JPS6336795A - Novel amino acid sequence and nucleic acid base sequence - Google Patents

Abstract

PURPOSE:To use an amino acid sequence as a unit to obtain an antibody light chain, by forming the amino acid sequence in a versatile region of light chain in a mouse hybridoma forming a common antigen antibody of anti-human acute leukemic lymphoma. CONSTITUTION:An amino acid sequence in a versatile region of light chain in a mouse hybridoma producing a common antigen antibody of anti-human acute leukemic lymphoma and a nucleic acid base sequence to code the amino acid sequence are formed. Since the novel amino acid sequence is a versatile region of light chain in a mouse hybridoma, the amino acid sequence is usable as a unit to obtain an antibody light chain bonded to an amino acid sequence in a constant region of a certain type of light chain or a unit to obtain a complete antibody wherein the antibody light chain is bonded to a certain type of heavy chain.

Description

DETAILED DESCRIPTION OF THE INVENTION a. Field of Industrial Application The present invention relates to a 117-order amino acid sequence and a nucleobase sequence encoding the same. More specifically, it relates to the amino acid sequence of the V region of the L chain in a mouse hybridoma producing an anti-human acute leukemia/lymphoma common antigen antibody and the nucleobase sequence encoding the same.

As used herein, amino acids, polypeptides, IUPA
It shall be abbreviated according to the method adopted by the C-ItlB Biochemistry Committee (CBN), for example, the following abbreviations are used.

Ala L-alanine Arg L-arginine Asn L-asparagine octaso L-aspartic acid Cys L-cysteine Gln L-glutamine Glu L-glutamic acid G+y Glycine His L-hisdecine 11e L-isoleucine Leu L-leucine Lys l-lysine) let L-methionine Phe L-phenylalanine Pro L-proline Ser L-serine Thr L-threonine rrp Li-lyptophan Tyr c--Tyrosine Val L-valine Also, the sequence of DNA is divided into each deoxyribonucleotide that makes up the DNA. It shall be abbreviated by the type of base contained,
For example, use the following abbreviations.

A Adenine (Deoxyadenylic acid) C Cytosine (Deoxysibutylic acid) G Guanine (Deoxyguanylic acid) T Thymine (Deoxythymidylic acid) b, Prior art In general, immunoglobulin genes are , [(Chain(HeaV11
/Chain) and L chain (Light Chain), each of which has a V region (variable region) with the function of specifically binding to an antigen and a C region (constant region) with effector function. .

On the other hand, regarding the -1 chain and L chain genes in mouse antibodies, various gene units included in both regions of the ■ region and the C region, as well as promoters.

The existence of units with various functions such as enhancers has been revealed, and the DNA sequences of some of them have also been revealed.

However, the structure of the gene in the V region, which determines the antigen-binding specificity of the tail chain of antibodies produced by mouse hybridomas having specificity for the human acute leukemia-lymphoma common antigen, is not yet known.

Therefore, the present inventors conducted research on the tail chains of antibodies produced by mouse hybridomas that have specificity for human acute leukemia-lymphoma common antigens. The present invention was achieved by being able to obtain 1q of the gene and the protein of the region (■) of its antibody.

That is, according to the present invention, in the amino acid sequence shown in the attached FIG. ) and the first G.I.
A sequence of 109 amino acids from LI to the 109th Arg (hereinafter sometimes abbreviated as ``V-J-amino acid sequence'') is provided.

In the amino acid sequence of the present invention, the first position (Gl
The sequence from position u) to position 97 (LetJ) is the amino acid sequence of the V region of the chain in a mouse hybridoma that produces anti-human acute leukemia lymphoma common antigen antibody, and from position 1 (Glu) to position 109 th (Arg)
The sequences up to this point are the amino acid sequences of the ■ region and J region of the same chain. Therefore, from the 98th ('rhr) to the 109th [
+(Ar(]) means the amino acid sequence of the J region of the same chain.

Further, according to the present invention, a nucleobase sequence encoding the "V-amino acid sequence" (hereinafter referred to as "V-DNA
'') and the nucleobase sequence encoding the ``V-J-amino acid sequence'' (hereinafter referred to as ``V-J-amino acid sequence'').
-J-DNA") is provided.

Such V-DNA is shown in item 5791 (G) in FIG.
) to No. 869 (C), and as V-J-DNA, No. 51 in FIG.
It can be the DNA sequence from the 9th (G) to the 905th (T).In Figure 2, the DNA sequence from the 870th (A) to the 905th (T) is J.
-It encodes an amino acid sequence.

Furthermore, V-DNA or V-J-DNA in the present invention
In the DNA sequence shown in Fig. 2, the DNA sequence containing 562nd (T) to 905th
It can be up to the 340th (A>) to the 905th (-[), and it can be the 2nd
It can be from the 30th (-r) to the 905th (T).

Thus, since the novel amino acid sequence of the present invention is the sequence of the V region of the protein chain in a mouse hybridoma that produces anti-Human 1 to acute leukemia lymphoma common antigen antibodies, it is the amino acid sequence of the C region of the species protein chain. The antibody chain can be used as a unit for binding the antibody and the chain can also be used as an intermediate to obtain a complete antibody combined with the chain of the species consisting of the antibody chain.

The present invention will be described in detail below with reference to Examples.

Example 1 (Isolation of mouse chromosomal DNA) Mouse hybridoma N1--11X108 pieces were collected at 1%3[)3
(Sodium 1 auryl 5 ulfate) was treated with Proteapi K (Sigma Inc. ¥1), water-saturated phenol was added to extract the DNA, the aqueous phase was separated by centrifugation, 10 m)l Tris-) 1 G, pH 7
,4,1,0m)l NaC5! , 0.1mM E
Dialysis was performed with DTA (-rNE) buffer. After treatment with ribonuclease A (Sigma) and phenol extraction again, 1.2 mg of mouse chromosomal DNA was obtained by dialysis with TNE buffer [N, brine, D.

W, Stafford: Nucleitsk Acid Research 312303 pages (I976) (N, B11n,
D.W.

5tafford: Nucleic Ac1ds
Res., 3 2303 (I976))].

Example 2 (Creation of mouse gene library) Example 1
150 μq of mouse chromosomal DNA obtained in
After digestion with d■ (Takara Shuzo), sucrose density gradient centrifugation [sucrose 10-40% (Wt/vol), 28000r, p
, m, x 15 hours, 20'C] and 4Kb
A DNA fragment corresponding to ~9 Kb was obtained.

Next, 0.45 μg of this DNA fragment and Charon 28
Ligation with the II and III arms of vector DNA (Bethesda Research Laboratories) was performed, and then in vitro using a kit from Amerjam.
tro packaging was performed to obtain a mouse NL-1m Buddha library of 4x106 PFtJ/μq.

For ligation, T4 DNA ligase (Takara Shuzo) was used, and the reaction mixture was 66ml) Tris HC! 2 (pH7,6)-6
, 6m) IHgC92-1011M dithiothreitol-1mHA-rP aqueous solution at 4°C for 16 hours.

Example 3 (Screening for genes linked to mouse immunoglobulin) DNA derived from mouse NL-1 obtained in Example 2 above
Charon 28 phage containing E. coli 11392
strain, and plaque hybridization method [W
, D., Benton, R.W., Davis: Science 196.
Volume 180 page (I977) W, 0.8entOn,
R, W, 0avis: 5CienCe 1961s
.

(I977))] was used to select 32P-labeled mouse antibodies using the chain J gene. DNA from Charon 28 phage containing mouse immunoglobulin chain genes was prepared by the method of Thomas and Davis. CM
, Thomas, R.W., Davis: Journal of Molecular Biology, Volume 91, Page 315 (I
974) ()f, Thomas, R.

W, Davis: J, )lol, Biol,...
91315 (I974) Reference 1 Example 4 (Creation of restriction enzyme cleavage map of mouse chain IJA gene) Phage D containing the mouse chain gene obtained in Example 3
NA, and 1μ9 of the DNA recloned into a plasmid according to Example 5 below, in a restriction enzyme cleavage buffer [XbaI, 50ml for egl m cutting] l Tri
sHG (Dt17.4) -100mHNaC9
-10mH) fg3Q4 aqueous solution, Bam111°tl
indl, Pst Eng, HincI [, Dra I
For cutting, 10mM Tris HG (pH 17°5)
-60m)l Na G -7n+HH(]C2
z aqueous solutions were used respectively. ] Dissolved in 20 μl of water, restriction enzyme (R3a ① manufactured by Nirabon Gene).

Others were made by Takara Shuzo) and added 2 units to 37
Digestion was carried out at ℃ for over 1 hour.

After cleavage with restriction enzymes, 4 μl of 0.25% bromophenol blue/50% glycerol aqueous solution was added.
8% to 2.5% agarose gel electrophoresis was performed. The agarose used was Sigma's type ■ for electrophoresis.

As electrophoresis buffer, 50 mHIr1s-acetic acid 8
0n+t4 Sodium acetate - 72mM salt or sodium 1
Electrophoresis was performed on a 5 mm ice thick gel at a voltage of 2 V/cm for 9 to 16 hours using iEDTA.

During this electrophoresis, λ phage DNA digested with tlind■ (manufactured by Chinoku Nippon Gene) was used as a molecular marker for the DNAI #7 piece. After electrophoresis, the DNA in the agarose gel was stained with a 2μ (J/ml) ethidium bromide aqueous solution, and the gel was irradiated with long wavelength ultraviolet rays to observe the cutting pattern.

The relative positional relationship of each restriction enzyme cleavage point was determined by analyzing the cleavage patterns of cleavage by each restriction enzyme alone and by a combination of two types of restriction enzymes.

A restriction enzyme cleavage map of the mouse immunoglobulin chain gene fragment is shown in FIG. Dra ■, Hincl [, R
There are other sai cut points other than those shown.

Example 5 (Rib cloning of chain V-J region gene into mouse immunoglobulin) Ch containing chain VJfI region gene in mouse immunoglobulin
Aron 28 phage DNA was added to the method of Example 4.
It was cut with rf and tlindl and subjected to agarose gel electrophoresis. 6.5k containing genes in V-J
The DNA fragment b was recovered from the agarose gel using the electro-elution method. On the other hand, plasmid pBR3221μQ for E. coli was tlin in accordance with Example 4.
For those cut with dI [I, alkaline phosphatase (E, coli C75) (Takara Shuzo f!A) was added to 0
．． 5 units were added and reacted at 68°C for 1 hour. After the reaction was completed, phenol extraction was repeated three times in order to deactivate and remove alkaline phosphatase in the reaction solution. In this way (Hir + dll of p8R322
r/alkaline phosphatamine treatment solution was mixed with an aqueous solution of 6,5KtltlindIII fragment recovered from the gel,
After ethanol precipitation, ligation reaction buffer (Example 2
)) Dissolve in 10 μl. 2 units T 4
-Add DNA ligase and react at 11°C for 12 hours to obtain hybrid DNA.

The transformation of Escherichia coli D)-1-1 strain is carried out using normal CaG
2 methods [M, V, Norgard, Ni, Keene.

J, Mochiham: Gee Vol. 23, p. 279 (I978) (
)1. V., Norgard, K., Keen, J.H.
onaham: Gene, 3°279 (I97
8)))]. That is, 18% of Escherichia coli D)-1-1 strain was added to 5% Na (1% tripe, 0.5% MFEI, 0.5% Na, pH 7.5). Inoculate culture medium for 6 hours
Grow to an optical density of 0.3 at 0.00 nm. The bacterial cells were soaked in cold magnesium buffer (O118Na).
C! 2-5mH)l(l C!112-5m)l Tr
is-)-IC! 2 (Dt17.6, 0°C)] and cooled to 2d.
[100m)l CaC5! z 25On+HK
C9-5m)l Hg C! ;! 2-5m)l Tri
s-flG (pH 7.6, Q°C)] and left at 0°C for 25 minutes.

Next, the bacterial cells were resuspended in 1.10 volumes of calcium buffer as described above, and mixed with the hybrid DNA aqueous solution and 2.
: 1 (vol, :vol,) a combination. After keeping the mixture at 0°C for 60 minutes, add 1 portion of LBG medium (
I% tryptone, 0°5% yeast extract.

1% NaC2, 0.08% glucose, pH 17.5
> and culture at 37°C for 1 hour. The culture solution is inoculated onto a selective medium (medium plate containing 30 μl of ampicillin (I/ml) at 100 μm/plate. The plate is incubated overnight at 37°C to grow the transformed strain. Obtained colonies DNA was prepared using a known method, and the desired hybrid DNA was confirmed by agarose gel electrophoresis.Thus, the tlin of pBR322
A 6.5 kb DNA fragment containing the dllI gene and the V-J gene was cloned into LDYN-)11VI and pyN-+nv2.

BamHI containing V/C-J/[-i gene (A-
1') -11indm (Δ-2) fragment tlind
III (A-2) is EC0RI' of p8R322
The one linked in the right direction is pYN-)kaVl, and the one in the opposite orientation is 1)YN-HLV2te(￥)le.

In addition, pYN-NLVl was added to Bamt by i% according to Example 4.
lI.

Bam old (A-1)-Pst I (A-3>
1 NA fragment? is. On the other hand, PUC18 vector (manufactured by PLC Biochemicals) was similarly used as Bam old and pst I vector.
A linear vector fragment of approximately 2.7 kb was obtained. These two DNA fragments were ligated according to Example 2, and E. coli strain J8103 was treated in the same manner as the D H1 strain to grow a transformed strain. Thereafter, plasmid DNA was extracted from the transformed strain by a known method.
The desired recombinant plasmid was confirmed by agarose electrophoresis. Thus, part of the gene cloned in Example 3, namely BamHI shown in FIG.
pt containing (A-1>-Pst I (A-3)
Jc18 recombinant plasmid pYN-HIVBP (q
Ta.

Example 6 (Determination of base sequence) pYN-)ILVI described in Example 5 was cleaved with Bamfl I and Pst i according to Example 4, and the Ba
The DNA fragment sandwiched between mHI (A-1) and PstI (A-3) cleavage sites was prepared (7). Similarly, Bg+ n and Ps
Cut at PstI (A-3) and B(l) in Figure 3.
17 is a DNA fragment of about 1.5 kb sandwiched by II.

These DNA fragments were cloned into old 3mp18 (manufactured by PL Biochemicals) that had been cut with RamIII and PstI. Base sequencing was performed using the old 3 sequencing kit (Takara Shuzo) and [α-32P]dCTP (
The process was carried out using the dideoxy chain termination method using Amarjam (manufactured by Amerjam) [Mitsuru Takanami.

“Ryūin Oi Edition rDNA Sequence Analysis Manual” (I9
83) See Kodansha].

BamHI (A-1>-Pst I (A-3)
For fragments, from pst 1 side to 5' direction, Pst
I (Pst for the A-3>-Bc+Iff fragment
The base sequence was determined in the 3' direction from the I side. Furthermore, plasmid pYN-HLVBP was transformed into Rsa according to Example 4.
A DNA fragment of approximately 0.65 kb was obtained by cutting with Sma I and Pst I, and cloned into the Mt3mp 19 (manufactured by PEL Biochemicals) phage, which was cut with Sma I and Pst I, and a nucleotide fragment of approximately 0.65 kb was obtained by cutting with Rsa I and pst I. The sequence was determined. Sma I digestion is 10mHTri
s-)-l C9(pt18.o), 7
mHH(] CS!2, 20mHKCS!,
37℃2 in 7mM 2-mercaptoethanol aqueous solution
After that, the NaC9III degree was adjusted to 5On+H and the digestion was carried out with PSt■. Also, plasmid pYN
-) Rsa I and Kano a according to Example 4 with ILVBP
I, and D generated by cutting with Dra I and Pst I
NA fragments were fractionated. A 2 mm thick 590 acrylamide vertical gel was used for fractionation (see 2M Butsuko Operating Experiment Manual J (I982) edited by Yasutaka Takagi, Kodansha).

Rsa ■ and Dra I cut approximately 0.3 kb, D
About 0.4 kb DNA fragment 17 was obtained by ra I and pst I digestion.
A ligation reaction was performed on 13mp19 digested with Sma T and Pst, resulting in Rsa I-Dra shown in Figure 3.
I and leaf a-PstI (A-3> D surrounded by cleavage site
The base sequence of the crudely recombined phage 17 into which the NA fragment had been inserted was determined as described above. R3a knee Dra i
For the fragment, 5' direction from leaf aI, DraI-Pst
For the I fragment, each was carried out in the 3' direction from Dra I.

A concatenation and summary of each result is shown in Figure 2.

[Brief explanation of drawings]

FIG. 1 shows the amino acid sequence of the V region of the mouse antibody chain of the present invention, FIG. 2 shows the nucleobase sequence of the V region gene, and FIG. This figure shows a restriction enzyme cleavage map of the V region gene. Glu Ile Val Leu Thr Gin S
er Pro Ala LeuMet Ala Ala
Ser Pro Gly Glu Lys Val
Thr1ie Arc+ cyS Ser Val S
er Ser Ser Ser lie Ser+40 Ser Ser Asn Leu Hls Trp T
yr Gin Gin LysSer Glu Thr
Ser Pro Lys Pro Trp lie
TyrGly Thr Ser Asn Leu Al
a Ser Gly Vat Pr. Val Arc+ Phe Ser Gly Ser
Gly Ser Gly Thr Ser Tyr Ph
e Leu Thr Ile Ser Ser Met
GluAla Glu Asp Ala Ala T
hr Tyr Tyr Cys G1n211J￥J GTACTCAATT GAACATCCCT T
GTTTAGTGT ATCAAATCAA Gc
rGGrcTiAAGAGAAATCA ATGAAC
AATA CTTTGTGACA GATATGCAC
CACAAAAGAGGAAGAGAAAAAA CAG
AAATTTCCTTCTTTGTA AGTGTAG
TGT CTACAAATAAGTAGATATTG
GTCCTAGATT AGCCAGGTn GCCT
TTGTTA ACAGACCACCTGACTTTTA
TA AGCCGAGAACTCCAAAGACT A
CTATTTGCA TAGTTCATCC3o. TCAGAAACCA CAAATTTCTCACA
GTTGTTT TAAAGAGATG CACT
TATAGGAAGAGCAATA ATTAGTCA
GA
GGATTTTCATGTGCAGATT TTCAG
CTTCA TGCTAATCAG TGTCACAG
GT AGAGATGGGTI+50 AGGAGTTTGA GTTCAGAAAA CAA
GGTTC:TT TTTCCCAGGA AAGTT
TCATAAAGTAGACn TTTCTTTCC
T CTGAATATTG AATGCTATGA
AATT8TTTTGTATCTCTGT CT
ACTAACACCCTCTATCTCTTTTCACT
CTCTCTTCTGTTG-chome'TTCCATA G
TCATAnGT CCAGTGGAGA AATTG
TGCTCACCCAGTCTCCAGCACTCAT
GGCTGCnCT CCAGGGGAGA AGG
TCACCAT CCGCTGCAGTGTCAGCT
CAA GTATAAGTTCCAGCAACTTG
CACTGGTACCAGCAGAAGTC Sai 2 (Kasumi-
(I) AGAAACCTCCCCCCAAACCCT GGAT
TTATGG CACATCCAACcrGGcnCi
GGAGTCCCTGT TCGTTTCAGT GG
CAGTGGAT CTGGACCTCTTATTT
TCTCACAATCAGCAGCATGGAGG
CTGAAGATGCT GCCACTTATT
ACTGTCAACAGTGGAGTAGT TACC
CACTCA CGTTCGGAGGGGGGACC
AAG CTGGAAATAAACGT /+21 yen) - (2)

Claims (1)

[Claims] 1. No. 1 (Glu) to No. 97 (Le
A novel amino acid sequence comprising at least the amino acid sequence represented by u). 2. From 1st (Glu) to 109th (A) in attached Figure 1
2. The novel amino acid sequence according to item 1, comprising the amino acid sequence represented by up to rg). 3. From 1st (Glu) to 97th (Le) in attached Figure 1
A nucleobase sequence (I-a) encoding at least the amino acid sequence shown up to u). 4. From 1st (Glu) to 109th (A) in attached Figure 1
rg), which encodes the amino acid sequence up to
Nucleic acid base sequence (I-b) described in Section 1. 5. The nucleobase sequence (I-a) is 579 in attached Figure 2.
The nucleobase sequence according to item 3, represented by positions 869 to 869. 6. The nucleobase sequence (I-b) is 579 in attached Figure 2.
5. The nucleobase sequence according to item 4, represented by positions 905 to 905. 7. The novel nucleobase sequence described in item 3, which is represented by positions 562 to 905 in the attached FIG. 8. The novel nucleobase sequence according to item 3, which is represented by positions 340 to 905 in the attached FIG. 9. The novel nucleobase sequence according to item 3, which is represented by positions 230 to 905 in the attached Figure 2.