JPWO2006123445A1 - Protein display method - Google Patents

Abstract

Translating the mRNA in the sample using the cell extract, and at this time, skipping at least one stop codon to obtain a complex containing a conjugate of the mRNA and the resulting protein Protein display method. When translating mRNA in a sample using a cell extract, at least one type of stop codon is skipped by adding at least one type of mutant tRNA in which the anticodon of the amino acid tRNA is replaced with an anticodon corresponding to the stop codon. be able to.

Description

  The present invention relates to a protein display method and a kit used therefor.

    Ribosome display is a method in which a polypeptide synthesized in a complex of mRNA and ribosome is bound to mRNA so that each polypeptide is tagged with mRNA and the polypeptide is displayed by mRNA. . This is based on the fact that unlike a polypeptide, mRNA can be easily sequenced using a sequencer or the like, and because nucleic acid is easy to amplify, it can be easily sequenced even if only a small amount is present. .

    For example, when a protein to which a mRNA tag is attached to all proteins contained in a human sample is reacted with a test protein or test substance, the test protein or test substance and the specific protein in the sample are bound and separated. At this time, identification of the protein takes time, but the corresponding protein can be easily identified by reading the base sequence of mRNA bound thereto. In this way, a protein that specifically binds to the test protein or test substance can be screened.

As a display or screening method for such a target protein, Patent Document 1
(a) constructing an in vitro expression unit comprising an RNA polymerase binding site, a ribosome binding site, and a 5 ′ untranslated region containing a translation initiation signal capable of synthesizing mRNA;
(b) attaching a random nucleic acid sequence to the expression unit;
(c) transcribe or replicate the expression unit and the sequence associated with the random nucleic acid sequence to produce RNA;
(d) translate this RNA to produce polysomes under conditions that can maintain the polysomes,
(e) binding a test substance to this polysome,
(f) isolating the polysome bound to the test substance,
(g) destroying the isolated polysomes,
(h) recovering mRNA;
(i) constructing cDNA from the recovered mRNA;
(j) A method for producing a novel polypeptide by expressing cDNA is disclosed.

  However, in the method of Patent Document 1, polysomes on which polypeptides of various lengths are presented can be isolated, but the full-length polypeptides are not displayed.

Non-Patent Document 1
(a) A DNA library encoding the scFv of an antibody is amplified by PCR to produce a DNA template having a T7 promoter, a ribosome binding site, a stem-loop, a 3-terminal artificial linker, and containing no stop codon Transcribing it into RNA;
(b) translating mRNA in the presence of a factor that stabilizes the ribosome complex in vitro to improve scFv antibody folding on the ribosome;
(c) selecting a desired ribosome complex from the translation mixture by binding native scFv to an immobilized antigen;
(d) detaching the EDTA-bound ribosome complex and specifically eluting the entire complex with the antigen;
(e) isolating RNA from the complex;
(f) reverse transcription of isolated mRNA into cDNA, and a method of amplifying the cDNA by PCR. In this method, the target of screening is limited to a DNA library encoding the scFv of an antibody, and it is not possible to screen all human proteins. In addition, since it is necessary to add an artificial linker to the 3 ′ end and further remove the stop codon, natural mRNA cannot be used directly.

Non-Patent Document 2
(a) in vitro transcription / translation of a synthetic DNA library containing a random NNK codon region;
(b) stopping protein synthesis with chloramphenicol and separating polysomes;
(c) placing the polysome in a well containing an immobilized receptor capable of affinity selection;
(d) separating the bound polysomes with EDTA and recovering mRNA;
(f) reverse transcription of mRNA into cDNA;
(g) a method comprising amplifying cDNA by PCR. However, in this method, protein synthesis is stopped with chloramphenicol before reaching the stop codon, so the full-length protein is not displayed and affinity selection cannot be performed for the full-length protein.

  Non-Patent Document 3 discloses a method for elucidating the suppression mechanism of the translation system using mRNA in which serine codon of mRNA encoding alicyclobacillus acidocardarius-derived esterase is replaced with UAG of stop codon. Yes. Furthermore, it teaches that translation of mRNA can be suppressed more effectively by inactivating RF1 using an antibody against the release factor RF1 that separates ribosomes and polypeptide chains.

However, Non-Patent Document 3 only elucidates the suppression mechanism of the translation system, and does not describe that a full-length polypeptide and a corresponding mRNA were obtained.
WO 91/05058 Proc. Natl. Acad. Sci. USA, Vol. 94, 4937-4942, 1997 Proc. Natl. Acad. Sci. USA, Vol. 91, 9022-9026, 1994 FEBS Letters, Vol.579,2156-2160,2005

  An object of the present invention is to provide a method for displaying a protein contained in a sample by being physically linked to mRNA encoding the same, and a kit used therefor.

In order to solve the above-mentioned problems, the present inventors have conducted research and obtained the following knowledge.
(i) When the mRNA in the sample is translated in vitro using the cell extract, the stop codon is added by adding to the translation system a mutant tRNA in which the anticodon of the amino acid tRNA is replaced with an anticodon corresponding to the stop codon. The skipped and synthesized protein does not leave the mRNA. Thereby, the conjugate | bonded_body of mRNA and corresponding protein is obtained.
(ii) When mRNA extracted from a sample is translated in vitro using a cell extract, a cell extract in which the termination factor does not function is used to skip the stop codon and Does not leave the mRNA. Thereby, the conjugate | bonded_body of mRNA and corresponding protein is obtained.
(iii) Since mRNA extends a polypeptide chain in a state of being complexed with a ribosome, the polypeptide chain extending part and the mRNA polypeptide extending part are covered with a ribosome tunnel and displayed externally. Not. By skipping the stop codon, the peptide chain extends beyond the coding sequence to the stop codon and 3′-UTR, so that at least the full length of the protein corresponding to the coding sequence of the natural mRNA is pushed out of the ribosome tunnel. Displayed outside. In this way, at least the full length of the protein corresponding to the coding sequence of the natural mRNA can be displayed without separating the ribosome from the conjugate of protein and mRNA.

  The present invention has been completed based on the above findings, and provides the following protein display method and kit.

    Item 1. Translating the mRNA in the sample using the cell extract, and at this time, skipping at least one stop codon to obtain a complex containing a conjugate of the mRNA and the resulting protein Protein display method.

    Item 2. When translating mRNA in a sample using a cell extract, at least one type of stop codon is skipped by adding at least one type of mutant tRNA in which the anticodon of the amino acid tRNA is replaced with an anticodon corresponding to the stop codon. Item 2. The method according to Item 1.

    Item 3. Item 3. The method according to Item 2, wherein all the stop codons are skipped by adding a mutant tRNA so as to correspond to all the stop codons.

    Item 4. Item 4. The method according to Item 2 or 3, wherein the mutant tRNA is aminoacylated by an aminoacyl-tRNA synthetase.

    Item 5. Item 5. The method according to Item 4, wherein the mutant tRNA is paired with an aminoacyl-tRNA synthetase that does not have an anticodon site as a recognition site.

    Item 6. As the mutant tRNA, a mutant tRNA in which the anticodon of leucine tRNA is replaced with an anticodon for the stop codon, a mutant tRNA in which the anticodon of serine tRNA is replaced with an anticodon for the stop codon, a mutant tRNA in which the anticodon of cysteine tRNA is replaced with an anticodon for the stop codon, and Item 6. The method according to any one of Items 2 to 5, wherein at least one selected from the group consisting of a mutant tRNA in which an anticodon of alanine tRNA is substituted with an anticodon for a stop codon is used.

    Item 7. Item 7. The method according to any one of Items 2 to 6, wherein a cell extract in which at least one termination factor does not function is used as the cell extract.

    Item 8. A cell extract in which at least one terminator does not function is a reconstructed cell extract that does not contain at least one terminator, a cell extract in which at least one terminator is inactivated, or an excess amount Item 8. The method according to Item 7, which is a cell extract containing the tRNA.

    Item 9. Item 2. The method according to Item 1, wherein when the mRNA in the sample is translated using the cell extract, at least one kind of stop codon is skipped by using a cell extract that does not function at least one termination factor as the cell extract. the method of.

    Item 10. A cell extract in which at least one terminator does not function is a reconstituted cell extract that does not contain at least one terminator, a cell extract in which at least one terminator is inactivated, or an excess amount Item 10. The method according to Item 9, which is a cell extract containing tRNA.

    Item 11. Item 11. The method according to Item 9 or 10, which uses a cell extract in which all termination factors do not function.

    Item 12. Item 12. The method according to any one of Items 1 to 11, further comprising a step of extracting mRNA from the sample before the mRNA translation step.

    Item 13. Item 13. The method according to Item 12, further comprising the step of adding an arbitrary nucleic acid sequence to the 3 'end of the extracted mRNA after the mRNA extraction step and before the mRNA translation step.

    Item 14. A protein display kit comprising a cell extract and at least one mutant tRNA in which an anticodon of an amino acid tRNA is replaced with an anticodon corresponding to a stop codon.

    Item 15. Item 15. The kit according to Item 14, further comprising a cell extract in which at least one termination factor does not function.

    Item 16. A protein display kit comprising a cell extract in which at least one termination factor does not function.

Item 17. The following mutant tRNA of (1), (2), or (3)
(1) A mutant tRNA for skipping a stop codon UAG in which the anticodon of serine tRNA is replaced with CUA.
(2) A mutant tRNA for skipping a stop codon UGA in which the anticodon of serine tRNA is replaced with UCA.
(3) A mutant tRNA for skipping the stop codon UAA in which the anticodon of serine tRNA is replaced with UUA.

  According to the method of the present invention, when the mRNA in the sample is translated in vitro, the extension of the polypeptide proceeds by skipping the stop codon, and the full length of the protein corresponding to at least the coding sequence of the natural mRNA is transferred to the ribosome tunnel. Can be exposed from. Furthermore, the synthesized full-length protein does not leave from the mRNA, and a conjugate of the protein and the mRNA encoding it can be obtained.

  By displaying the full length of the protein from the ribosome tunnel to the outside, a protein having a desired property can be screened without performing a special operation such as removal of the ribosome. For example, a protein that interacts with a specific compound or a specific protein can be screened. In addition, by detecting a protein that interacts with a specific compound, there is a possibility that a protein causing a side effect by the compound can be predicted.

    Moreover, the amino acid sequence of a corresponding protein can be read by reading the base sequence of the protein coding region of mRNA. mRNA has a high reading sensitivity because it is easy to read the base sequence and can be easily amplified by a method such as RT-PCR.

    Thus, in the method of the present invention, a protein is displayed by binding the tag of mRNA encoding the protein to the protein. By skipping all three stop codons, all proteins contained in the sample can be displayed.

    A conjugate of protein and mRNA is usually obtained as a complex with ribosome. Therefore, in order to present the full length of the protein corresponding to at least the coding sequence of mRNA, it is necessary to extend the peptide chain beyond the coding sequence or to separate the ribosome from the conjugate of protein and mRNA. Become. By skipping the stop codon as in the present invention, at least the full length of the protein corresponding to the coding sequence of the natural mRNA can be displayed without complicated and special operations.

It is a figure which shows that reading skip of the stop codon UAG was performed by using tRNA ^Leu5 _CUA or / and RF ((DELTA)) cell extract.

It is a figure which shows the length of 3'-UTR required for full length display of the protein coding region of mRNA.

The use of tRNA ^SerU _UUA , tRNA ^SerU _UCA , tRNA ^SerCUA and RFs (Δ) cell extract showed that the stop codons UAA, UGA and UAG were skipped, respectively, and 3 'of natural DHFR -It is a figure which shows that full length protein presentation is feasible also with a UTR sequence.

Hereinafter, the present invention will be described in detail.
(I) Protein display method

In the protein display method of the present invention, mRNA in a sample is translated using a cell extract, and at this time, at least one kind of stop codon is skipped, and a conjugate of the mRNA and the protein produced by translation of the mRNA. And a second step of obtaining a complex containing.
mRNA extraction

  Although mRNA can be used for translation while contained in a test sample such as blood, it is preferable to use mRNA extracted from the test sample. The extraction method of mRNA is well-known, for example, it can extract by RNeasy Kit by Qiagen. In addition, mRNA can be extracted as a total RNA containing other RNA and used as it is for in vitro translation in the second step. However, in order to avoid the possibility that contaminating RNA inhibits translation, only mRNA may be extracted. Preferably, it is more preferable to purify mRNA. The method for extracting total RNA is well known, and for example, the method described in Nucleic Acids Res. 1997 Sep 1; 25 (17): 3465-70.

  As shown in the examples described later, the prokaryotic ribosome differs depending on the cell type, but if the length of the 3 ′ adjacent region of the protein coding region of mRNA is 75 bases or more, the entire region of the protein coding sequence is Get out of the ribosome tunnel. Since the prokaryotic 3′-UTR is usually about 100 to 300 bases, even if natural mRNA is used as it is, most of the protein corresponding to the coding sequence of the natural mRNA goes out of the ribosome tunnel to the outside. .

  The eukaryotic ribosome differs depending on the cell type, but if the length of the 3 ′ adjacent region of the protein coding region of mRNA is 70 to 80 bases or more, the entire length of the protein coding region goes out of the ribosome tunnel. it is conceivable that. Since the 3′-UTR of eukaryotic cells is usually about 200 to 1000 bases, even if natural mRNA is used as it is, usually at least the full length of the protein corresponding to the coding sequence of the natural mRNA is from the ribosome tunnel to the outside. Get out.

Therefore, the extracted mRNA may be subjected to in vitro translation as it is, or an arbitrary nucleotide sequence may be added to the 3 ′ end of the extracted mRNA, thereby more reliably determining the full-length protein coding region of the mRNA. It can be pushed out of the ribosome. Examples of the nucleotide sequence to be added include poly A by polyadenylation enzyme.
In translating mRNA using an in vitro translated cell extract, the mRNA and the cell extract are mixed, and the mRNA is translated into protein by a translation system contained in the cell extract. In the present invention, the synthesized protein is prevented from leaving the mRNA at the position of the stop codon by skipping the stop codon on the mRNA.

    In normal protein synthesis, an amino acid is not introduced at a position corresponding to a termination codon of a growing polypeptide chain, and the protein is detached from the complex of ribosome and mRNA by the action of a termination factor.

    In the present invention, “skip the stop codon” means that the full-length protein is pushed out of the ribosome tunnel by continuing to extend without extending the polypeptide at the position of the stop codon, and the protein (polypeptide Chain) does not leave the complex of mRNA and ribosome. For example, by introducing an amino acid or a modified amino acid at a position corresponding to a stop codon of a polypeptide chain extending on mRNA, or when the termination factor does not function, polypeptide synthesis is stopped, and mRNA and ribosome Detachment of the polypeptide chain from the complex with.

    In the present invention, “stop codon was skipped” not only when the termination of polypeptide synthesis by the signal of the stop codon and the elimination of the polypeptide chain are completely prevented but also when 50% or more are prevented. Judge.

    In both eukaryotic and prokaryotic cells, the three codons UAA, UAG, and UGA function as stop codons. By making it possible to skip all three types of stop codons and skipping the stop codons present in each 3'UTR, the total protein in the sample can be labeled with mRNA and displayed.

As the cell extract, a eukaryotic cell extract may be used if the sample mRNA is derived from a eukaryotic cell, and a prokaryotic cell extract may be used if the sample mRNA is derived from a prokaryotic cell. It is preferable to use a cell extract of a biological species closely related to the biological species from which the sample mRNA is derived, particularly the same biological species.
Mutant tRNA

  For example, if a mutant tRNA in which the anticodon of a tRNA that is transported by combining amino acids is replaced with an anticodon corresponding to the stop codon is added to the mixture of mRNA and cell extract, it corresponds to the stop codon of the extending polypeptide chain. This mutant tRNA binds an amino acid at a position where Thereby, the termination factor does not function and the polypeptide chain does not leave the mRNA. The mutant tRNA may be any aminoacylylated by an endogenous or artificially mutated aminoacyl-tRNA synthetase. For example, a tRNA paired with an aminoacyl-tRNA synthetase that does not have an anticodon site as a recognition site can be used. In this case, an anticodon-mutated mutant tRNA can also be efficiently acylated with an aminoacyl-tRNA synthetase. Specific examples include leucine tRNA synthetase (especially leucine 5 tRNA synthetase), serine tRNA synthetase (especially serine 3 tRNA synthetase), cysteine tRNA synthetase, alanine tRNA synthetase and the like.

  In the method of the present invention, as a mutant tRNA, in the tRNA that binds amino acids, the anticodon is UUA (anticodon of the stop codon UAA), the anticodon is CUA (anticodon of the stop codon UAG), and the anticodon is UCA (stop) One or more of the codon UGA anticodons) may be used. Further, by using all of the anticodons that are UUA, CUA, and UCA, it is possible to skip all stop codons.

  The mutant tRNA may bind any amino acid. Among them, it is terminated by using those that carry non-charged amino acids such as glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, tyrosine, tryptophan, serine, threonine, cysteine, methionine, asparagine, glutamine. Codons can be skipped efficiently. In particular, a mutated tRNA obtained by modifying the anticodon of leucine tRNA (particularly leucine 5 tRNA), serine tRNA (particularly serine 3 tRNA), cysteine tRNA, or alanine tRNA is preferable in terms of skipping efficiency.

    Mutant tRNA may use only one that carries one type of amino acid, or may mix and use one that carries multiple types of amino acids.

  The mutant tRNA can be prepared by, for example, a run-off in vitro transcription method, and specifically can be prepared according to the method described in the Examples.

In addition, the mutant tRNA is not limited to a natural tRNA mutant that carries an amino acid, but may carry a homologue of an amino acid. Examples of the misacylated tRNA include tRNA in which naphthylalanine is bound to the 3 ′ end. However, mutant tRNAs that carry natural amino acids have the advantage that they can be reused after the amino acids are transferred to the peptide chain.
Cell extract without termination factor

  A stop codon can also be skipped by using a cell extract that does not function as a termination factor.

  Examples of the cell extract in which the termination factor does not function include a reconstructed cell extract. A reconstructed cell extract from which a termination factor is removed and other components necessary for translation are added is commercially available from, for example, Post Genome Institute.

    In addition, a cell extract obtained by inactivating a termination factor by adding an aptamer or an antibody against the termination factor can also be used. An aptamer that binds to a termination factor can be prepared, for example, by the in vitro selection method described in Annu Rev Biochem. 1999; 68: 611-47. Further, the antibody against the termination factor may be a polyclonal antibody or a monoclonal antibody. These can be prepared by well-known methods (for example, Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley and Sons. Section 11.12-11.13; Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley and Sons. Section 11.4-11.11).

    Furthermore, a cell extract of a cell line in which the termination factor is deficient or mutated can also be used. In prokaryotic cells, e.g. E. coli XAC30 strain is known as a termination factor 1 (RF1) -deficient strain.

    Further, if tRNA is further added to a cell extract containing few termination factors so as to contain an excessive amount of tRNA relative to the termination factor, misreading occurs, resulting in a cell extract in which the termination factor does not function.

    In the method of the present invention, a cell extract in which one or more termination factors do not function may be used, but all termination codons can be skipped by using cell extracts in which all types of termination factors do not function. .

  Three types of termination factors, RF1, RF2 and RF3, are known in E. coli as a representative example of prokaryotic cells. RF1 recognizes stop codons UAG and UAA, and RF2 recognizes stop codons UGA and UAA. Accordingly, UAG can be skipped if a cell extract that does not function RF1 is used, UGA can be skipped if a cell extract that does not function RF2 is used, and a cell extract that does not function both can be used. All stop codons can be skipped. The function of RF3 has not been elucidated.

  In eukaryotic cells, a termination factor called eRF recognizes all three types of stop codons. Therefore, if a cell extract in which eRF does not function is used, all stop codons are skipped.

In order to skip the stop codon, at least one type of mutant tRNA can be used, and a cell extract in which at least one type of termination factor does not function can also be used. This makes it possible to more reliably skip the stop codon. In this case, it is desirable to use a mutant tRNA that skips a specific stop codon and a cell extract that does not function a termination factor that recognizes the stop codon.
Translation process

  Translation of mRNA is carried out by mixing and incubating mRNA, cell extract and amino acids constituting the protein. As amino acids, 20 kinds of amino acids that usually constitute proteins may be used, but these amino acids are usually added to commercially available cell extracts. As described above, the stop codon can be skipped by a method of adding a mutant tRNA to this mixture, a method of using a cell extract in which a termination factor does not function, or the like.

Incubation may be performed, for example, at about 25 to 50 ° C. for about 10 to 240 minutes. This usually synthesizes the full length of all proteins.
mRNA reading

According to the method of the present invention, a protein having a protein bound to a part or all of the ribosome constituting the polysome is usually obtained. By subjecting this to EDTA treatment, each protein-mRNA-ribosome complex in the polysome is separated from each other, and the sequence of the mRNA may be read using a sequencer. When the complex is separated, the full length sequence can be read. In addition, when the protein which it codes can be identified by reading the partial sequence of mRNA, it is not necessary to isolate | separate mRNA from a polysome.
Example

EXAMPLES Hereinafter, although an Example is shown and this invention is demonstrated in detail, this invention is not limited to these.
<Reagent / Enzyme / Cell extract>

  In the following Examples, gel electrophoresis used Mini Protein SPR300 system (Bio-Rad), and blotting used Trans-Blot SD system (Bio-Rad). The enzyme purchased the commercial item.

The reconstructed two prokaryotic cell-free translation system Classic 1 was purchased from the Post Genome Institute. The RF1 (+) cell extract contains a sufficient amount of RF1 and has a small amount of RF2. The RF1 (Δ) cell extract is low in both RF1 and RF2.
<Preparation of template DNA>
Preparation of template DNA of Example 1

  PDHFR encoding E. coli DHFR was provided by Dr. Y. Shimizu of Post Genome Institute. The first round of PCR included 4 pmol forward and reverse primers, 20 ng pDHFR, 4 nmol of 1.25 U Pfu Ultra HF DNA polymerase (Stratagene), 4 nmol of each dNTPs (TOYOBO), and 2 μL of 10 × Pfu Ultra HF reaction buffer. A 20 μL reaction mixture containing was used. After the PCR reaction, the amplified product was subjected to agarose gel electrophoresis.

The second round of PCR was performed using a primer with 4 pmol of T7 promoter (underlined) (5'-d (GAA AT T AAT ACG ACT CAC TAT A GG GAG ACC ACA ACG GTT TCC CTC TAG AAA TAA TTT TGT TTA ACT TTA AGA AGG AGA TAT ACC A) -3 ′: SEQ ID NO: 3), 4 pmol reverse primer, first PCR product of 20 fmol or less, 1.25 U Pfu Ultra HF DNA polymerase, 4 nmol of each dNTPs, 2 μL of 10 × The reaction was performed using 20 μL of the reaction mixture containing Pfu Ultra HF reaction buffer. The primers used for these PCRs are shown below.

T7 (+) UAG (+) Stop (-) template
First PCR
Forward primer: 5'-AAGGAGATATACCAATGGCTAGCATGACTGGTGGACAGCAAATGGGTTAGATCAGTCTGATTGC-3 '(SEQ ID NO: 1)
Reverse primer: 5'-CCGCCGCTCCAGAATCTC-3 '(SEQ ID NO: 2)
Second PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3 '(SEQ ID NO: 3)
Reverse primer: 5'-CCGCCGCTCCAGAATCTC-3 '(SEQ ID NO: 4)

UAG (+) T7 (+) Stop (-) template
First PCR
Forward primer: 5'-AAGGAGATATACCAATGTAGATGGCTAGCATGACTGGTGGACAGCAAATGGGTATCAGTCTGATTGCGGCGTTAG-3 '(SEQ ID NO: 5)
Reverse primer: 5'-CCGCCGCTCCAGAATCTC-3 '(SEQ ID NO: 6)
Second PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3 '(SEQ ID NO: 7)
Reverse primer: 5'-CCGCCGCTCCAGAATCTC-3 '(SEQ ID NO: 8)

T7 (+) UAG (+) UAA (+) template
First PCR
Forward primer: 5'-AAGGAGATATACCAATGGCTAGCATGACTGGTGGACAGCAAATGGGTTAGATCAGTCTGATTGC-3 '(SEQ ID NO: 9)
Reverse primer: 5'-TATTCATTACCGCCGCTCCAGAATCTCA-3 '(SEQ ID NO: 10)
Second PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3 '(SEQ ID NO: 11)
Reverse primer: 5'-TATTCATTACCGCCGCTCCAGAATCTCA-3 '(SEQ ID NO: 12)

UAG (+) T7 (+) UAA (+) template
First PCR
Forward primer: 5'-AAGGAGATATACCAATGTAGATGGCTAGCATGACTGGTGGACAGCAAATGGGTATC AGTCTGATTGCGGCGTTAG-3 '(SEQ ID NO: 13)
Reverse primer: 5'-TATTCATTACCGCCGCTCCAGAATCTCA-3 '(SEQ ID NO: 14)
Second PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3 '(SEQ ID NO: 15)
Reverse primer: 5'-TATTCATTACCGCCGCTCCAGAATCTCA-3 '(SEQ ID NO: 16)

T7 (+) UAG (-) UAA (+) template
First PCR
Forward primer: 5'-AAGGAGATATACCAATGGCTAGCATGACTGGTGGACAGCAAATGGGTATCAGTCTGATTGCGGCGTTAG-3 '(SEQ ID NO: 17)
Reverse primer: 5'-TATTCATTACCGCCGCTCCAGAATCTCA-3 '(SEQ ID NO: 18)
Second PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAGACCACAACGGTTTCCCTCTAGA AATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3 '(SEQ ID NO: 19)
Reverse primer: 5'-TATTCATTACCGCCGCTCCAGAATCTCA-3 '(SEQ ID NO: 20)

Preparation of template DNA of Example 2

The DNA template for the synthesis of mRNA containing the naturally occurring sequence 3′-UTR used in Example 2 was further used for the third PCR (for 75 nucleotides) and the fourth PCR (for 147 nucleotides). ), Or 5th PCR (due to 219 nucleotides). The primers used for these PCRs are shown below.

T7 (+) UAG (+) UAG (+) template
First PCR
Forward primer: 5'-AAGGAGATATACCAATGATCAGTCTGATTG-3 '(SEQ ID NO: 21)
Reverse primer: 5'-CCGCCGCTCCAGAATCTC-3 '(SEQ ID NO: 22)
Second PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3 '(SEQ ID NO: 23)
Reverse primer: 5'-GCATCCGGCGCTAGCCGTAAATTCTATACAAAACTAACCCATTTGCTGTCCACCAGTCATGCTAGCCATCCGCCGCTCCAGAATCTCAAAGC-3 '(SEQ ID NO: 24)
3rd PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 25)
Reverse primer: 5'-AACACAGCCTGATATAGGAAGGCCGGATAAGACGCGACCGGCGTCGCATCCGGCGCTAGCCGTAAATTC-3 '(SEQ ID NO: 26)
4th PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 27)
Reverse primer: 5'-CTGGGAAGATAAACAGTATTTTGTCCAGCCGTCGAACCGGCATAAGGATTTGGGCGAAGCGGCGGCGTCCTAAACACAGCCTGATATAGGAAG-3 '(SEQ ID NO: 28)
5th PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 29)
Reverse primer: 5'-CAAAGGTACGCCGGAAGGTATATACGCGCTGGATACCGGCTGCTGCTGGGGTGGTACATTAACCTGCCTGCGCTGGGAAGATAAACAGTATTTTGTC-3 '(SEQ ID NO: 30)

T7 (+) UAG (-) Leu (+) template
First PCR
Forward primer: 5'-AAGGAGATATACCAATGATCAGTCTGATTG-3 '(SEQ ID NO: 31)
Reverse primer: 5'-CCGCCGCTCCAGAATCTC-3 '(SEQ ID NO: 32)
Second PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3 '(SEQ ID NO: 33)
Reverse primer: 5'-GCATCCGGCGCTAGCCGTAAATTCTATACAAAAACCCATTTGCTGTCCACCAGTCATGCTAGCCATCCGCCGCTCCAGAATCTCAAAGC-3 '(SEQ ID NO: 34)
3rd PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 35)
Reverse primer: 5'-AACACAGCCTGATATAGGAAGGCCGGATAAGACGCGACCGGCGTCGCATCCGGCGCTAGCCGTAAATTC-3 '(SEQ ID NO: 36)
4th PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 37)
Reverse primer: 5'-CTGGGAAGATAAACAGTATTTTGTCCAGCCGTCGAACCGGCATAAGGATTTGGGCGAAGCGGCGGCGTCTAAAACACAGCCTGATATAGGAAG-3 '(SEQ ID NO: 38)
5th PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 39)
Reverse primer: 5'-CAAAGGTACGCCGGAAGGTATATACGCGCTGGATACCGGCTGCTGCTGGGGTGGTACATTAACCTGCCTGCGCTGGGAAGATAAACAGTATTTTGTC-3 '(SEQ ID NO: 40)

Preparation of template DNA of Example 3 The PCR primers used for preparing the template DNA used in Example 3 are shown below. The T7 promoter and T7 tag sequence are underlined. The anticodon sequence is double underlined.

T7 (+) UAA (+) UAA (+) (222) template
First PCR
Forward primer: 5'-AAGGAGATATACCAATGATCAGTCTGATTG-3 '(SEQ ID NO: 41)
Reverse primer: 5'-CCGCCGCTCCAGAATCTC-3 '(SEQ ID NO: 42)
Second PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3 '(SEQ ID NO: 43)
Reverse primer: 5'-GCATCCGGCGCTAGCCGTAAATTCTATACAAAA TTA ACCCATTTGCTGTCCACCAGTCATGCTAGCCATCCGCCGCTCCAGAATCTCAAAGC-3 '(SEQ ID NO: 44)
3rd PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 45)
Reverse primer: 5'-AACACAGCCTGATATAGGAAGGCCGGATAAGACGCGACCGGCGTCGCATCCGGCGCTAGCCGTAAATTC-3 '(SEQ ID NO: 46)
4th PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 47)
Reverse primer: 5'-CTGGGAAGATAAACAGTATTTTGTCCAGCCGTCGAACCGGCATAAGGATTTGGGCGAAGCGGCGGCGTCTC TTA AACACAGCCTGATATAGGAAG-3 '(SEQ ID NO: 48)
5th PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 49)
Reverse primer: 5'-CAAAGGTACGCCGGAAGGTATATACGCGCTGGATACCGGCTGCTGCTGGGGTGGTACATTAACCTGCCTGCGCTGGGAAGATAAACAGTATTTTGTC-3 '(SEQ ID NO: 50)

T7 (+) UGA (+) UGA (+) (222) template
First PCR
Forward primer: 5'-AAGGAGATATACCAATGATCAGTCTGATTG-3 '(SEQ ID NO: 51)
Reverse primer: 5'-CCGCCGCTCCAGAATCTC-3 '(SEQ ID NO: 52)
Second PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3 '(SEQ ID NO: 53)
Reverse primer: 5'-GCATCCGGCGCTAGCCGTAAATTCTATACAAAA TCA ACCCATTTGCTGTCCACCAGTCATGCTAGCCATCCGCCGCTCCAGAATCTCAAAGC-3 '(SEQ ID NO: 54)
3rd PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 55)
Reverse primer: 5'-AACACAGCCTGATATAGGAAGGCCGGATAAGACGCGACCGGCGTCGCATCCGGCGCTAGCCGTAAATTC-3 '(SEQ ID NO: 56)
4th PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 57)
Reverse primer: 5'-CTGGGAAGATAAACAGTATTTTGTCCAGCCGTCGAACCGGCATAAGGATTTGGGCGAAGCGGCGGCGTC TCA AACACAGCCTGATATAGGAAG-3 '( SEQ ID NO: 58)
5th PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 59)
Reverse primer: 5'-CAAAGGTACGCCGGAAGGTATATACGCGCTGGATACCGGCTGCTGCTGGGGTGGTACATTAACCTGCCTGCGCTGGGAAGATAAACAGTATTTTGTC-3 '(SEQ ID NO: 60)

T7 (+) UAG (+) UAG (+) (222) Template
First PCR
Forward primer: 5'-AAGGAGATATACCAATGATCAGTCTGATTG-3 '(SEQ ID NO: 61)
Reverse primer: 5'-CCGCCGCTCCAGAATCTC-3 '(SEQ ID NO: 62)
Second PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3 '(SEQ ID NO: 63)
Reverse primer: 5'-GCATCCGGCGCTAGCCGTAAATTCTATACAAAA CTA ACCCATTTGCTGTCCACCAGTCATGCTAGCCATCCGCCGCTCCAGAATCTCAAAGC-3 '(SEQ ID NO: 64)
3rd PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 65)
Reverse primer: 5'-AACACAGCCTGATATAGGAAGGCCGGATAAGACGCGACCGGCGTCGCATCCGGCGCTAGCCGTAAATTC-3 '(SEQ ID NO: 66)
4th PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 67)
Reverse primer: 5'-CTGGGAAGATAAACAGTATTTTGTCCAGCCGTCGAACCGGCATAAGGATTTGGGCGAAGCGGCGGCGTC CTA AACACAGCCTGATATAGGAAG-3 '(SEQ ID NO: 68)
5th PCR
Forward primer: 5'-GAAAT TAATACGACTCACTATA GGGAG-3 '(SEQ ID NO: 69)
Reverse primer: 5'-CAAAGGTACGCCGGAAGGTATATACGCGCTGGATACCGGCTGCTGCTGGGGTGGTACATTAACCTGCCTGCGCTGGGAAGATAAACAGTATTTTGTC-3 '(SEQ ID NO: 70)

<In vitro transcription of template mRNA>

    Template mRNAs were obtained by run-off transcription of template DNA using T7-MEGAshortscript Kit (Ambion). Briefly, a solution containing 3 μL of final PCR product was added to 10 μL of T7-transcription mixture, which was incubated at 37 ° C. for 2 hours. 1 U DNase I was added to the reaction mixture and the mixture was incubated for an additional 15 minutes. MRNAs subjected to polyadenylation using Poly A tailing kit (Ambion) and mRNAs not subjected to such adenylation were purified using RNeasy MinElute Cleanup Kit (QIAGEN).

The concentration of purified mRNAs was determined by measuring the absorbance at 260 nm.
<Translation of mRNA template and Western blotting analysis>
<Example 1>

  1 μg translation of T7 (+) UAG (+) UAA (+), UAG (+) T7 (+) UAA (+), or T7 (+) UAG (-) UAA (+), 2.5 μg tRNA It was carried out at 37 ° C. for 10 minutes using 12.5 μL of the RF1 (+) translation system or RF1 (Δ) translation system. Add 1 μL of the reaction solution to 2.5 μL of sample loading buffer (125 mM Tris-HCl (pH 6.8), 4% (w / v) SDS, 20% (w / v) glycerol, 0.002% (w / v) bromophenol blue , 10% (v / v) 2-mercaptoethanol, and 1.5 μL of water The mixture was incubated at 95 ° C. for 5 minutes and subjected to 15% SDS-PAGE.

Western blotting was performed using PVDF membrane (Hybond ^™ -P, Amersham). T7-tagged protein was visualized using anti-T7-HRP conjugate antibody (Novagen) and ECL Plus ^™ Western Blotting Detection Reagent (Amersham)

Suppression, ie, read-through efficiency, is based on the internal standard of serial dilutions (10, 20, 40, 60, 80, 100%) of T7 (+) UAG (-) UAA (+) template full length DHFR. This was done by evaluating the density of the band using Image J software (NIH).
<Formation of PRM (polysome) complex and selection by T7 tag>

As described above, 2 μg of the template mRNA was translated at 37 ° C. for 10 minutes together with 5 μg of suppressor tRNA using 25 μL of RF1 (+) translation system or RF1 (Δ) translation system. This solution was ice-cooled in 455 μL containing 92.2 mM K ⁺ , 300 mM Na ⁺ , 50 mM Mg ²⁺ , 0.05% Tween20 (WAKO), and 2% Block Ace (Dainippon Pharmaceutical). Selection buffer (potassium phosphate, pH 7.3) was added followed by 20 μL of anti-T7-tag antibody (Novagen). The mixture was gently inverted upside down at 4 ° C. for 30 minutes, transferred to an empty filter column (Microspin Columns, Amersham) and filtered by centrifugation. Wash the remaining agarose 5 times with 200 μL ice-cold selection buffer (1,000 μL total), and finally 92.2 mM K ⁺ , 300 mM Na ⁺ , 30 mM EDTA, 0.05% Tween20, and Resuspended in 200 μL elution buffer (Phosphate-K, pH 7.2) containing 2% Block Ace. The resulting suspension was gently inverted for 10 minutes at room temperature. MRNAs detached from the PRM complex or polysomes were eluted by centrifugation.

The eluted mRNAs were purified using RNeasy MinElute Cleanup Kit. Yield was determined by measuring UV absorbance at 260 nm. Amplification of these recovered mRNAs by RT-PCR was performed using a QIAGEN One-Step RT-PCR kit (QIAGEN). The following primers were used.
Forward primer:
5'-GAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCA-3 '(Universal) (SEQ ID NO: 71)
Reverse primer: 5'-CCGCCGCTCCAGAATCTC-3 '(SEQ ID NO: 72)
< Preparation of tRNA ^Leu5 _CUA >

The E. coli suppressor tRNA ^Leu5 _CUA was prepared by run-off in vitro transcription. Template DNA consists of 20 pmol forward primer (5'-d (TAA TAC GAC TCA CTA TAG CCC GGA TGG TGG AAT CGG TAG ACA) -3 '(SEQ ID NO: 73)), 20 pmol reverse primer (5'-d (TGG TAC CCG GAG CGG GAC TTG AAC CCG CAC AGC GCG AAC) -3 '(SEQ ID NO: 74)), 100 fmol template DNA (5'-d (TG GTA CCC GGA GCG GGA CTT GAA CCC GCA CAG CGC GAA CGC CGA GGG ATT TAG AAT CCC TTG TGT CTA CCG ATT CCA CCA TCC GGG C) -3 '(SEQ ID NO: 75)), 1.25 U Pfu Ultra HF DNA polymerase (Stratagene), 10 nmol of each dNTPs (TOYOBO), and 2 μL The PCR was performed using 20 μL of the reaction mixture containing 10 × Pfu Ultra HF reaction buffer. The obtained PCR solution was used for transcription reaction without purification.

In vitro transcription consists of 2,500 U T7 RNA polymerase (TOYOBO), 2 μmol of each NTPs (Fermentas), 5 μmol GMP (Sigma), 1 U inorganic pyrophosphate (Calbiochem-Novabiochem), 80 U RNase inhibitor (TOYOBO) ), 500 μL of the reaction mixture containing 18 μL of the template DNA PCR solution and 50 μL of 10 × reaction buffer (18 hours at 37 ° C.). The transcribed tRNA was purified using denaturing PAGE (8%), followed by ethanol precipitation and dissolved in 500 μL of water. The resulting tRNA was further purified by passing continuously through Microcon YM-30 (Millipore) and G-25 Microspin Columns (Amersham).
< Preparation of tRNA ^SerU _UUA >

In the preparation method of the aforementioned tRNA ^Leu5 _CUA, as a forward primer, 5'-G TAA TAC GAC TCA CTA TA GGA GAG ATG CCG GAG CGG CTG AAC-3 '( SEQ ID NO: 76), 5'-TGG CGG AGA as the reverse primer GAG GGG GAT TTG AAC CCC CGG TAG AGT TGC C-3 '(SEQ ID NO: 77), 5'-GGA GAG ATG CCG GAG CGG CTG AAC GGA CCG GTC T TT A AA ACC GGA GTA GGG GCA ACT CTA CCG GGG An E. coli suppressor tRNA ^SerU _UUA was prepared in the same manner as tRNA ^Leu5 _CUA ^except that GTT CAA ATC CCC CTC TCT CCG CCA-3 ′ (SEQ ID NO: 78) was used.
< Preparation of tRNA ^SerU _UCA >

In the above-described method for preparing tRNA ^Leu5 _CUA , 5′-G TAA TAC GAC TCA CTA TA GGA GAG ATG CCG GAG CGG CTG AAC-3 ′ (SEQ ID NO: 79) as a forward primer, and 5′-TGG CGG AGA as a reverse primer. GAG GGG GAT TTG AAC CCC CGG TAG AGT TGC C-3 '(SEQ ID NO: 80), 5'-GGA GAG ATG CCG GAG CGG CTG AAC GGA CCG GTC T TC A AA ACC GGA GTA GGG GCA ACT CTA CCG GGG An E. coli suppressor tRNA ^SerU _UCA was prepared in the same manner as tRNA ^Leu5 _CUA ^except that GTT CAA ATC CCC CTC TCT CCG CCA-3 ′ (SEQ ID NO: 81) was used.
< Preparation of tRNA ^SerU _CUA >

In the above-described method for preparing tRNA ^Leu5 _CUA , 5′-G TAA TAC GAC TCA CTA TA GGA GAG ATG CCG GAG CGG CTG AAC-3 ′ (SEQ ID NO: 82) is used as a forward primer, and 5′-TGG CGG AGA is used as a reverse primer. GAG GGG GAT TTG AAC CCC CGG TAG AGT TGC C-3 '(SEQ ID NO: 83), 5'-GGA GAG ATG CCG GAG CGG CTG AAC GGA CCG GTC T CT A AA ACC GGA GTA GGG GCA ACT CTA CCG GGG An E. coli suppressor tRNA ^SerU _CUA was prepared in the same manner as tRNA ^Leu5 _CUA ^except that GTT CAA ATC CCC CTC TCT CCG CCA-3 ′ (SEQ ID NO: 84) was used.
< Preparation of yeast tRNA ^Phe _CUA misacylated with Nap >

A plasmid encoding yeast tRNA ^Phe _CUA- CA was provided by Dr. M. Endo of Osaka University. 20 units of FokI (NEB) was added to 30 μg of plasmid dissolved in 110 μL of 1 × reaction buffer. The reaction solution was incubated at 37 ° C. for 6 hours and then incubated at 65 ° C. for 20 minutes. Translation reactions consisted of 55 μL of FokI linearized plasmid solution, 2 μmol of each NTPs (Fermentas), 5 μmol GMP (Sigma), 80 U RNase inhibitor (TOYOBO), 1 U inorganic pyrophosphate (Calbiochem-Novabiochem) 2,200 U of T7 RNA polymerase (TOYOBO) and 10 μL of 10 × reaction buffer (400 mM Tris-HCl (pH 8.0), 200 mM MgCl ₂ , 50 mM DTT, 500 μL of reaction solution) were used. The mixture was incubated for 8 hours at 37 ° C. and the transcribed yeast tRNA ^Phe _CUA- CA was purified using the QIAGEN DNA / RNA kit.The ligation reaction consisted of 10 μg tRNA ^Phe _CUA- CA, 12 pmol L naphthylalanyl. 20 μL reaction solution (55 mM Hepes-Na (pH 7.5), 15 mM MgCl ₂ , 3.3 mM DTT, 1 mM ATP) containing pdCpA (dissolved in DMSO) and 50 U T4 RNA ligase (Takara) The mixture was incubated for 2 hours at 4 ° C. and then diluted with 40 μL of 0.45 M aqueous potassium acetate (pH 5.0). Nord / chloroform / extracted with iso Amiri alcohol (25/24/1), and extracted again with chloroform, further precipitated with ethanol. The purified Nap-tRNA ^Phe _CUA, until use, 1 mM aqueous potassium acetate solution (pH 5.0 ).

The base sequences of suppressor tRNA ^Leu5 _CUA (FIG. 1b) _, suppressor tRNA ^Phe _CUA (FIG. 1b), and three types of suppressor tRNA ^Ser (FIG. 3b) are shown in SEQ ID NOs: 85, 86, and 87, respectively.
Example 1 ( stop-codon skipping using tRNA ^Leu5 _CUA )

  From the natural mRNA encoding E. coli dihydrofolate reductase (DHFR), the following five mutant mRNAs were prepared. The stop codon of this natural mRNA is UAA.

  In the first and second mutant mRNAs, a T7 tag is inserted between the start codon and the DHFR coding region, and a stop codon UAG is inserted before or after the T7 tag. UAG is recognized by the termination factor RF1. The stop codon after DHFR was deleted (first and second from the top in FIG. 1a).

  In the third and fourth mutant mRNAs, a T7 tag is inserted between the start codon and the DHFR coding region, and a stop codon UAG is inserted before or after that, and the stop codon UAA after the DHFR coding region is They are present as they are (third and fourth from the top in FIG. 1a). UAA is recognized by the termination factor RF2.

  The fifth mutant mRNA is one in which a T7 tag is inserted between the initiation codon of DHFR natural mRNA and the DHFR coding region (fifth from the top in FIG. 1a). The stop codon UAA after the DHFR coding region is present as it is.

  These template mRNAs were translated in vitro using a cell extract containing RF1 (RF +) and a reconstructed cell extract with reduced RF1 (RFΔ), respectively.

In addition, E.I. E. coli-derived leucine 5 tRNA (tRNA ^Leu5 _CUA ) or yeast-derived tRNA to which naphthylalanine was bound instead of phenylalanine (Nap-yeast-tRNA ^Phe _CUA ) was added. These are mutant tRNAs in which the anticodon is replaced with CUA that can pair with the stop codon UAG. These tRNAs are shown in FIG.

    The efficiency of skipping the stop codon is considered to depend on the type of amino acid introduced at the stop codon position and the level of the termination factor. Further, it is considered that the efficiency of skipping is improved by using tRNA that carries hydrophobic naphthylalanine.

FIG. 1 c shows the result of isolating the protein from the obtained protein solution using the T7 antibody and conducting Western blotting. Lanes 10 and 14 show the results using Nap-tRNA ^Phe _CUA which is a mutant tRNA, and lanes 11 and 15 show the results using tRNA ^Leu5 _CUA which is a mutant tRNA. The other lanes are the results when no such mutant tRNA is used.

    When a cell extract with reduced RF1 was used, a template mRNA (T7 (+) UAG (−) UAA (+)) in which no stop codon UAG is present upstream of DHFR and stop codon UAA is present downstream of DHFR. The amount of protein increased in a dose-dependent manner in the template mRNA, and DHFR was generated (lanes 1 to 7), and this template mRNA was the same regardless of the presence or absence (some amount) of the termination factor RF1. (Compare lanes 7 and 17.) This indicates that sufficient amounts of RF1 and RF2 are present in the cell extract to recognize the UAA stop codon and terminate protein synthesis. Show.

  Further, in T7 (+) UAG (+) UAA (+) and UAG (+) T7 (+) UAA (+) in which the stop codon UAG is present upstream of the DHFR coding region, the cell extract of RF1 (+) DHFR has not been synthesized (lanes 18 and 19). Thus, the stop codon UAG is recognized under the condition of RF1 (+).

    In addition, when a stop codon UAG is present upstream of DHFR, by using a cell extract with reduced RF1 and using a mutant tRNA, the stop codon UAG was efficiently read out and the amount of DHFR synthesis increased. (Comparison between lane 9 and lanes 10 and 11; comparison between lane 13 and lanes 14 and 15).

In the presence of Nap-tRNA ^Phe _CUA , recovery of the full-length protein amount was 34% (lane 10) for T7 (+) UAG (+) UAA (+), and for UAG (+) T7 (+) UAA (+). 35% (lane 14). Also, in the presence of tRNA ^Leu5 _CUA carrying leucine, 61% (lane 11) for T7 (+) UAG (+) UAA (+) and 86% for UAG (+) T7 (+) UAA (+) ( Lane 15).

  Thus, these suppressor tRNAs skipped the UAG stop codon and the downstream DHFR sequence was translated.

Next, translation using a template that does not have a UAA stop codon at the end will be described. FIG. 1d is a diagram showing the amount of mRNA recovered after selection of polysomes formed during translation using a T7 tag antibody. In the template of T7 (+) UAG (+) STOP (-) and UAG (+) T7 (+) STOP (-), when tRNA ^Leu5 _{CUA of} suppressor tRNA was used, under the condition of RF1 (Δ), T7 Tagged DHFR mRNA was recovered.

    The recovered amounts were about 28% for T7 (+) UAG (+) STOP (−) and about 26% for UAG (+) T7 (+) STOP (−) with respect to the total mRNA amount ( Lanes 4, 6). UAG was not present upstream of DHFR, and the yield was about 35% in a positive control (lane 1) using a normal cell extract and not using a mutant tRNA. Compared to this control, T7 (+) UAG (+) STOP (-) reading skip efficiency was about 80%, UAG (+) T7 (+) STOP (-) reading skip efficiency was about 71%. .

It can be seen that by using the RF (Δ) cell extract and using the suppressor tRNA, UAG skipping was performed very efficiently.
The above results indicate that the T7 tag was pushed out of the ribosome tunnel to the extent that the antibody can access by skipping the UAG stop codon, and that both the DHFR protein and the mRNA template were present.
Example 2
( Display of full-length protein using tRNA ^Leu5 _CUA as a template for pseudo-natural mRNA)

As shown in FIG. 2a, two types of pseudo- natural mRNAs were prepared from natural mRNA encoding E. coli dihydrofolate reductase (DHFR).

  The top row of FIG. 2a is the native DHFR mRNA. This is because the stop codon is UAA, and there is also a UAA sequence in the 3'-UTR.

    Shown in the middle of FIG. 2a is the first pseudo-natural mRNA, with the T7 tag sequence inserted immediately after the DHFR coding region and immediately before the stop codon. When the T7 tag is accessible, it indicates that the preceding DHFR is also accessible, that is, displayed. In order to facilitate skipping, two stop codon sequences were replaced from UAA to UAG. The length of the 3'-UTR is 219 nt.

  Shown in the lower part of FIG. 2a is a second pseudo-natural mRNA in which the first stop codon sequence is deleted and the second stop codon sequence UAA present in the 3′-UTR is replaced with UUA encoding leucine. It was. This is a positive control in which a conjugate of mRNA and DHFR protein is obtained because there is no stop codon without using a mutant tRNA.

  Furthermore, for the second pseudo-natural mRNA, the length of the 3′-UTR was changed to 75 nt (nucleotide) (corresponding to 25 amino acids), 147 nt (corresponding to 49 amino acids), and 219 nt (corresponding to 73 amino acids). Were prepared. This is to examine the length of the 3'-UTR, which is a spacer necessary for displaying the DHFR coding region outside from the ribosome tunnel.

  Furthermore, in the second pseudo-natural mRNA, instead of the 3'-UTR having a length of 219 nt, a poly A was added to make a length of 219 nt or more. The addition of poly A is described in E.I. E. coli polyA polymerase was used.

These template mRNAs were translated in the absence of suppressor tRNA and in the presence of tRNA ^Leu5 _CUA , respectively. In addition, translation was performed using RF (+) and RF (Δ) cell extracts, respectively.

  The mRNA template was isolated with an antibody against T7 tag, electrophoresed, and then mRNA was quantified by UV irradiation. The result is shown in FIG.

    Since there is no stop codon in T7 (+) UAG (−) LEU (+), DHFR is generated even under RF1 (+) conditions. When the 3'-UTR length of the DHFR coding region was 75 nt, DHFR was not detected (lane 1). This is probably because the T7 tag was not pushed out of the ribosome tunnel, and the template mRNA was not picked up by the T7 antibody. Since the T7 antibody is not extruded from the ribosome tunnel, it is unknown whether the upstream DHFR is extruded from the ribosome tunnel.

    In contrast, DHFR was detected when the length of the 3'-UTR was 147 nt or longer (lanes 3, 5, and 7). This is probably because the T7 tag is pushed out of the ribosome tunnel. This indicates that the full length of DHFR existing upstream of the T7 tag is pushed out of the ribosome tunnel.

    The yield of mRNA was 1.5% when the length of 3′-UTR was 147 nt, 4% when 219 nt, and 2.5% when 219 nt of poly A, based on the total amount of mRNA added. It was.

Next, T7 (+) UAG (+) UAG (+) (219nt) has two stop codons, but this template is in the presence of the suppressor tRNA tRNA ^Leu5 _CUA and of RF1 (Δ). Under conditions, the stop codon was skipped (lane 10 in FIG. 2b). The yield of template mRNA was 4.3%. It can be seen that the 219 nt length of the 3′-UTR is sufficient even when two stop codons are present.
Example 3
( Skip of stop codon using tRNA ^SerU _UUA , tRNA ^SerU _UCA , and tRNA ^SerU _CUA )

The stop codon on the natural DHFR mRNA of E. coli is UAA (Ocher). In addition, another UAA exists in the 3′-UTR of DHFR. In this example, suppressor tRNAs in which the anticodon of tRNA ^SerU was replaced with one corresponding to the stop codon using the three types of template mRNAs shown in FIG. 3a were all UAA, UGA (opal), and UAG (amber). It was shown that it is possible to skip the stop codon, and that a full-length protein display using the 3′-UTR of natural DHFR mRNA is possible.

    T7 (+) UAA (+) UAA (+) (222) in FIG. 3a is obtained by inserting a T7 promoter and a T7 tag into wild-type DHFR. T7 (+) UGA (+) UGA (+) (222) is obtained by substituting two stop codons UAA with UGA in T7 (+) UAA (+) UAA (+) (222). . T7 (+) UAG (+) UAG (+) (222) is obtained by replacing two stop codons UAA with UGA in this T7 (+) UAA (+) UAA (+) (222). . In all template mRNAs, the length of 5'-UTR is 222 nucleotides (nt).

The translation of template T7 (+) UAA (+) UAA (+) (222) is performed in the presence of the suppressor tRNA ^Ser _UUA , and the translation of template T7 (+) UGA (+) UGA (+) (222) The suppressor tRNA ^Ser _UCA was carried out, and the template T7 (+) UAG (+) UAG (+) (222) was translated in the presence of the suppressor tRNA ^Ser _CUA .

    As shown in FIG. 3c, the protein recovery rate relative to mRNA was 2.6% for the stop codon UAA, 3.7% for the stop codon UGA, and 3.1% for the stop codon UAG (FIG. 3c, lanes 2, 4, and 6).

    As a control, a template mRNA in which the T7 promoter and T7 tag were inserted into E. coli DHFR and the two stop codons UAA were deleted was constructed, and this mRNA was reconstructed containing RF1 and RF2. Was translated in the same manner as described above. The length of 3′-UTR of template T7 (+) Stop (−) having no stop codon is 222 nucleotides. The recovery rate of mRNA was 4% as shown in FIG. 3d.

Thus, the skipping efficiency of the three types of stop codons of the suppressor tRNA ^Ser was almost the same as that without the stop codon. It is also considered that not only the first stop codon functioning as a terminator but also the second stop codon was efficiently skipped. This is because when the distance between them is 81 nucleotides (corresponding to 27 amino acids), the entire T7 tag is not fully displayed following the ORF region with a length of 26 amino acids.

    On the other hand, in the absence of suppressor tRNA, neither template was recovered even when RF1 and RF2 were decreased (FIG. 3d, lane 2).

Claims (17)

Translating the mRNA in the sample using the cell extract, and at this time, skipping at least one stop codon to obtain a complex containing a conjugate of the mRNA and the resulting protein Protein display method. When translating mRNA in a sample using a cell extract, at least one kind of stop codon is skipped by adding at least one kind of mutant tRNA in which the anticodon of the amino acid tRNA is replaced with an anticodon corresponding to the stop codon. The method of claim 1. The method according to claim 2, wherein all the stop codons are skipped by adding a mutant tRNA so as to correspond to all the stop codons. The method according to claim 2, wherein the mutant tRNA is aminoacylated by an aminoacyl-tRNA synthetase. The method according to claim 4, wherein the mutant tRNA is paired with an aminoacyl-tRNA synthetase that does not have an anticodon site as a recognition site. As the mutant tRNA, a mutant tRNA in which the anticodon of leucine tRNA is replaced with an anticodon for the stop codon, a mutant tRNA in which the anticodon of serine tRNA is replaced with an anticodon for the stop codon, a mutant tRNA in which the anticodon of cysteine tRNA is replaced with an anticodon for the stop codon, and The method according to any one of claims 2 to 5, wherein at least one selected from the group consisting of a mutant tRNA in which an anticodon of alanine tRNA is substituted with an anticodon for a stop codon is used. The method according to claim 2, wherein a cell extract in which at least one termination factor does not function is used as the cell extract. A cell extract in which at least one terminator does not function is a reconstructed cell extract that does not contain at least one terminator, a cell extract in which at least one terminator is inactivated, or an excess amount The method according to claim 7, which is a cell extract containing tRNA. 2. When translating mRNA in a sample using a cell extract, at least one type of stop codon is skipped by using as the cell extract a cell extract in which at least one termination factor does not function. The method described. A cell extract in which at least one terminator does not function is a reconstituted cell extract that does not contain at least one terminator, a cell extract in which at least one terminator is inactivated, or an excess amount The method according to claim 9, which is a cell extract containing tRNA. The method according to claim 9, wherein a cell extract in which all termination factors do not function is used. The method according to claim 1, further comprising the step of extracting mRNA from the sample before the mRNA translation step. The method according to claim 12, further comprising the step of adding an arbitrary nucleic acid sequence to the 3 'end of the extracted mRNA after the mRNA extraction step and before the mRNA translation step. A protein display kit comprising a cell extract and at least one mutant tRNA in which an anticodon of an amino acid tRNA is replaced with an anticodon corresponding to a stop codon. The kit according to claim 14, further comprising a cell extract in which at least one termination factor does not function. A protein display kit comprising a cell extract in which at least one termination factor does not function. The following mutant tRNA of (1), (2), or (3)
(1) A mutant tRNA for skipping a stop codon UAG in which the anticodon of serine tRNA is replaced with CUA.
(2) A mutant tRNA for skipping a stop codon UGA in which the anticodon of serine tRNA is replaced with UCA.
(3) A mutant tRNA for skipping the stop codon UAA in which the anticodon of serine tRNA is replaced with UUA.