JPWO2006013923A1 - Treatment for arthritis with autoimmune disease - Google Patents

Abstract

The present invention provides a therapeutic agent for RA, which contains an interferon producing cell (IPC) activity inhibitor as an active ingredient. As the IPC activity inhibitor, for example, an antibody that recognizes an IPC cell surface antigen is used. For example, antibodies that recognize BST2 or a homologue thereof are useful in the present invention. The present invention also provides a method for screening a therapeutic agent for RA, which comprises the step of selecting a substance having an action of regulating IPC activity. The present invention revealed that the immune balance of RA patients can be regulated by suppressing the activity of IPC. That is, the present invention provided a new treatment strategy for arthritis associated with autoimmune diseases.

Description

  The present invention relates to the treatment of arthritis with autoimmune disease.

  Rheumatoid arthritis (RA) is one of the typical diseases of rheumatic diseases. The prevalence of RA is considered to be about 1% of the population. In Japan, it is estimated that there are about 700,000 patients. RA is a chronic systemic disease, also called rheumatoid arthritis. The pathology of RA is mainly chronic arthritis. The pain associated with arthritis is easy to move, and arthritic lesions affect the whole body such as fingers, arms, hands, toes (heels), knee joints, or cervical spine joints. The chronic arthritis of RA is thought to be mainly caused by the following lesions, as well as chronic inflammation and bone tissue destruction caused by the following lesions.

Inflammatory symptoms of RA are induced by infiltration of T cells or macrophages into the joint space. Inflammatory cells that infiltrate the joint cavity produce inflammatory cytokines and angiogenic factors. On the other hand, upon receiving stimulation such as inflammatory cytokines, synovial cells start to grow toward the cartilage tissue. Synovial tissue is one of normal joint constituent tissues. Normal joint tissue is wrapped in synovial tissue. The joint cavity is filled with synovial fluid produced by the synovial tissue. In RA, granulation tissue is formed with the proliferation of synovial cells in the joint cavity. This granulation tissue is a characteristic lesion in RA called synovial pannus. Synovial cells in the synovial pannus produce protease. Collagen fibers that make up the cartilage tissue in the joint are broken down by the action of proteases produced by synovial cells. Cartilage tissue degradation causes inflammation in the joint cavity.
On the other hand, the proliferation of synovial cells in the joint space induces angiogenesis. Angiogenesis also causes inflammation and leads to migration of inflammatory cells such as T cells or macrophages. This series of joint tissue damage results in RA-specific symptoms such as joint swelling or pain. As the symptom progresses, the destruction of the cartilage tissue progresses, and motor dysfunction eventually appears.

  At present, the cause of RA and the details of the onset mechanism have not been clarified. However, various findings support that RA has the characteristics of autoimmune diseases. For example, autoantibodies that recognize their IgG are detected in the blood of many RA patients. This autoantibody is called a rheumatoid factor (RF). RF has long been used as a diagnostic marker for RA.

  The therapeutic goal for RA is to improve patient quality of life and control tissue destruction. Specifically, the improvement of QOL of RA patients is mainly related to tissue movement disorders and pain reduction. Currently, the most common treatment method that is routinely employed is the administration of anti-inflammatory analgesics. For example, non-steroidal anti-inflammatory drugs (NSAIDs), which are cyclooxygenase (COX) inhibitors, are often administered to patients to relieve RA symptoms. In particular, COX-2 is an enzyme that is induced by inflammatory mediators and is involved in the production of prostaglandins in inflammatory lesions. NSAIDs alleviate inflammatory symptoms through inhibition of COX-2.

  Steroids may be selected as anti-inflammatory analgesics for the treatment of RA. A certain anti-inflammatory effect can be expected in a short time by administering steroids to RA patients. Administration of steroids is an effective treatment method in RA. But RA is a chronic disease. Therefore, if steroid administration is selected as the treatment method, the steroid is administered repeatedly over a long period of time. As a result, side effects of steroids may be problematic (Non-Patent Document 1 / Saag K. G. et al., AM. J. Med., 96, 115, 1994). For example, it has been pointed out that steroid drugs may suppress a patient's immune function and increase the likelihood that the patient will suffer from an infection. Therefore, steroids are usually used temporarily when it is necessary to obtain a therapeutic effect in the short term.

  Furthermore, drugs capable of regulating RA activity by modifying immune abnormalities in RA patients have been put into practical use. This type of drug is called an anti-rheumatic drug or disease modifying antirheumatic drugs (DMARDs) (Non-patent Document 2 / Kyosei Mimori Medicina, 38, 430, 2001). DMARDs are often effective even in patients who do not have a sufficient therapeutic effect with NSAIDs. In addition, DMARDs are expected to be introduced from an early stage because remission induction or joint protection can be expected. However, on the other hand, the existence of a non-responder who has no therapeutic effect has been clarified. It has also been pointed out that the incidence of side effects is high.

In synovial cells of RA, inflammatory cytokines are produced and joint destruction is progressing. Thus, inflammatory cytokines have attracted attention as therapeutic targets. For example, treatment methods targeting tumor necrosis factor (TNF-α) and interleukin (IL-1 or IL-6) have been attempted. Specifically, the effectiveness of the following antibodies or fusion proteins has been evaluated by clinical trials.
Anti-TNF-α chimeric antibody c2A (registered trademark of Remicade / Centocor)
Anti-TNF-α human antibody D2E7 (Non-Patent Document 3 / Peter C., Curr. Opin. In Rheumatol., 12, 164-169, 2001)
TNF-α receptor Fc fusion protein (Enbrel: etanercept / Amgen, Wyeth)
Anti-IL-6 receptor humanized antibody (MRA: Atlizumab; Non-Patent Document 4 / Arthritis Rheum. 2002 Dec; 46 (12): 3143-50.)

  It has also been shown that helper T cells in RA patients are biased. That is, differentiation of naive T cells into helper Th1 cells by stimulation with IFN-γ is observed. Helper Th1 cells are involved in organ-specific autoimmune disease symptoms such as RA through production of IFN-γ, a Th1 cytokine. In RA patients, Th1 cells or Th0 cells producing IFN-γ are found from infiltrating T cells, and the balance of T cells is shifted to the Th1 side. Furthermore, macrophages detected at the lymphocyte infiltration site produce IL-12 or IL-18. These cytokines induce IFN-γ production. Thus, in RA patients, a state where production of inflammatory cytokines is enhanced is observed. There is an attempt to achieve the therapeutic effect of RA by adjusting the immune balance of RA patients biased toward Th1. In other words, it is an attempt to treat RA by suppressing the action of cytokines that enhance the Th1 cell response with its antagonists and adjusting the immunological balance.

  As a cytokine antagonist for realizing such an approach, an antibody against type 1 interferon was used (Patent Document 1 / WO 01/054721). That is, treatment of RA with an antibody against IFN-α has been proposed. In fact, it is known that IFN-α production is increased in RA patients (Non-patent Document 5 / Hopkins et al., Clin Exp Immunol. 1988 Jul; 73 (1): 88-92.) . It has also been reported that exacerbation or onset of RA is observed as a side effect of IFN-α preparation administration.

WO 01/054721 Saag K.G. et al., AM.J.Med., 96, 115, 1994 Mimori Tsuneyo Medicina, 38, 430, 2001 Peter C., Curr. Opin. In Rheumatol., 12,164-169,2001 Choy E.H. et al., Arthritis Rheum. 2002 Dec; 46 (12): 3143-50. Hopkins et al., Clin Exp Immunol. 1988 Jul; 73 (1): 88-92.

  It is considered that the therapeutic effect of RA can be expected by suppressing the activity of type 1 interferon. For example, an antagonist of type 1 interferon suppresses interferon activity. On the other hand, if interferon production itself can be regulated, the therapeutic effect of RA can be expected as in the case of antagonists. The treatment of RA by modulating interferon production can be said to be a more essential therapeutic strategy compared to treatment with antagonists. That is, an object of the present invention is to provide a therapeutic technique for RA by regulating production of interferon.

One of the causes of the imbalance in the immune system in humans is the action of type 1 interferon. Type 1 interferons include interferon α (IFNα) and interferon β (IFNβ). IFNα or IFNβ is known as an interferon having antiviral activity or antitumor activity. Interferon-producing cells (hereinafter sometimes abbreviated as IPC) have been identified as cells that produce these interferons in large quantities due to viral infection. There is little IPC in the blood. The proportion of IPC in peripheral blood lymphocytes is considered to be 1% or less. However, IPC has a very high ability to produce interferon. The ability of IPC to produce IFN reaches, for example, 3000 pg / mL / 10 ⁶ cells. That is, although the number of cells is small, it can be said that most of the IFNα or IFNβ in the blood is brought about by IPC.

  Therefore, if the production of IPC interferon or the number of IPC cells themselves can be suppressed, the amount of type 1 interferon in vivo can be controlled. As a result, it may be possible to regulate the biased immune balance and realize more essential treatment for arthritis associated with autoimmune diseases such as RA.

The present inventors thought that if the activity of IPC can be regulated in vivo, the symptoms of arthritis associated with autoimmune diseases can be improved. Then, the present inventors made many antibodies that recognize cell surface antigens of IPC and analyzed the influence on the activity of IPC. As a result, it was clarified that an antibody recognizing a specific antigen has an action of regulating the activity of IPC. Furthermore, the effect of treating arthritis with autoimmune disease was analyzed. The present invention was completed by confirming that an antibody that suppresses the activity of IPC can provide a therapeutic effect for arthritis associated with an autoimmune disease. That is, the present invention relates to the following arthritis therapeutic agent with autoimmune disease, therapeutic method, and therapeutic agent screening method.
[1] A therapeutic agent for arthritis associated with an autoimmune disease, containing an interferon-producing cell activity inhibitor as an active ingredient.
[2] The therapeutic agent according to [1], wherein the interferon-producing cell activity-suppressing substance is a substance having an action of suppressing either or both of interferon production and cell survival of the interferon-producing cell.
[3] The therapeutic agent according to [2], wherein the substance that suppresses the activity of interferon-producing cells is an antibody having an action of suppressing either or both of interferon production and cell survival of interferon-producing cells.
[4] The therapeutic agent according to [3], wherein the antibody is an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment that includes at least an antigen-binding region thereof.
[5] The antibody is an antibody comprising at least an antigen-binding region of a monoclonal antibody produced by hybridoma 3D3 # 7 deposited as FERM BP-10339 or hybridoma 3G7 # 6 deposited as FERM BP-10340 [4] ] The therapeutic agent as described in.
[6] A method for treating arthritis associated with an autoimmune disease, comprising a step of suppressing the activity of interferon-producing cells.
[7] The treatment method according to [6], wherein the activity of the interferon-producing cells to be suppressed is any one or both of interferon production and cell survival of the interferon-producing cells.
[8] The step of suppressing the activity of an interferon-producing cell includes a step of administering an antibody having an action of suppressing either or both of interferon production and cell survival of the interferon-producing cell. Method of treatment.
[9] The treatment method according to [8], wherein the antibody is an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region thereof.
[10] The antibody is an antibody including at least an antigen-binding region of a monoclonal antibody produced by hybridoma 3D3 # 7 deposited as FERM BP-10339 or hybridoma 3G7 # 6 deposited as FERM BP-10340 [9] ] The treatment method as described in this.
[11] A method for detecting a therapeutic effect of arthritis associated with an autoimmune disease of a test compound, comprising the following steps.
(1) A step of contacting the interferon production inducer of the interferon producing cell and the interferon producing cell in any order of the following i) -iii):
i) contacting the interferon-producing cells with a cell stimulator that induces interferon production after contacting the test compound and the interferon-producing cells;
ii) contacting a test compound and a cell stimulator that induces interferon production simultaneously with the interferon-producing cells, or
iii) Contact the interferon-producing cells with a cell stimulator that induces interferon production, and then contact the test compound with the interferon-producing cells.
(2) measuring the activity of interferon-producing cells, and
(3) A step of detecting the arthritis therapeutic effect of the test compound when the activity of interferon-producing cells is suppressed as compared with the control [12] The cell stimulant is a virus, a viral component, or a bacterial DNA [11] The method according to [11], wherein the method is at least one cell stimulant selected from the group consisting of:
[13] The method according to [11], wherein the test compound is an antibody that recognizes interferon-producing cells or an antibody fragment containing at least an antigen-binding region thereof.
[14] A screening method for a compound having a therapeutic effect for arthritis associated with an autoimmune disease, comprising a step of selecting a test compound in which the therapeutic effect for arthritis associated with an autoimmune disease is detected by the method according to [11].
[15] A therapeutic agent for arthritis associated with an autoimmune disease, comprising as an active ingredient a compound selected by the screening method according to [14].

Alternatively, the present invention relates to the use of an interferon-producing cell activity inhibitor in the manufacture of a therapeutic agent for arthritis associated with an autoimmune disease. Alternatively, the present invention relates to the use of a compound selected by the above screening method in the manufacture of a therapeutic agent for arthritis associated with an autoimmune disease.
By the way, anti-BDCA-2 monoclonal antibody (Dzionek, A. et al. J. Immunol. 165: 6037-6046, 2000.), which is a known monoclonal antibody that recognizes IPC, suppresses IFN production of human IPC. Has been shown to have In addition, a monoclonal antibody that recognizes mouse interferon-producing cells has also been reported to suppress interferon production (Blood 2004 Jun 1; 103/11: 4201-4206. Epub 2003 Dec). A decrease in the number of dendritic cells by a monoclonal antibody against mouse plasmacytoid dendritic cells was reported (J. Immunol. 2003, 171: 6466-6477). However, the therapeutic effect of these antibodies on the treatment of arthritis associated with autoimmune diseases is unknown.

  According to the present invention, a therapeutic agent for arthritis associated with an autoimmune disease targeting IPC is provided. In other words, it has been clarified that IPC activity inhibitors can treat arthritis associated with autoimmune diseases. The activity of IPC is suppressed, for example, by administration of an antibody that recognizes the cell surface antigen of IPC. For example, antibodies to BST2 and its homologues bind to IPC and act in a suppressive manner on its IFN production and cell survival itself. The antibody that binds to BST2 was actually confirmed to have a therapeutic effect on RA when administered in vivo.

  In the present invention, the therapeutic effect of arthritis associated with autoimmune disease was achieved by regulating the function of IPC. Although the possibility of showing the therapeutic effect of RA has already been disclosed for an antagonist of Type 1 IFN, a sufficient effect has not been shown. The present invention, on the other hand, provided a therapeutic strategy that targets IFN-producing cells rather than modulating IFN function. That is, the approach of the present invention enables more essential RA treatment. More specifically, for example, the following merits can be expected in the present invention.

  First, IPC activity inhibitors can achieve a high therapeutic effect even in a small amount. In IPC, few cells produce large amounts of IFN. For neutralization of IFN, an antibody corresponding to the number of IFN molecules is required. However, in the present invention, the activity of the production cell is directly suppressed. As a result, compared to neutralization with anti-IFN antibody, a stronger IFN suppression effect can be expected with a smaller amount of antibody. When the function of IFN is regulated by an antibody or a soluble receptor, a therapeutic agent corresponding to the concentration of IFN is required. On the other hand, IPC activity regulators act directly on IPCs producing very large amounts of IFN. Therefore, IFN production can be efficiently suppressed. Generally, the manufacturing cost of an antibody drug is high. At present, no method has been established that can achieve a significant reduction in manufacturing costs. Therefore, the small dose of antibody required for treatment is a great economic advantage. Also, a small dose is not only economically advantageous, but also reduces the risk of side effects.

Furthermore, when IFN is produced continuously, neutralization of IFN with an antibody is expected to be only transient suppression. The antibody bound to IFN forms an immune complex and is quickly removed by the action of phagocytic cells and the like. And, the neutralizing action of the IFN activity of the antibody is lost. IPC is a cell having a high IFN production function. Therefore, even if the IFN concentration is temporarily reduced by the action of the anti-IFN antibody, there is a high possibility that IFN will be rapidly replenished again.
On the other hand, in the present invention, since the activity of IPC is suppressed, an effect of suppressing IFN production over a long period can be expected. In particular, according to a desirable embodiment of the present invention, an antibody that recognizes BST2 or a homolog thereof suppresses not only IFN production of IPC but also the number of cells. That is, the suppression effect of IFN production continues until new IPC is supplied. In addition, production of other inflammatory cytokines that can be produced by IPC is also directly or indirectly suppressed. These effects act synergistically and IFN production is effectively suppressed. As a result, a high therapeutic effect of RA is achieved. In particular, in a method for treating a chronic disease such as RA, sustainability of the therapeutic effect is a great advantage.

It is the FACS analysis image which dye | stained the cell surface of the bone marrow cell (IPC is concentrated) of the mouse | mouth culture | cultivated for 10 days after FLT-3 ligand addition with the produced antibody and another marker. The culture supernatant positive fraction and negative fraction were designated as R2 and R3, respectively. In the graph, R1 & R2 represents an antibody-positive cell population, and R1 & R3 represents an antibody-negative cell population. It is a microscope picture (x400) showing the form of the cell extracted with each monoclonal antibody. (A) shows the form before infection with influenza virus PR8, and (b) shows the form after 24 hours culture with influenza virus PR8. The cells after infection had dendrites and showed a morphology typical of dendritic cells. It is a graph which shows the interferon production ability of the cell isolate | separated using monoclonal antibody SNK01. In the figure, the horizontal axis indicates the type of cell treatment, and the vertical axis indicates the IFNα concentration (pg / mL) in the culture supernatant. P (+) on the horizontal axis indicates that cells infected with the monoclonal antibody were infected with virus, N (+) indicates that cells that did not bind to the monoclonal antibody were infected with virus, and N (-) represents monoclonal Results are shown when cells that did not bind to the antibody were not infected with the virus. It is a graph which shows the influence on the interferon production ability of monoclonal antibody SNK01. In the figure, the horizontal axis represents the concentration (μg / mL) of the antibody used for the treatment, and the vertical axis represents the IFNα concentration (pg / mL) in the culture supernatant. The horizontal axis (-) indicates the result when no virus treatment was performed. SNK01 showed interferon production inhibitory activity in a concentration-dependent manner. It is a photograph which shows the result of the western blotting assay by the monoclonal antibody SNK01. The photo shows the results with the anti-His tag antibody, and the bottom shows the results with the monoclonal antibody SNK01 of the present invention. The left side of the photograph is the result of COS7 cells transformed with pcDNA3.1-mBST2DHis, and the right side is transformed with pcDNA3.1-mBST2H-His. The results for the precipitate (P) and the supernatant (S) when the cultured cells were lysed were shown. It is a photograph showing the result of comparing the mRNA expression level of mouse BST2 between tissues and cells. Lanes indicate the analyzed tissues and cells, respectively. It is a figure which shows the amino acid sequence and genome structure of mouse BST2 and its homologue. (a) shows the alignment of amino acid sequences of each isoform, and (b) shows exon mapping. It is a figure which shows the amino acid sequence and genome structure of human BST2 and its homologue. (a) shows the alignment of amino acid sequences of each isoform, and (b) shows exon mapping. It is a photograph showing the result of comparing the mRNA expression level of human BST2 between tissues and cells. It is a graph which shows the influence on the interferon production ability of the monoclonal antibody with respect to produced mouse | mouth BST2. In the figure, the horizontal axis indicates the type of hybridoma culture supernatant used for the treatment, and the vertical axis indicates the IFNα concentration (pg / mL) in the culture supernatant. When CpG is treated with CpG, PR8 shows the result of infection with influenza virus PR8. It is a graph which shows the influence on the interferon production ability of the monoclonal antibody with respect to the produced human BST2. In the figure, the horizontal axis represents the type and concentration of the antibody used for the treatment, and the vertical axis represents the IFNα concentration (pg / mL) in the culture supernatant when human IPC was stimulated with HSV. FIG. 3 is a view showing various cells of a wild type mouse (WT) or an IFN receptor knockout mouse (IFNR-KO) stimulated with CpG or influenza virus PR8 and then stained with a SNK01 antibody labeled with a fluorescent dye Alexa488. The horizontal axis indicates the fluorescence intensity of SNK01, that is, the expression intensity of BST2, and the vertical axis indicates the number of cells. (A) is the figure which analyzed the whole spleen cell. (B) is the figure which fractionated and analyzed each cell. (C) is the figure which fractionated and analyzed IPC. It is the figure which examined the expression of BST2 when stimulating human IPC with IFN (alpha) using the anti- BDCA-4 and BDCA-2 antibody as a marker of human IPC. The horizontal axis represents the fluorescence intensity of the 5C11 # 7 antibody, that is, the expression intensity of BST2, and the vertical axis represents the number of cells. It is the figure which examined the expression of BST2 when stimulating human IPC with CpG. The horizontal axis represents the fluorescence intensity of anti-human BST2 antibodies 3E2 # 8 and 5C11 # 7, that is, the expression intensity of BST2, and the vertical axis represents the number of cells. Each thick line shows the pattern when stimulated with CpG, and the dotted line shows the pattern when not stimulated. It is the figure analyzed using the cell extract | collected from the mouse | mouth which administered the anti-mouse BST2 antibody SNK01. (A) shows the administration schedule. (B) shows the IPC ratio in each organ, the horizontal axis indicates the administered antibody, and the vertical axis indicates the IPC ratio. (-) Indicates a group in which only PBS was administered instead of the antibody. (C) shows the concentration of IFN produced when bone marrow cells were stimulated with CpG or influenza virus PR8. The horizontal axis represents the administered antibody. It is the figure which analyzed using the mouse | mouth which administered anti-mouse BST2 antibody SNK01 and was infected with the virus. (A) shows the administration schedule. (B) shows the concentration of IFNα in serum, and the horizontal axis shows the administered antibody. (C) shows the IPC ratio in the spleen, the horizontal axis indicates the administered antibody, and the vertical axis indicates the IPC ratio. (-) Indicates a group in which only PBS was administered instead of the antibody. The effect of the antibody was examined using a mouse rheumatoid arthritis model prepared using an arthritis-inducing antibody cocktail (n = 15). (A) is a figure which shows the schedule of antibody administration. (B) is a figure which shows the ratio which developed arthritis. The vertical axis shows the incidence, that is, the value obtained by dividing the number of mice that have developed by the number of surviving mice, and the horizontal axis shows the number of days after antibody cocktail administration. (C) is a figure which shows the average value of an arthritis score. The horizontal axis indicates the number of days after administration of the antibody cocktail. IgG indicates control rat IgG. FIG. 3 is a view of rheumatoid factor measured in serum on the 16th day after administration of an arthritis-inducing antibody cocktail in rheumatoid arthritis model mice (n = 10) administered with an antibody. The vertical axis represents the absorbance value of each individual ELISA, that is, the amount of rheumatoid factor, and the horizontal axis represents the administered antibody. It is the result of measuring the concentration of IFNα in the serum on day 16 after administration of an arthritis-inducing antibody cocktail in a rheumatoid arthritis model mouse (n = 10) to which an antibody was administered. The vertical axis represents the IFNα concentration (pg / mL) in the serum of each individual, and the horizontal axis represents the administered antibody. It is the result of measuring the concentration of TNFα in serum of rheumatoid arthritis model mice (n = 10) administered with antibody by serum on the 16th day after administration of arthritis-inducing antibody cocktail. The vertical axis represents the TNFα concentration (pg / mL) in the serum of each individual, and the horizontal axis represents the administered antibody. In the rheumatoid arthritis model mouse administered with the antibody, the ratio of IPC in the spleen and peripheral blood on the 16th day after administration of the arthritis-inducing antibody cocktail was analyzed by FACS. (A) shows an example of an FACS analysis image, with the upper row showing peripheral blood and the lower row showing a spleen pattern. The left side is a pattern of mice administered with a control antibody, and the right side is a pattern of mice administered with SNK01. The cell group surrounded by a square is IPC, and the above numerical value indicates the percentage (%) of the cell group. (B) is a graph showing the results of a plurality of mice, where the vertical axis indicates the ratio of IPC and the horizontal axis indicates the administered antibody. No Ab is the result of mice not receiving antibody. It is the figure which examined the effect of the antibody after onset using the rheumatoid arthritis model mouse created using the arthritis induction antibody cocktail (n = 5). The vertical axis represents the average value of the arthritis score, and the horizontal axis represents the number of days after administration of the antibody cocktail. Arrows in the figure indicate the timing of antibody administration, and IgG indicates rat IgG administered as a control.

  The present invention relates to a therapeutic agent for arthritis associated with an autoimmune disease containing an interferon-producing cell activity inhibitor as an active ingredient. In the present invention, an autoimmune disease means that tissue damage or inflammation is caused by immune function. The immune function includes humoral immunity with antibodies and cellular immunity with immunocompetent cells. The autoimmune disease in the present invention can also be defined by the activation of an immune mechanism against a self antigen. The self-antigen referred to here includes foreign antigens introduced into the host by some means in addition to antigens present in the tissues of healthy individuals. For example, an attack of an immune function against a foreign antigen introduced into a living body by infection, transplantation, or contact may damage cells or tissues. Such a disorder is included in the autoimmune disease in the present invention. The presence of an autoimmune disease in a living body can be detected using as an index the reactivity of the immune mechanism against the self antigen. IgG and the like are known as self-antigens that can be used as indicators of autoimmune diseases.

Arthritis, on the other hand, is a condition defined by inflammation of joint tissue. Inflammation in the joint can be known by pain and swelling of the joint. That is, the arthritis accompanied by an autoimmune disease in the present invention can be said to be a state in which cell or tissue damage due to the autoimmune mechanism is observed and inflammation in the joint is observed. The arthritis in the present invention includes not only a direct disorder caused by an autoimmune mechanism but also an indirect disorder. For example, arthritis caused by excessive production of inflammatory cytokines due to increased function of immunocompetent cells is a superficial condition of arthritis associated with autoimmune diseases. Furthermore, arthritis caused by complex mechanisms, including autoimmune diseases, is included in the arthritis that is the subject of treatment in the present invention. For example, RA is a typical disease of arthritis accompanied by an autoimmune disease in the present invention. The pathology of RA is composed of multiple factors such as inflammatory cytokines and synovial cell proliferation. More specifically, the following arthritis is preferable as a treatment target in the present invention.
Rheumatoid arthritis (RA)
Juvenile Idiopathic Arthritis (JIA)
Psoriatic arthritis (PsA)
Ankylosing spondylitis
In fact, in patients with RA and psoriatic arthritis (PsA. Or PA), many IPCs are present in synovial fluid and synovial tissue, suggesting that they are involved in pathogenesis (Lande et al., J. Immunol. 173: 2815-2824, 2004). This fact also confirms that the treatment of arthritis by controlling the activity of IPC based on the present invention is useful.

  In the present invention, rheumatoid arthritis (RA) refers to a disease particularly associated with chronic arthritis among rheumatic diseases. More specifically, symptoms of autoimmune diseases and diseases associated with arthritis are included in rheumatoid arthritis. Symptoms of autoimmune disease can be confirmed, for example, by the presence of RF in the blood. Alternatively, autoimmune disease symptoms can be confirmed using an increase in Th1 lymphocytes or infiltration into joint tissues as an index. RA is preferred as arthritis with autoimmune disease in the present invention.

  Juvenile Idiopathic Arthritis JIA is a chronic arthritis that occurs in children younger than 16 years whose symptoms are similar to rheumatoid arthritis. Psoriatic Arthritis is polyarthritis that is associated with psoriasis, a chronic recurrent inflammatory keratosis of the skin caused by various immune abnormalities. Ankylosing spondylitis is similar to rheumatoid arthritis, but HLA-B27-positive people are more frequent, and there is a common antigen in microbial antigens and HLA-B27 molecules. It is a disease that is thought to cause an immune response.

  In all of the above diseases, it is considered that enhancement of the autoimmune mechanism is brought about by IPC. Therefore, therapeutic effects can be expected by regulating autoimmune diseases based on suppression of IPC function. Therefore, in the present invention, these diseases can also be referred to as arthritis having an autoimmune disease caused by IPC hyperfunction.

Moreover, the interferon producing cell (IPC) in the present invention refers to a cell having IFN producing ability. For example, cells that produce interferon and express either or both of BST2 and its homolog on the cell surface are included in the IPC of the present invention. In the present invention, the expression of either or both of BST2 and its homolog includes the case where these molecules are expressed upon cell activation. For example, in humans and mice, cells that are precursor cells of dendritic cells and produce IFN upon stimulation are preferred as IPC. Unless otherwise specified, IPC is not only a cell that is a precursor cell of a dendritic cell, but also a cell that has IFN production ability and expresses either or both of BST2 and its homolog on the cell surface. including. Such an IPC identification method is known. For example, IPC can be distinguished from other blood cells using several cell surface markers as indicators. Specifically, the cell surface marker profile of human IPC is as follows (Shortman, K. and Liu, YJ. Nature Reviews 2: 151-161, 2002). In recent years, there is a report that positions BDCA-2 positive cells as IPC (Dzionek, A. et al. J. Immunol. 165: 6037-6046, 2000.). Therefore, BDCA-2 positive cells are preferred as the IPC in the present invention.
[Profile of human IPC cell surface antigen]
CD4 positive, CD123 positive,
Lineage (CD3, CD14, CD16, CD19, CD20, CD56) negative, CD11c negative

Alternatively, mouse IPC is defined by the following profile:
[Cell surface antigen profile of mouse IPC]
-CD11c, B220, Ly6C, and CD45RB are positive.-CD11b, CD3, and CD19 are negative. Furthermore, the following characteristics can be shown as characteristics common to human or mouse IPC.
[Characteristics of cell morphology]
-Similar to plasma cells-Round cells with smooth cell surface-Relatively large nuclei [Functional characteristics of cells]
-Produces a large amount of Type-1 interferon in a short time during viral infection-Differentiates into dendritic cells after viral infection

  In the present invention, IPC activity suppression refers to suppression of at least one of the functions of IPC. That is, the IPC activity inhibitor includes any substance that suppresses at least one of the functions of IPC. The function of IPC can indicate IFN production and cell survival. Cell survival can be rephrased as the number of cells. Therefore, IPC activity is said to be suppressed when both or any of these functions are suppressed. A substance that suppresses both or any of these functions can be used as an IPC activity inhibitor.

  It has been clarified that type 1 IFN produced by IPC is responsible for various diseases. Therefore, suppressing its production is useful as a therapeutic strategy for these diseases. For example, the relationship between IFNα and the pathology of autoimmune diseases has been pointed out. Most of IFNα is produced by IPC. Therefore, if the production is suppressed, the pathological condition caused by IFNα can be alleviated. In the present invention, suppression of IFN production by IPC refers to suppression of production of at least one kind of IFN produced by IPC. The preferred IFN in the present invention is type 1 IFN. Of these, IFNα is important.

  IPC includes cells that produce large amounts of IFN with a small number of cells. For example, dendritic cell progenitors stimulated with viruses and the like produce most of the IFN produced by the living body. Suppressing the number of IPC cells that produce a large amount of IFN results in suppression of IFN production. Therefore, suppression of the number of IPC cells can also alleviate the pathology caused by IFNα.

In the present invention, a preferred IPC activity inhibitor is an antibody that recognizes an IPC cell surface antigen and suppresses its activity. Specifically, it is an antibody that suppresses either or both of the ability of IPC to produce interferon and the number of cells of IPC. Whether an antibody suppresses the activity of IPC can be confirmed by, for example, a method for detecting the therapeutic effect of arthritis associated with an autoimmune disease described later. For example, the present inventors have confirmed that an antibody recognizing either or both of BST2 and its homolog suppresses the activity of IPC.
That is, the present invention relates to a therapeutic agent for arthritis associated with an autoimmune disease, which contains, as an active ingredient, an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region thereof. The present invention also relates to a method for treating arthritis associated with an autoimmune disease, comprising the step of administering an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region thereof. Alternatively, the present invention relates to the use of an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region thereof in the manufacture of a therapeutic agent for arthritis associated with an autoimmune disease.

In the present invention, the IPC is not particularly limited as long as it expresses either or both of BST2 and its homolog and produces IFN. For example, in humans and mice, it was confirmed that IPC expresses BST2 and / or its homologue. Accordingly, human and mouse IPCs are preferred as IPCs in the present invention. In particular, in the human IPC, the expression level of BST2 and its homolog increases significantly with its activation. Therefore, antibodies that recognize BST2 and its homologues act specifically on activated IPC in humans. Accordingly, human IPC is particularly preferred as the IPC of the present invention.
The present inventors have revealed that an antibody against BST2 or a homologue thereof suppresses IPC activity. It was also confirmed that RA symptoms can be alleviated through suppression of IPC activity. That is, the present inventors have found a method for suppressing the activity of IPC, and confirmed that treatment of RA can be realized by actually suppressing the activity of IPC by the method. Based on these findings, it was revealed that suppression of IPC function is useful as a therapeutic strategy for arthritis associated with autoimmune diseases.

  In addition, antibodies against BDCA-2 (Dzionek, A. et al. J. Immunol. 165: 6037-6046, 2000.) have also been shown to suppress IPC function (Dzionek, A. et al. J. Exp. Med. 194; 1823-34. 2001.). Therefore, an antibody that binds to BDCA-2 can also be used as an “IPC activity inhibitor” in the present invention.

  In the present invention, the BST2 gene is a human-derived protein defined by the amino acid sequence set forth in SEQ ID NO: 2. The amino acid sequence described in SEQ ID NO: 2 is encoded by cDNA consisting of the base sequence described in SEQ ID NO: 1. There are reports on the cloning of human BST2 cDNA and monoclonal antibodies (Ishikawa J. et al. Genomics 26: 527, 1995; GenBank Acc #. D28137). BST2 was considered to be a membrane protein having the ability to support pre-B cell proliferation (Japanese Patent Laid-Open No. 7-196694). Knowledge about the BST2 genomic gene and promoter has also been obtained (WO99 / 43803). It has also been clarified that human BST2 is an antigen recognized by anti-HM1.24 antibody, which is a monoclonal antibody against myeloma (Ohmoto T. et al. B.B.R.C 258: 583, 1999). The anti-HM1.24 antibody is a monoclonal antibody established using a human plasma cell line as an immunogen (Goto T. et al. Blood 84: 1992, 1994). Later, it was revealed that myeloma was specifically recognized, and a humanized antibody was prepared for the purpose of treating myeloma (Ozaki S. et al. Blood 93: 3922, 1999;: WO98 / 14580). The humanized anti-HM1.24 antibody has a therapeutic effect on hematopoietic tissue cancer (WO02 / 064159). Currently, clinical trials are underway with the aim of commercialization. As described above, human BST2 is used as a marker in hematopoietic tumors. Further, it has been suggested that an antibody that specifically binds to human BST2 can suppress the activation of T cells and B cells and can be a therapeutic agent for autoimmune diseases (Japanese Patent Laid-Open No. 10-298106). However, there is currently no report suggesting an association between antibodies that recognize BST2 and IPC.

  In the present invention, BST2 includes the homologue. The homologue of BST2 can be defined as a protein functionally equivalent to the protein consisting of the amino acid sequence set forth in SEQ ID NO: 2. Such proteins include naturally occurring proteins. In general, eukaryotic genes have polymorphism as is known from IFN genes and the like. One or more amino acids may be substituted, deleted, inserted, and / or added due to a change in the base sequence caused by this polymorphism. Thus, it is a protein derived from human and has an amino acid sequence in which one or more amino acids are substituted, deleted, inserted, and / or added in the amino acid sequence set forth in SEQ ID NO: 2. A protein functionally equivalent to the protein consisting of the amino acid sequence of No. 2 is included in the BST2 homologue of the present invention.

  Specifically, for example, a BST2 splicing variant or a mutant caused by a gene polymorphism is included in the BST2 homolog. For example, the present inventors revealed the presence of a splicing variant for cDNA consisting of the nucleotide sequence of SEQ ID NO: 1. This splicing variant consisted of the base sequence shown in SEQ ID NO: 3 or SEQ ID NO: 5, and encoded the amino acid sequence shown in SEQ ID NO: 4 or SEQ ID NO: 6.

  Alternatively, the amino acid sequence may not change even if the base sequence changes due to the polymorphism. Such a nucleotide sequence variation is called a silent variation. A gene comprising a base sequence having a silent mutation is also included in the present invention. The polymorphism referred to here means that a certain gene has a different base sequence among individuals within a population. In general, polymorphisms and mutations are genetically defined by genotype distribution rates. However, the polymorphism referred to here is irrelevant to the ratio (distribution rate) at which different base sequences are found.

  BST2 homologs include functionally equivalent proteins in species other than humans. A protein functionally equivalent to BST2 can be identified using, for example, hybridization. That is, a polynucleotide encoding BST2 as shown in SEQ ID NO: 1 or a fragment thereof is used as a probe, and a polynucleotide capable of hybridizing with this is isolated. If hybridization is performed under stringent conditions, a highly homologous polynucleotide is selected as the base sequence, and the protein isolated as a result may contain a protein functionally equivalent to BST2. Rise.

The present inventors have confirmed that antibodies against homologues of BST2 mice suppress mouse IPC activity in the same manner as antibodies in humans. Mouse BST2 had the base sequence set forth in SEQ ID NO: 9 and encoded the amino acid sequence set forth in SEQ ID NO: 10. Furthermore, the present inventors similarly confirmed the presence of homologues in mice for BST2H, which is a splicing variant of BST2. The base sequence of mouse BST2H is shown in SEQ ID NO: 7, and the amino acid sequence encoded by this base sequence is shown in SEQ ID NO: 8. It was confirmed that the antibody against mouse BST2H also suppressed the activity of IPC.
The base sequence information and amino acid sequence information of human and mouse BST2 and its homologs revealed in the present invention are summarized below.
Base sequence Amino acid sequence Amino acid sequence length Human BST2D SEQ ID NO: 1 SEQ ID NO: 2 (180)
Human BST2H SEQ ID NO: 3 SEQ ID NO: 4 (158)
Human BST2HS SEQ ID NO: 5 SEQ ID NO: 6 (100)
Mouse BST2H SEQ ID NO: 7 SEQ ID NO: 8 (178)
Mouse BST2D SEQ ID NO: 9 SEQ ID NO: 10 (172)
Mouse BST2HS SEQ ID NO: 22 SEQ ID NO: 23 (105)

  The stringent conditions can be specifically exemplified by conditions such as 6 × SSC, 40% formamide, hybridization at 25 ° C. and washing at 1 × SSC, 55 ° C. Stringency depends on conditions such as salt concentration, formamide concentration, or temperature. Those skilled in the art can appropriately adjust these conditions to obtain the necessary stringency.

  By utilizing hybridization, for example, a polynucleotide encoding a homologue of BST2 in an animal species other than human can be isolated. BST2 homologs encoded by polynucleotides obtainable from animal species other than humans, ie, animal species such as mice, rats, rabbits, pigs, goats, etc. constitute functionally equivalent proteins in the present invention.

  A protein encoded by a polynucleotide isolated using a hybridization technique or the like usually has high homology in amino acid sequence with human BST2D (SEQ ID NO: 2). High homology refers to sequence identity of at least 30% or more, preferably 50% or more, more preferably 80% or more (eg, 95% or more, 98%, or even 99% or more). The identity of nucleotide sequences and amino acid sequences can be examined using a homology search site using the Internet [for example, homology such as FASTA, BLAST, PSI-BLAST, and SSEARCH in Japan DNA Data Bank (DDBJ). Search is available [For example, the search and analysis page of the Japan DNA Data Bank (DDBJ) website; http://www.ddbj.nig.ac.jp/E-mail/homology-j. html]. In addition, a search using BLAST can be performed in the National Center for Biotechnology Information (NCBI) (for example, the BLAST page of the NCBI website; http://www.ncbi.nlm.nih.gov/BLAST Altschul, SF et al., J. Mol. Biol., 1990, 215 (3): 403-10; Altschul, SF & Gish, W., Meth.Enzymol., 1996, 266: 460-480; Altschul , SF et al., Nucleic Acids Res., 1997, 25: 3389-3402).

  For example, amino acid sequence identity in Advanced BLAST 2.1 is calculated using blastp as the program, Expect value is 10, Filter is all OFF, BLOSUM62 is used for Matrix, Gap existence cost, Per residue gap cost, and Lambda ratio Can be set to 11, 1, 0.85 (default values), respectively, to obtain identity values (%) (Karlin, S. and SF Altschul (1990) Proc. Natl. Acad Sci. USA 87: 2264-68; Karlin, S. and SF Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-7).

  Furthermore, BST2 homologues in other species can also be found by searching the nucleotide sequence information of cDNA or genomic DNA whose structure has already been clarified. That is, similar sequence information is searched by a homology search using a base sequence information and / or amino acid sequence information of human BST2 as a query for a database in which known base sequence information or amino acid sequence information is accumulated. If known genes and proteins with high homology derived from other species exist in the database, they can be found by homology search. Even if the full length of the gene is not identified, the full length sequence of the gene may be constructed by in silico cloning if fragment sequence information such as EST is obtained. A homolog derived from another species thus clarified can be used as a homolog of BST2 in the present invention if expression in the IPC of the animal species can actually be confirmed.

An antibody that recognizes either or both of BST2 and its homolog used in the present invention can be prepared using BST2 and its homolog or fragments thereof as an immunogen. The antibodies in the present invention may be of any class. The biological species from which the antibody is derived is not limited. Furthermore, a fragment containing an antigen-binding region of an antibody can be used as an antibody. For example, an antibody fragment containing an antigen binding site produced by enzymatic digestion of IgG can also be used as the antibody in the present invention. Specifically, antibody fragments such as Fab or F (ab ′) 2 can be obtained by digestion with papain or trypsin. It is well known that these antibody fragments can be used as antibody molecules having binding affinity for an antigen. Alternatively, an antibody constructed by gene recombination can be used as long as the necessary antigen-binding activity is maintained. Examples of the antibody constructed by gene recombination include a chimeric antibody, a CDR-grafted antibody, or a single chain Fv. Methods for obtaining these antibodies using any immunogen are known.
In the present invention, a chimeric antibody in which an antigen-binding region of a certain antibody is joined to a constant region of another antibody or a CDR-grafted antibody in which a CDR of a certain antibody is transplanted to another antibody is referred to as an antibody containing at least the antigen-binding region. Furthermore, an antibody fragment containing an antigen-binding region that maintains the antigen-binding activity is also included in an antibody containing at least the antigen-binding region.

In the present invention, the antibody can be modified as necessary. According to the present invention, an antibody that recognizes either or both of BST2 and its homolog has an action of suppressing the number of IPC cells. That is, the antibody itself was considered to have cytotoxicity against IPC. Subclasses of antibodies that exhibit strong effector activity are known. Alternatively, the effect of suppressing the activity of IPC can be further enhanced by modifying the antibody with a cytotoxic agent. The following substances can be shown as cytotoxic substances.
Toxins: Pseudomonas Endotoxin (PE), diphtheria toxin, ricin Radioisotopes: Tc ^99m , Sr ⁸⁹ , I ¹³¹ , Y ⁹⁰
Anticancer agents: calikiamycin, mitomycin, paclitaxel Toxins composed of proteins can be bound to an antibody or fragment thereof by a bifunctional reagent. Alternatively, a gene encoding a toxin can be joined to a gene encoding an antibody to obtain a fusion protein of the two. Methods for binding radioisotopes to antibodies are also known. For example, a method for labeling an antibody with a radioisotope using a chelating agent is known. Furthermore, the anticancer agent can be bound to the antibody by utilizing a sugar chain or a bifunctional reagent.

The antibody used in the present invention may be an antibody having an artificially modified structure. For example, various modification methods for improving antibody cytotoxicity and stability are known. Specifically, an immunoglobulin having a modified heavy chain sugar chain is known (Shinkawa, T. et al. J. Biol. Chem. 278: 3466-3473. 2003.). By modifying the sugar chain, the ADCC (antibody-dependent cell-mediated cytotoxicity) activity of immunoglobulin was enhanced. Alternatively, immunoglobulins in which the amino acid sequence of the Fc region is modified are also known. That is, ADCC activity was enhanced by artificially increasing the binding activity of immunoglobulin to the Fc receptor (Shield, RL. Et al. J. Biol. Chem. 276; 6591-6604, 2001.).
In addition, IgG bound to the Fc receptor is once taken up into the cell. Subsequently, it has been clarified that it binds to the Fc receptor expressed in the endosome and is released into the blood again. IgG with high Fc receptor binding activity is more likely to be released into the blood after being taken up by cells. As a result, the residence time of IgG in the blood is prolonged (Hinton, PR. Et al. J Biol Chem. 279: 6213-6216. 2004). In addition, it is also said that modification of the amino acid sequence of the Fc region leads to a change in CDC (Complement Dependent Cytotoxicity) activity. Antibodies with these modifications can be used as antibodies in the present invention.

For example, a monoclonal antibody can be collected from antibody-producing cells that produce the monoclonal antibody. Monoclonal antibody-producing cells that can be used in the present invention include, for example, BST2 or a homolog thereof, a fragment thereof, a cell that produces them, or a cell membrane fraction thereof administered to an immunized animal as an immunogen, and the antibody-producing cells are cloned Can be obtained by doing. More specifically, the antibody used in the present invention can be obtained, for example, by a method including the following steps.
(1) A step of administering BST2 or a homolog thereof to an immunized animal as an immunogen
(2) a step of selecting an antibody-producing cell that produces an antibody that recognizes BST2 from the antibody-producing cells of the immunized animal of (1),
(3) culturing the antibody-producing cells selected in (2), or isolating a gene encoding an antibody produced by the antibody-producing cells and culturing cells that retain this gene in an expressible manner, and
(4) A step of recovering an antibody that suppresses the activity of interferon-producing cells from the culture of (3).

In a general method for producing a monoclonal antibody, a hybridoma obtained by cell fusion between an immune cell and a tumor cell is used as an antibody-producing cell. As the immunogen in the present invention, BST2 or a homologue thereof, or a fragment thereof can be used. The immunogen can be purified from cells transformed with the gene encoding it. Furthermore, cells expressing BST2 or a homologue thereof can be used as an immunogen. Specific examples of such cells include the following cells. The cell membrane fraction of these cells can also be used as an immunogen.
-IPC collected from living organisms
-IPCs induced to differentiate from hematopoietic stem cells
-Cells carrying exogenous BST2 or its homologous gene so that it can be expressed. In order to collect IPC from a living body, for example, the target cell should be collected based on the expression profile of the cell surface marker as described above. That's fine. A method for collecting specific cells using a plurality of cell surface markers as an index is known. For example, by using immunostaining and a cell sorter, cells that match the target expression profile can be easily sorted. For example, human IPC is enriched by selecting BDCA-2 positive cells. IPCs collected from humans are used as an immunogen after being activated as necessary.
IPC can also be obtained as cultured cells in addition to the peripheral blood or hematopoietic tissue of a living body. For example, it can be obtained in large quantities by culturing human and mouse hematopoietic stem cells and differentiating them into IPC. Conditions for differentiating human and mouse hematopoietic stem cells into IPC in vitro are known.

  For example, humans from hematopoietic stem cells in vitro (Blom, B. et al. J. Exp. Med. 192: 1785-1796, 2000 .; Chen, W. et al. Blood 103: 2547-2553, 2004.) And induction of IPC in mice (Gilliert et al 2002, J. Exp. Med. 958-953) has been reported. Alternatively, induction of mouse IPC in vivo is also known (Bjorck et al. Blood 2001, 3520-3526). IPC differentiated in vitro is advantageous as an immunogen for obtaining monoclonal antibodies that recognize IPC.

  Specifically, differentiation into IPC is induced by culturing a cell population containing hematopoietic stem cells in the presence of an IPC inducer. As a cell population containing hematopoietic stem cells, for example, bone marrow cells can be used. As the IPC inducer, FLT-3 ligand or a combination of FLT-3 ligand and thrombopoietin (TPO) can be used. The concentration of FLT-3 ligand in the medium can usually be 1 to 100 ng / mL. As other culture conditions, general blood cell culture conditions may be applied. That is, RPMI1640 or the like can be used as a basal medium, and about 10% fetal bovine serum can be further added. Alternatively, Yssel's Medium was used for induction of human IPC. Differentiation into IPC in vitro peaks in humans, for example, around 25 days.

If cells differentiated to IPC are obtained from the cultured hematopoietic stem cells, IPC for the immunogen can be obtained. In practice, several cell surface markers are utilized to sort cells with cell surface antigens characteristic of IPC. That is, for example, BDCA-2 positive cells can be obtained as human IPC. Alternatively, CD11c-positive, CD11b-negative, and B220-positive cell fractions can be sorted using a cell sorter to obtain mouse IPC.
Alternatively, by using an antibody that is already clearly IPC-specific, the antibody-positive cells can be sorted as IPC. The monoclonal antibody produced by the monoclonal antibody-producing cell 2E6 that recognizes mouse IPC-specific antigen (WO 2004/013325, FERM-BP-8445) established by the present inventors can be used for sorting of mouse IPC. .

  IPC can also be collected from peripheral blood. However, as described above, since the population of IPC in peripheral blood is extremely low, a large amount of blood is required to collect IPC from peripheral blood. Therefore, it is advantageous to use cells differentiated from hematopoietic stem cells for IPC as an immunogen.

  Preparation of the monoclonal antibody used in the present invention includes not only IPC but also the amino acid sequence described in any one of SEQ ID NOs selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6. Proteins or fragments thereof can also be used as immunogens. The monoclonal antibody of the present invention recognizes, as an antigen, a protein comprising an amino acid sequence described in any one of SEQ ID NO: 2, selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 4, and SEQ ID NO: 6. Was revealed. Therefore, the monoclonal antibody of the present invention can be obtained by using these proteins as immunogens.

  A protein containing the amino acid sequence described in any one of SEQ ID NOs selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6 can be obtained as a recombinant. For example, the base sequence described in SEQ ID NO: 1 encodes the amino acid sequence described in SEQ ID NO: 2. The base sequence described in SEQ ID NO: 3 encodes the amino acid sequence described in SEQ ID NO: 4. Therefore, the target protein can be obtained by expressing DNA comprising these base sequences using an appropriate host-vector.

  Alternatively, an oligopeptide consisting of a continuous amino acid sequence selected from the amino acid sequences described in any one of SEQ ID NO: selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6 is used as an immunogen. You can also The amino acid sequence to be selected as the immunogen consists of, for example, about 5-50, preferably about 7-20 amino acids. Methods for obtaining oligopeptides having an arbitrary amino acid sequence are known. For example, an oligopeptide having a target amino acid sequence can be obtained by chemically combining amino acids. Alternatively, a fragment having a predetermined amino acid sequence can also be obtained by cleaving a protein having a full-length amino acid sequence obtained as a recombinant. The resulting oligopeptide can be made more immunogenic by binding to an appropriate carrier protein. As the carrier protein, keyhole limpet hemocyanin, bovine serum albumin and the like are used.

  SEQ ID NO: 2 and most of the amino acid sequences of SEQ ID NO: 4 and SEQ ID NO: 6 are identical. Therefore, a monoclonal antibody that recognizes all of these proteins can be obtained by utilizing an amino acid sequence selected from a common amino acid sequence. Further, for each of the three types of proteins, two specific types of proteins can be distinguished from the other by using an amino acid sequence shared by the two types. Alternatively, a monoclonal antibody that specifically identifies each protein can be obtained by using an amino acid sequence unique to each amino acid sequence. For example, in the amino acid sequence shown in SEQ ID NO: 4, the amino acid sequence from 139 to 158 from the N-terminal is an amino acid sequence unique to SEQ ID NO: 4. Similarly, in the amino acid sequence set forth in SEQ ID NO: 6, the amino acid sequence of 96 to 100 from the N-terminal is an amino acid sequence unique to SEQ ID NO: 6.

  Subsequently, an appropriate immunized animal is immunized with the immunogen. IPC can be administered to an immunized animal with a suitable adjuvant. Alternatively, the protein described in any one of SEQ ID NOs selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6, or a peptide consisting of a partial amino acid sequence thereof is administered to an immunized animal together with an adjuvant can do.

  Further, an immunogen is used to transform a cell that holds a DNA encoding the amino acid sequence described in any one of SEQ ID NOs: 2 selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6. Can be used as For example, a DNA containing a base sequence constituting a coding region of a base sequence described in any one of SEQ ID NOs selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5 is preferable as the DNA. . By incorporating these DNAs into appropriate expression vectors and transforming host cells, transformed cells useful as immunogens can be obtained.

  A host cell for use as an immunogen can be a cell derived from the same species as the immunized animal. By using the same type of cells, a specific immune response against a foreign protein can be induced. For example, if a rat is used as an immunized animal, it is advantageous to use a host cell derived from the rat. A fraction of transformed cells containing the protein can also be used as an immunogen. As shown in the Examples, a transmembrane domain was found in the amino acid sequence described in any one of SEQ ID NOs: 2 selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6. (Transmembrane region in FIG. 8). Therefore, proteins having these amino acid sequences may be expressed on the cell membrane. When the protein was actually expressed in COS cells, a larger amount of the protein having the amino acid sequence of SEQ ID NO: 8 and SEQ ID NO: 10 was detected in the precipitate fraction of the transformant culture. Therefore, a cell membrane fraction of a cell expressing the protein can be used as an immunogen.

  As the immunized animal in the present invention, any non-human vertebrate that recognizes IPC as a foreign substance can be used. In order to obtain a monoclonal antibody, an animal from which a fusion partner for obtaining a hybridoma is easily available is advantageous. For example, the establishment of hybridomas derived from cells such as mice, rats, rabbits, cows and goats has been established. These immunized animals can be used in the present invention. On the other hand, Freund's complete adjuvant, Freund's incomplete adjuvant, or the like is used as the adjuvant.

The immunized animal is immunized multiple times at intervals of 3-10 days. The number of IPCs used for one immunization is arbitrary. Usually, 10 ³ to 10 ⁸ , for example 10 ⁶ IPCs are immunized. In immunization with proteins and peptides, generally 1 to 100 μg is immunized. The monoclonal antibody of the present invention can be obtained by collecting immunocompetent cells from an immunized animal that has undergone multiple immunizations and cloning cells that produce the desired antibody. An immunocompetent cell refers to a cell having antibody-producing ability in an immunized animal.

  Immunocompetent cells can be cloned, for example, by the hybridoma method. One immunocompetent cell produces one type of antibody. Therefore, if a cell population derived from one cell can be established (that is, cloning), a monoclonal antibody can be obtained. The hybridoma method refers to a method in which immunocompetent cells are fused with an appropriate cell line, immortalized, and then cloned. Many cell lines useful for hybridoma methods are known. These cell lines are excellent in the immortalization efficiency of lymphoid cells and have various genetic markers necessary for selection of cells that have been successfully fused. Furthermore, for the purpose of obtaining antibody-producing cells, a cell line lacking antibody-producing ability can also be used.

  For example, mouse myeloma P3x63Ag8.653 (ATCC CRL-1580) is widely used as a cell line useful for mouse and rat cell fusion methods. In the present invention, since mouse IPC is used as an immunogen, the immunized animal is an animal other than a mouse. In general, hybridomas are produced by fusion of cells of the same type, but monoclonal antibodies can also be obtained from heterozygous hybridomas between closely related species.

Specific protocols for cell fusion are known. That is, the immunocompetent cells of the immunized animal are mixed with an appropriate fusion partner to cause cell fusion. Spleen cells and peripheral blood B cells are used as immunocompetent cells. As the fusion partner, various cell lines described above can be used. For cell fusion, a polyethylene glycol method or an electrofusion method is used.
Next, a cell that has succeeded in cell fusion is selected based on a selection marker possessed by the fused cell. For example, when a HAT-sensitive cell line is used for cell fusion, cells that have succeeded in cell fusion are selected by selecting cells that grow in the HAT medium. Further, it is confirmed that the antibody produced by the selected cell has the desired reactivity.

  Each hybridoma is screened based on antibody reactivity. That is, a hybridoma that produces an antibody that binds to either or both of BST2 and its homolog is selected. Preferably, the selected hybridoma is subcloned and finally selected as a hybridoma that produces the monoclonal antibody of the present invention when production of the target antibody is confirmed.

  Specifically, for example, a protein consisting of the amino acid sequence described in any one of SEQ ID NO: 2, selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6, or a peptide consisting of a partial amino acid sequence thereof Can be screened as an antigen. The monoclonal antibody that binds the antigen to an appropriate solid phase and binds to the antigen can be detected by a labeled antibody that recognizes the immunoglobulin of the immunized animal. Monoclonal antibodies can be rapidly screened by binding an antigen to the inner wall of the microplate and using an ELISA method using an enzyme-labeled antibody. A monoclonal antibody whose binding activity to an antigen has been confirmed is confirmed to have an effect on IPC activity as required. The influence on the IPC can be confirmed by a method described later, for example.

  Such a monoclonal antibody can be expressed by obtaining cDNA encoding the antigen-binding region of the antibody from the hybridoma and inserting it into an appropriate expression vector. A technique for obtaining cDNA encoding the variable region of an antibody and expressing it in an appropriate host cell is known. In addition, a technique for preparing a chimeric antibody by binding a variable region including an antigen-binding region to a constant region is also known.

  Furthermore, the antigen-binding activity of the monoclonal antibody can be transplanted to other immunoglobulins. The antigen-binding region of an immunoglobulin is composed of a complementarity determining region (CDR) and a frame region. The antigen binding properties of each immunoglobulin are determined by CDR, and the frame maintains the structure of the antigen binding region. The amino acid sequence of CDR is highly diverse, whereas the amino acid sequence in the frame portion is highly conserved. It is known that antigen binding activity can also be transplanted by incorporating the amino acid sequence constituting CDR into the frame region of other immunoglobulin molecules. Using this method, a method has been established for transplanting the antigen-binding properties of different types of immunoglobulins to human immunoglobulins.

Any monoclonal antibody thus prepared can be used in the present invention. That is, a monoclonal antibody comprising an immunoglobulin containing an antigen-binding region encoded by a polynucleotide derived from a cDNA encoding the antigen-binding region of the monoclonal antibody can be used in the present invention.
As a hybridoma producing a monoclonal antibody that can be used in the present invention, for example, hybridoma 3D3 # 7 or 3G7 # 6 can be shown. Hybridoma 3D3 # 7 and Hybridoma 3G7 # 6 were deposited to the Patent Organism Depositary of the National Institute of Advanced Industrial Science and Technology as of May 27, 2005 under the accession number FERM BP-10339 and the accession number FERM BP-10340. Has been. The contents specifying the deposit are described below.
(a) Name and address of depositary institution Name: National Institute of Advanced Industrial Science and Technology, Patent Biological Depositary Center Address: Central 1st 1-1, Higashi 1-1-1 Tsukuba, Ibaraki, Japan (Zip 305-8566)
(b) Date of deposit: May 27, 2005
(c) Accession number: BP-10339 (Hybridoma 3D3 # 7)
(c) Accession number: BP-10340 (Hybridoma 3G7 # 6)

  The monoclonal antibody for use in the present invention can be recovered from the culture by culturing the hybridoma producing it. The hybridoma can be cultured in vitro or in vivo. In vitro, hybridomas can be cultured using a known medium such as RPMI1640. Immunoglobulin secreted by the hybridoma accumulates in the culture supernatant. Therefore, the monoclonal antibody of the present invention can be obtained by collecting the culture supernatant and purifying it as necessary. Immunoglobulin purification is easier without adding serum to the medium. However, about 10% fetal bovine serum can also be added to the medium for the purpose of faster growth of the hybridoma and promotion of antibody production.

  Hybridomas can also be cultured in vivo. Specifically, the hybridoma can be cultured in the peritoneal cavity by inoculating the peritoneal cavity of a nude mouse. Monoclonal antibodies accumulate in ascites. Therefore, the necessary monoclonal antibody can be obtained by collecting ascites and purifying it as necessary. The obtained monoclonal antibody can be appropriately modified or processed according to the purpose.

Antibodies that bind to either or both BST2 and its homologues suppress their activity when contacted with IPC. Therefore, these antibodies can be used as IPC activity inhibitors in the present invention. That is, the present invention provides a therapeutic agent for arthritis associated with an autoimmune disease, comprising as an active ingredient at least one component selected from the group consisting of the following (a) to (c). Alternatively, the present invention relates to a method for treating arthritis associated with an autoimmune disease, comprising the step of administering at least one component selected from the group consisting of the following (a) to (c). The present invention further relates to the use of at least one component selected from the group consisting of the following (a) to (c) in the manufacture of a therapeutic agent for arthritis associated with an autoimmune disease.
(a) an antibody that binds to either or both of BST2 and its homolog, or a fragment containing an antigen-binding region thereof
(b) an immunoglobulin grafted with the complementarity determining region of the antibody of (a), or a fragment containing the antigen-binding region thereof, and
(c) Polynucleotide encoding the component described in (a) or (b) In the present invention, the monoclonal antibody that suppresses the activity of IPC includes SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6. A monoclonal antibody that recognizes a protein having an amino acid sequence described in any one of SEQ ID NOs selected from the group can be used.

  It can be confirmed as follows that the antibody has an action of suppressing the IFN production activity of IPC. IPC produces large amounts of IFN upon viral stimulation. The antibody is given before, after, or simultaneously with virus stimulation for IPC, and the ability to produce IFN is compared using IPC without antibody as a control. The ability to produce IFN can be evaluated by measuring IFN-α and IFN-β contained in the culture supernatant of IPC. As a result of the comparison, if the amount of IFN in the supernatant is significantly reduced by the addition of the antibody, it can be confirmed that the tested antibody has an action of suppressing IFN production ability. These methods for measuring IFN are known. An IPC is a cell that produces the majority of IFN in the living body. Therefore, the production state of IFN in the living body can be regulated by suppressing the IFN production ability of IPC.

  In the present invention, IPC activity includes maintenance of the number of IPC cells. Therefore, suppression of IPC activity in the present invention includes suppression of the number of IPC cells. Similar to IFN production, IPC activation is induced by stimuli such as infectious viruses. If it is confirmed that the number of cells of activated IPC is suppressed in the presence of the antibody, it can be seen that the antibody suppresses the activity of IPC. As a comparative control, an inactive immunoglobulin derived from the same animal species as the antibody whose activity should be confirmed can be used, as in IFN production. The number of cells in IPC can be compared quantitatively by counting cells. The number of cells can be counted by FACS or a microscope.

When an antibody that recognizes either or both of BST2 and its homolog is administered to a host different from the species from which the antibody is derived, it is desirable to process it into a form that is difficult for the host to recognize as a foreign substance. For example, immunoglobulins can be made difficult to be recognized as foreign substances by processing them into the following molecules. Techniques for processing immunoglobulin molecules as follows are known.
-Fragment containing antigen-binding region lacking constant region (Monoclonal Antibodies: Principles and Practice, third edition, Academic Press Limited. 1995; Antibody Engineering, A Practical Approach, IRL PRESS, 1996)
-Chimeric antibody composed of antigen-binding region of monoclonal antibody and constant region of immunoglobulin of host (Gene Expression Experiment Manual Kodansha 1994 (Ishida Isao, Ando Tamie))
-CDR-replacement antibody in which complementarity-determining region (CDR) in host immunoglobulin is replaced with CDR of monoclonal antibody (Gene Expression Experiment Manual Kodansha 1994 (Ishida Isao, Ando Tamie))

  Alternatively, by using a non-human animal into which a human antibody gene has been incorporated as an immunized animal, a human antibody can be obtained while using the non-human animal. For example, transgenic mice incorporating human antibody genes have been put into practical use as immunized animals for producing human antibodies (Ishida et al., Cloning and Stem Cells, 4: 85-95, 2002). By using such an animal, a human antibody that recognizes BST2 can be obtained using human BST2 as an antigen. Human antibodies are preferred antibodies for administration to humans.

  Alternatively, by phage display (McCafferty J. et al., Nature 348: 552-554, 1990; Kretzschmar T et.al., Curr Opin Biotechnol. 2002 Dec; 13 (6): 598-602.) An immunoglobulin variable region gene can also be obtained. In the phage display method, a gene encoding a human immunoglobulin variable region is incorporated into a phage gene. Phage libraries can also be created using various immunoglobulin genes as sources. The phage expresses the variable region as a fusion protein of the proteins constituting itself. The variable region of the phage surface expressed by the phage maintains the binding activity with the antigen. Therefore, by selecting a phage that binds to an antigen or a cell that expresses the antigen, a phage that expresses a variable region having a target binding activity can be screened from a phage library. Furthermore, in the phage particles thus selected, a gene encoding a variable region having a desired binding activity is retained. That is, in the phage display method, a gene encoding a variable region having a target binding activity can be obtained using the binding activity of the variable region as an index.

In the therapeutic agent or therapeutic method for arthritis associated with an autoimmune disease according to the present invention, an antibody or a fragment thereof that recognizes either or both of BST2 and its homolog, or an antibody comprising at least an antigen-binding region thereof is used as a protein, or It can be administered as a polynucleotide encoding it. In order to administer the polynucleotide, it is desirable to use a vector in which a polynucleotide encoding the target protein is placed under the control of an appropriate promoter so that the target protein can be expressed. An enhancer or terminator can also be placed in the vector. Vectors that retain the heavy and light chain genes that make up immunoglobulins and that can express immunoglobulin molecules are known.
A vector capable of expressing an immunoglobulin can be administered by introducing it into a cell. In administration to a living body, those that can infect cells by administration to a living body can be administered as they are. Alternatively, the vector can be introduced into lymphocytes once separated from the living body and returned to the living body again (ex vivo).

  In the therapeutic agent or therapeutic method for arthritis with autoimmune disease according to the present invention, the amount of monoclonal antibody administered to the living body is usually 0.5 mg to 100 mg, for example 1 mg to 50 mg, preferably 1 mg to 50 mg per kg body weight as immunoglobulin. Is 2 mg to 10 mg. The administration interval of the antibody to the living body can be appropriately adjusted so that the effective concentration of immunoglobulin in the living body during the treatment period can be maintained. Specifically, for example, it can be administered at intervals of 1 to 2 weeks. The administration route is arbitrary. Those skilled in the art can appropriately select an administration route effective for treatment. Specifically, oral or parenteral administration can be shown. For example, the antibody can be administered systemically or locally by intravenous injection, intramuscular injection, intraperitoneal injection, or subcutaneous injection. Examples of preparations suitable for parenteral administration in the present invention include injections, suppositories, and sprays. When given to cells, the immunoglobulin is usually given in an amount of 1 μg / mL, preferably 10 μg / mL or more, more preferably 50 μg / mL or more, and even more preferably 0.5 mg / mL or more.

  In the therapeutic agent or therapeutic method for arthritis associated with the autoimmune disease of the present invention, the monoclonal antibody can be administered to a living body by any method. Normally, monoclonal antibodies are formulated with a pharmaceutically acceptable carrier. Monoclonal antibodies can contain additives such as thickeners, stabilizers, preservatives, and solubilizers as necessary. Such carriers or additives include lactose, citric acid, stearic acid, magnesium stearate, sucrose, starch, talc, gelatin, agar, vegetable oil, ethylene glycol and the like. The term “pharmaceutically acceptable” is used by animals, mammals, and especially humans in national pharmacopoeia or generally recognized pharmacopoeias as approved by national government supervisory authorities. Say what is listed. The therapeutic agent for arthritis with autoimmune disease of the present invention can also be supplied in the form of one or more doses of lyophilized powder or tablets. The lyophilized powder or tablet may further be combined with sterile water for injection, physiological saline or buffer to dissolve the composition to the desired concentration prior to administration.

Further, when administered as a vector expressing immunoglobulin, 0.1 to 10 mg, for example, 1 to 5 mg of each plasmid is administered per kg body weight, assuming that the heavy chain and the light chain are cotransfected as separate plasmids. be able to. For introduction into cells in vitro, a vector of 1 to ⁵ μg / 10 ⁶ cell is used.

Furthermore, this invention relates to the detection method of the arthritis therapeutic effect accompanying the autoimmune disease of the test compound including the following processes.
(1) A step of contacting the interferon production inducer of the interferon producing cell and the interferon producing cell in any order of the following i) -iii):
i) contacting the interferon-producing cells with a cell stimulator that induces interferon production after contacting the test compound and the interferon-producing cells;
ii) contacting a test compound and a cell stimulator that induces interferon production simultaneously with the interferon-producing cells, or
iii) Contact the interferon-producing cells with a cell stimulator that induces interferon production, and then contact the test compound with the interferon-producing cells.
(2) measuring the activity of interferon-producing cells, and
(3) A step of detecting the therapeutic effect of arthritis associated with autoimmune disease of the test compound when the activity of interferon-producing cells is suppressed compared to the control

  In the method of the present invention, a cell stimulator refers to a substance that can induce IPC activation and interferon production. For example, viruses and virus components can be shown as cell stimulants. Specifically, it is known that IPC is activated by administration of a virus such as herpes simplex virus (HSV) or influenza virus (Influenza virus). In addition, the IPC activation action of CpG, which is DNA in bacteria, is also known. These cell stimulants may be used alone or in combination with different cell stimulants. The cell stimulant and the test compound may be contacted with the IPC simultaneously, or the IPC and the test compound may be contacted before or after the contact with the cell stimulant.

In the present invention, the cell stimulant, IPC, and test compound can be contacted in vitro, in vivo, or ex vivo. In vitro, the cell stimulator and the test compound can be contacted with the IPC in any order as described above under conditions where the IPC can be cultured. Further, in vivo, after administering a test compound or cell stimulating substance to IPC in vivo, IPC is collected. After the collected IPC is contacted with a cell stimulating substance or a test compound in vitro, the level of cell activation can be evaluated. The level of cell activation can be evaluated by a change in the concentration of IFN produced by the cell.
Furthermore, in ex vivo evaluation, a cell stimulant or a test compound is brought into contact with IPC prepared in vitro. The contacted IPC is administered to the living body, and further the test compound or cell stimulant is administered. The level of IPC activation in vivo is evaluated, and the effect of the test compound is evaluated. The level of IPC activation can be evaluated using, for example, the level of IFN in blood as an index. The preparation of IPC in vitro refers to collecting IPC from a living body or artificially preparing IPC by inducing differentiation of IPC progenitor cells.

  In addition, as a control in the method of the present invention, a substance having a known therapeutic effect on arthritis associated with an autoimmune disease can be used in place of the test compound. For example, physiological saline is a substance that has no therapeutic effect. Alternatively, a substance that has been confirmed to have a therapeutic effect on arthritis associated with an autoimmune disease can be used as a target, and the action of the test compound can be evaluated by relative comparison with the substance.

  In the method for detecting the therapeutic effect of arthritis with autoimmune disease according to the present invention, the activity of IPC refers to, for example, either or both of the production level of IFN and the number of IPCs. A particularly preferred activity is the ability to produce IFN by IPC. The ability of IPC to produce IFN can be compared by determining the amount or concentration of IFN contained in the cell culture. Reagents or kits for measuring various IFNs are commercially available. Alternatively, the number of IPC cells can be compared by counting the number of cells present in the IPC culture. The number of cells can be determined by FACS using an antibody that recognizes the cell surface antigen of IPC. For example, BST2 or BDCA-2 can be used as the cell surface antigen of IPC. In addition, CD4 and CD123 can be used as markers for counting IPC.

  In the present invention, the reagent necessary for detecting the therapeutic effect of arthritis associated with autoimmune disease is further combined with a cell stimulant for activating IPC, a medium for culturing IPC, a culture vessel, and the like. You can also. In addition, substances that clearly have an influence on the activation action of IPC can be combined as a control.

Furthermore, a method for screening a candidate compound for a therapeutic agent for arthritis associated with an autoimmune disease is provided using the method for measuring the therapeutic effect of arthritis associated with an autoimmune disease of the present invention. That is, this invention relates to the screening method of the test compound which has the therapeutic effect of the arthritis accompanying an autoimmune disease including the following processes.
(1) a step of measuring the therapeutic effect of arthritis associated with an autoimmune disease possessed by the test compound by the method for measuring the therapeutic effect of arthritis associated with an autoimmune disease of the present invention, and
(2) A step of selecting a test compound having a greater effect than the control The test compound used in the screening method of the present invention includes an antibody that recognizes an IPC cell surface antigen, an antibody that includes at least an antigen-binding region thereof, or A fragment containing the variable region can be used. As an antibody, a phage library expressing a variable region can also be used. Alternatively, in addition to compound preparations synthesized by combinatorial chemistry, mixtures containing multiple compounds such as extracts of animal and plant tissues or microbial cultures, and preparations purified from them may be used as candidate compounds. it can.

In order to find out the therapeutic effect of the arthritis accompanying autoimmune disease of the antibody which recognizes an IPC surface antigen based on this invention, the detection method including the following processes can be implemented, for example.
(1) A step of contacting the interferon production inducer of the interferon producing cell and the interferon producing cell in any order of the following i) -iii):
i) After contacting the antibody with IPC, a cell stimulator that induces IFN production is contacted with IPC.
ii) contacting the IPC with the antibody and a cell stimulator that induces IFN production, or
iii) Contacting the IPC with a cell stimulator that induces IFN production, and then contacting the antibody with the IPC
(2) measuring the activity of IPC, and
(3) The step of detecting the therapeutic effect of arthritis associated with an autoimmune disease of the antibody when the activity of IPC is suppressed compared to the control The therapeutic effect of arthritis associated with the autoimmune disease of the antibody based on the present invention This detection method further enables a screening method for an antibody having the activity. That is, this invention relates to the screening method of the antibody which has the therapeutic effect of the arthritis accompanying an autoimmune disease including the following processes.
(1) a step of measuring the therapeutic effect of arthritis associated with an autoimmune disease possessed by an antibody by the method for measuring the therapeutic effect of arthritis associated with an autoimmune disease of the present invention, and
(2) A step of selecting an antibody having a greater effect than the control In the detection method and screening method of the present invention, the antibody is a natural immunoglobulin molecule, a fragment containing the antigen-binding region, an amino acid sequence or a sugar chain. Are modified and chemically modified derivatives. A fragment containing the antigen-binding region of an antibody can be obtained by enzymatic digestion of immunoglobulin. Alternatively, it can be obtained by genetic engineering by isolating a gene encoding the region and expressing it in an appropriate expression system. As such an immunoglobulin recombinant, for example, a phage antibody library can be shown. On the other hand, the IPC and the cell stimulating agent can be used as described above.

  Since stimulation on IPC induces IFN production, IFN production can be regulated by regulating its activation. The present inventors have clarified that a therapeutic effect of RA can be obtained through suppression of IPC activity. Therefore, a substance capable of suppressing IPC activity can be used as a therapeutic agent for RA. That is, the compound that can be selected by the screening method of the present invention is useful as a therapeutic agent for arthritis associated with an autoimmune disease.

  In the screening method of the present invention, if IPC contacted with a substance apparently having a therapeutic effect on arthritis associated with an autoimmune disease is used as a control, a substance having a therapeutic effect greater than this substance can be found. IPC is an important cell that produces most of the IFN in the body. Therefore, the compound obtainable by the screening method of the present invention is important as a therapeutic agent for arthritis associated with autoimmune diseases by regulating immune balance. Alternatively, the compound obtainable by the screening method of the present invention can be used for the production of a therapeutic agent for arthritis associated with autoimmune disease by regulating immune balance.

The action on other cells can be confirmed by bringing the compound selected by the screening of the present invention into contact with various cells other than IPC, if necessary. If no significant growth inhibition or cytotoxic effect is detected on cells other than IPC, the compound is likely to be used as a safe therapeutic agent. Or even if it is a case where the disorder | damage | failure effect | action with respect to a specific cell is confirmed, there exists a possibility that it can utilize as a therapeutic agent by selecting administration forms, such as local administration. Furthermore, the therapeutic effect of RA can be evaluated in more detail by administering to a rheumatic model animal or the like.
In addition, all prior art documents cited in the present specification are incorporated herein by reference.
Hereinafter, the present invention will be described in more detail based on examples.

Monoclonal antibody production protocol The cells used as the immunogen were prepared as follows. Bone marrow cells of Balb / c female mice (4-6 weeks old) were supplemented with 10% FCS-RPMI1640 medium supplemented with 10 ng / ml FLT-3 ligand (R & D Systems) [10% fetal calf serum (FCS), And RPMI1640 medium containing penicillin and streptomycin] for 10 days. Ten days later, IPC (Interferon producing cell) was separated with a cell sorter (FACSVantage, manufactured by Becton Dickinson) as a CD11c positive, CD11b negative, and B220 positive fraction. An antibody manufactured by Becton Dickinson was used.
On the 0th, 4th and 11th days, 1 × 10 ⁶ cells per one foot were injected into the rat foot pad together with complete Freund's adjuvant (CFA: manufactured by Yatron) on the 0th, 4th and 11th days. On day 12, the lymph nodes of the immunized rat were isolated and lymphocytes were collected. Mouse myeloma cells P3x63Ag8.653 and rat lymphocytes were mixed at a ratio of 4: 5, and polyethylene glycol (PEG) was added to fuse the cells. The fused cells were thoroughly washed and dispersed in HAT medium, and seeded in a 96-well plate to contain 5 × 10 ⁴ cells per well.

  The cells in the wells in which the cells grew were collected and diluted, and the culture supernatant was screened using as an index the reactivity with mouse spleen cells and cultured bone marrow cells. Details of the screening method are as in Example 2. Cells in wells that showed a positive reaction were cloned by limiting dilution to establish hybridoma clones producing monoclonal antibodies. Furthermore, the reactivity of the antibody purified from the culture supernatant of the hybridoma or the ascites obtained by transplanting the hybridoma into the abdominal cavity of the mouse was analyzed.

Screening of culture supernatant
Bone marrow cells of Balb / c female mice (4-6 weeks old) were cultured for 10 days in 10% FCS-RPMI1640 medium supplemented with 10 ng / ml FLT-3 ligand. On day 10, about 40% of the cells became IPC. Using these cells, the hybridoma culture supernatant was used as the primary antibody, and the secondary antibody was stained with a FITC-labeled anti-rat Ig antibody (BD Pharmingen). Thereafter, double staining was performed with various antibodies (CD11b, CD11c, CD3, CD19, CD45RB, B220, Ly6C; all manufactured by Becton Dickinson), and analysis was performed by flow cytometry (FACS analysis).

  The culture supernatant positive fraction and negative fraction were R2 and R3, respectively, and the expression of various antigens in each Gate was shown as a histogram (FIG. 1). The cell group stained with several kinds of antibodies produced matched the cell surface antigen profile of mouse IPC (Nature Immunol., 2001; 2, 1144-1150.) Defined in the literature. Therefore, these antibodies were considered to be antibodies that specifically bind to mouse IPC.

Morphology of cells separated by antibody Bone marrow cells cultured in the same manner as in Example 2 were stained using the culture supernatant as the primary antibody and FITC-labeled anti-rat Ig antibody as the secondary antibody. Thereafter, positive cells were separated using a cell sorter (FACSVantage, manufactured by Becton Dickinson). After cytospinning, Giemsa staining and observation under a microscope showed a form specific to IPC (FIG. 2a). That is, the shape of this cell was round and had a large nucleus.

1x10 ⁵ cells were cultured in a 96 well round bottom plate with influenza virus PR8 for 24 hours at 37 ° C, stained similarly with Giemsa, and observed under a microscope. (Fig. 2b). From these results, it was confirmed that the cells isolated by the antibody have the characteristics of mouse IPC that differentiate into dendritic cells by viral infection. Among such mouse IPC-specific monoclonal antibodies and hybridomas producing the antibodies, SNK01 was selected and used in subsequent experiments.

Interferon-producing ability of cells separated by antibody After staining bone marrow cells cultured in the same manner as in Example 2 with SNK01 culture supernatant and secondary antibody, positive and negative cells were separated using a cell sorter. Dispense 1x10 ⁵ cells from each fraction into a 96-well round-bottom plate (100 μl / well), infect with influenza virus PR8, and measure the concentration of IFNα in the culture supernatant after 24 hours as follows: Measured by a simple ELISA method.

First, rat anti-mouse IFNα antibody (manufactured by PBL Biomedical Laboratory) was reacted overnight at 4 ° C. in a 96-well plate and coated. After washing the plate, 100 μl of culture supernatant was added and reacted at 4 ° C. overnight. After washing the plate, a labeled anti-interferon antibody that recognizes IFNα and IFNβ was added and reacted for 1 hour for detection. Each reaction was performed in triplicate and the average value was determined. By creating a calibration curve, the IFNα concentration in the culture supernatant was calculated.
SNK01 positive cells produced higher levels of interferon than negative cells. That is, it was confirmed that the antigen recognized by the monoclonal antibody SNK01 was a surface antigen specific for IPC (FIG. 3).

Effect of antibody on mouse interferon production ability Mouse bone marrow cells cultured in the same manner as in Example 2 were dispensed into 96-well round-bottom plates in an amount of 1 × 10 ⁵ pieces. To this, add SNK01 antibody or rat IgG as a control antibody, and incubate at 37 ° C for 30 minutes, then add influenza virus PR8, incubate at 37 ° C for 24 hours, and perform IFNα in the culture supernatant as above Measurement was performed by ELISA shown in Example 4 (FIG. 4). As a result, SNK01 suppressed IFNα production in a concentration-dependent manner. That is, the action of this antibody on mouse IPC was considered to be a specific action.

Cloning of molecules recognized by antibodies 1) Preparation of IPC-cDNA library In the same manner as in Example 2, total RNA was extracted from IPCs derived from bone marrow cells with FLT-3 ligand by the phenol-guanidine method, and oligo-dT column. mRNA was purified. CDNA was synthesized from purified mRNA by Gubler-Hoffman method, EcoRI-NotI adapter (manufactured by Invitrogen) was bound to both ends, and then unreacted EcoRI adapter and 500 bases or less by span column (Chromaspin 400, Clontech) Short cDNA was removed. The obtained cDNA having EcoRI sites at both ends was ligated to the EcoRI site of animal cell expression vector pME18s (excluding the XhoI fragment) by T4 ligase, and transformed into E. coli DH10 (Invitrogen) by electroporation. Converted. This was cultured overnight at 30 ° C in LB medium (LB carbenicillin) containing 100 µg / ml carbenicillin at 30 ° C, and plasmid was extracted and purified using QIA filter plasmid maxi kit (Qiagen) according to the protocol of the kit. -A cDNA library was obtained.

2) Expression cloning using COS7 cells
COS7 cells were seeded 10 sheets one by 5x10 ⁵ cells in 6cm dish, 37 ° C., after 20 hours incubation in the presence of 5% CO ₂ in accordance with the protocol of the product by Effectene trasfection Reagent (Qiagen Inc.), obtained in the above 1) IPC cDNA library was transfected. After culturing at 37 ° C and 5% CO _{2 for} 48 hours, washed with PBS (Phosphate Buffered Saline), detached cells from the dish with PBS / 5mM EDTA, further washed with PBS, and cell strainer (70μm, manufactured by Falcon) ) After centrifugation (1300 rpm, 5 minutes), the supernatant was removed, 1 ml of PBS / 0.5% BSA / 2 mM EDTA was added and suspended, 40 μl of Fc block (Pharmingen) was added, and the mixture was placed at 4 ° C. for 20 minutes. To this, 30-50 μg of biotinylated SNK01 antibody was added and kept on ice for 30 minutes. After washing with PBS, the suspension was suspended in 100 μl of PBS, 10-20 μl of streptavidin microbeads (Miltenyi Biotec) was added, and the mixture was allowed to stand at 10 ° C. for 15 minutes. Excess streptavidin microbeads were removed by washing with PBS / 0.5% BSA / 2 mM EDTA and suspended in 1 ml PBS / 0.5% BSA / 2 mM EDTA. Cells were sorted using AutoMACS (Miltenyi Biotec) under posselds conditions. The plasmid was extracted and purified by the improved Hirt method (BioTechniques Vol. 24,760-762, 1998). The resulting plasmid was transformed into Escherichia coli DH10 by electroporation, cultured overnight at 30 ° C with 100 ml of LB carbenicillin, and extracted with QIA filter plasmid midi kit (Qiagen) according to the protocol of the kit, Purified.

  The above operation was taken as one course, and thereafter the same operation was repeated four times to concentrate the plasmid encoding the antigen that reacts with the SNK01 antibody. Finally, positive cells were collected using a cell sorter (FACSVantage, manufactured by Becton Dickinson) instead of AutoMACS, and an appropriate amount of E. coli DH10 transformed with plasmid extracted from these cells was applied to an LB / carbenicillin plate. The cells were cultured overnight at 30 ° C., and 30 colonies that appeared were picked up, plasmids were extracted from each of them, transfected into COS7 cells, and positive plasmids were selected by FACS analysis using SNK01 antibody.

The nucleotide sequence of cDNA cloned on the obtained plasmid was determined, and the gene was determined by blast search with the nucleotide sequence information registered in the mouse gene database. At the same time, the counterparts were identified by searching the human gene database.
As a result, the clone bound with the monoclonal antibody SNK01 had the nucleotide sequences set forth in SEQ ID NO: 7 and SEQ ID NO: 9. The amino acid sequences encoded by these base sequences are shown in SEQ ID NO: 8 and SEQ ID NO: 10.
The base sequence described in SEQ ID NO: 9 was a base sequence known as mouse BST2 (GenBank Acc # .BC027328). On the other hand, the base sequence described in SEQ ID NO: 7 had a base sequence partially identical to the base sequence of SEQ ID NO: 9, but a different base sequence was found on the 3 ′ end side, and a different amino acid sequence Was coded. That is, among the amino acid sequences described in SEQ ID NO: 8, the amino acid sequence from the N-terminal to the 139th position was identical to the amino acid sequence described in SEQ ID NO: 10. In the amino acid sequence shown in SEQ ID NO: 8, the 140th to 178th amino acids from the N-terminal were unique to the amino acid sequence shown in SEQ ID NO: 8. Both were considered to be variants caused by alternative splicing. Based on these findings, the protein consisting of the amino acid sequence (SEQ ID NO: 8) encoded by the base sequence described in SEQ ID NO: 7 was considered to be a novel splicing variant of mouse BST2. Hereinafter, the gene consisting of the base sequence set forth in SEQ ID NO: 7 is also referred to as mBST2H, and the gene consisting of the base sequence set forth in SEQ ID NO: 9 is also referred to as mBST2D. (Fig. 7 (a))

3) Confirmation by FACS The plasmid obtained by the above expression cloning method was again highly purified from Escherichia coli again using the QIA filter plasmid midi kit (manufactured by Qiagen), and again transfected into COS7 cells. After 48 hours, according to a standard method, the reaction was carried out with SNK01 antibody and FITC-labeled anti-rat Ig antibody, and FACS analysis was performed to confirm whether the cDNA cloned on plasmid encoded the antigen.
As a result, the monoclonal antibody SNK01 was observed to bind to COS7 cells introduced with a plasmid. Therefore, it was confirmed that all the cDNAs cloned on the plasmid encoded the antigen recognized by this monoclonal antibody.

Confirmation of antibody reactivity by Western blotting It was confirmed by Western blotting that the monoclonal antibody recognizes and binds to a protein having the amino acid sequence of SEQ ID NO: 8 or SEQ ID NO: 10. The amino acid sequence shown in SEQ ID NO: 8 or SEQ ID NO: 10 was expressed as a gene recombinant, and the reactivity with the monoclonal antibody of the present invention was confirmed. The specific operation is as follows.

1) Construction of pcDNA3.1-mBST2D and pcDNA3.1-mBST2H DNA having the nucleotide sequence set forth in SEQ ID NO: 7 or SEQ ID NO: 9 by PCR using the cloned mBST2D and mBST2H-encoding plasmid (1 μg) as a template Was amplified. The base sequences of the primers used for PCR are as follows.
forward primer (SEQ ID NO: 11):
5'-tttttgctagcgacggatcacatggcgccctctttctatcactatctgcccgtgcccatggatgagatgggggggaagcaagga-3 '
reverse primer (SEQ ID NO: 12)
5'-tttttttctcgagtcctcaaaagagcaggaacagtgac-3 '
The composition of the reaction solution is as follows.
1XGC bufferI,
dNTP mix (0.25 mM),
LA Taq DNA polymerase 5U (above Takara Bio) / 100μL
forward primer (1 pmol):
reverse primer (1 pmol)

After incubation at 95 ° C. for 1 minute, PCR was performed under 25 conditions, with [95 ° C. 30 seconds / 55 ° C. 30 seconds / 72 ° C. 1 minute 30 seconds] as one cycle. After confirming that a DNA fragment of a desired size was amplified by agarose gel electrophoresis, phenol chloroform extraction and ethanol precipitation were performed, and the recovered amplification product was dissolved in 10 μL of TE buffer. This was cleaved with restriction enzymes Nhe I and Xho I (Takara Bio), purified by agarose gel electrophoresis using QIAquick Gel Extraction Kit (QIAGEN), ethanol precipitated, and dissolved in 4 μL of TE buffer.
On the other hand, 5 μg of mammalian cell expression plasmid pcDNA3.1 (manufactured by Invitrogen) was digested with restriction enzymes Nhe I and Xho I, treated with CIAP (manufactured by Takara Bio), purified by agarose gel electrophoresis, ethanol precipitated, TE buffer Dissolved in 4 μL. 2 μL of each of the aforementioned DNA fragments and 0.5 μL of this plasmid were ligated using ligation kit ver. II (manufactured by Takara Bio Inc.) and transformed into E. coli DH5.
After overnight culture at 37 ° C. in LB medium (100 μg / ml ampicillin), several colonies that appeared were selected, and plasmids were extracted using QIAprep Spin miniprep kit (manufactured by QIAGEN). The base sequence of the DNA fragment inserted into the extracted plasmid was determined according to a standard method. The plasmids were confirmed to be plasmids into which a DNA fragment having the base sequence encoding the amino acid sequence set forth in SEQ ID NO: 8 or SEQ ID NO: 10 had been inserted, and the desired constructs pcDNA3.1-mBST2D and pcDNA3.1-mBST2H Got.

2) Construction of pcDNA3.1-mBST2D-His and pcDNA3.1-mBST2H-His
Using pcDNA3.1-mBST2D (in the case of pcDNA3.1-mBST2D-His construction) or pcDNA3.1-mBST2H (in the case of pcDNA3.1-mBST2H-His construction) 1 μg as a template, the nucleotide sequence encoding the His tag by PCR Added. The base sequences of the primers used for PCR are as follows. The same forward primer (SEQ ID NO: 13) was used for pcDNA3.1-mBST2D-His and pcDNA3.1-mBST2H-His. The composition of the reaction solution and the temperature cycle conditions were the same as in 1).
forward primer (SEQ ID NO: 13):
5'-ccagctcacccgcacccaggacagtc-3 '
reverse primer (for pcDNA3.1-mBST2D-His, SEQ ID NO: 14):
5 '-tttttttctcgagtcaatgatgatgatgatgatgaaagagcagaaacagtgacactttga-3'
reverse primer (for pcDNA3.1-mBST2H-His, SEQ ID NO: 15):
5'-tttttttctcgagtcaatgatgatgatgatgatggaagtctccttttggatcctgagctg-3 '

After confirming that a DNA fragment of the desired size was amplified by agarose gel electrophoresis, phenol chloroform extraction, ethanol precipitation, and dissolution in 10 μL of TE buffer were performed. This was cleaved with restriction enzymes BamH I and Xho I (Takara Bio), purified by agarose gel electrophoresis using QIAquick Gel Extraction Kit (QIAGEN), precipitated with ethanol, and dissolved in 4 μl of TE buffer.
On the other hand, pcDNA3.1-mBST2D and pcDNA3.1-mBST2H 5 μg were digested with restriction enzymes BamH I and Xho I, treated with CIAP (Takara Bio), purified by agarose gel electrophoresis, ethanol precipitated, and TE buffer 4 μL Dissolved in. 2 μL of each DNA fragment amplified by PCR and 0.5 μL of these plasmids were ligated using ligation kit ver.II (manufactured by Takara Bio Inc.) and transformed into E. coli DH5.
After overnight culture at 37 ° C. in LB medium (100 μg / ml ampicillin), several colonies that appeared were selected, and plasmid was extracted from them using QIAprep Spin miniprep kit (manufactured by QIAGEN). The base sequence of the DNA fragment inserted into the extracted plasmid was determined according to a standard method. It was confirmed that the DNA fragment to which the base sequence encoding the His tag was added was inserted, and the intended constructs pcDNA3.1-mBST2D-His and pcDNA3.1-mBST2H-His were obtained.

3) Western-blotting
Ten COS7 cells were seeded at 5 × 10 ⁵ in a 6 cm dish and cultured at 37 ° C. under 5% CO ₂ for 20 hours. The pcDNA3.1-mBST2D-His or pcDNA3.1-mBST2H-His was transformed into the COS7 cells after the culture by Effectene trasfection Reagent (manufactured by Qiagen). The operation followed the protocol of the product. After culturing at 37 ° C. and 5% CO ₂ for 48 hours, the cells were washed with PBS, and the cells were detached from the dish with PBS / 5 mM EDTA and collected. The collected cells were further washed with PBS, 2 ml of RIPA buffer containing 1 × Halt Protease Inhibitor Coctail (PIERCE) was added, and the cells were lysed on ice for 1 hour. The composition of RIPA buffer is shown below.
50 mM Tris-HCl (pH 7.4),
150 mM NaCl,
1% Triton x-100,
0.5% sodium deoxycholate,
0.1% SDS

The cells after lysis were centrifuged at 4 ° C., 15000 rpm for 5 minutes. The supernatant was concentrated to 50 μL or less with Microcon YM-10 (MILLIPORE) and used as a sample for Western blotting. On the other hand, the precipitate was washed once again with 1 mL of RIPA buffer containing 1 × Halt Protease Inhibitor Coctail (manufactured by PIERCE), and used as a sample for Western blotting.
200 μL of 1 × denatured buffer was added to the precipitate, and an equal volume of 2 × denatured buffer was added to the concentrated supernatant. After boiling at 100 ° C. for 10 minutes, 5 μL each of NuPAGE4-12% Bis-Tris Gel (Invitrogen) Electrophoresis. A sample was transferred from the gel after electrophoresis to a PVDF membrane (MILLIPORE) using a semi-dry blotting apparatus (BIO CRAFT, MODEL BE-330).
Immunostar kit (manufactured by Wako Pure Chemical Industries, Ltd.) was used for detection by antibody. First, as a primary antibody, an HRP-labeled anti-His tag antibody (manufactured by Invitrogen) was used at a concentration of 5000-fold dilution, and a signal was detected according to the protocol of the immunostar kit. After detection of the signal, the PVDF membrane was treated with a denaturing solution (7 M guanidine hydrochloride, 50 mM glycine, 0.05 mM EDTA, 0.1 M potassium chloride, 20 mM 2-mercaptoethanol) for 1 hour at room temperature to give labeled anti-His tag. The antibody was removed. Next, signals were similarly detected using a biotinylated SNK01 antibody. The results are shown in FIG.

  In the monoclonal antibody SNK01, a clear band was seen at the position of the molecular weight (about 20 kD) predicted from the amino acid sequence. SNK01 reacted strongly against both BST2D (SEQ ID NO: 10) and BST2H (SEQ ID NO: 8). A strong reaction was detected even at positions above 20 kD. These large molecular weight proteins were expected to have sugar chain modifications. BST2D (SEQ ID NO: 10) showed a stronger signal in precipitation than the supernatant. BST2H (SEQ ID NO: 8) also showed a stronger signal in the precipitate, but a strong antibody reaction was also detected in the supernatant. The reason why the signal of the His tag antibody against BST2D (SEQ ID NO: 10) was not detected was thought to be that the His tag added to the C-terminal was removed by processing.

Confirmation of mouse BST2 expression by RT-PCR
PCR was performed according to a conventional method using cDNA synthesized from RNA extracted from each cell as a template, and it was confirmed that the antigen gene was specifically expressed in IPC. The base sequences of the primers used for PCR are as follows.
Forward for SEQ ID NO: 7 (SEQ ID NO: 16):
5'-acatggcgccctctttctatcac-3 '
reverse (SEQ ID NO: 17):
5'-gagcccaggttttgaaggaagtg-3 '
Forward for SEQ ID NO: 9 (SEQ ID NO: 18):
5'-agctcacccgcacccaggacagt-3 '
reverse (SEQ ID NO: 19):
5'-cactccccagtcctaaagttct-3 '
Sense primer for β-actin (SEQ ID NO: 20):
5'-gtgggccgctctaggcaccaa-3 '
Antisense primer (SEQ ID NO: 21):
5'-ctctttgatgtcacgcacgatttc-3 '

The cDNAs or cells for which the expression levels are compared are as follows. A commercially available product (manufactured by Clonetech) was used as the DNA panel. The cells were highly separated by a cell sorter (FACSVantage, manufactured by Becton Dickinson). The results are shown in FIG. BST2D (SEQ ID NO: 9) was expressed in a plurality of cells. It was IPC that showed strong expression. BST2H (SEQ ID NO: 7) was strongly expressed in mouse IPC.
CD3 positive cells (T cells),
CD8 positive cells,
Mouse IPC,
cDNA panel synthesized from myeloid DC and RNA extracted from mouse organs

Cloning of Novel Splicing Variant of Mouse BST2 In Example 8, a short amplified fragment was observed in addition to the amplified fragment corresponding to the cDNA of SEQ ID NO: 7 by the combination of primers for SEQ ID NO: 7. When this amplified fragment was cloned by a conventional method and the nucleotide sequence was confirmed, it had a nucleotide sequence in which the second exon portion of mBST2H shown in SEQ ID NO: 7 was deleted. That is, it was considered to be a novel splicing variant of mouse BST2 having the base sequence shown in SEQ ID NO: 22. The amino acid sequence encoded by this gene is shown in SEQ ID NO: 23. As shown in Example 8, it was confirmed that this gene was also expressed in mouse IPC. The gene described in SEQ ID NO: 22 is hereinafter also referred to as mBST2HS.
The alignment of the amino acid sequences of mBST2D, mBST2H, and mBST2HS is shown in FIG. 7 (a), and the respective genome structures are shown in FIG. 7 (b).

Preparation of mouse BST2 expression vector PCR was performed under the following conditions using primers of mBST2D and mBST2H obtained in Example 6 as templates and primers having the following base sequences.
pmBST2-F; tttttgctagcgacggatcacatggcgccctctttctatcactatctgcccgtgcccatggatgagatgggggggaagcaagga (SEQ ID NO: 24) and
pmBST2-R; tttttttctcgagtcctcaaaagagcaggaacagtgac (SEQ ID NO: 25)
DNA polymerase: LA Taq (Takara Bio Inc.)
[95 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. for 2 minutes] 25 cycles After amplification, each fragment was treated with restriction enzymes NheI and XhoI (both manufactured by Takara Bio Inc.) and cleaved. Similarly, ligation was performed using an animal cell expression vector pcDNA3.1-Zeo (+) (Invitrogen) treated with NheI and XhoI and ligation kit ver.II (Takara Bio Inc.) to obtain respective expression vectors. The mBST2HS expression vector was prepared by removing the second exon portion of mBST2H using a PCR method according to a standard method.

Cloning of human ortholog cDNA and construction of expression vector When human orthologue of mouse IPC-specific antigen BST2 identified in the present invention was searched, it was a known gene reported as human BST2 (Ishikawa, J. et al. Genomics 1995; 26, 527-; GenBank Acc #. D28137). In addition, a new splicing variant human ortholog found in mice was cloned by PCR as described below to prepare three types of expression vectors.

  According to the method shown in the following examples, Herpes Simplex virus-stimulated human IPC was prepared, RNA was extracted, and first strand cDNA was synthesized using Superscript First Strand System Kit (Invitrogen). Using this as a template, hBST2 primer F; aaaaaaagctagctggatggcatctacttcgtatg (SEQ ID NO: 26) and hBST2 primer R; ℃ 30 seconds, 72 ℃ 2 minutes, 25 cycles). The amplified fragment was cleaved with restriction enzymes NheI and XhoI and then inserted into the NheI-XhoI site of pcDNA3.1-Zeo (+) (Invitrogen) to obtain an expression plasmid for human BST2.

For genes that are orthologs of mouse splicing variants, use the primers of the following base sequence with the IPC cDNA library as a template, PCR using LA Taq (Takara Bio) as an enzyme (95 ° C for 30 seconds, 55 ° C: 30 seconds, 72 ° C for 2 minutes, 25 cycles). cDNA was synthesized by GeneRacer kit (Invitrogen). The amplified fragment was cleaved with restriction enzymes NheI and XhoI and then inserted into the NheI-XhoI site of pcDNA3.1-Zeo (+) (Invitrogen) to obtain an expression plasmid.
Primer for mBST2H ortholog
hBST2 primer F (SEQ ID NO: 26) and
primerhBHR; ttttttctcgagctagggatgtgggggtgagaggaatgtggcaggtggagggtagcgggggaaggctatctctgacctcagtcgctccacctctgcagac (SEQ ID NO: 28)
Primer for mBST2HS ortholog
hBST2 primer F (SEQ ID NO: 26) and
primerhBST2HSR1; aaaaaaactcgagcttatggtttaatgtagtgatctctccacagtgtggttgcaggtggcggcct (SEQ ID NO: 29)

The base sequence of human BST2 which is a known gene is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2. Hereinafter, the gene having this sequence is also referred to as hBST2D. In addition, the base sequence of the human ortholog of mBST2H obtained above (hereinafter also referred to as hBST2H) is shown in SEQ ID NO: 3, the amino acid sequence is shown in SEQ ID NO: 4, and the human ortholog of mBST2HS (hereinafter also referred to as hBST2HS). The nucleotide sequence is shown in SEQ ID NO: 5, and the amino acid sequence is shown in SEQ ID NO: 6.
The alignment of the amino acid sequences of hBST2D, hBST2H, and hBST2HS is shown in FIG. 8 (a), and the respective genome structures are shown in FIG. 8 (b). It was suggested that hBST2H and hBST2HS are novel splicing variants.

Confirmation of human BST2 gene expression by RT-PCR PCR was performed according to a conventional method using cDNA synthesized from RNA extracted from each cell as a template, and expression of each variant of human BST2 was examined. PCR conditions include 95 ° C for 1 minute, then 95 ° C for 30 seconds, 60 ° C for 30 seconds, 73 ° C for 45 seconds, D cycle for 30 cycles, H type and HS type for The reaction was performed for 35 cycles (FIG. 9).
Primer sequences are as follows.
Forward primer; gccttcgggcagtgatggagtgtc (SEQ ID NO: 30)
Reverse primer for D; tcaagcgaaaagccgagcaggac (SEQ ID NO: 31)
Reverse primer for H, HS; aatgtggcaggtggagggtag (SEQ ID NO: 32)
As a result, human BST2 mRNA was found to be expressed in multiple tissues and cells. In IPC, the expression was enhanced by stimulation with HSV.

Production and Evaluation of Antibody Recognizing Mouse BST2 1) Production of Anti-Mouse BST2 Antibody An antibody that recognizes one or more of the three subtypes D, H, and HS of mouse BST2 was prepared as follows.
Each 6 cm dish is seeded with ⁴ × 10 ⁵ COS7 cells per plate and cultured for 20 hours, using Effectene trasfection Reagent (manufactured by Qiagen) according to the protocol of the same product and each type prepared in Example 10 above. The three types of expression vectors cloned with the cDNA were mixed in the same amount (1 μg per dish) and transfected. After 24 hours, the medium was replaced with fresh medium. After another 24 hours, the cells were collected with PBS / 5 mM EDTA, washed with PBS, and adjuvant CFA on the foot pads of both feet of Wister rat (5-6 weeks old). Infused with. Lymph nodes were collected on the 12th day from rats immunized by performing such operations on the 0th, 4th, and 11th days, and hybridomas were prepared in the same manner as described in Example 1. The hybridoma culture supernatant was screened by Cell ELISA, and clones were selected that reacted with COS7 cells transfected with the three expression vectors but did not react with the host COS7 cells. Furthermore, the FACS analysis confirmed the binding activity and the cells were cloned, and finally 5 positive clones were obtained.

2) Influence on mouse IFN production ability The influence on IFN production was examined according to the method shown in Example 5 using the culture supernatant of the obtained clone. There was activity to suppress IFN production. Furthermore, when stimulated with 0.1 μM CpG ODN 1668 (MWG Biotech), it also showed IFN production inhibitory activity (FIG. 10). From this, it was confirmed that antibodies against mBST2 other than SNK01 also showed activity to suppress IFN production from IPC.

Production and evaluation of an antibody that recognizes human BST2 (hBST2) 1) Production of human BST2 antibody An antibody that recognizes any of the three subtypes D, H, or HS of human BST2 or the same as in Example 13. Prepared according to the method. Hybridomas were screened by FACS analysis of the culture supernatant using the three types of expression vectors in which each type of human cDNA prepared in Example 11 was cloned. Multiple clones were obtained, including clones 3D3 # 7, 3E2 # 8, 5C11 # 7, and 3G7 # 6. Purified antibodies of the obtained clones were obtained and further analyzed.

2) Influence on human IFN production ability Peripheral blood was collected from healthy individuals, and PBL (peripheral blood lymphocytes) was isolated. Various cells were removed by MACS with Lineage antibodies (CD3, CD14, CD16, CD19, CD20, CD56 antibodies), and then CD4-positive, CD123-positive, and Lineage-negative cell groups were separated as IPCs using a cell sorter. The human IPC thus obtained was seeded on a 96-well plate at 2 × 10 ⁴ cells / well, added with anti-BST2 antibody at concentrations of ³ , 10, and 30 μg / mL, respectively, and cultured at 37 ° C. for 1 hour. After 1 hour of culture, Herpes Simplex virus (20 pfu / cell) was added and cultured at 37 ° C. for 24 hours, and IFNα in the culture supernatant was measured by ELISA kit (Bender Med System). As a result, it was revealed that the anti-human BST2 antibody exhibits human IFN production inhibitory activity in the same manner as the previously reported BDCA2 antibody (Miltenyi). (FIG. 11) That is, it was revealed that an antibody recognizing human BST2 affects the IFN production activity of cells expressing the molecule.

Expression pattern of BST2 protein 1) Expression pattern of mouse BST2 The expression of mouse BST2 protein was analyzed by FACS using monoclonal antibody SNK01. Spleen cells of Balb / c mice or TypeI IFN receptor knockout mice were stimulated with CpG (0.5 μM) or influenza virus PR8 for 24 hours, and then stained with various antibodies. In the normal state without stimulation, BST2 was expressed specifically in IPC as shown in FIG. 1, but in Balb / c mice, BST2 expression was induced in many cells by stimulation. It became clear (Fig. 12). Similar tendencies were detected in CD3 positive T cells, CD19 positive B cells, DX5 positive NK cells, and Gr-1 positive granulocytes. Furthermore, since BST2 expression enhancement by these CpG and viruses was not detected in IFNR knockout mice, it was estimated that BST2 expression was induced via IFN signals.

2) Expression pattern of human BST2 Using the antibody 5C11 prepared in 1) of Example 14, the expression of human BST2 protein was analyzed by FACS. PBL was collected from the peripheral blood of healthy individuals, added with IFNα at a concentration of 1 ng / ml, cultured at 37 ° C for 24 hours, and double-stained with anti-BDCA-2 antibody, anti-BDCA-4 antibody and 5C11 (FIG. 13). As a result, it was revealed that BST2 expression is not normally detected in human IPC, but BST2 expression is induced by IFN stimulation. That is, it has been clarified that the expression of BST2 molecule is induced by IFN in humans as well as mice and further affects the production of IFN itself. It was also revealed that expression was induced on IPC when stimulated with CpG (FIG. 14).

In vivo evaluation of antibodies 1) Analysis of cells collected from antibody-treated mice
Balb / c mice were intraperitoneally administered SNK01 and control rat IgG, 300 μg per mouse, 3 times every other day (0.9 mg / mouse). On day 6, spleen and bone marrow were collected and IPC The cell population was analyzed by staining with B220, CD11c, and CD11b. Furthermore, bone marrow cells were seeded on a 96-well plate at 1 × 10 ⁶ / well, stimulated with CpG (0.5 μM) or influenza virus PR8, and the cytokine value of the culture supernatant after 24 hours was measured by ELISA (FIG. 15).
As a result, in the SNK01 administration group, it became clear that IFN production ability with respect to various stimuli of IPC was low. There was no effect on IL-12 production. From this, it was shown that administration of an antibody against BST2 caused changes in the function of cells expressing BST2 molecules, and the ability to produce IFN by in vitro stimulation was suppressed.

2) Analysis using virus-infected mice 5x10 ⁴ pfu / mouse MCMV (mouse cytomegalovirus) was intraperitoneally injected into mice (n = 3) pre-administered with antibodies (500 µg per mouse 1.5 days and 0.5 days before, respectively) Infection occurred. After this infection, IFNα in the serum of mice 1.5 days later was measured by ELISA. In addition, the cell population of IPC in the spleen was analyzed by staining with B220, CD11c, and CD11b (FIG. 16).
As a result, in the SNK01 administration group, the amount of IFN production in serum was suppressed. That is, it was shown that administration of this antibody suppressed IFN production ability in vivo. From these results, it was considered that the binding of the antibody to the cells regulated the cell function.

Test of antibody administration to rheumatoid arthritis (RA) model mice Using an arthritis-inducing antibody cocktail (Chondrex), an antibody against BST2 was administered to a mouse rheumatoid arthritis model prepared according to the attached instruction, and the arthritis inhibitory activity evaluated. Two days before and 1 day before the arthritis-inducing antibody cocktail was intraperitoneally administered at 2 mg / mouse to Balb / c mice (6 weeks old female), 300 μg of SNK01 and control rat IgG were intraperitoneally administered per mouse. After administration of the antibody cocktail, 300 μg / mouse antibody was intraperitoneally administered every other day, and 3 days after the cocktail administration, 50 μg of LPS was administered, and thereafter, SNK01 and control antibody were continuously administered (FIG. 17 (a )). Two tests were performed blind each, and changes over time were observed. The number of mice used in the test is 15 (n = 15) in total: 5 (n = 5) in the first test and 10 (n = 10) in the second test.

The incidence of arthritis was determined by calculating the ratio of the number of affected animals to the number of surviving animals (n = 15). The arthritis score was evaluated according to the following criteria.
0: Healthy
1: Mild limited redness and swelling are observed on the ankles and wrists.
Or individual fingers have obvious redness and swelling.
2: Moderate redness and swelling are observed on the ankles and wrists.
3: Severe redness and swelling are observed in the entire foot, including the fingers.
4: Inflammation is observed in the entire limb across multiple joints.

As shown in FIGS. 17B and 17C, the onset of arthritis was suppressed in the SNK01 administration group compared to the control administration group.
In addition, rheumatoid factor was analyzed by ELISA using mouse serum collected 16 days after antibody cocktail administration. First, Rabbit IgG (R & D Systems) (10 μg / ml in PBS) heat-denatured at 56 ° C. for 30 minutes was added to ELISA plate (NUNC) at 50 μl / well and allowed to react overnight at 4 ° C. And plate coated. After plate washing and blocking, diluted mouse serum was added at 50 μl / well and allowed to react for 1 hour. After washing the plate, react with diluted HRP-labeled Rabbit anti-Mouse IgG (H & L) (abcam) at 50 μl / well and react with Substrate Reagent (BD Pharmingen), then OD450 (absorbance at 450 nm) Was measured. The results are shown in FIG. Rheumatoid factor was suppressed in the SNK01 administration group compared to the control administration group.

  Furthermore, the amount of cytokine in the serum of the mice after administration of the antibody cocktail was measured. IFNα was measured by the method shown in Example 4, and the serum results 16 days after administration of the antibody cocktail are shown in FIG. In the SNK01 administration group, IFN production was suppressed compared to the control administration group. The serum TNFα concentration was measured using an ELISA Development kit (Genzyme-Techne) according to the method indicated in the attached instructions. The results of serum 16 days after administration of the antibody cocktail are shown in FIG. TNF production was also suppressed in the SNK01 administration group compared to the control administration group.

The percentage of IPC in spleen cells and peripheral blood was determined by FACS analysis. At that time, staining was performed using SNK02, which is an IPC-specific antibody prepared by the method shown in Example 1, and a CD11c antibody (Becton Dickinson). As a result, in the SNK01 administration group, the ratio of IPC in spleen cells and peripheral blood decreased (FIG. 21).
From the above, it was shown that administration of SNK01 antibody suppressed the activity of IPC and suppressed the onset of arthritis.

Test of antibody administration to arthritic mice In the same manner as in Example 17, arthritis-inducing antibody cocktail and LPS were administered to mice (n = 5) to induce arthritis, and then SNK01 antibody was administered. The therapeutic effect was evaluated. The number of mice was 5 in each group, and 5 times every other day from the 6th day, that is, 500 μg each of SNK01 and control rat IgG were intraperitoneally administered on the 6th, 8th, 10th, 12th and 14th days. Changes over time were observed. The arthritis score was determined according to the same method as in Example 17. The results for the affected mice are shown in FIG. SNK01 showed a decrease in arthritis score, that is, a therapeutic effect for arthritis. In the serum on day 17, the amount of IFN was suppressed in the SNK01 administration group.

  According to the present invention, a therapeutic agent and a therapeutic method for arthritis associated with autoimmune diseases such as RA targeting IPC as a therapeutic target are provided. IPCs include cells that produce thousands of times more IFN than other cells. Therefore, if either or both of the IFN production ability and cell survival (or the number of cells) are suppressed, IFN production is effectively suppressed and symptoms such as RA can be alleviated. The therapeutic agent of the present invention that acts on IPC not only suppresses arthritic symptoms but also realizes more essential treatment through improving the immune balance of RA patients.

  In addition, the present invention provides a method for detecting the therapeutic effect of arthritis associated with autoimmune diseases such as RA, and a method for screening candidate compounds useful for treatment using the method. The present invention has revealed that modulation of IPC activity is an important issue in the treatment of arthritis associated with autoimmune diseases. Therefore, by selecting a compound that modulates the activity of IPC, a compound useful for the treatment of arthritis associated with an autoimmune disease such as RA can be selected. That is, the compound selected based on the screening method of the present invention is useful for the treatment of arthritis associated with autoimmune diseases such as RA.

Claims (15)

A therapeutic agent for arthritis associated with an autoimmune disease, comprising an interferon-producing cell activity inhibitor as an active ingredient. The therapeutic agent according to claim 1, wherein the substance that suppresses the activity of interferon-producing cells is a substance having an action of suppressing either or both of interferon production and cell survival of interferon-producing cells. The therapeutic agent according to claim 2, wherein the substance that suppresses the activity of interferon-producing cells is an antibody having an action of suppressing either or both of interferon production and cell survival of interferon-producing cells. The therapeutic agent according to claim 3, wherein the antibody is an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region thereof. 5. The antibody according to claim 4, wherein the antibody is at least an antigen-binding region of a monoclonal antibody produced by hybridoma 3D3 # 7 deposited as FERM BP-10339 or hybridoma 3G7 # 6 deposited as FERM BP-10340. Therapeutic agent. A method for treating arthritis associated with an autoimmune disease, comprising a step of suppressing the activity of interferon-producing cells. The treatment method according to claim 6, wherein the activity of the interferon-producing cells to be suppressed is any one or both of interferon production and cell survival of the interferon-producing cells. The treatment method according to claim 7, wherein the step of suppressing the activity of the interferon-producing cell comprises a step of administering an antibody having an action of suppressing either or both of the interferon production and the cell survival of the interferon-producing cell. The treatment method according to claim 8, wherein the antibody is an antibody that recognizes either or both of BST2 and its homolog, or an antibody fragment containing at least an antigen-binding region thereof. 10. The antibody comprising at least an antigen-binding region of a monoclonal antibody produced by hybridoma 3D3 # 7 deposited as FERM BP-10339 or hybridoma 3G7 # 6 deposited as FERM BP-10340. Treatment methods. A method for detecting a therapeutic effect of arthritis associated with an autoimmune disease of a test compound, comprising the following step.
(1) A step of contacting the interferon production inducer of the interferon producing cell and the interferon producing cell in any order of the following i) -iii):
i) contacting the interferon-producing cells with a cell stimulator that induces interferon production after contacting the test compound and the interferon-producing cells;
ii) contacting a test compound and a cell stimulator that induces interferon production simultaneously with the interferon-producing cells, or
iii) Contact the interferon-producing cells with a cell stimulator that induces interferon production, and then contact the test compound with the interferon-producing cells.
(2) measuring the activity of interferon-producing cells, and
(3) The step of detecting the arthritis therapeutic effect of the test compound when the activity of interferon-producing cells is suppressed compared to the control 12. The method of claim 11, wherein the cell stimulating agent is at least one cell stimulating agent selected from the group consisting of viruses, viral components, and bacterial DNA. The method according to claim 11, wherein the test compound is an antibody that recognizes an interferon-producing cell or an antibody fragment containing at least an antigen-binding region thereof. A method for screening a compound having a therapeutic effect on arthritis associated with an autoimmune disease, comprising a step of selecting a test compound in which the therapeutic effect on arthritis associated with an autoimmune disease is detected by the method according to claim 11. The therapeutic agent of the arthritis accompanying the autoimmune disease containing the compound selected by the screening method of Claim 14 as an active ingredient.