JPWO2005082412A1 - Cancer treatment and prevention - Google Patents

Abstract

Providing anticancer drugs based on a novel mechanism of action. A therapeutic or prophylactic agent for cancer comprising as an active ingredient a substance that enhances the expression of DSCR-1 protein, DSCR-1 gene or DSCR-1 protein.

Description

  The present invention relates to a therapeutic and prophylactic agent for cancer.

  Cancer deaths are increasing year by year, and many compounds are being treated, but there are still no specific drugs for cancer. The onset mechanism of cancer is being elucidated by molecular biological methods, and new anticancer agents are awaited.

  DSCR-1 is an abbreviation for DOWN SYNDROME CRITICAL REGION 1, which is MCIP1 (MYOCYTE-ENRICHED CALCINEURIN-INTERACTING PROTEIN), CSP1 (CALCIPRESSIN), and MODULATERIN CALLINERIN.

Cancer is a disease with abnormal cell growth. It is known that abnormal growth of cells involves angiogenesis, arrest of apoptosis, and abnormal cell cycle. However, there are few reports that DSCR-1 is involved in these phenomena, but there is only a report that FASL is induced in Th1 cells in DSCR-1 gene-deficient mice, leading to cell death (Non-patent Document 1). ). This is cell death due to DSCR-1 deficiency, and is the reverse phenomenon that the present invention is aimed at suppressing abnormal growth of cancer cells due to enhancement of DSCR-1.
Nature Immun. 2003, 4: 874-881

  An object of the present invention is to provide a therapeutic and prophylactic agent for cancer having a new mechanism of action.

  Therefore, the present inventor has examined various effects on DSCR-1, and surprisingly, DSCR-1 has an anti-angiogenic effect, an inhibitory effect on cell migration, an inhibitory action on cell adhesion, and a cell cycle arrest. It was found that there is an effect. Furthermore, as a result of examining the influence of xenograft on the growth of transplanted cancer cells, the suppression of the growth of transplanted cancer cells was confirmed, and a substance that enhances the expression of DSCR-1 protein, DSCR-1 gene or DSCR-1 protein is used for cancer treatment and It was found useful as a preventive drug.

That is, the present invention provides a therapeutic and prophylactic agent for cancer comprising as an active ingredient a substance that enhances the expression of DSCR-1 protein, DSCR-1 gene or DSCR-1 protein.
The present invention also provides a method for treating or preventing cancer, comprising administering a substance that enhances DSCR-1 protein, DSCR-1 gene or DSCR-1 protein expression.
The present invention also provides use of a substance that enhances DSCR-1 protein, DSCR-1 gene or DSCR-1 protein expression for the manufacture of a therapeutic / preventive drug for cancer.

  The anticancer agent of the present invention is an anticancer agent that exhibits multifunctionality, that is, inhibition of angiogenesis, inhibition of cell migration, inhibition of cell adhesion, and cell inflammation as well as suppression of inflammation as compared with conventional anticancer agents.

It is a figure which shows the examination result by RT-PCR of the angiogenesis induction | guidance | derivation / growth stimulating factor and inflammation-inducible gene expression suppression by DSCR-1. It is a figure which shows the influence of DSCR-1 with respect to lumen formation ability. It is a figure which shows examination of the influence on the cell migration ability of DSCR-1. It is a figure which shows the influence of DSCR-1 which gives to recovery of a cell wound. It is a figure which shows the state of the cell 10 days after a cell wound. It is a figure which shows examination of G1 (G0) suppression effect by DSCR-1 expression analyzed by FACS. It is a figure which shows observation of a hematoxylin & eosin dyeing | staining specimen. It is a figure which shows the influence on the hemoglobin content in a matrigel plug. It is a figure which shows examination of the tumor inhibitory effect of DSCR-1. It is a schematic diagram of a DSCR-1 gene structure. It is a figure which shows the riboprobe sequence for specifying the isoform induced by HUVEC. It is a figure which shows the result of an RNase protection assay. It is a figure which shows the result of RT-PCR using a DSCR-1 (exon 1567) specific PCR primer. It is a figure which shows DSCR-1 gene expression enhancement by TRAP. It is the figure which showed the examination result of the inhibition by DSCR-1 in the adhesion | attachment to the vascular endothelial cell of a lymphoma origin cell line. It is the figure which showed the examination result of the inhibition by DSCR-1 in the adhesion | attachment to the vascular endothelial cell of a lymphoma origin cell line. It is the figure which showed the examination result of the inhibition by DSCR-1 in the adhesion | attachment to the vascular endothelial cell of a lymphoma origin cell line.

Hereinafter, the present invention will be described in detail.
Construction of a DSCR-1 gene expression system can be performed as follows.
The full-length cDNA of DSCR-1 is generally obtained by RT-PCR from total RNA of cell lines such as HUVEC whose expression is enhanced by thrombin stimulation and cell lines such as HepG2 that is expressed in a steady state. Can be incorporated into cloning vectors used in In order to express the DSCR-1 protein in Escherichia coli, animal cells, insect cells, yeast, etc., the full-length cDNA of DSCR-1 can be incorporated into a known expression vector suitable for expression in each host. Moreover, not only a plasmid but the virus generally used for gene expression, such as a retrovirus vector, an adenovirus vector, an adeno-associated virus vector, a herpes simplex virus vector, a vaccinia virus vector, can also be used. As a promoter for expressing DSCR-1, a commonly used promoter such as CMV corresponding to the host can be used. In addition, when a gene is introduced into the human body, side effects can be suppressed by using a promoter that works specifically for cancer cells or a promoter that can induce expression under certain conditions. When purifying proteins, tags such as GST, HA, FLAG, and His can be added for the purpose of efficient purification. In order to identify DSCR-1 protein-expressing cells, the GFP protein can be co-expressed using an expression vector such as pIRES-EGFP (Clontech). In order to simplify the purification, a signal peptide can be added to the DSCR-1 protein and secreted outside the cell, and the DSCR-1 protein can be recovered in the medium. The constructed DSCR-1 expression vector can be expressed in an animal cell such as Escherichia coli, CHO, COS-7, insect cell such as Sf-9, or a host generally used for expression of a recombinant protein such as yeast. I can do it. It can also be expressed in human cancer cells for the treatment and prevention of cancer cells.

The DSCR-1 protein can be obtained, for example, by the following method.
The forced expression cell line can be cultured by a known general method to obtain a culture containing DSCR-1 protein. In the case of viruses, a culture containing DSCR-1 protein can be obtained by infecting known host cells. In addition, cultures containing DSCR-1 protein can be similarly obtained from other known organisms commonly used for recombinant protein expression, such as Escherichia coli and yeast. Furthermore, cell lines such as HepG2 that naturally express DSCR-1 and cell lines such as HUVEC that enhance natural DSCR-1 expression after thrombin stimulation are similarly cultured by a known culture method. A culture containing DSCR-1 protein can be obtained.

  Purification of DSCR-1 protein from cultures containing DSCR-1 protein by cation / anion exchange chromatography, gel filtration chromatography, affinity chromatography, chelate chromatography, etc. can do.

A substance for enhancing DSCR-1 production can be screened, for example, by the following method.
As a method for measuring DSCR-1 gene expression and protein expression, methods well known by those skilled in the art are used. Specifically, using DSCR-1-expressing tissues, cell lines and DSCR-1 forced expression cells, adding a screening compound and culturing, and measuring the amount of DSCR-1 gene or protein by a known method, It can screen by comparing with the quantity at the time of addition.
For the measurement of gene amount, methods commonly used by those skilled in the art, such as RT-PCR and quantitative PCR after gene extraction, can be used. As a method for measuring the amount of DSCR-1 protein, a known method such as ELISA can be used.
In addition, a commonly used reporter gene assay can also be used for screening for substances that improve the expression of the DSCR-1 gene. A general method is to prepare a vector in which the promoter region of the DSCR-1 gene is connected upstream of the cDNA of a marker protein such as luciferase, galactosidase or GFP, and this vector is transfected into animal cells by a general method. To do. The compound of interest can be screened by adding the screening compound to the transfected cells, culturing, and detecting the marker protein by a method suitable for each cell.
Substances that enhance DSCR-1 protein, DSCR-1 gene and DSCR-1 protein expression obtained as described above are angiogenesis inhibitory action, cell migration inhibitory action, cell adhesion inhibitory action, cell cycle arresting action, It has an inhibitory effect on the growth of cancer cells and is useful as a therapeutic and prophylactic agent for various cancers.

  In order to examine the ability of DSCR-1 to inhibit angiogenesis, there are a tube formation assay using HUVEC and an angiogenesis measurement method using chicken egg, cornea, avian chorioallantoic membrane, rabbit, mouse, and rat cornea. As a general method, HUVEC is seeded on a collagen gel or matrigel and bound to a carrier such as polylysine, polyarginine, HIV-Tat, HSV VP22 for promoting the transfer of DSCR-1 protein into cells. In addition to the medium, the formation of the lumen after the culture is observed under a microscope. In addition, as a method for examining the effect when the DSCR-1 gene is introduced, the ability to form a capillary network and a tube can be examined using the gene-introduced HUVEC. In addition, carriers containing DSCR-1 are injected into the corneas of chicken eggs, corneas, avian chorioallantoic membranes, rabbits, mice, and rats, or DSCR-1 gene is introduced, and subsequent angiogenesis is observed. Thus, the ability to suppress DSCR-1 angiogenesis can be examined.

  The cell cycle arrest is evaluated using a known method. That is, in order to promote the transfer of DSCR-1 protein into cells, cells cultured in a medium added with a combination of polylysine, polyarginine, HIV-Tat, HSV VP22, etc., or a substance to be evaluated are expressed. The collected cells are collected by a general method and stained with a fluorescent dye that binds to DNA such as propidium iodide. After that, the state of the cell in the cell cycle can be estimated by measuring the fluorescence amount of the cell by FACS or the like. In addition, as a method for examining the effect when the DSCR-1 gene is introduced, the effect can be examined using a cell into which the gene has been introduced. This can confirm whether the cell cycle is stopped.

  A known method can be used to evaluate the suppression of cell adhesion. That is, an adhesion factor is expressed on the cell surface by stimulating vascular endothelial cells adhering to a culture container using cytokines, thrombin, etc. as various cell stimulants. Next, the cells are mixed and cultured with cells such as THP-1, U-937, which are suspension monocyte cells. After washing non-adherent cells, the number of adherent cells is counted. In order to evaluate the cell adhesion inhibitory effect of a drug, it can be determined by comparison with no drug addition.

As a general method of examining the growth inhibition of cancer cells, a cancer cell line such as B16 melanoma cells is transplanted into a mouse, and when the tumor size reaches a certain size (about 50 mm ³ ), a drug or gene is contained in the tumor. The virus, cells, and plasmid vectors capable of expressing the substance to be evaluated are administered intravenously or orally. Thereafter, the tumor suppressor effect can be determined by measuring the size of the tumor over time with a caliper.

  There are no particular limitations on the cancer that is the target of the therapeutic and prophylactic agent for cancer of the present invention, but melanoma, liver cancer, lung cancer, colon cancer, rectal cancer, gastric cancer, pancreatic cancer, breast cancer, uterine cancer, prostate cancer, leukemia, lymphoma, etc. Can be mentioned.

Administration of DSCR-1 protein binds to a carrier such as polylysine, polyarginine, HIV-Tat, HSV VP22, etc. in order to promote migration into the target cell, and dissolves in an appropriate solution such as physiological saline. .1-100 mg / person can be administered intravenously.
Administration of the DSCR-1 gene is performed by a general method known to those skilled in the art. A general method is a retrovirus vector, adenovirus vector, adeno-associated virus vector, herpes simplex virus vector, vaccinia virus vector, etc., in which DSCR-1 cDNA is incorporated, together with a general carrier for retaining directly or locally, Can be administered into tumors. In addition, as a gene introduction method without using a virus, a plasmid vector capable of expressing DSCR-1 can be introduced using a liposome, gene gun, polylysine or the like.

  Hereinafter, the present invention will be described specifically by way of examples. However, the present invention is not limited to these examples.

Example 1 Cloning of Human DSCR-1 cDNA Full-length cDNA encoding human DSCR-1 (exon 4-7) was obtained by using 1st strand cDNA prepared using Superscript (Invitrogen, Cat No. 11904-018) from 5 ug of HUVEC total RNA. Amplification was performed by PCR reaction using Ex-Taq (Takara, Cat No. RR001A) as a template, 2 μL of HUVEC-derived cDNA, 50 pmol of sense primer (SEQ ID NO: 3), antisense primer (SEQ ID NO: 4). ) 5 μl of 10 × Ex-Taq buffer, 50 μL of a reaction solution containing 4 μL of dNTP mix (2.5 mM etch), 2.5 Units of Ex-Taq DNA polymerase, A cycle consisting of 1 minute, 62 ° C., 1 minute, 72 ° C. and 3 minutes was performed 30 times, and the amplification product by PCR reaction was (pGEM-T Easy Vector System I (Promega Cat. No. A1360)). As a result of sequence confirmation using the ABI3100 DNA sequencer (inserted into the TA vector pGEM-T easy), a cDNA encoding human full-length DSCR-1 (exon 4-7) was isolated and represented by SEQ ID NO: 1. The sequence shown is the base sequence of human DSCR-1 gene, and the sequence represented by SEQ ID NO: 2 is the amino acid sequence of human DSCR-1 protein.

Sequence number 3: AAGGAACCTACAGCCCTCTTGGAAAGG
Sequence number 4: TTGGAATGCGTCCCTCGTCCGTGCCAG

Example 2 Production of adeno-DSCR-1 DSCR-1 full-length cDNA was obtained from HUVEC total RNA by RT-PCR and then subcloned into pIRES-EGFP (Clontech). A DSCR-1 expression construct was constructed by excising the DSCR-1-IRES-EGFP sequence and incorporating it into a pAdeno vector (Clontech) having a CMV promoter. The DSCR-1-expressing adenovirus was obtained by infection and amplification of HEK-293 cells.

Example 5 HUVEC DNA Microarray Analysis with Thrombin Stimulation Subconfluent HUVECs were treated overnight in 0.5% FBS, EBM-2 basal medium, followed by addition of 1.5 units / mL thrombin. Total RNA was purified using Trizol. Production of cRNA and hybridization to Affimetrix Human Focus Array were performed based on the Affimetrix protocol. Using two types of HUVEC Badges, gene variation due to thrombin stimulation after 1, 4 and 18 hours was observed twice. Table 1 shows the results of the HUVEC DNA microarray with thrombin stimulation. The genes that are most induced to be induced by thrombin stimulation are shown from the top to the fifth. DSCR-1 was shown as the most induced gene in thrombin stimulation.

Table 2 is Affimetrix microarray data using the DSCR-1 probe.
DSCR-1 is an early induction gene that peaks at 1 hour after thrombin stimulation.

  Tables 3 to 5 show the results of comprehensive analysis of gene variation for 1 hour of HUVEC thrombin stimulation under the constitutive expression of DSCR-1. The total data obtained was classified into three. (1) Genes induced by thrombin stimulation on HUVEC of adeno-control infection at least 2-fold, but the induction decreased at least 2-fold by the presence of DSCR-1: 25 genes out of a total of 8974 genes were obtained. Seven of them were related to cell proliferation and angiogenesis, and 8 genes were related to inflammation. Regarding the other 10 genes, serine threonine kinases and transcription factors that were contrary to the anti-angiogenic and anti-inflammatory effects of DSCR-1 were not extracted. (2) Genes that were suppressed by thrombin stimulation at least twice on HUVEC of adeno-control infection, but whose induction was restored at least twice by the presence of DSCR-1: 7 genes were obtained. In this, p21 and p27 which are cell cycle brakes were obtained. (3) Genes induced by thrombin stimulation more than twice on HUVEC of adeno-control infection, but their expression was further induced by the presence of DSCR-1 (high expression): 7 genes were obtained. Among these, ADAMTS1 that induces a potent anti-angiogenic effect was also included.

Example 6 Examination by RT-PCR of Thrombin Stimulation-Induced Angiogenesis Induction / Growth Stimulating Factor and Pro-inflammatory Gene Expression by DSCR-1 4) Results of RT-PCR based on RNA of adeno-DSCR-1 infected thrombin stimulated for 1 hour (lane 5) and adeno-DSCR-1 infected unstimulated (lane 6) (FIG. 1). Cyclophilin A was used as an endogenous control. PCR primers and cycle numbers are shown below.
Tissue factor (22 cycles), forward 5'-TCAGAGTTTTGAACAGGTGGGAACA-3 '(SEQ ID NO: 5) and reverse 5'-TTCTCCTGGCCCATACACTCTACCCG-3' (SEQ ID NO: 6); E-selectin (22 cycles), forward 5'-CATGTGGAGCCACAGGACACTGTCT '(SEQ ID NO: 7) and reverse 5'-TCTGATTCAAGGCTTTGGCAGCTGCTG-3' (SEQ ID NO: 8); Angiopoietin-2 (20 cycles), Forward 5'-ACAAATGTATTGCAAATGTCACAAA-3 '(SEQ ID NO: 9) and Reverse 5'-GAAATCTGTCTGTCTG '(SEQ ID NO: 10); PlGF (20 cycles) Forward 5′-CCGGGTCATGAGGCTGTCCCTTGC-3 ′ (SEQ ID NO: 11) and reverse 5′-CTCGCTGGGGTACCTGGACACGAC-3 ′ (SEQ ID NO: 12); p27 (26 cycles), forward 5′-CGGCAGGAATAAGGAAGCGACCCTGC-3 ′ (SEQ ID NO: 13) '-CGTTTGACCGTCTTCTGAGGCCAGGCTT-3' (SEQ ID NO: 14); p21 (18 cycles), forward 5'-AGCAAGGCCTGCCCGCCGCCCTCTTC-3 '(SEQ ID NO: 15) and reverse 5'-TGACAGGTCCACCATGGTCTCTCTC-3' (SEQ ID NO: 16); ADAMTS1 ), Forward 5'-AGCTTTCTTGCCATCAAAGCTGC T-3 '(SEQ ID NO: 17) and reverse 5'-AACCTGGATGGTCAAGGGCTCTTT-3' (SEQ ID NO: 18); IL-8 (23 cycles), forward 5'-TGTCAGTGCATAAAGACATACTCCCA-3 '(SEQ ID NO: 19) and reverse 5'- CTCTCTCCACAACCCTCTGCACCCAG-3 ′ (SEQ ID NO: 20); ICAM-1 (23 cycles), forward 5′-GTGCAAGAGATAGAGCACAACCAATG-3 ′ (SEQ ID NO: 21) and reverse 5′-AGGAGTCGTTGCCATAGGTGACTG-3 ′ (SEQ ID NO: 22); 23 cycles), forward 5′-TTCGTGCTCTGAGCACTGGGAGA-3 ′ (SEQ ID NO: 23) and reverse 5′-GAGCCCGT TGCTTTAGGATGAAG-3 '(SEQ ID NO: 24).

Example 7 Effect of DSCR-1 on Luminogenic Ability HUVECs were infected with adeno-control and adeno-DSCR-1 at MOI = 20 and the HUVECs were gel treated dishes (24 wells with EGM-2 MV media (Clonetics) 400 μl of type I collagen containing (without bFGF) was added and gelled at 37 ° C.) and seeded at a rate of 1 × 10 ⁵ cells / dish. After 24 hours, 400 μL of type I collagen was further placed on HUVEC. After 24 hours, the capillary network and the ability to form a lumen were observed under a microscope. The luminal area was quantified using NIH images. FIG. 2 shows the result. (A, d) is a bright portion × 40 enlarged view, (b, e) is a fluorescent portion × 40 enlarged view, and (c, f) is a fluorescent portion × 100 enlarged view. The amount of EGFP was the same in both the upper and lower sides (the infection efficiency of adenovirus was the same), whereas the lumen forming ability was decreased by DSCR-1 expression.

Example 8 Examination of the effect of DSCR-1 on cell migration ability HUVEC was infected with adeno-control, adeno-DSCR-1, or adeno-DSCR-1 plus adeno-CANFAT at MOI = 40, and 24 hours later. The center of the HUVEC was scratched with a pipette. One and two days later, the level of cell migration was observed under a microscope and quantified by NIH image. Alternatively, cells infected with HUVEC, cultured in 0.5% FBS, EBM-2 medium, and migrated in the presence of thrombin for 4 hours were measured by the Boyden chamber method. HSCRECs with high expression of DSCR-1 have reduced levels of wound healing compared to controls, and the lack thereof was recovered by co-infection with adeno-CA-NF-AT. In addition, Adeno-control-infected HUVEC exceeded post-confluence and cells began to peel from the dish, whereas adeno-DSCR-1-infected HUVEC remained quiescent (arrows) without complete removal of the wound (arrow). 3, FIG. 4 and FIG. 5 (A, B)).

Example 9 Examination of G1 (G0) inhibitory effect by DSCR-1 expression analyzed by FACS Subconfluent HUVECs are infected with adeno-control or adeno-DSCR-1, and the cell cycle of the cells is measured for propidium iodide content Was identified. In control HUVEC, 67.2% were in the G0 / G1 phase, 17.7% were in the S phase, and 15.1% were in the G2 / M phase, whereas in HUVEC overexpressing DSCR-1, 90.5 % Was G0 / G1 period, 1.4% was S period, and 8.1% was G2 / M period. Similar results were obtained with 50% confluent HUVEC (FIG. 6).

Example 10 Observation of Hematoxylin & Eosin Stained Sample A large number of capillary migration was detected in Adeno-control, whereas it was significantly suppressed in adeno-DSCR-1 (FIGS. 7 and 8).

Example 11 Examination of Tumor Suppressive Effect of DSCR-1 Logarithmically growing B16 melanoma cells 1 × 10 ⁶ were subcutaneously administered as xenografts to 8-week-old C57 / BL6 mice. When the tumor size reached 50 mm ³ , 5 × 10 ⁹ pfu of adeno-control or adeno-DSCR-1 was administered into the tumor, and then the tumor size was measured with a caliper over time. The Adeno-DSCR-1 administration group was 9.1 times after 4 days, 7.7 times after 6 days, and 7.4 times after 8 days (both P <0.04) compared to the adeno-control administration group An inhibitory effect was observed (FIG. 9).

Example 12 Method for Measuring DSCR-1 Gene Expression Level FIG. 10 is a schematic diagram of the human DSCR-1 gene structure. The mRNA is composed of four alternative first exons (box 1 to 4) and three common exons (box 5 to 7). Shown are the two major isoforms DSCR-1 (exon 4-7) and DSCR-1 (exon 1567). FIG. 11 shows the riboprobe sequence to identify the isoforms that are induced to express in HUVEC. ing. FIG. 12 shows the results of the RNase protection assay. 10 μg yeast RNA (lane 2), 10 μg total RNA untreated HUVEC (lane 3), thrombin treatment (lane 7-9), TNF-α treatment (lane 10-12). The band indicated by the arrow is an isoform consisting of DSCR-1 (exon 4-7). On the other hand, an expression product consisting of DSCR-1 (exon 1567) was not detected by the RNase protection assay (* in the figure). GAPDH is an endogenous control of the amount of RNA loaded. It was revealed by an RNase protection assay using an exon 4-7-specific riboprobe that expression of the DSCR-1 (composed of exons 4-7) gene was induced early. FIG. 13 shows the results of RT-PCR using DSCR-1 (exon 1567) -specific PCR primers. The expression was detected at the 40th amplification cycle, but no change was observed in the expression by thrombin or TNF-α stimulation. By adding 10 pmol and 50 pmol (B, lanes 8 and 9) of TRAP, which is a PAR-1 selective agonist, in the same manner, strong induction similar to that of addition of thrombin was observed (FIG. 14).

It is well known that DSCR-1 inhibits NF-AT by inhibiting calcineurin (Ca ²⁺ / calmodulin dependent phosphatase) (Hum. Molec. Genet. 2000, 9: 1681-1690). However, not all signals of DSCR-1 are transmitted through the calcineurin-NF-AT pathway, but increased expression of ADAMTS1 that induces an anti-angiogenic effect of p21 and p27, which act as a cell cycle brake, is another transmission. It was inferred by this test that it originated from the route.

The relationship between calcineurin and abnormal cell growth (1) angiogenesis, (2) apoptosis and (3) cell cycle is as follows.
(1) Angiogenesis: There is no report that calcineurin is involved in angiogenesis.
(2) Apoptosis: There are many reports that calcineurin induces apoptosis (Clin Cancer Res., 1998, 4 (12): 2967-76, Science, 1999, 284 (5412): 339-43, J Biol Chem). , 1999, 274 (48): 34450-8, J Neurosci., 2000, 20 (19): 7426-51, J Biol Chem., 2000, 275 (44): 34528-33). This means that calcineurin inhibition leads to increased abnormal cell proliferation. However, as described above, it is well known that DSCR-1 inhibits calcineurin, and possibly DSCR-1 suppresses apoptosis other than via calcineurin.
(3) Cell cycle: Cyclinporin A, a calcineurin inhibitor, suppresses the expression of cyclins A and E by FGF (Arch Biochem Biophys. 1998, 353 (2): 374-8). On the other hand, since cyclosporin A promotes cdk4 kinase activity, which is a reverse phenomenon to the cell cycle (Oncogene. 2000, 19 (24): 2820-7), inhibition of calcineurin does not necessarily suppress the cell cycle. Is not limited.

  Therefore, it is presumed that the involvement of calcineurin through the suppression of abnormal growth of cancer cells by DSCR-1 is very thin.

Example 13 Inhibition by DSCR-1 in Adhesion of Lymphoma-Derived Cell Lines to Vascular Endothelial Cells Cell adhesion is an important phenomenon in cancer metastasis. On the other hand, although an inflammation image can be confirmed in cancer tissue, it goes without saying that cell adhesion in the field of inflammation is an important phenomenon. In order to clarify the involvement of DSCR-1 in cell adhesion, the following examination was performed.
That is, 1 × 10 ⁵ cells / well was seeded on 24 well plate with HUVEC, and 6 hours later, Ad-Control, Ad-DSCR-1, Ad-CA-NFAT, and Ad-IκBα were infected at MOI = 40. After 48 hours, the cell culture medium was replaced with serum-started media (EBM-2 plus 0.5% FBS) (Clonetics), and after an overnight culture, thrombin (2 units / ml) (Calbiochem) or PBS was added. Stimulated for 6 hours. HUVEC was washed with RPMI-1640 plus 1% FBS (Iwaki), and a lymphoma-derived cell line U-937 cell red-labeled with PKH-26 (Sigma) was added under conditions of 7.5 × 10 ⁵ cells / well. Allowed to stand for 5 hours. Thereafter, unadhered U-937 cells were washed away twice with HBSS (Invitrogen), and the adhered U-937 cells were observed with a microscope under transmitted light and fluorescence.
Adherent U-937 was quantified using NIH image to calculate the amount of fluorescence present from at least four independent fields.
In HUVEC infected with Ad-Control, the adhesion of U-937 cells increased 6-fold with thrombi stimulation, whereas in Ad-DSCR-1-infected HUVEC, the adhesion of U-937 cells with thrombi stimulation was 2. 5 times, which is about 58% lower than that of Ad-control (FIGS. 15 and 17). Although this reduction effect is less than 77% suppression in the presence of Ad-CA-IκBα, it was revealed that monocyte adhesion can be significantly suppressed by constitutive expression of DSCR-1. The data also suggests that constitutive expression of NF-AT, the main target-inhibiting transcription factor of DSCR-1, is always in monocyte adhesion and inflammation, even without thrombostimulation (Figure 16 and FIG. 17), DSCR-1 was presumed to be effective in cancer metastasis and inflammation inhibition.

  Cancer deaths increase year by year, and many compounds are being treated, but there are still no specific drugs for cancer. The pathogenesis of cancer is being elucidated by molecular biological methods, and new anticancer drugs are awaited. In vitro, DSCR-1 was confirmed to inhibit cell migration, inhibit cell adhesion, arrest cell growth and inhibit capillary formation, and inhibit in vivo proliferation of transplanted cancer cells by xenograft. Furthermore, since suppression of inflammation based on inhibition of calcineurin is also conceivable, it is considered that the present invention can provide a cancer suppression and therapeutic agent based on a novel mechanism of action.

Claims (7)

  A therapeutic or prophylactic agent for cancer comprising as an active ingredient a substance that enhances the expression of DSCR-1 protein, DSCR-1 gene or DSCR-1 protein.   The therapeutic / preventive agent for cancer according to claim 1, which suppresses angiogenesis, suppresses cell migration, suppresses cell adhesion, or stops the cell cycle.   The cancer therapeutic / preventive agent according to claim 1, wherein the cancer is selected from the group consisting of melanoma, liver cancer, lung cancer, colon cancer, rectal cancer, gastric cancer, pancreatic cancer, breast cancer, uterine cancer, prostate cancer, leukemia and lymphoma.   A method for treating or preventing cancer, comprising administering a substance that enhances DSCR-1 protein, DSCR-1 gene, or DSCR-1 protein expression.   The method for treating or preventing cancer according to claim 4, which comprises inhibiting angiogenesis, inhibiting cell migration, inhibiting cell adhesion or arresting the cell cycle.   The method for treating or preventing cancer according to claim 4, wherein the cancer is selected from the group consisting of melanoma, liver cancer, lung cancer, colon cancer, rectal cancer, gastric cancer, pancreatic cancer, breast cancer, uterine cancer, prostate cancer, leukemia and lymphoma.   Use of a substance that enhances the expression of DSCR-1 protein, DSCR-1 gene or DSCR-1 protein for the manufacture of a therapeutic / preventive agent for cancer.

Images