JPS63258580A - Chicken dna and use thereof - Google Patents

Abstract

PURPOSE:To carry out sexing of chicken, by cloning a DNA fragment containing a duplicate base sequence characteristic to female chicken, preparing a plasmid containing said fragment and using the plasmid as a probe. CONSTITUTION:DNA prepared from the liver of White Leghorn chicken is digested with restriction enzyme XhoI to obtain DNA fragment of 0.7kb or 1.1kb, which is ligated to plasmid pACYC177 which is cut with XhoI beforehand. An E.coli is transformed with the plasmid to obtain plasmid pAGD0601 or pAGD1101. In the same manner as above, the DNA is digested with restriction enzyme EcoRI to obtain a fragment of 1.3kb, which is ligated with pUC9 treated with said enzyme to obtain pUGD1301. These 3 kinds of DNA fragments are labeled and used as probes for the sexing of chicken by hybridization method.

Description

DETAILED DESCRIPTION OF THE INVENTION <Industrial Application Field> The present invention relates to a DNA probe for distinguishing between male and female chickens. More specifically, the present invention relates to a repetitive sequence specifically contained in the W chromosome that determines the sex of chickens, a plasmid containing the same, and a method for sexing chickens using the same.

<Conventional Technology> Conventionally, discrimination between the sexes of chickens is performed by a virtuoso method of discrimination based on the naked eye observation of newly born chicks.

DNA based on recent achievements in molecular biology and molecular genetics.
DNA with a specific base sequence that contains genetic information engraved inside
By using A as a probe, it became possible to identify it.

The sex chromosome composition of vertebrates includes the XX (female)/XY (male) type represented by mammals, and the ZW (female)/ZZ (male) type represented by birds and reptiles. Of these, the Y chromosome and the W chromosome are generally small and have limited functions centered on sex determination. It is thought that the Y chromosome plays a decisive role in the differentiation of undifferentiated gonads into testes in the early stages of development, and the W chromosome plays a decisive role in differentiating undifferentiated gonads into ovaries. DNA from vertebrate chromosomes
When extracted and subjected to density equilibrium centrifugation, the presence of so-called satellite DNA, which has a density different from that of the majority of DNA, is observed. It has been confirmed that these are derived from highly repetitive sequences on chromosomes. Label this repetitive sequence and in
When 5itu hybridization is performed, sex chromosomes often behave differently from other autosomes (e.g. Pardue & Ga11.5science River13
56 (1970)). In humans, the existence of repeat sequences specific to the Y chromosome is known (Kunkel L, M, et al.

5science 19±1189 (1976)), restriction enzyme 17:IIae [II gave male-specific fragments of approximately 3.4 kb and 2.1 kb (C
ooke, Il, Nature 262182 (19
76)).

Motori et al. found that about 50% of the DNA that makes up the chicken W chromosome
The repeat unit of the repeat sequence occupying 0% was cloned and the Southern blot hybridization method or in 5
We clarified the specificity of this repetitive sequence for the W chromosome using the itu hybridization method (M, Ton
e et al., Chromosoma, 86551-5691
9B2: Lee-228-237, 1984).

<Problems to be Solved by the Invention> A technology that utilizes specific base sequences contained in DNA to clarify the nature of the individual from which the DNA originated is called DNA diagnostic method. This method was being developed with the aim of early diagnosis of human genetic diseases and infectious diseases caused by viruses.

The present invention provides a sex discrimination method for applying this DNA diagnostic technology to a means for selecting only females capable of collecting eggs in poultry breeding.

Another object of the present invention is to use a probe as described in each item of claim 2.5.8 which is allowed only for females, as a probe necessary for performing a DNA diagnosis to distinguish the sexes of nits and rhinoceroses. The purpose is to provide DNA with specific characteristics.

Still another object of the present invention is to provide the three types of plasmids described in each item of claim 4.7.9, which are used for sexing chickens.

Means for Solving the Problems> The present invention involves cloning a DNA fragment containing a repeating base sequence unique to female chickens, and
By obtaining a plasmid containing the fragment and using it as a probe, it provides a means to enable discrimination between male and female chickens.

DNA fragments used as probes were obtained as follows. °That is, the liver was removed from a 60-day-old white Leghorn chicken, and 50 mM Tris-HCl buffer (lo
After washing with 0. IM EDTA
and 0.15 M Nac 1 (pH 8,0), and the lysate (2% sodium lauryl sulfate, 8.0
% triisopropylnaphthalene sulfonate, 12%
sec, butanol). The DNA is removed by phenol treatment and recovered by ethanol precipitation.

The DNA thus obtained was treated with restriction enzyme Xh.

! Alternatively, after cutting with Eco['LI, electrophoresis is performed in a 1% agarose gel. After electrophoresis, the gel was stained with ethidium bromide and 0.7 kb or 1.1 kb or 1
．． Cut out the part of the gel containing the 3 kb fragment. After the DNA fragments contained in the gel are adsorbed to hydroquinoapatite, they are eluted with 0.05M phosphate buffer. After treating the eluate with phenol, DNA fragments are recovered by ethanol precipitation.

Plasmid pA CY C17 previously cut with XhoI
7 (Chang, & Cohen, J. Bacter
iology 1341141-1156 (1978)
) and upper nE, XhoI O,7k of chicken DNA
b or 1.1 kb fragments and transformed into E. coli. In this way, XhoI O
, 7 kb fragment pAG D 0601
I got it. Also, p containing the X ho I 1.1 kb fragment
AGD1101 was obtained.

Similarly, plasmid puC9 cut with EcoRI in advance
A plasmid pUGD 1301 containing the EcoRI 1.3 kb fragment was obtained by ligation and transformation of E. coli with the EcoRI 1.3 kb fragment of chicken DNA.

The complete base sequence of the chicken repeat sequence XhoI O, 7 kb fragment and the partial base sequence of the XhoI 1.1 kb fragment were determined according to the Sanger method. That is, X h
The 7 kb fragment has the following base sequence.

CTCGAGAAAT ACCACTTTTCTCTC
GA^^AT CATGCATTTTCATCCAAA
AA TACCACCTGT CTCCCAAAAAA
TTCTGCACTTCCTTCCCGAA Eight T
ACCACTTTTTCGCTGGGAAATA
ACACATTTCTACCCCCA AATAT^^
CACGCTTCACTCA CA^^GCACGC
ATTTTCACCCCGAAAGTACCACCTT
TCAGCCGAAAATTACGCTTTTTCCT
CCAGAAAATA CCACTTCTCA AA
, CAGAAATATCACGTTTCGCCAAGA
AAAT AGCACCATTCACCCCAAAT
CACII; CGTTTT CTCTCCAGAA C
TACCACTTTTCTCACOGAAATCAC
ACATT TTCTTCCCGA AAGTACCA
CCTTGCACACGAAAATCACGCA T
TTTCTGCGCGAAACAAACCCCATTTC
ACCCCAAAATCAGT CTTTTTTCTT
CCGGAAAATAACAACTTTTCTAACGA
AATCCA TGCGTTATCA CTCTGAA
AAT ACACGTTTTTGCCCGAAAAT
CACGCATTTTTCCCTTCGTAAATT
CCCCATGTCGCCAGAAA A-choAATT
CATT Ding CCTTACCG Ding AAATGCC
CTTTTCACCCAA AAATCACGCA
TTTCCCCCCG GAAAAAACGCACC
TCTGTCCA AAACATCACGCATTTTC
TACCCGAAAATAACCACTTTTGGCT
GGGAAATAACACATTTCTCCCCCAA
ATATACCACCCTTTCA CCCCAAAAT
CACGCATTTTCTCTCGAGAlso XhoI
The 1.1 kb fragment has the following six base sequences.

CTCGAGAAAT GCCACTTCTCTTTC
GAAAAT CACGCATTTTCGCCCGA
AA ATACCACCCG TCTCCCAGA
A ATTCTGCACTTCCTTCCCGA A
AATACCACT TTTCGCTGCG AAAT
AACACATTTCTACCCCAAATATATACC
A CGCTTCACTCACAAAGCACGCAT
TTTCACCCCAAAAGTGCCACCTTTC
ACCCGAAAATTACGCTTTTTCCTCC
AGAAAAT ACCACTTCTCAAACAGA
AGTCACGCGTTTDING CTCCAAGAAA
ATACCACCATTCACCCCAAATC
ACGCGTTT CTCTCAAAACACCAC
TTTTCTCACAAAATTCACGCATTTTC
TCCGAATACCACCTT, , , , , , ,
,,,,,,.

TTTCCdCCCA AAAGTCACG C
ATTTCCCCCCGAAAAAAATAGCACCTC
TGTCCAAACATCACGCATTTTCT
ACTCGAAAATAACCATCTTTT GC
TGGAAAAG AATACATTTCTCCCC
AAGTATACCACCT TGCACCCCAA
AATCACCGCATTTTCTCTCGAX
The hoI O, 7 kb and 1.1 kb fragments are characterized by having a repeating structure in which each sequence consists of about 20 base pairs.

EXAMPLES Hereinafter, the present invention will be explained in more detail with reference to Examples, but these are not intended to limit the scope of the present invention in any way.

<Example 1> This is an example in which sex discrimination was performed using Southern plot hybridization using DNA extracted from blood cells of male and female chickens as samples.

Figure 1 is! Female chicken DNA X hol according to claim 2 labeled with ff1p
0.7kb fragment (A) and Xho described in Section 5
The I 1.1 kb fragment (B) was hybridized with DNA extracted from the male (M) or female (F), respectively, as a probe. In addition, FIG. 2B shows the chicken DNAEcoR1 described in claim 8.
A 1.3 kb fragment was used as a probe and hybridized with DNA extracted from a male (M) or female (F).

These results show that all three types of probes provided by the present invention react only with female DNA and do not react with male DNA, so that sex discrimination is possible.

<Example 2> Using DNA obtained from various types of chickens and related birds as samples, we investigated how this identification method would respond to the type of bird.

As shown in FIG. 3, the results are as follows: 3tp-labeled female chicken DNA according to claim 2.
When the X hol O, 7 kb fragment was used as a probe, DNA obtained from various females of the White Leghorn and related gamefowl, Nagoya Kojin, Brimas Rock, and Fayoumi.
The results show that although a reaction is observed when the sample is used as a sample, it does not react with DNA obtained from males of these species, or with DNA obtained from females or males of pheasants, quail, and guinea fowl.

<Example 3> DNA extracted from blood cells of male and female chickens was used as a sample by dot hybridization.
This is an example of male and female discrimination.

FIG. 4 shows a female chicken DNA XhoIO, 7kb fragment labeled with biotin and described in claim 2, which was used as a probe for a male White Leghorn chicken (
DNA obtained from M) or a female (F) was hybridized with a spotted sample.

The results show that it reacts only with female DNA and not with male DNA.

<Example 4> Using male and female chicken embryos as samples, in 5i
This is an example in which sex was determined by tu hybridization. FIG. 5 shows a female chicken DNA labeled with biotin as described in claim 2.
A hol 0.7 kb fragment was used as a probe, and FIG. 6 shows a white Leghorn male chicken ( Figure 5 A, B, Figure 6 M) or scalpel (Figure 5 C, D)
, Fig. 6F), the embryos removed from the fertilized eggs were fixed and incubated.
5 itu hybridization was performed.

The results show that in female samples, clearly stained areas are observed in the nucleus, but in males, no clear stained areas are observed.

<Effects of the Invention> The three types of DNA fragments containing repetitive base sequences unique to female chickens provided by the present invention all react only with female DNA and do not react with male DNA, making it easy to distinguish between males and females. It was shown to be useful as a probe for

By using this probe, it does not react with pheasants, quail, or guinea fowl, even if they belong to the order Phasianidae.
It has been revealed that it only reacts with closely related species such as chickens (white leghorn, Nagoya cordin, Plymouth rock, etc.), gamefowl, and fayoumi.

Furthermore, technical means for determining the sexes include the dot hybridization method, in which DNA obtained from chicken blood cells is spotted on a nylon membrane, and the DNA is cut with restriction enzymes and fractionated by agarose gel electrophoresis. Southern blot hybridization, in which the separated fragments are transferred onto a nylon membrane, and in-situ U hybridization, in which embryos are removed from fertilized eggs and fixed. was shown to be applicable. Furthermore, it was shown that the probe used could be labeled with either 3tp radioisotope or biotin labeling. That is, by using a DNA fragment containing a base sequence unique to female chickens provided by the present invention as a probe, if a very small amount of blood from a chicken chick is obtained, DNA can be extracted from it and the sex of the chick can be determined. can do. Furthermore, when there is a chick of an unknown bird, it is possible to identify whether the chick belongs to a species closely related to chickens by obtaining DNA from a very small amount of blood.

Furthermore, if a small amount of cells are obtained from a chicken chick or embryo, it is possible to determine the sex by using the in 5 in situ hybridization method.

[Brief explanation of drawings]

Figure 1 shows Southern blot hybridization results when DNA obtained from male and female chickens was digested with the restriction enzyme XhoI and 0.7 kb (A) or 1.1 kb (B) was used as a probe. show. Figure 2 shows DNA obtained from male and female chickens being digested with the restriction enzyme EcoRr and then using EcoRr as a probe.
This figure shows the Zazan hybridization using I 1.3 kb. Figure A shows ethidium after electrophoresis.
Promid staining. Figure 3 shows white leghorn, (1,2) gamecock (3°4
), Nagoya Cochin (5,6), Plymouth Rock (7,
8), Fayoumi (9, 10), cultured cell line established from female white leghorn (11), Nihon pheasant (12,
13), DNA extracted from guinea pigeon (14, 15), Japanese quail (16, 17), and rock pigeon (18, 19) were used as samples, and X ho I 0.7
Zazan plot hybridization was performed using kb as a probe. The lane with the first number in parentheses indicates that a male DNA sample was used, and the lane with a second number indicates that a female-derived DNA sample was used. Figure 4 shows DNA obtained from male and female chickens spotted on a nylon membrane and subjected to dot hybridization using XhoI O, 7kb as a probe. FIG. 5 shows Xh embryos removed from fertilized male and female chicken eggs, fixed, and labeled with biotin. 1. In 5 ito hybridization was performed using 0.7kb as a probe. Figure 6 shows a sample prepared in the same manner as in Figure 5.
In 5 in situ hybridization was performed using EcoRI 1.3kb labeled with as a probe.

Claims (1)

[Scope of Claims] 1. A DNA fragment having a specific base sequence localized in the sex chromosome (W chromosome) unique to female chickens. 2. The DNA according to claim 1, which is obtained as a 0.7 kb repeat sequence fragment when chicken DNA is digested with the restriction enzyme XhoI. 3. The DNA described in claim 2 having the base sequence shown by the following formula [There is a gene sequence] 4. A plasmid containing all or part of the base sequence described in claim 3. 5. The DNA according to claim 1, which is obtained as a 1.1 kb repeat sequence fragment when chicken DNA is digested with the restriction enzyme XhoI. 6. The DNA according to claim 5, which has a base sequence represented by the following formula as a part thereof. [There is a gene sequence] 7. A plasmid containing all or part of the base sequence described in claim 6. 8. The DNA according to claim 1, which is obtained as a 1.3 kb repeating fragment when chicken DNA is digested with the restriction enzyme EcoRI. 9. A plasmid containing all or part of the fragment according to claim 8. 10. A DNA probe labeled with the DNA fragment according to claim 1. 11. A method for determining the sex of chickens using the DNA probe according to claim 10. 12. Chicken cells were fixed on a slide glass and i.
12. The method for determining sexes according to claim 11, characterized in that an n-situ hybridization method is used. 13. The method according to claim 11, which involves extracting DNA from chicken cells, immobilizing it on a membrane, and examining hybridization ability using the DNA probe described in claim 10. Sexing method.