the DNA sample are buried in the double helix structure, the reaction can be caused only to the target base.
(iii) Since methyl cytosine is more susceptible to oxidation than methyl cytosine than cytosine, cytosine and methyl cytosine can be distinguished by the presence or absence of oxidation.

Therefore, as a reaction specific to methylcytosine, it is possible to determine whether the nucleotide is cytosine or methylcytosine by inducing an oxidation reaction only on the target base and detecting the presence or absence of the oxidation reaction product. .
(iv) When the oxidized DNA is treated with a basic substance, the N-glycoside bond between the oxidized methylcytosine base and sugar is degraded, and the nucleotide having the oxidized methylcytosine and the adjacent nucleotide The phosphodiester bond between is also hydrolyzed. Therefore, after treating with a basic substance, it is possible to determine whether the base in question is cytosine or methylcytosine by detecting the size of the DNA fragment by PCR or the like.
(v) It is also possible to determine whether the base is cytosine or methylcytosine by labeling the target base oxidation reaction product. In this case, if methylcytosine is present in a single-stranded portion that does not hybridize with the probe in the DNA sample, it is oxidized to produce an aldehyde, which causes false detection. In order to avoid this, after hybridizing the bulge-forming probe and the DNA sample, before the oxidation treatment, the hybridized product is treated with a single-stranded DNA-specific exonuclease to remove the single-stranded portion. That's fine.
(vi) As a labeling method, there is a method in which the oxidation reaction product is further oxidized to produce an aldehyde, and this aldehyde is labeled with an enzyme via, for example, an imino group. According to this method, the enzyme is labeled only when the base in question is methylcytosine.
(vii) When DNA is treated with bisulfite, cytosine is changed to uracil, but methylcytosine is not changed. When the bisulfite-treated DNA is treated with uracil DNA glycosidase and then treated with a basic substance, when the target base is uracil, the N-glycoside bond between uracil and sugar is decomposed, The phosphodiester bond between the nucleotide that had uracil and the adjacent nucleotide is hydrolyzed. Therefore, it is possible to determine whether the target base is cytosine or methylcytosine by detecting the size of the resulting DNA fragment by PCR or the like.

The present invention has been completed based on the above findings, and provides the following method for detecting methylcytosine and the like.
Item 1. A method for detecting cytosine methylation in a DNA sample, comprising:
A first step of hybridizing a DNA sample and a guide probe so that the target cytosine or methylcytosine forms a bulge structure or mismatch;
A method for detecting methylcytosine comprising a second step of inducing a reaction specific to cytosine or methylcytosine forming a bulge structure or mismatch, and detecting methylation based on the presence or absence of this reaction.
Item 2. The first step is a step of hybridizing the DNA sample and the guide probe so that the target cytosine or methylcytosine forms a bulge structure,
Item 2. The method for detecting methylcytosine according to item 1, wherein the second step is a step of inducing a reaction specific to the cytosine or methylcytosine forming a bulge structure and detecting methylation based on the presence or absence of this reaction.
Item 3. Item 2. The method for detecting methylcytosine according to item 1, wherein a reaction specific to methylcytosine is induced in the second step.
Item 4. The methyl according to Item 3, wherein the second step includes a second A step in which an oxidizing agent is allowed to act on cytosine or methylcytosine forming a bulge structure or mismatch, and a second B step in which the presence or absence of an oxidation reaction product due to the oxidizing agent is detected. Cytosine detection method.
Item 5. Item 5. The method for detecting methylcytosine according to Item 4, wherein the step 2B includes a step of allowing a basic substance to act.
Item 6. Item 6. The method for detecting methylcytosine according to Item 5, wherein the step 2B includes a step of detecting a fragment of the DNA sample after the step of applying a basic substance.
Item 7. Item 7. The method for detecting methylcytosine according to item 6, wherein a fragment of a DNA sample is detected by amplifying a region containing cytosine or methylcytosine that forms a bulge structure or mismatch.
Item 8. Item 6. The methylcytosine detection method according to Item 5, wherein a nitrogen-containing material is used as the basic material.
Item 9. Item 4. The method for detecting methylcytosine according to Item 3, comprising a step of removing the single-stranded portion of the hybridized product by exonuclease treatment after the first step.
Item 10. Item 10. The method for detecting methylcytosine according to Item 9, wherein the step 2B includes a step of labeling the oxidation reaction product generated in the step 2A and a step of detecting the labeling substance.
Item 11. Item 11. The method for detecting methylcytosine according to Item 10, wherein the step 2B includes a step of further performing a second oxidation treatment on the oxidation reaction product by the oxidizing agent.
Item 12. Item 11. The method for detecting methylcytosine according to Item 10, wherein labeling is performed using a labeling enzyme.
Item 13. Item 5. The method for detecting methylcytosine according to Item 4, wherein the oxidation reaction product of the target base in Step 2B is an oxidation reaction product of the 5-position carbon atom of the pyrimidine ring.
Item 14. Step 2A is a step of causing an oxidizing agent to act on cytosine or methylcytosine forming a bulge structure or mismatch to form an osmium-containing heterocyclic group represented by formula (5) in the methylcytosine moiety,
Item 5. The method for detecting methylcytosine according to Item 4, wherein the step 2B is a step of detecting the presence or absence of the osmium-containing heterocyclic group.

(Wherein R1 and R2 are the same or different and each represents a hydrogen atom, an alkyl group, or a substituted alkyl group)
Item 15. Item 15. The methylcytosine according to item 14, wherein the step 2B includes a step of labeling the osmium-containing heterocyclic group represented by the formula (5) with a labeling substance and a step of detecting the labeled osmium-containing heterocyclic group. Detection method.
Item 16. The guide probe used in the first step is a guide probe to which a fluorescent material is bound, and the second B step uses a fluorescent material that causes fluorescence resonance energy transfer with respect to the fluorescent material. And a step of measuring the presence or absence of fluorescence resonance energy transfer.
Item 15. The method for detecting methylcytosine according to Item 14.
Item 17. The guide probe used in the first step is a guide probe to which a fluorescent material that is quenched by the presence of the osmium-containing heterocyclic group represented by the formula (5) is bound, and the second B step is the quenching of the fluorescent material Is a step of measuring the presence or absence of
Item 15. The method for detecting methylcytosine according to Item 14.
Item 18. The method for detecting methylcytosine according to claim 1, wherein the reaction specific to the target base in the second step is a reaction specific to cytosine.
Item 19. Item 19. The methylcytosine detection method according to Item 18, wherein the second step includes a second C step of treating the target base with bisulfite and a second D step of detecting uracil generated in the second C step.
Item 20. In the second step, in the hybridized product obtained in the first step, the second E step of cross-linking the guide probe and methylcytosine in the DNA sample, and the presence or absence of cross-linking between the guide probe and the DNA sample. Item 4. The method for detecting methylcytosine according to Item 3, comprising a second F step of detection.
Item 21. Item 2. The method for detecting methylcytosine according to Item 1, wherein the length of the guide probe is 20 to 100 bases.
Item 22. Item 6. The method for detecting methylcytosine according to Item 5, wherein the length of the guide probe is 40 to 100 bases.
Item 23. Item 2. The method for detecting methylcytosine according to Item 1, wherein the guide probe is bound to a solid phase carrier.
Item 24. A probe for detecting methylcytosine complementary to a region excluding a nucleotide having a target base to be detected whether it is cytosine or methylcytosine in a DNA sample.
Item 25. A probe for detecting methylcytosine which hybridizes with a DNA sample and which mismatches only with a target base to detect whether it is cytosine or methylcytosine in a DNA sample.
Item 26. Item 26. A hybridized product of the probe according to Item 24 or 25 and a DNA sample.
Item 27. Item 26. A kit for detecting methylcytosine comprising the probe according to item 24 or 25 and a reagent capable of oxidizing methylcytosine.
Item 28. Item 28. The kit for detecting methylcytosine according to item 27, comprising a basic substance capable of cleaving a bond between a nucleotide having oxidized methylcytosine and a nucleotide adjacent thereto.
Item 29. And specifically degrades exonuclease single-stranded DNA, NH 2 _NH- group at the terminal, or a biotin or avidin with a NH 2 _O-group, and the labeling enzyme linked to avidin or biotin, a chromogenic substrate of the labeling enzyme Item 28. A kit for detecting methylcytosine according to Item 27.
Item 30. Item 28. A kit for detecting methylcytosine according to item 27, comprising an exonuclease that specifically degrades single-stranded DNA and a labeling substance of the following formula (1) or (2).

(In the formula, R represents a labeling substance.)

(In the formula, R represents a labeling substance.)
Item 31. Item 28. The kit for detecting methylcytosine according to item 27, comprising osmate and bipyridine as a reagent capable of oxidizing methylcytosine.
Item 32.
32. The methyl cytosine detection kit according to claim 31, wherein the methyl cytosine detection probe has a fluorescent substance bound thereto.
Item 33. Item 32. The methylcytosine detection kit according to Item 31, wherein the methylcytosine detection probe is formed by binding a fluorescent substance that is quenched by the presence of the osmium-containing heterocyclic group represented by formula (5).
Item 34. Item 26. A kit for detecting methylcytosine comprising the probe according to Item 24 or 25 and bisulfite.
Item 35. Item 26. A kit for detecting methylcytosine, comprising the probe according to item 24 or 25 to which a group capable of specifically binding to methylcytosine is bound.
Item 36. Item 26. A nucleic acid chip in which one or more of the probes according to Item 24 or 25 are immobilized on a substrate.
Item 37. Item 37. A methylcytosine detection device comprising the nucleic acid chip according to Item 36 and a device capable of detecting a color development pattern on the chip.

It is a figure explaining the procedure of the 1st method of this invention. It is a figure explaining the procedure of the 2nd method of this invention. It is a figure which shows the result of the electrophoresis performed in Example 1 and Comparative Example 1. FIG. 6 is a diagram showing the results of electrophoresis performed in Example 2. FIG. 6 is a diagram showing the results of electrophoresis performed in Example 3. FIG. 6 is a diagram showing the results of electrophoresis performed in Example 4. FIG. 6 is a diagram showing the results of electrophoresis performed in Example 5. FIG. 10 is a diagram showing the results of electrophoresis performed in Example 6. It is a figure which shows the change of the fluorescence intensity by real-time PCR performed in Example 7. FIG. (A) shows that methylcytosine could be detected by using a bulge-forming probe, and (B) shows that methylcytosine could be detected by oxidation treatment. FIG. 6 is a graph comparing the amount of amplification product of real-time PCR performed in Example 7. FIG. It is a figure which shows the result of the rectangular wave voltammetry measurement performed in Example 8. It is a figure which shows the result of the measurement of the fluorescence intensity performed in Example 9. It is a figure which shows the result of the measurement of the fluorescence intensity performed in Example 10. 10 is a diagram showing the results of electrophoresis performed in Example 11. FIG.

Hereinafter, the present invention will be described in detail.
(I) Method for detecting methylcytosine A method for detecting methylation of cytosine in a DNA sample, wherein the DNA sample and a guide probe are hybridized so that the target base cytosine or methylcytosine forms a bulge structure or mismatch. It is a method comprising a first step of making soybeans and a second step of inducing a reaction specific to the target base that forms a bulge structure or mismatch and detecting methylation based on the presence or absence of this reaction.

  “Bulge structure of target base” refers to a target base (cytosine or methylcytosine) that has jumped out of the double strand without forming a base pair in a double-stranded nucleic acid formed by a DNA sample and a probe. A bulge consisting of nucleotides containing.

  If the second step is to induce a reaction specific to methylcytosine, the second step is, but is not limited to, a second A step of oxidizing cytosine or methylcytosine that forms a bulge structure or mismatch; And 2B step of detecting whether or not the target base is oxidized (specifically, whether or not the carbon atom is oxidized). In step 2B, if an oxidation reaction product is detected, it can be determined that the target base is methylcytosine.

  Furthermore, according to the determination method in the 2B step, it is classified into the first and second methods. The first step is common to both methods.

  In addition, when the second step induces a reaction specific to cytosine, the second step is not limited thereto, but the second step of treating the target base with bisulfite, and the step of converting the target base to uracil. 2D process of detecting the presence or absence of a change. In the second step D, it can be determined that the target base is cytosine when it is uracil. This method is a third method.

Further, the second step includes a second E step of cross-linking the guide probe and methylcytosine in the DNA sample in the hybridized product obtained in the first step, and a cross-linking of the guide probe and the DNA sample. The 2nd F process which detects the presence or absence of this can be included. In the second F step, when the guide probe and the DNA sample are cross-linked, it can be determined that the target base is methylcytosine. This method is the fourth method.
DNA sample The DNA sample may be a biological sample itself such as blood, urine, sputum, semen, hair, skin, etc., or may be isolated from a biological sample, but uses isolated DNA. It is preferable.
Hybridization As described above, in order to induce a reaction specific to a target base in a DNA sample, it is necessary for an oxidizing agent or the like to approach the target base. Usually, each nucleotide has a helical structure of double-stranded DNA. It is buried inside and the oxidant is inaccessible.

  Therefore, in the method of the present invention, as one option, a double-stranded DNA in which nucleotides having the base jump out to the outside without forming a base pair only for the target base, which is a problem whether it is cytosine or methylcytosine. Make it. For this purpose, for example, a DNA sample is hybridized with a guide probe complementary to a region excluding a nucleotide having a target base of the DNA sample, that is, a region on both sides adjacent to the region excluding the nucleotide having the target base. This guide probe is a bulge generating probe for forming a “bulge” of a nucleotide having a target base, which jumps out of double-stranded DNA.

  The probe is complementary to the regions on both sides. In addition to methylcytosine, thymine is susceptible to oxidation because it has a methyl group at the 5-position carbon of the pyrimidine ring. Accordingly, since it is necessary to avoid false detection of thymine, the probe is complementary to the regions on both sides. Moreover, it is designed so that only the target base does not form a base pair, so that even if thymine is present adjacent to the target base, it will not be oxidized and cause misdetection of methylcytosine.

  In the method of the present invention, as a second option, double-stranded DNA is prepared so that only the target base is mismatched. Methylcytosine isolated by mismatch is susceptible to oxidation as in the case of forming a basil structure. In order to make a mismatch only with the target base, a DNA probe and a guide probe that only mismatches with the DNA base may be hybridized. This guide probe is a mismatch generating probe for forming a loose structure consisting of mismatched base pairs in double-stranded DNA. Between the mismatch generating probe and the DNA sample, all base pairs are complementary except for mismatched base pairs.

  The suitable length of the guide probe varies depending on the method, and is usually preferably about 20 to 100 bases, more preferably about 20 to 50 bases. Among these, in the first method, about 40 to 100 bases are preferable, and about 50 to 80 bases are more preferable. Moreover, if it is this length, while being able to form a double strand stably, it can synthesize | combine with a DNA automatic synthesizer. In the first method, as will be described later, a nucleic acid amplification such as PCR may be performed on a double-stranded forming region with the probe, so that a probe long enough to allow PCR primers to bind is required.

  In addition, there is no particular limitation as to where the guide probe is designed to form a bulge or mismatch. Preferably, it may be designed so that the bulge or mismatch of the target base can be formed near the center of the double strand.

  The guide probe only needs to be complementary so that it can hybridize with the above region, and may be any of DNA, RNA, peptide nucleic acid (PNA), modified nucleic acid, and the like. When a DNA sample containing a nuclease such as a cell extract is used, it becomes difficult to be degraded by a nuclease by using a modified nucleic acid probe. Examples of the modified nucleic acid include phosphorothioate modified nucleic acid, morpholino modified nucleic acid, 2′-O-alkyl nucleic acid, 2′-N-alkyl nucleic acid, 2′-S-alkyl nucleic acid, 2′-halogen nucleic acid and the like. In addition, in order to stabilize hybridization, nucleotides having a modified base such as 2-aminoadenine and 5-alkynyluridine are arranged in the probe sequence, or the end or the inside of the probe is modified with amine, polyamine or the like. Alternatively, a dideoxynucleotide can be added to the end of the probe.

  In addition, the nucleic acid probe is preferably fixed to a bead-shaped or flat-shaped carrier, whereby different treatments are sequentially performed on the DNA sample bound to the probe, or the DNA sample is washed between the treatments. Can do. In addition, the probe can be reused. Examples of such a carrier material include polystyrene, gold, glass, magnetic iron oxide fine particles, and zinc sulfide fine particles having quantum dot properties.

Hybridization conditions are not particularly limited. Depending on the type of DNA sample, the length of the probe, etc., for example, after treatment with a hybridization solution such as pH 7 sodium phosphate buffer at room temperature to about 100 ° C. for about 5 minutes to 1 hour, pH 7 phosphorous The conditions include washing for about 1 to 5 minutes at about 5 to 25 ° C. using a sodium acid buffer or the like.
<First Method / Second Method>
In the first and second methods of oxidation treatment , the hybridization product containing the target base is treated with an oxidizing agent in the second step. When the target base is methylcytosine, the carbon atom having a methyl group is oxidized (first step). 2A step). A typical methylcytosine is 5-methylcytosine. Since 5-methylcytosine is more likely to be oxidized at the 5-position carbon atom of the pyrimidine ring than cytosine, the oxidized products are compared to detect the presence or absence of oxidation reactants (step 2B). it can.

  Typical examples of the structure after the oxidation reaction of the 5-methylcytosine portion of the DNA sample include a dihydroxy-substituted pyrimidyl group represented by the following formula (3) or an epoxy-substituted pyrimidyl group represented by the following formula (4). It is done.

In the method of the present invention, a known oxidizing agent capable of oxidizing a carbon atom can be used without limitation. As such an oxidizing agent, an oxidizing agent capable of oxidizing a double bond between the 5-position carbon atom and the 6-position carbon atom of the pyrimidine ring, for example, a permanganate such as potassium permanganate (KMnO ₄ ); Osmium tetroxide (OsO ₄ ), osmates such as potassium osmate (K ₂ OsO ₄ ), tungstates such as sodium tungstate (Na ₂ WO ₄ ), and sodium periodate (NaIO ₄ ) Periodate, hydrogen peroxide (H ₂ O ₂ ), t-butyl hydroperoxide (t-BuOOH), perbenzoic acid and its substitutes (m-chloroperbenzoic acid (mCPBA), 3,5-dinitro Perbenzoic acid), iodine (I ₂ ), rhenium oxide (Re ₂ O ₇ ), peracetic acid (AcOOH) and its substitutes, manganese-salen complexes, and the like. It is done.

In addition, an oxidizing agent capable of reoxidizing the oxidizing agent capable of oxidizing the carbon-carbon double bond when it is in a reduced state can be used. Examples of such a reoxidant include N-methylmorpholine N-oxide (NMO), potassium ferricyanide (K ₃ Fe (CN) ₆ ), and the like. Bipersulfates such as oxone (manufactured by DuPont) / potassium bipersulfate (KHSO ₅ ) may be mentioned as those containing a double bond oxidizing agent and its reoxidizing agent.

  In addition, oxidation aids such as vanadium oxide acetylacetonate, oxygen, hypochlorite such as sodium hypochlorite (NaOCl), and dimethyldioxirane can also be used.

  The oxidation treatment may be performed by adding an oxidizing agent aqueous solution having a concentration (for example, 0.1 to 1000 mM) according to the type of oxidizing agent to the hybridized product and at a temperature of about 0 to 40 ° C. for about 1 minute to 1 hour. The oxidation treatment is preferably performed under basic conditions of about pH 7 to 9, whereby the oxidation rate is increased and cytosine and methylcytosine can be more clearly distinguished. Moreover, if it is in the said pH range, a double strand will be maintained stably.

  Within the above range, suitable conditions may be selected according to the type of oxidizing agent. In addition, for example, osmate can be used in combination with an oxidizing activator such as potassium ferricyanide or methylmorpholine oxide.

In addition, the reaction rate is increased by adding about 10 to 500 mM of a compound capable of coordinating with an oxidizing agent such as pyridine, bipyridine, or phenanthroline to the oxidation reaction solution. In addition, when performing an oxidation treatment by adding bipyridine, it is necessary to treat with a sulfite such as Na ₂ SO ₃ in order to generate a dihydroxy-substituted pyrimidyl group represented by the formula (3). Such treatment conditions with sulfites are known.

Furthermore, in the presence of pyridine, bipyridine or phenanthroline, the combined use of an oxidizing agent capable of oxidizing a carbon-carbon double bond and a reoxidizing agent results in a significantly higher oxidation rate, resulting in cytosine and methylcytosine. Can be more clearly distinguished. Although the usage-amount of a reoxidant changes with the kinds, it can be normally set to about 10 mM-1M, and about 10-100 mM is preferable.
First Method The first method will be described with reference to FIG.

  In the first method, the oxidation product of the target base contained in the hybridized product is treated with a basic substance. This breaks down oxidized methyldeoxycytidylic acid into oxidized methylcytosine and sugar and hydrolyzes the phosphodiester bond between oxidized methyldeoxycytidylic acid and the adjacent nucleotide. Is done. Therefore, in the first method, an oxidizing agent that causes such decomposition by the basic substance treatment is used. If the oxidizing agent can oxidize the carbon atom of the base, such decomposition is caused by the basic substance treatment. As such an oxidizing agent, for example, those exemplified above can be used. Among these, in terms of oxidation reaction efficiency, osmates such as permanganate, osmium tetroxide, and potassium osmate are preferable, and osmium tetroxide is more preferable.

  Following the oxidation treatment, a basic substance treatment is performed (FIG. 1a). If the target base is methylcytosine, methylcytosine is oxidized, so that the region hybridized with the probe is cleaved at the nucleotide portion having the target base by the basic substance treatment. On the other hand, if the target base is cytosine, cytosine is not oxidized, and the region hybridized with the probe is not cleaved even by treatment with a basic substance. Therefore, if it is determined whether or not at least one phosphodiester bond between the nucleotide having the target base and both nucleotides adjacent thereto has been degraded, it is determined whether or not the target base is oxidized, and thus the target base is cytosine. Or methylcytosine can be determined. In other words, since specific cleavage occurs at the methylcytosine moiety by the basic substance treatment, the presence or absence of methylcytosine can be determined by measuring the size of the generated DNA fragment.

  As such a basic substance, for example, a nitrogen-containing basic substance such as piperidine or aniline can be used. Of these, piperidine is preferred because of its high reaction efficiency.

  The treatment with the basic substance may be carried out by adding an aqueous solution having an appropriate concentration to the DNA sample according to the kind thereof and at about 60 to 100 ° C. for about 1 minute to 1 hour.

  The presence or absence of decomposition of the phosphodiester bond can be known by detecting the size of a DNA fragment obtained by treatment with a basic substance containing a nucleotide having a target base.

  For example, a nucleotide having a target base is obtained by performing nucleic acid amplification on a region containing a nucleotide having a target base in a DNA sample after base treatment and detecting whether or not the entire DNA region has been amplified by electrophoresis or the like. It can be seen whether or not the phosphodiester bond between and the adjacent nucleotides has been broken. Typically, PCR may be performed using a primer capable of amplifying the entire region hybridized with the probe, and the amplified product may be subjected to electrophoresis (FIG. 1b). In particular, when performing Real Time PCR, the amplification efficiency for each PCR cycle can be monitored, so that the presence or absence of amplification can be detected efficiently. In addition, it is possible to quantify how many cells are methylated in the collected cell group.

  Also, nucleotide nucleotides having the target base and adjacent to them can be measured by measuring the weight of DNA fragments by mass spectrometry or by examining the presence or absence of phosphodiester bonds by electrochemical analysis using quartz crystal microbalance. It can be detected whether the phosphodiester bond between the nucleotides has been broken. Furthermore, it is possible to detect whether or not the phosphodiester bond has been decomposed by detecting the amount of response to the weight of the DNA fragment by surface plasmon resonance.

Second Method In the second method, the presence or absence of oxidation of the target base is determined by specifically detecting the oxidized product of the target base contained in the hybridized product.

  In the second method, the single-stranded portion that is not hybridized with the probe is usually treated with a single-stranded DNA-specific exonuclease before the target base is oxidized (before step 2A). It is desirable to remove it. Thereby, even if methylcytosine is present in a region that does not hybridize with the probe, erroneous detection due to this can be avoided. The kind of exonuclease is not specifically limited, A well-known thing can be used. Such an exonuclease is commercially available from USB, for example. The exonuclease treatment may be performed after oxidizing the target base. Further, the exonuclease treatment may be performed not only in the second method but also in the first method and the third method.

  As a specific embodiment of the second method, the target base contained in the hybridized product is oxidized to form a dihydroxy-substituted pyrimidyl group represented by the formula (3) or an epoxy-substituted pyrimidyl group represented by the formula (4). A method of detecting these groups after formation (hereinafter referred to as the method 2-2) can be mentioned. As another embodiment of the second method, the target base contained in the hybridized product is treated with an osmate and a bipyridyl compound to contain an osmium represented by the following formula (5). Examples include a method of detecting the osmium-containing heterocyclic group after forming a heterocyclic group (hereinafter referred to as the 2-2nd method). In the present specification, the expression “second method” means to include both the above-mentioned 2-1 method and 2-2 method.

Hereinafter, the second method will be described by dividing it into the above-mentioned 2-1 method and 2-2 method.
2-1 Method In the 2-1 method, the oxidation treatment is performed as described above (step 2B). In the 2-1st method, the oxidizing agent which can oxidize the carbon atom illustrated above can be used without a restriction | limiting. Especially, the oxidizing agent which can oxidize a carbon-carbon double bond like potassium permanganate is preferable at a point with a large reaction rate.

  Next, the oxidized product is labeled. When the target base is methylcytosine, a dihydroxy-substituted pyrimidyl group or an epoxy-substituted pyrimidyl group is generated by the above-described oxidation treatment. For example, by reacting compound (1), the dihydroxy-substituted pyrimidyl group or epoxy is treated as follows. The substituted pyrimidyl group is labeled with the labeling substance R. The label may be an enzyme label, a fluorescent label, or a radiolabel.

  Further, for example, by reacting the compound (2), the dihydroxy-substituted pyrimidyl group or the epoxy-substituted pyrimidyl group is labeled with the labeling substance R as follows.

  In the compounds (1) and (2), R represents a labeling substance.

  Further, the dihydroxy-substituted pyrimidyl group or the epoxy-substituted pyrimidyl group can be further converted into another functional group, and the labeling substance can be bound thereto. An example of this method will be described with reference to FIG. In FIG. 2, after treatment with a single-stranded DNA-specific exonuclease to remove a single-stranded portion not hybridized with the probe (FIG. 2a), an oxidation treatment is performed (FIG. 2b).

  A second oxidation treatment is further performed on the oxidized target base. The kind of oxidizing agent is not specifically limited, For example, what was illustrated above can be used. Of these, periodate is preferable. This oxidation treatment may be performed at about 0 to 40 ° C. for about 1 minute to 1 hour. If the dihydroxy-substituted pyrimidyl group represented by the above formula (3) or the epoxy-substituted pyrimidyl group represented by the formula (4) is present in the DNA fragment, any one hydroxyl group or epoxy group is converted into an aldehyde. (FIG. 2c).

The aldehyde is then detected using a labeling substance. For the bond between the labeling substance and the aldehyde, a functional group that reacts with the aldehyde to form an imino group can be used, and examples of such a functional group include NH ₂ NH— or NH ₂ O—. (FIG. 2d).

  The labeling substance may be any of a labeling enzyme, a fluorescent substance, a radioactive substance, and the like. Among these, a labeling enzyme is preferable in that detection sensitivity is increased by an enzyme reaction. The labeling enzyme is not particularly limited, and known labeling enzymes such as peroxidase such as horseradish peroxidase (HRP), alkaline phosphatase, galactosidase can be used without limitation. The chromogenic substrates for these enzymes are well known. In the case of labeling with HRP, a chromogenic substrate such as HPPA, orthophenylenediamine, or TMBZ may be used. Among them, HPPA emits fluorescence, so that the detection sensitivity becomes high. When labeling with alkaline phosphatase, a chromogenic substrate such as NBT / BCIP may be used. When labeling with galactosidase, a chromogenic substrate such as x-gal may be used.

In labeling an aldehyde via an imino group, for example, a biotin-avidin reaction can be used. More specifically, the aldehyde on the DNA side is reacted with a biotin derivative to which NH ₂ NH— or NH ₂ O— is bound, and the end is made biotin. In contrast, a biotin-avidin bond may be formed by allowing a labeling substance to which avidin is bound to react and reacting at about 5 to 40 ° C. for about 1 minute to 1 hour. The positional relationship between biotin and avidin can also be reversed. Thereby, an aldehyde can be labeled through an imino group and a biotin-avidin bond.

For example, when a labeling enzyme is used, its presence can be detected by reaction with a chromogenic substrate. If the substrate develops color due to the enzymatic reaction, it can be seen that aldehyde was present in the base of the target nucleotide, and that the target nucleotide was oxidized, and that the target base was methylcytosine.

Method 2-2 In method 2-2, first, the hybridized product is treated with a bipyridine compound represented by the formula (A) together with an osmate such as potassium osmate, An osmium-containing heterocyclic group represented by the formula (5) which is an oxidation reaction product is formed.

  In formulas (5) and (A), R 1 and R 2 are the same or different and each represents a hydrogen atom, an alkyl group, or a substituted alkyl group. Specific examples of the alkyl group or the alkyl group portion of the substituted alkyl group include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, and a sec-butyl group. And a linear or branched alkyl group having 1 to 6 carbon atoms such as n-pentyl group, neopentyl group, n-hexyl group, isohexyl group and 3-methylpentyl group. Examples of the substituent of the substituted alkyl group include a halogen atom, a cyano group, a hydroxyl group, an amino group, a carboxyl group, a lower alkoxy group, a lower alkanoyloxy group, a mono-lower alkylamino group, a di-lower alkylamino group, a carbamoyl group, and a lower alkyl. Aminocarbonyl group, di-lower alkylaminocarbonyl group, lower alkoxycarbonylamino group, (N-amino lower alkyl) aminocarbonyl group, lower alkylsulfonamide group, lower alkoxycarbonyl group, lower alkylthio group, lower alkylsulfinyl group, lower alkyl A sulfonyl group, a lower alkanoylamino group, etc. are mentioned. Here, the “lower alkyl” is a linear or branched alkyl group having 1 to 6 carbon atoms, and specific examples thereof include the groups exemplified above. Moreover, the number of substituents of a substituted alkyl group should just be 1 or 2, Preferably it is 1 or 2.

  In particular, among the bipyridine compounds represented by the formula (A), a compound represented by the following formula (hereinafter referred to as “Bipyridyl Ligand 4”) is designed so that it can easily bind a labeling substance and is suitable. .

  Bipyridyl Ligand 4 can be synthesized according to a known method, and typical synthetic pathways include synthetic pathways represented by the following chemical formulas.

  The amount of the osmate salt and the bipyridine compound represented by the formula (A) is not particularly limited. Usually, the osmate salt is about 0.1 to 1000 mM, and the bipyridine compound represented by the formula (A) is about 0.1 to 1000 mM. The osmate is preferably about 1 to 100 mM, and the bipyridine compound represented by the formula (A) is preferably about 10 to 100 mM.

  In addition to osmate and bipyridine, an oxidizing activator such as potassium ferricyanide or methylmorpholine oxide can be used in combination. When these oxidation activators are used in combination, the amount used is usually about 0.1 to 100 mM, preferably about 0.1 to 50 mM.

  The oxidation treatment may be performed at a temperature of about 0 to 40 ° C. for about 30 seconds to 1 hour. Moreover, it is preferable to perform the said oxidation process on basic conditions of about pH 7-9, and, thereby, an oxidation rate becomes high and cytosine and methylcytosine can be distinguished more clearly. Moreover, if it is in the said pH range, a double strand will be maintained stably.

Next, the osmium-containing heterocyclic group represented by the formula (5) is detected. The osmium-containing heterocyclic group can be detected, for example, according to the following three detection methods.
(Detection method 1)
Detection method 1 includes a step of labeling the osmium-containing heterocyclic group represented by the formula (5) with a labeling substance and a step of detecting the labeled osmium-containing heterocyclic group. The label of the osmium-containing heterocyclic group represented by the formula (5) may be any of an enzyme label, a fluorescent label, an electrochemical label, or a radiolabel. Among these, labeling with anthraquinone is advantageous in that it can be detected electrochemically and can be easily detected. The labeling of the osmium-containing heterocyclic group represented by the formula (5) is performed according to a known method such as a post-modification method. For example, an anthraquinone-labeled osmium-containing heterocyclic group is obtained by reacting an oxidized product formed with the osmium-containing heterocyclic group represented by formula (5) with an anthraquinone derivative in which -NHS is bonded to anthraquinone. Can do. Specific examples of the anthraquinone-labeled osmium-containing heterocyclic group include a group represented by the formula (6).

(In the formula, AQ represents anthraquinone. R2 is the same as described above.)
The labeled osmium-containing heterocyclic group is detected by a known method according to the type of the labeling substance. For example, when the labeling substance is anthraquinone, it can be detected using an electrochemical technique such as square wave voltammetry measurement.

(Detection method 2)
In detection method 2, the first step is performed using a guide probe to which a fluorescent substance is bound, and then the following steps are performed:
A step of labeling the osmium-containing heterocyclic group represented by the formula (5) with a fluorescent substance that causes FRET (fluorescence resonance energy transfer) to the fluorescent substance;
Measuring the presence or absence of FRET (fluorescence resonance energy transfer);
I do.

  In the detection method 2, when the osmium-containing heterocyclic group represented by formula (5) is present, FRET is present between the fluorescent substance bound to the guide probe and the fluorescent substance bound to the osmium-containing heterocyclic group. As a result, a change is observed in the fluorescence wavelength region or the fluorescence intensity of the fluorescent substance bound to the guide probe. On the other hand, when the osmium-containing heterocyclic group represented by the formula (5) does not exist, no change is observed in the fluorescence wavelength region or the fluorescence intensity of the fluorescent substance bound to the guide probe.

  In the guide probe used when the detection method 2 is adopted, the binding position of the fluorescent substance is not particularly limited. However, in the case of a bulge generating probe that forms a bulge structure, it is adjacent to the target base of the DNA sample. It is preferable that a fluorescent substance is bonded to a base that forms a base pair with respect to the base. In the case of a mismatch generating probe that forms a mismatch, it is preferable that a fluorescent substance is bound to a base that mismatches with respect to the target base.

  Examples of the combination of fluorescent substances that cause FRET include HEX and fluorescein; TAMRA and fluorescein; Cy3 and Cy5.

(Detection method 3)
In the detection method 3, the first step is performed using a guide probe to which a fluorescent substance that is quenched by the presence of the osmium-containing heterocyclic group represented by the formula (5) is bound, and whether or not the fluorescent substance is quenched Measure. In the detection method 3, when an osmium-containing heterocyclic group is present, quenching of the fluorescent substance bound to the guide probe is recognized.

  When the detection method 3 is employed, the guide probe used in the first step is specifically exemplified by a guide probe including a base to which a group represented by the following formula (7) is bonded. . In the guide probe, the binding site of the group represented by formula (7) is appropriately set according to the type of base to which the group is bound. Preferable examples of the bonding site of the group represented by formula (7) include a nitrogen atom or an oxygen atom bonded to the 6-position carbon of the purine ring when the base to be bonded is adenine or guanine. In the case where the base to be bonded is cytosine or thymine, a nitrogen atom or an oxygen atom bonded to the 4-position carbon of the pyrimidine ring, or the 5-position carbon of the pyrimidine ring can be mentioned.

  Further, in the guide probe used when the detection method 3 is adopted, the bonding position of the group represented by the formula (7) is not particularly limited. However, in the case of a bulge generating probe, the target base of the DNA sample is used. It is preferable that the group shown by Formula (7) is couple | bonded with the base which forms a base pair with respect to the base adjacent to. In the case of a mismatch generating probe, it is preferable that a group represented by the formula (7) is bonded to a base that mismatches with a target base.

<Third method>
In the third method, the target base is treated with bisulfite in step 2C. By this treatment, if the target base is cytosine, it is changed to uracil. Therefore, in the second D step, it is detected whether or not uracil is formed. When it is uracil, it can be determined that the target base is cytosine.

  Bisulfite (acid sulfite, hydrogen sulfite) may be any of sodium salt, potassium salt, calcium salt and the like. This treatment may be performed at a concentration of about 0.1 to 10 M and a temperature of about 5 to 95 ° C. for about 0.5 to 60 minutes.

  The method for detecting uracil is not limited thereto, but the hybridized product having the target base treated with bisulfite is treated with uracil DNA glycosidase, then treated with a basic substance, A method for detecting whether or not the phosphodiester bond between adjacent nucleotides has been broken is mentioned.

  When the target base is changed to uracil, the N-glycoside bond between uracil and sugar is hydrolyzed by uracil DNA glycosidase treatment. Next, by treating with a basic substance, the phosphodiester bond between the nucleotide having the target base and both adjacent nucleotides is cleaved. The uracil DNA glycosidase treatment may be performed, for example, at about 0 to 50 ° C. for about 1 to 30 minutes. The basic substance treatment is as described in the first method.

  In addition, whether or not the phosphodiester bond between the nucleotide having the target base and the nucleotide adjacent thereto is broken is determined by, for example, nucleic acid amplification for the region containing the nucleotide having the target base, as described in the first method. Can be detected.

  The target base can also be changed to uracil by performing nucleic acid amplification using a primer that amplifies only when the target base is uracil on the hybridized product having the target base treated with bisulfite. It can be detected whether or not. In addition, nucleic acid amplification is performed using primers that can be amplified regardless of whether the target base is uracil or methylcytosine, and there is a slight difference in the size of the amplified product (difference between uracil and methylcytosine). It is also possible to detect whether it is uracil or methylcytosine.

  Furthermore, a bisulfite-treated hybridized product can be amplified regardless of whether the target nucleotide is a nucleotide having no base or a nucleotide having methylcytosine, which is treated with uracil DNA glycosidase. Detect nucleic acid amplification using such primers, and detect whether the target base is uracil or methylcytosine by detecting a slight difference in the size of the amplified product (difference in the size of methylcytosine) can do.

<Fourth method>
In the fourth method, hybridization is performed in the first step using a guide probe to which a group capable of specifically binding to methylcytosine is bound, and then the following steps are performed:
In the hybridization product obtained in the first step, a second E step of cross-linking the guide probe and methylcytosine in the DNA sample;
A second F step of detecting the presence or absence of cross-linking between the guide probe and the DNA sample;
To implement.

  In the fourth method, when a cross link between the guide probe and the DNA sample is detected, it is determined that the target base is methylcytosine. On the other hand, if the cross link between the guide probe and the DNA sample is detected, it is determined that the target base is cytosine.

  When the detection method 4 is adopted, the guide probe used in the first step is formed by binding a group capable of specifically binding to methylcytosine. The “group capable of specifically binding to methylcytosine” bound to the guide probe is bound to methylcytosine forming a bulge structure or mismatch in a state where the guide probe and the DNA sample are hybridized. As long as it is possible, it is not particularly limited, but a preferred example is a group represented by the following formula (8). In formula (8), R2 is the same as described above.

(In formula (8), R2 is the same as above.)
Further, in the guide probe used when adopting the fourth method, the binding position of the “group capable of specifically binding to methylcytosine” is not particularly limited. It is preferable that a “group capable of specifically binding to methylcytosine” is bonded to a base that forms a base pair with a base adjacent to the target base of the DNA sample. In the case of a mismatch generating probe, it is preferable that a “group capable of specifically binding to methylcytosine” is bonded to a base that mismatches with a target base.

  In the fourth method, the single-stranded portion that is not hybridized with the probe is removed by treating with a single-stranded DNA-specific exonuclease in the same manner as in the second method before the 2E step. You may keep it.

  In the 2E step, the conditions for cross-linking the guide probe and methylcytosine in the DNA sample are appropriately set according to the type of “group capable of specifically binding to methylcytosine” bound to the guide probe. do it. For example, when a guide probe to which a group represented by formula (8) is bound is used, osmate is present at about 0 to 40 ° C. in the presence of about 0.1 to 1000 mM, preferably about 1 to 100 mM. What is necessary is just to process about 30 seconds-1 hour. Such treatment is desirably performed under pH conditions of about pH 6-7. Furthermore, in this treatment, the cross-link formation rate can be increased by adding an oxidizing activator such as potassium ferricyanide or methylmorpholine oxide to the extent of 0.1 to 100 mM, preferably about 0.1 to 50 mM. .

  In addition, you may implement 2E process simultaneously with 1st process. That is, the fourth method can be carried out by simultaneously mixing a guide probe, a DNA sample, and other compounds necessary for forming a crosslink and reacting them under predetermined conditions.

  The second F step is conveniently carried out by measuring the molecular weight of the DNA sample by mass spectrometry or gel electrophoresis. The details are as follows. If the guide probe and the DNA sample are cross-linked, they exist in a bound state even under conditions where hybridization is not possible. On the other hand, if the guide probe and the DNA sample are not cross-linked, they are separated and exist under conditions where hybridization is not possible. Therefore, if the DNA sample is subjected to mass spectrometry analysis or gel electrophoresis under conditions where hybridization cannot be performed, and the weight or molecular weight of the DNA sample is increased, the guide probe and the test DNA are cross-linked. If there is no change in weight or molecular weight, it is determined that the guide probe and the DNA sample are not cross-linked.

(II) Kit for detecting methylcytosine The first kit of the present invention is a kit used for the first or second method of the methylcytosine detection method of the present invention described above. This kit includes the above-described guide probe and a reagent capable of oxidizing methylcytosine. Reagents that can oxidize methylcytosine are typically oxidants that can oxidize carbon atoms as described above, but precursors that change to such oxidants are also included in reagents that can oxidize methylcytosine.

  Moreover, what is necessary is just to provide the basic substance demonstrated above, when using for a 1st method. Furthermore, it is preferable to provide a set of PCR reagents.

Further, if those subjected to the 2-1 method further biotin or with exonuclease capable of specifically degrade single-stranded DNA, NH 2 _NH- group at the end, or NH 2 _O-group What is necessary is just to provide the labeling enzyme couple | bonded with avidin, avidin, or biotin, and the coloring substrate of this labeling enzyme. Moreover, the kit provided for the method 2-1 further includes an exonuclease capable of specifically degrading single-stranded DNA and the compound of the above formula (1) or the compound of the formula (2). It is done.

  In the case of subjecting to the method 2-2, an osmate is used as the oxidizing agent, and further includes bipyridine.

  The second kit used for the third method described above includes a bulge generating probe and bisulfite. Furthermore, it is preferable to provide a set of PCR reagents.

  The third kit provided for the above-described fourth method includes the above-described guide probe and a reagent for cross-linking the above-described guide probe and the DNA sample.

(III) Using a nucleic acid chip in which one or more guide probes are immobilized on a nucleic acid chip substrate for detecting methylcytosine, the presence or absence of methylation of cytosine at various positions for various genes can be detected at a time. Can do.

  The probe is the probe described above, but different probes may be used so that a plurality of target bases can be determined.

  The material of the base of this nucleic acid chip is not particularly limited, and known materials such as glass, silica, and gold can be used. The spot diameter of the probe on the substrate can be about 50 to 200 μm, for example, and the spot pitch can be about 100 to 500 μm, for example.

  What is necessary is just to perform each operation of the method of this invention demonstrated above with respect to the probe group on this nucleic acid chip.

  In the first method, PCR is simultaneously performed on a probe group on a nucleic acid chip, and a PCR amplification product can be measured, for example, by a microplate reader (for example, Mithras of Berthold, Inc.) that can measure fluorescence, absorption, fluorescence polarization, fluorescence lifetime, and the like. It may be detected by a commercially available product such as LB940), a microchip reader, a fluorescence microscope, a fluorescence imager, or the like. Thereby, the size of each DNA fragment on the chip can be detected, and as a result, it can be determined at a time whether the target base of a plurality of DNA samples is cytosine or methylcytosine.

  In the second method, the color development pattern on the chip can be read using a microplate reader or the like in the same manner as described above, whereby the target base of a plurality of DNA samples is cytosine or methylcytosine. It can be determined at once.

  In the third method, PCR is performed simultaneously on the probe group on the chip, and the PCR amplification product may be detected by a microplate reader or the like.

(IV) Methylcytosine Detection Device The methylcytosine detection device of the present invention is a device comprising the nucleic acid chip described above and a device capable of detecting a color development pattern on the chip. Examples of the color pattern detection device include a microplate reader, a microchip reader, a fluorescence microscope, and a fluorescence imager that can measure fluorescence, absorption, fluorescence polarization, fluorescence lifetime, and the like.

EXAMPLES Hereinafter, although an Example is shown and this invention is demonstrated in detail, this invention is not limited to these. In the following Examples and Comparative Examples, the notation “ ^m C” means 5-methylcytosine.
Example 1 (first method)
Here, in order to detect the size of the DNA fragment by electrophoresis without performing PCR, the target DNA was first radiolabeled. That is, 2 μL of T4 polynucleotide kinase and 4 μL of [γ- ³² P] ATP were mixed with 4 μL of a 100 μM aqueous solution of the target DNA fragment, and water was added to make a total of 20 μL. The DNA sample containing methylcytosine is 13mer DNA (5′-GCGTTG C GTTGCG) (SEQ ID NO: 1), and the DNA sample containing methylcytosine is 13mer DNA (5′-GCGTTG n GTTGCG; n represents ^m C) ( SEQ ID NO: 2). In the DNA of SEQ ID NO: 1, the base of the nucleotide of base number 7 is cytosine, and in the DNA of SEQ ID NO: 2, the base of the nucleotide of base number 7 is methylcytosine.

  The mixture was allowed to stand at 37 ° C. for 40 minutes to label the 5 ′ end. The reaction solution was subjected to 15% polyacrylamide / 7 M urea gel electrophoresis to purify the target DNA fragment.

  Next, 10 μL of the labeled DNA and 20 μL of a 12-mer DNA (5′-CGCAACCAACGC) (SEQ ID NO: 3) 1.33 μM aqueous solution as a probe are dissolved in 300 mM sodium acetate buffer pH 6.0, and water is added. The total amount was 50 μL, and double strands were formed at room temperature.

Next, 50 μL of a 3.2 mM KMnO ₄ aqueous solution dissolved in 5 mM cacodylate buffer pH 6.0 was added to the double strand to initiate the oxidation reaction. After standing for 3 minutes, 50 μL of β-mercaptoethanol (1 M) dissolved in 1.5 M sodium acetate buffer pH 7.0 was added to terminate the reaction.

  After the reaction, the sample was purified by ethanol precipitation, 50 μL of 1 M piperidine was subsequently added, and the mixture was allowed to stand at 90 ° C. for 60 minutes.

  Then, after vacuum-drying and preparing the reaction sample which added water so that radiation dose might become fixed using LSC, it analyzed by 15% polyacrylamide / 7M urea gel electrophoresis. The confirmation of the cut band was determined by comparing with the lane where the Maxam-Gilbert G + A reaction was performed.

Comparative Example 1
In Example 1, the same operation as in Example 1 was performed, except that 13-mer DNA (5′-CGCAAC G CAACGC) (SEQ ID NO: 4) was used as a probe.

G underlined in SEQ ID NO: 4 is used to form a base pair with C at base number 7 in SEQ ID NO: 1 or ^m C at base number 7 in SEQ ID NO: 2 of the DNA sample.

The result of electrophoresis is shown in FIG. Lane 1 in FIG. 1 shows the result of hybridizing the probe (12mer) of SEQ ID NO: 3 to the DNA sample (13mer; ^m C) of SEQ ID NO: 1, and Lane 2 shows the DNA sample (13mer; 13mer; The results of hybridizing the probe (12mer) of SEQ ID NO: 3 to C) are shown. Lane 3 hybridizes the probe (13mer) of SEQ ID NO: 4 to the DNA sample (13mer; ^m C) of SEQ ID NO: 1. The result of soybean sowing is shown, and lane 2 shows the result of hybridizing the probe (13mer) of SEQ ID NO: 4 to the DNA sample of SEQ ID NO: 2 (13mer; C).

When lane 1 and lane 2 are compared, when a probe capable of forming a bulge is used for a DNA sample having methylcytosine ( ^m C), the DNA sample is cleaved by piperidine treatment, but cytosine (C) It can be seen that the DNA sample was not cleaved by piperidine treatment when a probe capable of forming a bulge was used for the DNA sample.

In addition, when a probe that cannot form a bulge is used from lanes 3 and 4, the DNA sample is cleaved by piperidine treatment regardless of whether the DNA sample has methylcytosine ( ^mC ) or cytosine (C). You can see that there wasn't.

Example 2 (Combination of reoxidants)
As a DNA sample, 15mer DNA (5′-AAAAAAG n GAAAAAA-3 ′; n represents ^m C) (SEQ ID NO: 5) was used, and these 5 ′ ends were radiolabeled in the same manner as in Example 1. Purified.

  Next, 10 μL of the labeled DNA and 20 μL of a 1.33 μM aqueous solution of 14-mer DNA (5′-TTTTTTCCTTTTTT-3 ′) (SEQ ID NO: 6) as a probe were dissolved in 300 mM sodium acetate buffer pH 6.0, Water was added to make a total of 50 μL, and a double strand was formed at room temperature.

This duplex was then combined with 1 mM EDTA, 100 mM Tris-HCl (pH 7.7), 100 mM bipyridine, 5 mM K ₂ OsO ₄ , 10% MeCN, and a concentration of 10-100 mM hexacyanoiron complex [Fe (III) (CN ₆ ) Oxidation reaction was performed by incubating at 0 ° C. for 3 minutes in the presence or absence of ^3- . After incubation for 3 minutes, 0.5 M sodium acetate buffer pH 7.0 and Herring Sperm DNA (1 mg / mL) were added, and ethanol precipitation was performed.

  Thereafter, piperidine treatment and electrophoresis were performed in the same manner as in Example 1.

The results are shown in FIG. FIG. 4 shows that the use of [Fe (III) (CN) ₆ ] ^3- together with K ₂ OsO ₄ improves the oxidation rate and facilitates the detection of methylcytosine.

Example 3 (Combination of reoxidants)
As DNA samples, 15mer DNA (5′-AAAAAAG n GAAAAAA-3 ′; n represents ^m C) (SEQ ID NO: 5), and 15mer DNA (5′-AAAAAAG C GAAAAAA-3 ′) (SEQ ID NO: 7) As a probe, 14mer bulge-forming DNA (5′-TTTTTTCCTTTTTT-3 ′) (SEQ ID NO: 6) and full-match DNA (5′-TTTTTTC G CTTTTTT-3 ′) (SEQ ID NO: 8) were used.

In addition, in order to investigate the influence of [Fe (III) (CN) ₆ ] ^3- during oxidation treatment, oxidation without using [Fe (III) (CN) ₆ ] ^3- and oxidation used at a concentration of 100 mM. And did both. Others were carried out in the same manner as in Example 2 for labeling DNA samples, forming double strands, oxidizing treatment, piperidine treatment, and electrophoresis.

  In addition, as a positive control for detection of methylcytosine, oxidation treatment, piperidine treatment, and electrophoresis were performed on a single-stranded DNA sample without using a probe in the same manner as in Example 2.

The results are shown in FIG. From FIG. 5, when using a bulge-forming probe, particularly when [Fe (III) (CN) ₆ ] ^3- was used in combination, a strong methylcytosine cleavage band was detected, and cytosine and methylcytosine were clearly identified. It can be seen that it was possible to distinguish. The cleavage band detected when methylcytosine is the same size as when a single-stranded DNA sample without using a probe was cleaved with piperidine. By using a bulge-forming probe, the target methylcytosine was detected. It turns out that it is detecting correctly. On the other hand, when a full-match probe that does not form a bulge was used, methylcytosine and cytosine could not be distinguished.

Example 4 (Effect of pH on oxidation treatment)
As DNA samples, 15mer DNA (5′-AAAAAAG n GAAAAAA-3 ′; n represents ^m C) (SEQ ID NO: 5), and 15mer DNA (5′-AAAAAAG C GAAAAAA-3 ′) (SEQ ID NO: 7) The 14-mer bulge-forming DNA (5′-TTTTTTCCTTTTTT-3 ′) (SEQ ID NO: 6) was used as a probe.

The oxidation treatment was performed by incubating at 0 ° C. for 3 minutes in the presence of 1 mM EDTA, 100 mM Tris-HCl (pH 7.7), 100 mM bipyridine, 5 mM K ₂ OsO ₄ , 10% MeCN. Here, the reoxidant [Fe (III) (CN) ₆ ] ³⁻ was not used in combination. Others were carried out in the same manner as in Example 1, and radiolabelling, double strand formation, oxidation treatment, piperidine treatment, and electrophoresis were performed on the DNA sample.

The results are shown in FIG. From FIG. 6, it can be seen that in the range of pH 7.15 to 9.01, a darker cut band is detected only in the case of methylcytosine than in the case of pH 6.02 or 6.54, and the detection sensitivity of methyl cytosine is high.
Example 5 (Examination of oxidant ligand during oxidation treatment)
As DNA samples, 15mer DNA (5′-AAAAAAG n GAAAAAA-3 ′; n represents ^m C) (SEQ ID NO: 5), and 15mer DNA (5′-AAAAAAG C GAAAAAA-3 ′) (SEQ ID NO: 7) The 14-mer bulge-forming DNA (5′-TTTTTTCCTTTTTT-3 ′) (SEQ ID NO: 6) was used as a probe.

The oxidation treatment should be incubated at 0 ° C. for 3 minutes in the presence of 1 mM EDTA, 100 mM Tris-HCl (pH 7.7), 100 mM pyridine, bipyridine or phenanthroline, 5 mM K ₂ OsO ₄ , 10% MeCN. It went by. Here, the reoxidant [Fe (III) (CN) ₆ ] ³⁻ was not used in combination. Others were carried out in the same manner as in Example 1, and radiolabelling, double strand formation, oxidation treatment, piperidine treatment, and electrophoresis were performed on the DNA sample.

  The results are shown in FIG. From FIG. 7, methylcytosine and cytosine can be distinguished from each other when pyridine, bipyridine, or phenanthroline is used. In particular, when bipyridine is used, a cleavage band is detected only with methylcytosine, and methylcytosine and cytosine are detected. It can be seen that can be more clearly distinguished.

Example 6 (Detection of methylcytosine in an existing gene)
In real genes, methylcytosine is often present in close proximity. Even in such a case, in order to show that a specific methylcytosine can be detected by the method of the present invention, detection of methylcytosine was attempted using a partial sequence of p53 as a DNA sample.

As DNA samples, 5′-TACTGGGA C GGAACAGCTTTGAGGTGCGTGTTTGT-3 ′ (SEQ ID NO: 9), 5′-TACTGGGA n GGAACAGCTTTGAGGTGCGTGTTTGT-3 ′ (n represents ^m C; SEQ ID NO: 10), 5′-TACTGGGACGGAACAGCTTTGAGGTG C GTGTTTGT-3 ′ (SEQ ID NO: 11) and 5′-TACTGGGACGGAACAGCTTTGAGGTG n GTGTTTGT-3 ′ (n indicates ^m C; SEQ ID NO: 12) were used. In SEQ ID NOS: 9 and 10, the first target base of base number 9 is cytosine and methylcytosine, respectively, and in SEQ ID NOS: 11 and 12, the second target base of base number 17 is cytosine and methylcytosine, respectively. Further, as a bulge forming probe, 5′-ACAAACACGCACCTCAAAGCTGTTCCTCCCAGTA-3 ′ (SEQ ID NO: 13) for detecting the first target base and 5′-ACAAACACCACCTCAAAGCTGTTCCGTCCCAGTA-3 ′ (SEQ ID NO: 14) for detecting the second target base are used. ) Was used. Furthermore, a full match probe 5′-ACAAACACGCACCTCAAAGCTGTTCCGTCCCAGTA-3 ′ (SEQ ID NO: 15) was also used as a negative control.

The oxidation treatment was performed by incubating at 0 ° C. for 5 minutes in the presence of 1 mM EDTA, 100 mM Tris-HCl (pH 7.7), 100 mM bipyridine, 5 mM K ₂ OsO ₄ , 10% MeCN. Here, the reoxidant [Fe (III) (CN) ₆ ] ³⁻ was not used in combination. Others were carried out in the same manner as in Example 1 by subjecting the test DNA to radiolabeling, double strand formation, oxidation treatment, piperidine treatment, and electrophoresis.

  The results are shown in FIG. FIG. 8 shows that the presence or absence of methylation of each base could be detected by using a bulge-forming probe that can specifically detect the first and second target bases.

Example 7 (Quantification of methylcytosine by real-time PCR)
As DNA samples, 5'-GCTATCTGAGCAGCGCTCATGGTGGGGGCAG C GCCTCACAACCTCCGTCATGTGCTGTGA-3 '( SEQ ID NO: 16), 5'-GCTATCTGAGCAGCGCTCATGGTGGGGGCAG n GCCTCACAACCTCCGTCATGTGCTGTGA -3' (n represents a ^m C; SEQ ID NO: 17) was used. These sequences are partial sequences of p53. In this example, since the cleaved fragment was detected by PCR, the DNA sample was not radiolabeled.

  Moreover, 5'-TCACAGCACATGACGGAGGTTGTGAGGCCTGCCCCCACCATGAGCGCTGCTCAGATAGC ... PS-3 '(sequence number 18) was used as a bulge formation probe. This probe has a 3 ′ end attached to polystyrene beads.

  First, a small amount of a guide probe, 10 μL of a 10 nM DNA sample, 10 μL of 10 mM 1M Tris-HCl (pH 7.7), and 30 μL of milliQ water were mixed to make a total of 50 μL. There is a large excess of DNA sample relative to the guide probe. This mixture was incubated at 90 ° C. for 5 minutes to form duplexes and then cooled overnight.

Next, 25 μL of 20 mM K ₂ OsO ₄ aqueous solution, 10 μL of 1M bipyridine MeCN solution, and 15 μL of milliQ water were mixed to make a total of 50 μL. This mixed solution was incubated at 0 ° C. for 5 minutes for oxidation treatment, and 200 μL of 3M sodium acetate (pH 6.0) was added to stop the oxidation reaction.

  Next, single-stranded DNA was recovered and purified as follows. That is, the operation consisting of vortexing, centrifugation, supernatant discarding, and addition of 200 μL of reaction stop solution (3M sodium acetate (pH 6.0)) was repeated twice, and vortexing, centrifugation, and supernatant discarding were performed once. The operation of adding 50 μL of 7M urea to the beads with the probe obtained by discarding the supernatant, incubating at 55 ° C. for 20 minutes, and collecting the supernatant was repeated twice. Next, 1 mM cold ethanol was added to the obtained supernatant and allowed to stand at −78 ° C. overnight, centrifuged at −15 ° C. at 1500 rpm for 15 minutes, the supernatant was discarded, and 150 μL of 80% cold ethanol was then added. After adding and centrifuging for 5 minutes and discarding the supernatant, it was evaporated for 5 minutes.

  50 μL of 1M piperidine was added to the purified single-stranded DNA thus obtained, incubated at 90 ° C. for 20 minutes, and then evaporated for 40 minutes. Furthermore, the operation of adding 20 μL of milliQ water and evaporating for 20 minutes was repeated twice.

  Piperidine-treated DNA was subjected to real-time PCR. As a negative control, samples not subjected to oxidation treatment were also subjected to real-time PCR.

As a PCR reaction solution, a total of 20 μL of a mixture of HotStarTaq Master Mix 10 μL, 5 μL primer mixture, 5 × 10 ⁴ diluted SYBRI GREEN 6 μL was used. As the primer, 5'-TCACAGCACATGACGGAGGT-3 '(SEQ ID NO: 19) and 5'-GCTATCTGAGCAGCGCTCAT-3' (SEQ ID NO: 20) were used.

  PCR conditions were 95 ° C for 15 minutes; 94 ° C for 30 seconds, 50 ° C for 30 seconds, 72 ° C for 1 minute for 40 cycles; and then cooling to 40 ° C. As the real-time PCR apparatus, Roche Diagnostics Inc./LightCycler was used.

  The results are shown in FIG. Only when the bulge-forming probe and methylcytosine-containing DNA were hybridized, the amplification rate was slow (FIG. 9 (A)). In addition, the amplification rate was slowed by the oxidation treatment (FIG. 9B).

  Moreover, the result of having measured the amount of amplification products converted using the calibration curve from the amplification curve in real-time PCR is shown in FIG. Only when the hybridized product of the bulge-forming probe and methylcytosine was oxidized, there were few amplification products.

  From these results, it can be seen that the methylcytosination degree can be quantified by performing real-time PCR.

Example 8 (Detection of methylcytosine by formation of osmium-containing heterocyclic group-1)
As a DNA sample, 5′-GGGGCAG n GCCTCAC-3 ′ (n represents ^m C; SEQ ID NO: 21) and 5′-GGGGGCAG C GCCTCAC-3 ′ (SEQ ID NO: 22) were used. These sequences are partial sequences of p53.

In addition, 5′-GTGAGGCCTGCCCC- (CH ₂ ) ₆ -SH-3 ′ (SEQ ID NO: 23) was used as a bulge forming probe. In this probe, a group — (CH ₂ ) ₆ —SH is bonded to the 3 ′ end.

  First, 1 μL of a 10 μM bulge-forming probe was dropped on the cleaned gold electrode surface and immobilized at room temperature for 3 hours. Next, the obtained gold electrode surface was washed with a small amount of MilliQ water (about 500 to 1000 μL), 1 μL of 10 mM MCH was dropped, and the gold electrode surface was masked at room temperature for 0.5 hour. Next, after washing with a small amount of MilliQ water (about 500 to 1000 μL), 1 μL of a 10 μM DNA sample was dropped and incubated at room temperature for 1 hour to form double strands having a bulge structure on the electrode surface. Then, in order to fill the single-stranded bulge-forming probe remaining on the electrode surface, 1 μL of 5′-GGGGCAGGCCTCAC-3 ′ as a protective DNA is dropped at 10 μM and incubated at room temperature for 0.5 hours. Only double-stranded DNA having a double-stranded DNA or a bulge structure was used.

Separately, 25 μL of 20 mM K ₂ OsO ₄ aqueous solution, 10 μL of 1M Bipyridyl Ligand 4 in MeOH, 10 μL of 10 mM EDTA, 10 μL of 1M Tris-HCl (pH 7.7) buffer, 1 M K ₃ [Fe (CN) ₆ ] 10 μL of aqueous solution and 45 μL of MilliQ water were mixed to prepare a reaction solution. 1 μL of the reaction solution was dropped onto the treated electrode surface and reacted at room temperature for 30 minutes (formation of an osmium-containing heterocyclic group represented by the formula (5)). Next, after washing with a small amount of MilliQ water (about 500-1000 μL), 1 μL of 5 mM anthraquinone-NHS solution (solvent: H ₂ O / N, N-Dimethylformamide = 90/10 (volume ratio)) is added dropwise for post-modification. This was carried out at room temperature for 12 hours (formation of an anthraquinone-labeled osmium-containing heterocyclic group represented by the formula (6)).

  Subsequently, after washing with a small amount of MilliQ water (about 500 to 1000 μL), square wave voltammetry measurement was performed in an 1M NaCl aqueous solution using an electrochemical measurement apparatus ALS660A.

  The obtained results are shown in FIG. When the DNA sample of SEQ ID NO: 21 is targeted, the peak top at −0.66 V is attributed to the fact that the methylcytosine moiety is converted to an anthraquinone-labeled osmium-containing heterocyclic group represented by the formula (6). Shows a high current amount of 0.737 μA. On the other hand, when the DNA sample of SEQ ID NO: 22 is the target, since the anthraquinone-labeled osmium-containing heterocyclic group represented by the formula (6) is not formed, the peak top at −0.66 V is 0.450. Only a current of μA was shown. From the above results, it was confirmed that the detection of methylcytosine forming the bulge structure was made possible by forming the osmium-containing heterocyclic group represented by the formula (5) and detecting the group.

Example 9 (Methylcytosine detection by formation of osmium-containing heterocyclic group-2)
As DNA samples, 5′-AAAAAAG n GAAAAAA-3 ′ (n represents ^m C; SEQ ID NO: 24) and 5′-AAAAAAG C GAAAAAA-3 ′ (SEQ ID NO: 25) were used.

Further, as a mismatch formation probe, 5′-TTTTTTC n CTTTTTT-3 ′ (where n represents a base in which fluorescein is bonded via a linker to the 5-position carbon of the pyrimidine ring of deoxyuridine via a linker; SEQ ID NO: 26) was used.

First, in the presence of 1 M Tris-HCl (pH 7.7), 10 mM EDTA, 100 mM Bipyridyl Ligand 4, 5 mM K ₂ OsO ₄ , and 100 mM Fe ₃ (CN) ₆ , a 10 μM DNA sample was incubated at 37 ° C. For 2 hours (formation of an osmium-containing heterocyclic group represented by the formula (5)). Subsequently, the DNA sample was purified by HPLC (0.1 M TEAA / acetonitrile from 5% to 30% for 50 min). In a 50 mM aqueous sodium phosphate solution (pH 8.0), the treated DNA sample is added, and 10 μL of HEX-NHS (1 mg / mL in DMSO) is further added to make a total volume of 100 μL. 5) Incubated for hours (formation of HEX-containing osmium-containing heterocyclic group). Again, the DNA sample thus treated was purified by HPLC. The DNA sample thus treated was mixed with the mismatch-forming probe in the presence of 0.9 M NaCl in 50 mM aqueous sodium phosphate (pH 8.0). About the aqueous solution after incubation, it excited at 495 nm and measured the fluorescence intensity.

  The obtained result is shown in FIG. When the DNA fragment of SEQ ID NO: 24 is targeted, the fluorescence intensity derived from fluorescein (520 nm) due to the formation of the methylcytosine moiety in the osmium-containing heterocyclic group represented by the formula (5) In addition, HEX-derived fluorescence intensity (550 nm) also showed a high value. On the other hand, when the test DNA fragment of SEQ ID NO: 25 was targeted, the HEX-derived fluorescence intensity (550 nm) was low because the osmium-containing heterocyclic group represented by the formula (5) was not formed. It was. From the above results, it is possible to detect methylcytosine forming a bulge structure by forming an osmium-containing heterocyclic group represented by the formula (5) and detecting the group using FERT. It was confirmed.

Example 10 (Detection of methylcytosine by formation of osmium-containing heterocyclic group-3)
As DNA samples, 5′-AAAAAAG n GAAAAAA-3 ′ (n represents ^m C; SEQ ID NO: 27) and 5′-AAAAAAG C GAAAAAA-3 ′ (SEQ ID NO: 28) were used.

In addition, as a mismatch formation probe, 5′-TTTTTTC n CTTTTTT-3 ′ (n is a base in which the group represented by the formula (7) is bonded to the oxygen atom on the 6-position carbon of the purine ring of guanine. Shown; SEQ ID NO: 29) was used.

First, in the presence of 1 M Tris-HCl (pH 7.7), 10 mM EDTA, 100 mM bipyridyl, 5 mM K ₂ OsO ₄ , and 100 mM Fe ₃ (CN) ₆ Incubated for a period of time (formation of an osmium-containing heterocyclic group represented by the formula (5)). The reaction solution after incubation was applied to a gel filtration spin column to collect the filtrate, and the obtained filtrate was concentrated. Subsequently, the obtained filtrate was added to a 50 mM sodium phosphate aqueous solution (pH 8.0), and further a 1 μM mismatch-forming probe was added to make a total volume of 100 μL, followed by incubation at 37 ° C. for 3 hours. About the aqueous solution after incubation, it excited at 380 nm or 390 nm, and measured the fluorescence intensity. Further, using the DNA sample of SEQ ID NO: 27, the step of forming an osmium-containing heterocyclic group was deleted, and an experiment was performed in the same manner as described above, and the fluorescence intensity was measured (denoted as M in FIG. 13) To do). Further, the fluorescence intensity exhibited in the case of a single strand of the DNA sample of SEQ ID NO: 28 was also measured (denoted as SS in FIG. 13).

  The obtained result is shown in FIG. When the DNA sample of SEQ ID NO: 27 was used (indicated as MOS in FIG. 13), the methylcytosine moiety was formed on the osmium-containing heterocyclic group represented by the formula (5). It was confirmed that the fluorescence derived from the group represented by the formula (7) was attenuated. on the other hand,. When the DNA sample of SEQ ID NO: 28 was used (denoted as C in FIG. 13), the osmium-containing heterocyclic group represented by the formula (5) was not formed, and therefore the formula (7) No attenuation of fluorescence derived from the group represented by. From the above results, detection of methylcytosine forming a mismatch is possible by forming an osmium-containing heterocyclic group represented by the formula (5) and detecting quenching of the fluorescent substance using the group. It was confirmed that

Example 11 (Detection of methylcytosine by formation of osmium-containing heterocyclic group-3)
As DNA samples, 5′-GGTGGGGGCAG n GCCTCACA-3 ′ (n represents ^m C; SEQ ID NO: 30) and 5′-GGTGGGGGCAG C GCCTCACA-3 ′ (SEQ ID NO: 31) were used. 5 ′ of this DNA sample is radiolabeled with ³² P.

As a mismatch formation probe, 5′-TGTGAGGC Y CTGCCCCCACC-3 ′ (Y is a base in which the group represented by the formula (8) is bonded to the nitrogen atom on the 6-position carbon of the purine ring of adenine. Shown; SEQ ID NO: 32) was used.

  First, in the presence of a 5 μM mismatch-forming probe, 5 mM osmium tetroxide potassium salt, 1 mM EDTA, 100 mM Tris-HCl, and 100 mM potassium ferricyanide (pH 7.0), a 10 μM DNA sample is prepared at 50 ° C. for 10 minutes. Incubated (hybridization of DNA sample and mismatch forming probe and formation of cross-link). Thereafter, 10 μL of 1 mg / mL Salmon Sperm DNA, 15 μL of 3 M sodium acetate (pH 5.0) aqueous solution, and 900 μM of chilled ethanol were further added, and after sufficient stirring, the mixture was allowed to stand at −20 ° C. for 30 minutes. Next, the mixture was centrifuged for 15 minutes, and the supernatant was discarded. Then, 150 μM of 80% cooled ethanol was added and centrifuged, and then the supernatant was discarded again. After depressurizingly distilling for 5 minutes, the sample diluted with Loading Buffer so that it might become 2000 CPM / microliter was poured by gel electrophoresis.

  The obtained result is shown in FIG. When the DNA sample of SEQ ID NO: 29 was used, a band corresponding to the complex of the DNA sample and the mismatch forming probe was detected in addition to the band of the DNA sample of SEQ ID NO: 29 alone. On the other hand, when the DNA sample of SEQ ID NO: 30 was used, no cross-linking was observed between the DNA sample and the mismatch forming probe, and only the band of the DNA sample of SEQ ID NO: 30 was observed. From the above results, it has been clarified that the detection of methylcytosine forming a mismatch can also be detected by cross-linking the mismatch forming probe and the methylcytosine.

Claims (37)

A method for detecting cytosine methylation in a DNA sample, comprising:
A first step of hybridizing a DNA sample and a guide probe so that the target cytosine or methylcytosine forms a bulge structure or mismatch;
A method for detecting methylcytosine comprising a second step of inducing a reaction specific to cytosine or methylcytosine forming a bulge structure or mismatch, and detecting methylation based on the presence or absence of this reaction. The first step is a step of hybridizing the DNA sample and the guide probe so that the target cytosine or methylcytosine forms a bulge structure,
The method for detecting methylcytosine according to claim 1, wherein the second step is a step of inducing a reaction specific to the cytosine or methylcytosine forming a bulge structure and detecting methylation based on the presence or absence of this reaction.   The method for detecting methylcytosine according to claim 1, wherein a reaction specific to methylcytosine is induced in the second step.   The second step includes a second step A in which an oxidizing agent is allowed to act on cytosine or methylcytosine forming a bulge structure or mismatch, and a second step B in which the presence or absence of an oxidation reaction product due to the oxidizing agent is detected. Methylcytosine detection method.   The method for detecting methylcytosine according to claim 4, wherein the step 2B includes a step of allowing a basic substance to act.   The method for detecting methylcytosine according to claim 5, wherein the step 2B includes a step of detecting a fragment of the DNA sample after the step of applying a basic substance.   The method for detecting methylcytosine according to claim 6, wherein a fragment of a DNA sample is detected by amplifying a region containing cytosine or methylcytosine that forms a bulge structure or mismatch.   The method for detecting methylcytosine according to claim 5, wherein a nitrogen-containing substance is used as the basic substance.   The method for detecting methylcytosine according to claim 3, further comprising a step of removing the single-stranded portion of the hybridized product by exonuclease treatment after the first step.   The method for detecting methylcytosine according to claim 9, wherein the step 2B includes a step of labeling the oxidation reaction product produced in the step 2A and a step of detecting the labeling substance.   The method for detecting methylcytosine according to claim 10, wherein the second step B includes a step of further performing a second oxidation treatment on the oxidation reaction product by the oxidizing agent.   The method for detecting methylcytosine according to claim 10, wherein the labeling is performed using a labeling enzyme.   The method for detecting methylcytosine according to claim 4, wherein the oxidation reaction product of the target base in Step 2B is an oxidation reaction product of the 5-position carbon atom of the pyrimidine ring. Step 2A is a step of causing an oxidizing agent to act on cytosine or methylcytosine forming a bulge structure or mismatch to form an osmium-containing heterocyclic group represented by formula (5) in the methylcytosine moiety,
The method for detecting methylcytosine according to claim 4, wherein Step 2B is a step of detecting the presence or absence of the osmium-containing heterocyclic group.
(Wherein R1 and R2 are the same or different and each represents a hydrogen atom, an alkyl group, or a substituted alkyl group)   The step 2B includes a step of labeling an osmium-containing heterocyclic group represented by the formula (5) with a labeling substance and a step of detecting the labeled osmium-containing heterocyclic group. Cytosine detection method. The guide probe used in the first step is a guide probe to which a fluorescent material is bound, and the second B step uses a fluorescent material that causes fluorescence resonance energy transfer with respect to the fluorescent material. And a step of measuring the presence or absence of fluorescence resonance energy transfer.
The method for detecting methylcytosine according to claim 14. The guide probe used in the first step is a guide probe to which a fluorescent material that is quenched by the presence of the osmium-containing heterocyclic group represented by the formula (5) is bound, and the second B step is the quenching of the fluorescent material Is a step of measuring the presence or absence of
The method for detecting methylcytosine according to claim 14. The method for detecting methylcytosine according to claim 1, wherein the reaction specific to the target base in the second step is a reaction specific to cytosine. The methylcytosine detection method according to claim 18, wherein the second step includes a second C step of treating the target base with bisulfite and a second D step of detecting uracil generated in the second C step.   In the second step, in the hybridized product obtained in the first step, the second E step of cross-linking the guide probe and methylcytosine in the DNA sample, and the presence or absence of cross-linking between the guide probe and the DNA sample. The method for detecting methylcytosine according to claim 3, further comprising a second F step of detecting.   The method for detecting methylcytosine according to claim 1, wherein the length of the guide probe is 20 to 100 bases.   The method for detecting methylcytosine according to claim 5, wherein the length of the guide probe is 40 to 100 bases. The method for detecting methylcytosine according to claim 1, wherein the guide probe is bound to a solid phase carrier. A probe for detecting methylcytosine complementary to a region excluding a nucleotide having a target base to be detected whether it is cytosine or methylcytosine in a DNA sample. A probe for detecting methylcytosine which hybridizes with a DNA sample and which mismatches only with a target base to detect whether it is cytosine or methylcytosine of a DNA sample. A hybridization product of the probe according to claim 24 or 25 and a DNA sample. A kit for detecting methylcytosine comprising the probe according to claim 24 or 25 and a reagent capable of oxidizing methylcytosine. 28. The kit for detecting methylcytosine according to claim 27, comprising a basic substance capable of cleaving a bond between a nucleotide having oxidized methylcytosine and a nucleotide adjacent thereto. And specifically degrades exonuclease single-stranded DNA, NH 2 _NH- group at the terminal, or a biotin or avidin with a NH 2 _O-group, and the labeling enzyme linked to avidin or biotin, a chromogenic substrate of the labeling enzyme A kit for detecting methylcytosine according to claim 27. 28. The kit for detecting methylcytosine according to claim 27, comprising an exonuclease that specifically degrades single-stranded DNA and a labeling substance of the following formula (1) or (2).
(In the formula, R represents a labeling substance.)
(In the formula, R represents a labeling substance.) The kit for detecting methylcytosine according to claim 27, comprising osmate and bipyridine as reagents capable of oxidizing methylcytosine.   32. The methyl cytosine detection kit according to claim 31, wherein the methyl cytosine detection probe has a fluorescent substance bound thereto.   32. The methyl cytosine detection kit according to claim 31, wherein the methyl cytosine detection probe is formed by binding a fluorescent substance that is quenched by the presence of an osmium-containing heterocyclic group represented by formula (5). A kit for detecting methylcytosine comprising the probe according to claim 24 or 25 and bisulfite.   A kit for detecting methylcytosine comprising the probe according to claim 24 or 25, to which a group capable of specifically binding to methylcytosine is bound. A nucleic acid chip in which one or more of the probes according to claim 24 or 25 are immobilized on a substrate. A methylcytosine detection apparatus comprising the nucleic acid chip according to claim 36 and an apparatus capable of detecting a color development pattern on the chip.