JPS63226288A - Novel gene, its manifestation plasmid dna and transformed microorganism - Google Patents

Abstract

PURPOSE:To provide a gene coding a fused polypeptide giving a polypeptide structure to be produced having a C-terminal or N-terminal corresponding to a collagenase nicking site. CONSTITUTION:A gene coding a polypeptide of formula (A and C are polypeptide having >=2 amino acid residues; - is peptide bond). The gene has a structure obtained by linking (1) a gene coding the objective polypeptide to be produced and (2) a gene coding other polypeptide existing relatively stably in a host with (3) a DNA fragment coding a polypeptide having collagenase nicking site and inserted between the genes 1 and 2. The objective gene is linked to downstream of a manifestation promoter to construct a manifestation plasmid DNA. A microorganism transformed with the DNA is cultured to produce a fused polypeptide, which is treated with collagenase to cut the peptide between B and glycine in the formula and obtain the objective polypeptide.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The present invention relates to a novel gene, its expression plasmid DNA, and transformed microorganisms. By using the transformed microorganism, useful polypeptides that are relatively lignically unstable in the host can be efficiently produced and isolated.

[Prior Art] Methods for producing polypeptides such as peptide hormones and enzymes using microbial cells such as Escherichia coli, Bacillus subtilis, and yeast have been widely studied using recombinant DNA techniques. However, despite numerous studies, there are still some unresolved problems, and it is not always easy to produce and isolate polypeptides as planned.

One such problem is that when a gene encoding a heterologous polypeptide that does not naturally exist in host microbial cells is expressed in the host cell, the produced polypeptide may be degraded by host cell-derived proteases. Because of this, the phenomenon of unstable production may be observed.

Therefore, as a way to enhance the stability of a polypeptide of interest in host cells, one method is to replace the gene encoding the polypeptide of interest with one that encodes another polypeptide that is known to exist relatively stably in the host. Combined with the gene that
Methods of expressing and producing fusion polypeptides have been studied. In these methods, separation of the target polypeptide from the produced fusion polypeptide is carried out by chemical treatment using cyanocene bromide or the like or treatment using a proteolytic enzyme such as trypsin. However, if a cleavage amino acid site that serves as a substrate for these treatments exists in the target polypeptide, the peptide chain will be cleaved at that location, making it impossible to obtain the target peptide as planned.

By the way, collagenase is known as a peptidase that specifically decomposes collagen derived from animal tissues or gelatin, which is a denatured product thereof, and
lostridium) genera, such as Clostridium histolyticum (C,...Dan1shojiang) and Clostridium verfrigerens (Dan1.

can be easily manually harvested from outside the bacterial cell (Voshida, E., etc., Biochim,
BiophS, Acta+105.562.1965)
. Two immunologically homogeneous isozymes (collagenase I and ■) are known for this enzyme. Both have high substrate specificity, -proline-X-glycine-proline-(
It is known that the peptide bond between X and glycine (X is any amino acid residue) can be specifically hydrolyzed.

For this reason, attempts have been made to use collagenase to hydrolyze fusion polypeptides, and Germi
No et al. inserted a fragment of the pro-α2 collagen gene between the cistron gene encoding the π protein, which is a replication initiation factor, and the Iac'Z gene encoding β-galactosidase into E. coli plasmid R6, and expressed the fusion protein. The π protein is isolated by treatment with collagenase (Germino, J. et al., Pro
, Natl, ^cad, sci, UsA+81+469
2, 1984).

[Problem to be solved by the invention] However, with this Germino method, approximately 25
By inserting a 0 bp fragment of the pro-α2 kolaken gene, a protein with at least 5 amino acid residues added to the C-terminus of the original π protein amino acid sequence was obtained, resulting in a protein with at least 5 amino acid residues added to the C-terminus of the original π protein amino acid sequence. A protein with a primary structure different from that of the original protein was produced.

Therefore, an object of the present invention is to provide a gene encoding a fusion polypeptide in which the C-terminus or N-terminus of the polypeptide structure to be produced serves as a collagenase cleavage site, and to express this gene in microbial cells to perform fusion. The object of the present invention is to provide a means for easily and accurately producing a polypeptide having a desired molecular structure by producing a polypeptide and subsequently treating the polypeptide with collagenase.

[Means for solving problems]

The above objective is achieved according to the present invention by the general formula % formula % (where A and C each represent a polypeptide with two or more amino acid residues, B represents one amino acid residue, and - indicates a peptide bond, and proline is L
A gene that coats the polypeptide' shown in
, and a microorganism transformed with its expression plasmid.

The above-mentioned gene according to the present invention is particularly provided between a gene encoding a target polypeptide to be produced and a gene encoding another polypeptide known to exist relatively stably in the host. This gene has a structure in which a DNA fragment encoding a polypeptide having a collagenase cleavage site, which is almost absent in natural polypeptides other than Kolaken, is inserted and linked. An expression plasmid containing this gene and capable of expression in a microorganism is created, a microorganism carrying this expression plasmid is produced, the microorganism is cultured to produce the fusion polypeptide, and the product is synthesized by collagenase. Upon treatment, the desired polypeptide can be obtained.

The present invention will be explained in more detail below.

In this specification, when amino acids, nucleobases, etc. are indicated by abbreviations, they follow the ItlPAC regulations or common symbols in the field. Here are some examples:

Ser: L-serine, Leu: L-leucine, Arg: 17-arginine, Cys: L-cysteine, Gln: ■7-glutamine, Tle: I--isoleucine.

Pro: I--proline, Val: T,-valine, Hi
s: L-histidine, Met: T,, -methionine, ^la: 17-l mini 1-fualanine: 1.
, -phenylalanine.

c+y nigericin, Asp: L-aspartic acid.

^sn: L, -asparagine, Glu: L-glutamic acid, Trp: L-) liptophan, Thr: T, -
Threonine, Tyr: L-tyrosine, X: any one of the above amino acids.

: adenine, T: thymine, Gnigeanine, C: cytosine, DNA: deoxyliponucleic acid, RNA: ribonucleic acid,
ATP: adenosine diphosphate.

dATP: Deoxyadenosine trisstate, dCTP
: deoxycytosine trisunate, dGTP: deoxyguanine trisunate, dTTP: deoxythymine trisphosphate.

ddATP Nidideoxyadenosine diphosphate, dd
CTP Nidideoxycytosine: phosphate, ddGTP
Nidideoxyguanine triphosphate, ddTTP Nidideoxythymine triphosphate.

bp: base pair, t+bp: kilobase pair, KDa: kilodalton, hCT: human lucitonin it gene, HPl
, C: High Performance Liquid Chromatography, RDTA: Ethylenediaminetetraacetic acid sodium salt.

In addition, genes were displayed according to the conventionally used method (Bachmann, B, J, + Micr.
obiol, Rev.

47.180, 1983. Mortimer, R.
etc., old crobio1. Rev.

49.18L1985).

As mentioned above, the gene according to the present invention has a C-terminus or an N-terminus.
It encodes a polypeptide with a collagenase-cleaved amino acid sequence at the end. Therefore, the polypeptide-substructure to be produced preferably has a terminal amino acid sequence suitable for constructing a collagenase-cleaved amino acid sequence. In other words, the C-terminus of the target polypeptide is -Pro-X, and N
The terminus is preferably Gly-Pro-. Many industrially useful polypeptides having such terminal amino acid sequences are known. For example, there are the following polypeptides.

Polypeptide (I) in which Cr is -Pro-X Angiotensin (derived from horses) that can be used as a vasoconstrictor or blood pressure increasing drug Asp-Arg-Val-Tyr-T 1e-His-
Pro-Phe (L, T, Skeggs et al., J, Ex
ptl, Med, 106.439.1957)
(2) r[[lAngiotensin ■ antagonist 5er-8rg-Val-Tyr-Val-11is-
Pro-^1a (3), angiotensin■ Arg-Val-Tyr-11e-llis-Pro-
Phe (Camphell, W, R, et al., 5cien
ce, 184,994.1974) (4) C-terminal glycine adduct of calcitonin (precursor for C-terminal amidation) known as a hypercalcemia therapeutic agent (human) Cys-Gly-^sn-Leu- 3er-Thr-C
ys-Met-Leu-Gly-Thr-Tyr-Th
r-Gln-^5p-Phe-^qn-1,ys-Ph
e-1(is-Thr-Phe-Pro-Gln-Th
r-Ala-11e-Gly-Val-Gly-^1a
-Pro-ly (pig) Cys-5er-^5n-1. eu-3er-Thr-
Cys-Val-Leu-5er-^1a-Tyr-T
rp-Arg-^5n-Leu- to 5n-Asn-Ph
e-old s-Arg-Phe-Ser-Gly-Met-
G Iy-Phe-G ly-Pro-G Iu-T
hr-Pro-15I (Cow) Cys-3er-85n-Leu-3er-Thr-C
ys-Val-Leu-5er-^1a-Tyr-Tr
p-Lys-Asp-Leu-Asn-^5n-Tyr
-His-^rg-Phe-5er-G Iy-Me
t-G ly-Phe-G Iy-Pro-G lu
-Thr-Pro-ty (Salmon) Cys-3er-^5n-Leu-3er-Thr-C
ys-Val-1, eu-Gly-Lys-1, eu-
3er-Gln-Glu-Leu-old 5-Lys-Le
u-Gln-Thr-Tyr-Pro-^rg-Thr
-Asn-Thr-Gly-3er-Gly-Thr-
Pro-Gly (eel) Cys-3er-Asn-1, eu-5er-Thr-
Cys-Va l-1, eu-G I y-1, ys
-Leu-5er-Gln-Glu-Leu-old s-1
,ys-Leu-Gln-Thr-Tyr-Pro-A
rg-Thr-Asp-Va I-Gly-A Ia-
Gly-Thr-Pro-Gly (Bi) Cys-8Ia-5er-Leu-3er-Thr-C
ys-sial-Leu-Gly-Lys-Leu-5e
r-G I n-G lu-Leu-His-Lys-
Leu-G I n-Thr-Tyr-Pro-＾rg
-Thr-Asp-Val-Gly-8Ia-Gly-
Thr-Pro-ly (Lasmoles, F., et al., PRBS Iett,
180, 113.1985) (5) Melanocyte stimulating hormone with melanocyte stimulating effect, α-MSH Ser-Tyr-3er-Met-Glu-11is-
Phe-8rg-Trp-Gly-1, ys-Pro-
Val (llarris, J., 1. + et al., Nature,
179.1346.1957) (6) Melanocyte stimulating hormone, β-MSH (horn shark) Asp-Gly-Asp-85p-Tyr-I, ys-
Phe-Gly-His-Phe-＾rg-Trp-5
er-Sial-Pro-Leu (Bennet+)1.
P, J, et al., Biochem, J, , 14L
439.1974) (7) Trypsin inhibitor (human) to 5p-3er-Leu-Gly-8rg-Glu-^
Ia-Lys-Cys-Tyr-85n-Glu-Le
Gly to u-Asn y-4:ys-Thr-Lys-r
le-Tyr-Asn-Pro-Val-Cys-Gl
y-Thr-85p-Gly-Asp-Thr-Tyr
-Pro-85n-Glu-Cys-νal-1, eu
-Cys-Phe-Glu-Asn-Arg-1,ys
-8rg-Gln-Thr-5er-Tle-1,eu
-Tle-Gln-I, ys-5er-Gly-Pro
-Cy3 (Bartel t, n, c, , etc., Arch,
Biochem, Biophys.

179, 189.1977) (Bovine) Asn-11e-Leu-Gly- to rg-Glu- to Ia-Lys-Cys-Thr-Asn-G 1 u-
Val-Asn-G Iy-Cys-Pro-Arg
-T 1 e-Tyr -ASn-Pro-Val-C
ys-Gly-Thr-^5p-Gly-Val-Th
r-Tyr-3er-^5n-G Iu-Cys-L
eu-Leu-Cys-Met-G Iu-Asn-L
ys-Glu-8rg-GIn-Thr-Pro-V
aI-1,p,u-Ele-GIn-1,ys-Set
-GIy-Pro-Cys (Greene, L, J, et al., J, Biol, Che
m, 244, 2646.1969) (8) Parathyroid hormone with calcium-releasing action (pig) Ser-VaI-5er-Glu-rle-Gln-L
5n-Leu-Gly-[,y
s-His-Leu-5er-3er-Leu-Glu
-8rg-VaLGln-Trp-Leu-^rg-L
ys-Lys-Leu-Gln-Asp-Simi l-11
is-Asn-Phe-Va I-A 1a-Leu-
G 1y-A Ia-3er-I Ie-Va 1-H
is-8rg-^sp-Gly-Gly-5er-Gl
n-Arg-Pro-8rg-1,ys-Lys-Gl
u-Asp-^5n-Val-Leu-Val-Glu
-3er-old 5-Gln-1,ys-5er-Leu-
1a- to Gly-Glu-Ala-Asp-1,ys-
81a-shea1-85p-Val-Leu-11e-L
ys-Ala-Lys-1”ro-Gln(Brewe
r,H,R,etc.,ocmer,J0Med,,56,7
59.1974) (9) Avoidance behavior-inducing pituitary peptide (pig) Cys-Tyr-Phe-Gln-Asn-Cys-P
ro-1,ys (Lande, S., et al., J.
Riol, Chem, 246.2058.197
1) (I0) Proinsulin C peptide (bovine) G 1u-Val-G Iu-G Iy-Pro-Gl
n-Val, -G Iy-A Ia-1, eu-G I
u-1, eu-A 1a-G 1y-G 1y-Pr
o-Gly-A 1a-G 1y-G ly-Leu-
Glu-Gly-Pro-Pro-Gln (Salok
angas, A, et al., Eur, J, old ochem,,2
0,183゜N Suekuni Mugi m Ritsuin 3■Kowal Polypeptide (I1) Insulin-like growth factor known as a cell growth promoting factor■ Gly-Pro-Glu-Thr-Leu-Cys-G
ly-8I a -G I u-L e u -Val
-hesp-he1a-Leu-Gln-Phe-Val-
Cys-Gly-Asp-8rg-Gly-Phe-T
yr-Phe-85n-Lys-Pro-Thr-Gl
y-Tyr-Gly-3er-5er-5er-to rg
-herR-heIa-Pro-Gln-Thr-Gly-
11e-Val-^5p-Glu-Cys-Cys-P
he-^rIX-5er-Cys-Asp-1, eu-
Arg-Arg-Leu-GIu-Me 1. -T
yr-Cys-A la-Pro-1,eu-1,ys
-Pro-Ala4. ys-5er-Ala(Rin
derknecht, E, etc., Proc, Natl
, Acad, Sci, llS.

73, 4379.1976) (I2) Pancreatic polypeptide (chicken) Gly-Pro-3et-Gln-Pro-Thr-T
yr-Pro-Gly-Asp-Asp-A 1a-P
ro-Va I-Glu-Asp-Leu-11e-A
rg7Phe-Tyr-^sp-^5n-Leu-Gl
n-Gln-Tyr-1, eu-8sn-νal-νa
l-Thr-^rg-old s-Arg-Tyr (Kimmel, J, R, et al., J, Riol, Che
m,,250,9369.

A gene encoding a fusion polypeptide with another polypeptide via a collagenase-cleaved amino acid sequence for the above-exemplified polypeptides having -Pro-X at the C-terminus or polypeptides having Gly-Pro- at the N-terminus. design. In this case, the polypeptides to be linked are
The type of polypeptide does not matter as long as it is stably produced in each host. Generally, polypeptides that are produced in large quantities by the host cells themselves are used. For example, when the host is Escherichia coli, examples include β-galactosidase, galactokinase, and desthiobiotin synthase, and when the host is yeast, examples include glutaraldehyde triphosphate dehydrogenase and galactokinase.

In addition, polypeptides with -Pro-'X at the C-terminus and N
It may be fused with a polypeptide having Gly-Pro- at the end.

The DNA base sequence of the gene encoding this fusion polypeptide is the DNA shown below corresponding to each amino acid residue.
It can be arbitrarily selected from the base sequences.

Phc: TTT, TTC.

1, eu: TTA, TTG, CTT, CTC,
CTA, CTG.

+1e: ATT, ATC, AT'A.

Met: ^TG.

Vat: GTT, GTC, GTA, GTG.

Ser: TCT, TCC, TCA, TCG,
AGT, AGC.

Pro: CCT, CCC, CCA, CCG.

Thr: 8CT, ACC, ACA, ACG.

Ala: GCT, GCC, GCA, GCG.

Tyr: TAT, TAC.

Old s: CAT, CAC.

Gin: CAA, CAG.

8th sn: AAT, ^AC.

1, ys: ^^A, AAG.

Asp: GAT, GAC.

Gb+: GAA, GAG.

Cys: TGT, TGC.

Trp: TGG.

Arg: CGT, CGC, CGA, CGG, A
GA, AGG.

cry: GGT, GGC, GGA, GGG 0 The gene encoding the fusion polypeptide of general formula (I) may be a part of a gene cloned from nature or a chemically synthesized DNA fragment. It's okay. In many cases, the gene corresponding to the collagenase cleavage site does not have a suitable restriction enzyme site, so synthetic NA
Constructed by inserting .

Synthesis T) NA can be successfully produced by either the phosphoamidide method or the phosphotriester method, but synthesis using an automatic DNA synthesizer using the phosphoamidide method is common.

Since DNA is synthesized as a single strand, complementary strands are always synthesized and annealed, and double-stranded DNA is used as a gene.

The gene according to the present invention obtained as described above has a 5'
By adding appropriate restriction enzyme sites at the 3′ and 3′ ends of the E. coli plasmid ptlc118 or pRI?
It can be easily subcloned into, for example, 322.

Furthermore, the genes can be easily obtained in large amounts by culturing E. coli containing these plasmids and then extracting and purifying the plasmid DNA.

Next, the expression plasmid DNA of the present invention can be obtained by ligating the gene of the present invention downstream of the expression promoter of the expression vector developed for each host. The expression vector and the gene according to the present invention can be linked by various conventionally known methods, for example, by appropriately cleaving the obtained DNA fragment with a reaction with an appropriate restriction enzyme.
This can be accomplished by a method such as ligation using DNA ligase. In this case, for the purpose of improving expression efficiency, etc., DN
You may remove part of A or use a suitable linker.
You may also insert . Furthermore, the ATG sequence of translation initiation and S
If a D sequence is required, a corresponding DNA sequence may be inserted. The DNA sequences used for these can be easily obtained by DNA chemical synthesis.

As the expression vector, expression vector systems developed for E. coli hyphae, Bacillus subtilis system, and yeast system can be used.

Expression vector systems for E. coli hyphae include pOMPo or pOP95-13 (0, Mercerau-Puija
lon et al., Nature.

275, 505.1978), p223-3 (I1,
8. de Boer et al., Proc. Natl., Acad.
, Sci, [ISA, 80, 21.1983) or p
DR540 (D, R, Ru5se1 etc., Gene, 2
tac promoter system, typified by expression vectors such as ptrpLl (J, CJd
man et al., Nature, 291, 503.1981)
or pBN37 (T, H, Fraser et al., Pro
c, Natl, 8cad, Sci, USA.

75, 5936.1978), pKT279 (K, Ta
lmadge etc., Proc, Natl, Acad, Sc
i, 1ISA, 77.398El, 1980) or p
KT287 (K, Talmadge et al., Proc.
, Natl, Acad, Sci, USA.

77.3369.1980), pMl1621 (T,
Maniatis+Mo1ecular Clonin
g, Co1d Spring 1larhor La
b.

omp promoter system represented by (1982), plN
-1 or p1M4 (V, Masui et al., Experi
mentalManipulation of Gen
e Expression, edited by M. Inouye.

p15. pMCR-545 (T), pMCR-545 (T), p p promoter system, pMCR-545 (T), pMCR-545 (T), pp promoter system, pMCR-545 (T), etc.

Old ki et al., Mo1. Gen, Genet, 183.2
5.1981) can be used.

As an expression vector for the expression vector, penP (D, Henner et al., 2n
d rnt, conference of Geneti
c, s and old otech-nology of B
acilli, 1983), pKTII93 (T, Pa1va et al., Gene, 22
．． 229.1983) or an expression vector using a penicillinase promoter and signal peptide gene (
S, Chang et al., Molecular Clonin
g and Gene Regulation in+
1aci11i, p159. Academic Pre
ss, 19B2), etc. can be used.

As a yeast expression vector, pGPD using the promoter of glutaraldehyde 3-phosphate dehydrogenase is used.
l or pGPD2 (G, A, Bitter et al., Gen
e+32.263.1984), pMFα containing the α1 factor promoter and signal peptide gene.
8 (eight.

Former yajima et al., Gene, 37, 155.1985
), A115 or AI(5(G, Ammerer,
Methods in IEnzymology (R,
(Wue et al., eds.) Vollol, p192. Acade
mic Press, 1983), YEp51 or YEp52 (J, 17°Broach et al., Experimental Mani
pulse of GeneExpressio
n (edited by M. Inouye) p83. Academ
ic Press.

1983), expression vector using G^1,7 promoter (JP-A-60-248181), pAT77 or 96M82 using repressible acid phosphatase promoter (^, Miyanohara et al., Proc.
Natl, Acad, Sci, IIS^, 80°1,
1983) etc. can be used.

In the above expression vector group having a signal peptide portion, it is necessary to link the gene portion according to the present invention to the 3' end of the signal peptide gene region with the reading frame (coding frame) aligned.

The expression plasmid DNA thus obtained was transferred to the host (
microorganisms such as Escherichia coli) to obtain a transformed strain according to the present invention.

Transformation of E. coli was performed using the calcium treatment method (Mandel
et al., J. Mo1. Biol, 53, 159.1970)
This can be done according to the following. Transformation of Bacillus subtilis was performed using the protoplast method (S, Chang et al., Mo1.Gen, G
er+et, 168. IIL 1979). In addition, transformation of yeast can be carried out using the Sulfoloblast method (^, Hianen et al., Proc, Natl, Acad
, Sci.

USA, 75.1929.1978) and the lithium chloride method (I1, Ito et al., J. Bacteriol, 153
．． 163, 1983).

Transformants are obtained by selecting on a plate medium using a selection marker (eg, ampicillin resistance) incorporated into each expression vector.

The obtained transformant is cultured as follows.

For E. coli or Bacillus subtilis, use TYG medium (tryptone 0.5%, yeast extract 0.5%, glucose 0.1%,
A selection marker encoded by the expression plasmid DNA is added to a medium in which E. coli or Bacillus subtilis generally grows, such as K2HPO40.1%) or I-, B medium (1% tryptone, 0.5% yeast extract, 1% salt). Culture is performed using a medium containing an appropriate amount of a certain antibiotic (ampicillin, kanamycin, etc.). Antibiotics are not necessarily required for short-term culture. Culture is performed at a temperature of 25 to 45°C with shaking. 5 to 100 transformed strains on a plate
m7! Cultured with shaking overnight in the above medium, 50-1001
Transfer to 00O00 medium and culture for 10 to 30 hours.

For yeast, minimal medium “0.7% yeast nitrogen source base (no amino acids), 2% glucose, 20w/#
various nucleic acids and amino acids] and selectable markers possessed by various expression plasmids (e.g. Eva, Uracil, ■, -
Prepare and use a medium that does not contain leucine, etc.). Culture is performed at a temperature of 25 to 35°C with shaking. The transformed strain on the plate medium is 5-100 mI! 1~
Culture with shaking for 2 days, transfer to 50-101000000 medium, and culture for 1-5 days.

The fusion polypeptide obtained by culturing is separated as follows.

For the fusion polypeptide produced in the secretion Hector system, the culture solution is centrifuged to obtain a supernatant. In addition, for other Hector systems, the bacterial cells are obtained, and after washing the bacterial cells with water, the bacterial cells are destroyed using a cell destruction device such as ultrasonication, French press, X press, Hue press, Dounce tube, etc. , obtain the supernatant by centrifugation.

These supernatants are condensed by acetone precipitation, ultrafiltration, freeze-drying, etc., partially purified by gel filtration using an open column, ion exchange chromatography, etc., and further purified using high-speed chromatography using IIPLc, PPI, C, etc. Purify by fluid chromatography.

At this time, the peak is identified using the properties of the target fusion polypeptide. For example, if the fusion polypeptide has enzymatic activity, enzymatic activity can be used, and if a specific antibody is present in the fusion polypeptide, radioimmunoassay or the like can be used.

The obtained fusion polypeptide is treated with collagenase to obtain the target polypeptide. Collagenase is generally used in Clostridium histolyticus (Clostridium histolyticus).
1 Lml of Clostridium bellfringes (Clostridium) or Clostridium bellfringes was cultured, and the culture solution was fractionated with ammonium sulfate, followed by gel filtration and DEAE.
- prepared by purification by cellulose chromatography (Yoshida et al., R4ochem.

Biophys, Acta, 105.5621965)
. Commercially available collagenase purified products may be used. The reaction with collagenase is not particularly special, and about 5mM of Ca' ions or C02' ions are added to an arbitrary buffer solution of about 50mM in p) 17 to 8, and about 1. peptide) and about 100 units of collagenase may be mixed and carried out at a temperature of around 37°C.At this time, it is preferable to add about 10mM of N-ethylmaleimide to inhibit non-specific peptidase activity. .

Reaction products can be easily separated and purified by gel filtration, ion exchange chromatography, 1 (PLC, FPLC, etc.).

〔Example〕

Next, the present invention will be explained in more detail with reference to Examples. Note that the present invention is not limited to this.

The experimental methods for DNA used on each side are as follows:
[Molecular Cloning (Molecular CIO) by Maniatis et al., unless otherwise stated.
ning)J (Cold Spring Harbo)
r Laboratory, 19B2). In addition, modification enzymes such as restriction enzymes, T4 DNA ligase, DNA polymerase (Klenow fragment), and S-1 nuclease were purchased from Zenshuzo ■, Toyobo ■, and 21-England Biolabs, and the recommended reactions were performed. The reaction was carried out depending on the conditions.

1: Human calcitonin - 1 ゛ In order to obtain a precursor of human calcitonin (the C-terminus is amidated to form human calcitonin), human calcitonin -
A gene encoding a collagenase cleavage site peptide-β-galactosidase fusion polypeptide was constructed.

(I) The amino acid-substructure of the precursor for C-terminal amidation of human calcitonin is as follows.

Cys-Gly-Asn-Leu-3er-Thr-C
ys-Met-Leu-Gly-Thr-Tyr-Th
r-Gln-85p-Phe-Asn-Lys-Phe
-Old 5-Thr-Phe-Pro-Gln-Thr-A
la-11e-Gly-Val-Gly-8Ia-Pr
oc+y.

This is a precursor polypeptide with a structure in which the C-terminal amide moiety of human calcitonin is replaced with glycine.
8. Fo et al., Nature 298.686.198
2), human lucitonin with an amidated C-terminus is obtained.

E. coli β-galactosidase is known to stably exist in E. coli even if other polypeptides are fused to its N-terminus, and to have sufficient enzymatic activity (Germi
no, Jo, etc., Proc, Natl, ^cad, sc
i.

115A 80, 6848.1983). Therefore, we created a gene encoding a fusion polypeptide for stably producing a precursor of human calcitonin.

The amino acid sequence of the designed fusion polypeptide is as follows.

Cys-Gly-8sn-Leu-3er-Thr-C
ys-Met-Leu-Gly-Thr-Tyr-Th
r-Gln-^5p-Phe-^5n-Lys-Phe
-His-Thr-Phe-Pro-Gln-Thr-
8Ia-11e-Gly-Val-Gly-Ala-P
ro-Gly-Gly-Pro-Val-Gly-Pr
o-Ala-Asp-Pro-C Below is the sequence of amino acid residues from the 8th amino acid residue from the N-terminus of β-galactosidase to the C-terminal amino acid residue].

The DNA base sequence corresponding to this amino acid sequence is converted into codons (Ikemura, T, etc.) that are preferentially used by E. coli.
ColdSpring trough Symp
, Mouth uant, Bioβ, 47, 1087.1983
) was designed as follows. Here,
ATG for translation initiation was added to the 5' end.

Column A, TGAGTCCTG AAGTTGTTCA
AAGTATGGAAGGGTGTCTGTIac
'Z gene was obtained from plasmid pMC874 (Casada
bar++M, J, etc., J, Bacteriol,
, 143,971.1980) BamHT-3all
A DNA fragment of 6.2 Kbp was cut out and used.

The gene encoding calcitonin with a collagenase cleavage site added was synthesized using a phosphoramidite method (Beaucage, S, L, and Caru) using a DNA synthesizer (Applied Biosystems Model 3 + OA).
thers, M, H, +Tetrahedron L
ett, 22, 1859.1981). The synthetic genes are seven types of single-stranded DNA shown below.
It was synthesized as

(i) 5'-^ATTC 88AA to CGGC
To 88 TT TCTACCTGCA-3' (31mer
) (ii) 5'-TGCTAGGTACCTA
TACTCAGGACTTCAACAAGTTTTCAT
ACCTTCCCACAGACA-3' (53mer
)(iii) 5'-GCCATCGGTGTCG
GAGCTCCAGGTGGCCCAGTA(”, GC
CAGCG-3' (42mar) (iv) 5
' -GATCCGCTGGGCCTACTGGGCC
ACCTGGAGCT-3' (32mer) (■) 5°-CCGACACCGATGGCTGTC
TGTGGG-3' (24mer) (vi) 5
' -AAGGTATGAAAACTTGTTGAAGT
CCTGAGTATAGGT＾G-3' (37mer
) (■) 5'-CTAGCATGCAGGTAGAC
AAATTGCCGCACATTTTG-3' (35
mer) The actual synthesis involves 1/1 mol of each 3' terminal base.
Using a CPG column bound with 7 as a starting material, one base was added in each 5' direction.

The addition method is Model 38 manufactured by Applied Biosystems.
It was performed according to the DNA synthesizer operator's manual. Synthetic NA with the predetermined number of bases combined
was deprotected with thiophenol with the 5'-terminal trityl group attached, separated from the CPG column using ammonia, and collected.

The collected DNA was separated and purified as follows.

Collection liquid approximately 1.5m7! 1 m of 27% ammonium hydroxide
After sealing, the mixture was heated at 60°C for 10 hours to remove the base protecting group. After drying in a vacuum rotary concentrator, 10
Dissolve 100μp of mM TEAA buffer (pH 7.5) (10mM triethylamine aqueous solution adjusted to pH 7.5 with acetic anhydride), HPLC (Shimadzu 5Pr)
The synthesized NA was separated and purified using the 1-6^ type). The column is ODS type column (Center 1-Pack NP-31
8.6φ), apply the gradient end shown in Table 1 below, and set the flow rate to 1.2 rrl/min. I let it come out.

Table 1 Example of elution pattern [single-stranded DNA (iv) above]
is shown in Figure 1. In this single-stranded DNA (iv), the main peak eluting around 15 to 20 minutes was fractionated and dried in a concentrator. 80% acetic acid (
100 μβ (prepared with acetonitrile) was added, mixed well for 20 minutes at room temperature, the dimethyltrityl group at the 5' end was removed to form a hydroxyl group at the 5' end, and the mixture was dried in a concentrator. 10m
Dissolve in 100 μl of M TRAA (pH 7,5) and add 2
~3 ether extractions were performed. HPI this solution again.
, C to separate the synthesized NA. The elution conditions were similar to the above method, except for the gradient end conditions, which were changed as shown in Table 2 below.

Table 2 □ Example of elution pattern [single-stranded DNA (iv) mentioned above]
is shown in Figure 2. Regarding this single-stranded DNA (iv), the main beak eluting around 10 minutes was collected and dried in a concentrator. This sample was synthesized and used as an NA sample. These operations are performed on each of the single-stranded DNAs described above, and finally each single-stranded DNA has 100 D units (25
A synthesized NA sample with an amount of about 0 μg or more was obtained.

Next, these synthetic NA samples were linked to create the human calcitonin gene. Prepare approximately 0.50 D units of each of the above synthetic NA samples, and test with T4 polynucleotide kinase (Takara Shuzo Co., Ltd.) 10 on a 50ite scale.
The 5' terminal hydroxyl group was phosphorylated with 1100 μM ATP using a unit. These seven single-stranded DNAs were treated with phenol, precipitated with ethanol, dried, and mixed with TE buffer (I0mM l-Lis-HCl buffer PII 8.0, 1 m
M EDT^) Dissolve in 100 μn, mix, and incubate at 65℃ for 2 hours.
After heating for 0 minutes, annealing was performed by gradually cooling to room temperature. When it was confirmed whether annealing was performed by 8% polyacrylamide gel electrophoresis,
A DNA fragment of approximately 130 bp was confirmed. Therefore, we cut out the polyacrylamide gel containing this DNA fragment.
Dounce homogenizer (Wheaton 5cien)
homogenized using 0.5 M
DNA was extracted by adding ammonium acetate (containing ImMEDT8) and an equal volume of TR buffer saturated phenol solution.

After centrifugation, the aqueous phase was precipitated with ethanol, and D
The NA fragment was dried.

On the other hand, the DNA of plasmids pUc119 and pHc118 (manufactured by Takara Shuzo) was digested with restriction enzymes EcoRI and flamH.
Cut with T and perform electrophoresis on 1% low temperature gel agarose (Sigma 11 type ■) to obtain 3.2 Kbp DNA.
The fragments were cut out and heated at 70° C. for 5 minutes, then approximately the same amount of Tp:buffer saturated furanol was added, mixed thoroughly (1), and an aqueous phase was obtained by centrifugation. This aqueous phase was precipitated with ethanol, and the DNA fragments were dried using a concentrator.

The approximately 130 bp DNA annealed with synthetic NA
Approximately 5 μg of the fragment and approximately 1 μG of a 3.2 Kbp DNA fragment derived from p[Ic119 and pUcll, 8 were added to Takara Shuzo D
Ligation was performed using an NA ligation kit.

The obtained plasmid DNA pUcll9-hCT
and pllcllB-hCT, E. coli MV13
04 strain (,1(lac-pro AB), thi, r
psL (strep'), erdA, shc 8
15. hspR4,Δ(srl-recA)306::
TnlO(tet')CF':traD36. p
roAB, Iac IqZ AMI5 ) ) (
[purchased from Takara Shuzo] was transformed. Transformation was performed using the calcium method (Mandel, M., et al., J. Mo1. Bio
1970). 5
0μg/mj! LB solid medium containing thiancillin [Hactodorypton (manufactured by Difco) 1%, Bacto yeast extract (manufactured by Difco) 0.5%, sodium chloride 1%
%, and agarose (manufactured by Difco) 1.5% plate adjusted to pH 7.5 with caustic soda.

(2) Created plasmids pUc119-hCT and p
In order to confirm whether lJCllB-hCT has the planned DNA base sequence, we used the dideoxy method (Mess
ing+J,+Methods Enzymol,,
101, 20.1983).

The transformed MV13Q4 strain was treated with 0.01% thiamin and 150 ml! 2XYT medium containing g/mβ ampicillin (
Batato tributon 1.6%, Hakuto yeast extract 1%, I.lium chloride 0.5%) were inoculated and cultured with shaking at 37°C. Increase i until 0Dbba is about 0.1
At the time point, helper phage M13KO7 (manufactured by Takara Shuzo) was added to m, o, i = about 20, and the culture was further continued overnight at 37°C. 17% by volume of 20% PEG (polyethylene glycol 6000)-2.5M sodium chloride solution was added to the culture supernatant to precipitate single-stranded DNA. The precipitate was dissolved in TF and buffer, treated with phenol, and then dissolved in water. The phase was ethanol precipitated.

After centrifugation, the single-stranded DNA was dried using Takara Shuzo's M13 sequence kit and Amajam's (α-32
P) A dideoxynucleotide enzymatic reaction was performed using dCTP (400 Ci/mmc).

The outline of the reaction is as follows.

E. coli+a r, 15 bp brimer DNA (5') corresponding to part of the coding region of the Z gene
-AGTCACGACGTTGTA-3') was annealed to the above single product r) NA, and using Klenow enzyme,
A DNA extension reaction was performed from the primer. At this time,
For radioisotope rahel [α-”P)-d
Incorporated CTP. In addition, for chain termination, a reaction system was prepared in which ddATP, ddCTP, ddGTP, or ddTTP were added, and the reaction was carried out. A set of four reaction solutions containing each dideoxynucleotide was placed on an 8% polyacrylamide gel (40 cm long, 0.3 mm thick) containing 7.5 M urea for 20 min.
Electrophoresis was performed at a constant voltage of 00 V. After electrophoresis, the gel was adhered to Whatman 3MM paper, dried in a gel dryer manufactured by Hyorathod, and autoradiographed. Using X-ray filter RXO manufactured by Fuji Photographic Film Co., Ltd., the film was left to develop overnight in a room and then developed41). FIG. 3 shows the sequence ladder of pllcllB-hCT. In Figure 3, the lower RamHl is the synthetic T
) It is an insertion site of NA, and a synthetic NA base sequence was present in the upper direction. As a result, it was found that this plasmid had the planned base sequence.

Similarly, it was confirmed that L7 ptlcl19-hCT also had the planned base sequence.

(3) The Iac,'Z gene was linked to the obtained human calcitonin gene--the gene corresponding to the collagenase cleavage site to create the human calcitonin-1ac'Z gene (see Figure 4).

MV13 with 7”-7 Sumi FpUC119-hCT
04 strain containing 77 picillin 50μg/m1■
Bacterial cells were obtained by culturing with shaking at 37°C for one day and night in B medium (a medium obtained by removing agarose from the L R solid culture described in ``1''), followed by alkaline extraction method (Rirnboim, 11.c, etc., 1luc1. ^c, id Res, 7°1513, 1
979) was used to isolate and prepare plasmid DNA. This DNA was digested with restriction enzymes, RamHI and Σ1
1, a 3.3Khp DNA fragment was confirmed by 1% agarose gel electrophoresis using low-temperature gel agarose, and the DNA fragment was separated and purified by the method described above.

On the other hand, plasmid pMC874 (Casadaban,
M, J, et al., J, Bacteriol, 143,97
1.1980) DNA was treated with restriction enzymes amHI and ΣI.
6. Cut with I and contain the lac'Z gene in the same way.
A 2 Kbp DNA fragment was obtained.

The two DNA fragments obtained by these treatments were ligated using the above ligation kit to create plasmid pUC.
119-hCT-1ac'Z was obtained.

Using this plasmid, E. coli strain M15 (Δ(lac
-pro) thi φ80d IacZM15.
ara, rpsL.

rec^) [purchased from Amajam] was transformed by the method described above. L containing ampicillin 50μg/ml
Colonies that could grow on the B and B medium were grown sufficiently on the I and B medium supplemented with ampicillin at 50 μg/mn, and plasmid DNA was obtained. It was confirmed by agarose electrophoresis after the cleavage that this plasmid DNA was cleaved at 2 sites with the restriction enzymes EcoRI, 2 sites with Σacl, 1 site with BamHI, and 1 site with U■. Also, at this time, 3.2 Kh in Oiku R■
p and 6.3 Khp DNA fragment, Σ赳l is 2. I
Kbp and 7.4 Kbp DNA fragments were obtained. These results revealed that the human calcitonin-1ac'Z gene was produced as planned.

12: Human calcitonin - In order to obtain a precursor for amidation of human calcitonin in the same manner as in 1, a gene encoding a human calcitonin-collagenase cleavage site peptide-desthiobiotin synthase fusion polypeptide was generated. Using the same concept as in Example 1, the amino acid sequence of the fusion polypeptide was designed as follows.

Cys-Gly-^sn-Leu-5er-Thr-C
ys-Met-Leu-Gly-Thr-Tyr-Th
r-Gln-^5p-Phe-85n-Lys-Phe
-His-Thr-Phe-Pro-G In-Thr
-A la-11e-G Iy-Va l -G Iy
-A Ia-Pro-Gly-Gly-Pro-Leu
-Gln- (hereinafter, 53 from the N-terminus of desthiobiotin
C-terminus from the amino acid residue (21111 from the N-terminus)
Sequence of amino acid residues up to the th amino acid residue].

A gene corresponding to this amino acid sequence was designed as follows. Note that ATG for translation initiation was added to the 5' end.

For the bio'D gene, a restriction enzyme-based 1-11indTn fragment 600hp of the plasmid pK)IN31 (Japanese Patent Application No. 60-296646, Kaikoken Bibliography No. 8586) was used. Furthermore, a gene encoding calcitonin with a collagenase cleavage site added was constructed using chemically synthesized NA in the same manner as in Example 1.

The fusion gene was prepared according to the procedure shown in FIG. 5, and the experimental operations were performed according to the method shown in Example 1.

It was confirmed by determining the DNA base sequence in the same manner as in Example 1 that the obtained plasmid DNA contained the gene as planned.

An expression plasmid for expressing the hCT-1ac'Z fusion gene prepared in Example 1 in E. coli was prepared. As the E. coli expression promoter, the tac promoter derived from plasmid pKK223-3 (manufactured by Amajam) was used. The manufacturing procedure is summarized in Figure 6. Further, the experimental operation was performed according to the method shown in Example 1.

Plasmid pBR322 (Peden, K., G.
ene+ 22+ 277+ 1983) with restriction enzyme F
, cleaved with coRT, Klenow enzyme (manufactured by Takara Shuzo) and 1
The cleavage site was made into a blunt end using 00mM dATP and 100mM dTTP. pBgl n linker
[Manufactured by Takara Shuzo, d(pC-A-G-A-T-C-T-G)
] was inserted at the cutting point and ligation was performed. At this time, the molar ratio of pBR322 DNA and linker-1')NA was approximately 1:10046). BamH of the obtained plasmid pBR322・Bg
A 6.2 kbp BamHI-Sal I fragment containing the IacZ gene derived from pMC874 was inserted into the r-bulb 11 site to obtain plasmid pZT1.

On the other hand, ρUC119-hC
T-1ac'Z-derived hCT gene tanran R1-1 fallen HI
The 130 bp fragment was inserted in the same direction as the promoter to obtain plasmid pKK223-3hCT.

Next, the degradation of plasmid pZT1-Hind
At the IIT site, Ptac derived from pKK223-3hCT
- Contains the hCT gene.

In addition, a 5Khp DNA fragment was inserted into pZT21. Furthermore, plasmid pUC119-
From hCT-Iac'Z, a 90 bp DNA fragment containing the collagenase cleavage peptide site was separated from polyacrylamide gel, and plasmid pZT was isolated from hCT-Iac'Z.
21 at KLI-B atn HI position 68, human calcitonin-collagenase cleavage site peptide-
Escherichia coli expression plasmid ρ7 of β-galactosidase fusion polypeptide. Obtained T31. The resulting plasmid pZ
T31 was confirmed by the presence of the restriction enzyme site shown in FIG. 6 at the expected position. Also, 0.002%5
- When E. coli strain M15 containing this plasmid is grown on an LB solid medium containing -bromo-4-chloro-3-indolyl-β-galactopyranoside, the colonies turn blue, indicating that β-galactosidase is the production regulator. I also confirmed that.

Furthermore, Ushinami R1 of plasmid ρKK223-3hCT
By applying 81 nuclease (manufactured by Boehringer Mannheim) to the cleavage site to make blunt ends, and by religating the ends, the plasmid p, which lacks the oRI recognition site, is created.
KK233-3hCT (2) was obtained. 4 shown in example 1
It was a sequence with a base deletion. As a result, pKK223-
In 3hCT, the SD sequence of Ptac (de Boer,
It, 8, 1st class, Proc, Nat, 8 cad, sci
, UsA, 7B, 21.1983) and hCT, whereas pKK233-3hCT
In (2), it was 9 bp. This plasmid pKK2
Using 33-3hCT (2) (4B) and according to the procedure shown in FIG. 6, an Escherichia coli expression plasmid pZT32 of a human calcitonin-collagenase cleavage site peptide-β-galactosidase fusion polypeptide was obtained. The restriction enzyme map is on p7. ptaC of Ta2, and hC
The F between T and coRT sites are missing. When the obtained plasmid pZT32 DNA was digested with each restriction enzyme, the results matched this restriction enzyme map.

It was also confirmed that it exhibited β-galactosidase activity like pZT31.

An expression plasmid for expressing the hCT-bio'D fusion gene prepared in Example 2 in E. coli was prepared. The manufacturing procedure is summarized in Figure 7. Experimental operations were performed according to the methods shown in Examples 1 and 3.

CoR of plasmid pKK223-3 carrying Ptac
I-.

At the HindII site, plasmid pUc119-hC
hCT-bio'll fusion gene derived from T-hio' D, namely EcoRI-Hind m O,7Khp
The DNA fragment was inserted to create an Escherichia coli expression plasmid pBcT31 of a human calcitonin-collagenase cleavage site peptide-desthiobiotin synthase fusion polypeptide. It was confirmed that the obtained plasmid DNA had restriction enzyme sites as shown in the restriction enzyme map shown in FIG.

Furthermore, between Ptac and hCT, the E. coli lipoprotein gene LI! An E. coli secretory expression plasmid was prepared by inserting the signal peptide coding portion of P.

The signal peptide of lipoprotein is known to have the following amino acid sequence (Inouye, S.

etc., Proc, Natl, 8cad, sr, i, L
ISA, 74, 1004.1977).

Net-1, ys-8Ia-Thr-1, ys-Leu
-Val-Leu-Gly-Ala-Val-11e-
Leu-Gly-8er-Thr-Leu-Leu-81a-Gly-Cys-.=↑ Signal peptidase cleavage site Therefore, we investigated the production of polypeptide F in which human calcitonin was linked to the C-terminus of this signal peptide. A gene was designed to coat a polypeptide in which Cys at the N-terminus of human calcitonin was linked to glycine at the signal peptide cleavage site, and DNA synthesis was performed according to the method shown in Example 1. Here, since plasmid pBcT31 was used for the 3' side of the string 1 site of hCT, the synthesis was carried out with
The test was performed on the 5' side of the yu site. The base sequence of the DNA actually synthesized is shown below.

↑ The synthetic gene prepared with a parallel R1 cut end is inserted into the E of plasmid 'pRCT3].
coRI-1 site, human calcitonin-
Escherichia coli secretion expression plasmid pB of collagenase cleavage site peptide-desthiohyothine synthase fusion polypeptide
CT33 was produced. pRCT33 plasmid
1-Bandan I 180hp to pUc119's Tannami RI-P
st1 site and the DNA according to the method shown in Example 1.
When the base sequence was confirmed, the base sequence was incorporated as planned.

Next, in the same manner as in Example 3, the SD sequence of Ptac and hC
Expression plasmids 'pBCT32 and pBCT34 were constructed in which the interval between T translation initiation ^TG (pRcT31) or lpp translation initiation ATG (pRCT33) was shortened. As a result of confirming the base sequence, pKK223-3hC
Similar to T(2), both plasmids contain F, coR1
A 4 bp deletion was confirmed at the site.

hCT-1ac'7. produced in Example 1. An expression plasmid was created to express the fusion gene in Saccharomyces yeast. As the yeast expression promoter, the yeast GAL7 (gene encoding caractose monophosphate uridyl transferase) promoter (Japanese Patent Application Laid-open No. 248181/1981) was used. Yeast multicopy plasmid pMT34-3 (
Tajima, M et al., Mo1. Ce11. Riol
, 6, 246° 1986), the GAL 7 promoter, which consists of 271 bp upstream of the transcription start point of the G AT 7 gene and 3 hp downstream, was converted into a Bam HI-
It has a structure that can be cut out with dH. 4 of this plasmid
A yeast expression plasmid was prepared by ligating the hCT-1ac'Z fusion gene downstream of the n site.

An outline of the procedure for producing this plasmid is shown in FIG.

Experimental operations were performed according to the method shown in Example 1.

According to the method performed with plasmid pRR322-J,
A plasmid pUc]19-hCT-Rg was prepared by converting the ordinary R1 site of pUc119-hCT to r<Irt. At the death ■-Σ11 site of p M T 34-3, p
Bgl n -Sal I 130hpDNA containing hCT derived from Uc119-hCT-BgDNA
The fragment was inserted to obtain pMT34-3hCT. In the NikaiT-SalT site of the obtained plasmid, plIC
hCT-1a derived from 119-hCT-1ac'Z DNA
Phase 1-Sal T 6.3 containing c'Z iii gene
By inserting Khp, human calcitonin-collagenase-
A yeast expression plasmid l'pMT]34-3 of the β-galactosidase fusion polypeptide was obtained.

When the DNA base sequence was confirmed, the translation initiation ATG of hCT was located 16 bp downstream of the transcription start point of the G A L 7 gene.
Eight of them were connected. The base sequence of ATG from the transcription start point was as follows.

Expression plasmid pZT31 produced in Examples 3 to 5
．． pZT,'(2, pRcT31, pBcT32
, in E. coli for pRc1'33 and pRCT34, and in E. coli for plasmid p? lT134-3 was expressed in Saccharomyces yeast.

E. coli strain M2S was used and transformed with each plasmid by the method shown in Example 3. The transformed strain was incubated with 10 mff containing ampicillin 100 tt g/mR.
Inoculate into LR medium and incubate for 30 minutes until ODl, 60 becomes approximately 1.
Cultured with shaking at °C. 5m7 of culture solution! The mixture was divided into two test tubes, and 1 mM TPTG (isopropyl-β-〇-thiogalactopyranocytes was added to one test tube), and the other was left as it was, and the shaking culture was continued at 30° C. for an additional 5 hours.

After culturing, the cells were collected by centrifugation and washed once with sterile water to obtain a cell suspension.

In the case of a transformed strain using a non-secreting plasmid, the above cell suspension was diluted with 10mM) Lis-HCl buffer (pH 8,
0) 1mM EDTA -0,1mM DTT
(dithiothreitol) and the bacterial cells were dispersed. The suspension was sonicated to disrupt the bacterial cells, and a cell extract was obtained by centrifugation. On the other hand, secretory plasmid pBcT33
For the transformed strains using pBCT34 and pBCT34, periplasmic fractions were prepared by the osmotic shock method. That is,
After centrifuging the cell suspension after washing with water, 20%
Sucrose - 30mM) Lis-HCl buffer (pH 8,0) -
Dispersed in 1mM EDTA. A precipitate was obtained by centrifugation, dispersed in cold water, and subjected to osmotic shock.

A supernatant was obtained by centrifugation and used as a periplasm fraction.

The following quantitative test was conducted on the obtained extract.

(i) Quantification of human calcitonin Calcitonin kit manufactured by the First Radioisotope Research Institute
It was quantified by radioimmunoassay using "No. 1".

The operating procedure followed the instruction manual.

(ii) Quantification of β-galactosidase 0NPG (o-
Miller's method (Miller, J, Il, +Exp, Mol
.

Gen, Col1d Spring trough L
ab, Press Co1d Springtlarh
or, NJ, p352.1972).

The activity was expressed as 1 unit of enzyme activity required to decompose 1 nmole of 0NPG in 1 minute at 28°C.

(iii) Quantification of protein amount by Lowry method (Lowry, 0.H, et al., J. Bio.
Chem, +193+265, 1951). A calibration curve was prepared using bovine serum albumin (manufactured by Sigma, fraction ■).

The quantitative results are summarized in Table 3.

On the other hand, plasmid pMT134-3 was transferred to Saccharomyces yeast MT8-1 strain (Sat, Sen [, Gu, Ko, Kobato 1 crime, Fart) (
Tajima, M et al., Mo1. Ce11. Biol,
6.246.1986). Transformation was performed using the lithium chloride method (Ito, )I.

et al., J. Bacteriol., 153, 163.1
983) using minimal medium without uracil [
0.66% amino acid removed yeast nitrogen source base (manufactured by Difco), 0.5% casamino acids (manufactured by Difco), 0.00
2% I, -tryptophan, 0.004% adenine sulfate, 2% glycerol, 2% sodium lactate, 2% agarose (hereinafter, this medium will be referred to as S Gly Lac solid medium, and the medium without agarose will be referred to as S Gly 1. (referred to as ac medium)]. The obtained transformed strain was divided into 10m7! inoculated into S Gly Lac medium of
Shaking culture was performed at 30°C. Bacterial cell amount is 107/mβ
The culture solution was divided into 5 mp portions, 2% galactose was added to one portion, and the culture was further continued at 30° C. for 6 hours. After culturing, bacteria were harvested, and a cell extract was obtained in the same manner as the above-mentioned method for obtaining the E. coli cell extract. Furthermore, similar to E. coli hyphae, (i) quantification of human calcitonin, (I
1) Quantification of β-galactosidase and (iii) quantification of protein amount were carried out, and the results are shown in Table 3.

It was confirmed that calcitonin production increases in both E. coli and yeast by promoter induction. Furthermore, in the E. coli secretion vector system, the calcitonin fusion protein was also shown to be transferred to the periplasmic fraction, indicating that the signal peptide was functional.

The transformants created in this example, E. coli M2S strain (pZT32) and E. coli M2S strain (pBcT34'
1 have been deposited at the National Institute of Industrial Science and Technology 441, respectively. The accession numbers are Keioken Bokuyori No. 9266 and Keikoken Bikoyori No. 9267, respectively.

, 1. Margin Table 3: Expression of human calcitonin fusion polypeptide expression plasmid by E. coli and yeast.Escherichia coli strain M15 transformed with calcitonin-cola f history 2 proximal plasmid pZT32 was transformed into 5β Jafa Mentor
(manufactured by Marubishi 01) and cultured for 21 days.

The medium shown below was used.

Na211PO+ ' 1211□0 1.8
%Kll□PO40,2% (NI14)2S04 0.2% Yeast extract 0.5% Hactopeptone (Dirco) 0.5% Mg5
Oa・71120 0.01% Grape #N
O, 5% ampicillin
150trrr/mj! Ampicillin 150μ
g/m 7! 2 m7 of bacterial solution pre-cultured at 30°C overnight in I-B medium containing was inoculated into the above medium and heated at 30°C.
It was cultured in The culture was continued after aeration with air at 1 vvm and adjusting the medium p++ to 7.0 with caustic soda. When OD rho = 2 after 4 hours of culture, r
1mM PTG? Added once. Furthermore, the culture was continued for 6 hours, and the bacteria were collected by centrifugation at 0 Db. After washing with sterile water, the bacterial cells were washed with 10111M Tris-HCl (pH 8,0) -1
The cells were suspended in mMEDT^-0 and 1mM DTT, and the cells were disrupted using an X-press (manufactured by Hachi11 RIOX).

The supernatant obtained by centrifugation was used as a cell extract.

The human calcitonin fusion polypeptide was purified using β-galactosidase activity as an indicator.

First, ammonium sulfate was added in a 40% saturation amount, and the temperature was increased to 4°C.
After standing for one night, a precipitate was obtained by centrifugation.

Almost 100% of the β-galactosidase activity was recovered in this (0 to 40% saturated) ammonium sulfate fraction, and the specific activity increased approximately 1.8 times. Next, it was desalted by ultrafiltration using a type PT filter manufactured by Millibore, and further purified by ion exchange column chromatography using DEAR-Sepharose C1,-6B (manufactured by Pharmacia). Elution buffer is 10mM Tris-HCl buffer (pH 7.4)
10mM mercaptoethanol and 10mM magnesium chloride were used. As shown in the elution pattern in Figure 9, at the time when non-adsorbed proteins were eluted, sodium chloride (250 m
A linear concentration gradient (indicated by the broken line in FIG. 9) was applied to elute the adsorbed protein. In Figure 9,
A β-galactosidase activity measured by Miller's method
4□. .

(-) indicates the Lowry method (Lowry, 0,
If, et al., J.

The protein amount measured by Riol, Chem, 193, 265.1951) is shown as A75O11, (.-). A calibration curve for the Lowry method was prepared using bovine edge albumin (manufactured by Sigman Co., Ltd., fraction ①). Varaxidin N
An activity peak was observed around 0.30. Therefore, fractions 11h30 and Na31 were treated as purified fluorescent fractions.

The behavior of specific activity resulting from the above treatment is shown in Table 4 below.

Table 4 in the margin below: Purification increased the specific activity by about 6 times to 160,000U.
/■ Became a protein. For purified samples, Laemml
i's method (Laemmli, Il., Nature
, 227,680°1970) 12%5DS-
Polyacrylamide gel electrophoresis (SO3-PAGE)
I did it. Staining was performed with Coomassie brilliant blue. As the molecular weight marker, a molecular weight marker (Kiso) 30,000 to 200,000 manufactured by Sigma was used.

As shown in FIG. 10 after DEAE-Sepharose treatment (I) and molecular weight marker (2), it was significantly purified.

Hunt around 116 KDa accounted for more than 50% of the total protein. The molecular weight marker of 116 KDa is β-galactosidase. The fusion protein was also observed at almost the same location. This is thought to be because the molecular weight of the calcitonin-collagenase cleavage site peptide is 4WDa, so when it is fused to β-galactosidase, the difference in molecular weight becomes almost undetectable.

The human calcitonin-collagenase cleavage site peptide-β-galactosidase fusion polypeptide purified in Example 7 was specifically degraded using collagenase to obtain a human calcitonin C-terminal glycine adduct. Clostricheme peptidase manufactured by Ohno Pharmaceutical was used as collagenase. The reaction solution composition is shown below.

5mM calcium chloride 50mM Tris-HCl buffer pl+7.5200mM
Sodium chloride 10mM N-ethylmaleimi F IINZ/rl! Purified fusion protein preparation 100 units/mβ Collagenase enzyme reaction was carried out at 37°C for 15 hours, and Il 111. C
The reaction product was confirmed. ■For circles and C, as in Example 1, 5PD-6A manufactured by Shimadzu Corporation was used, and the column was ODS.
Kabucilback C-184, 6φ manufactured by Shiseido was used. Elution was performed at a flow rate of 1.5 ml/min by applying a linear concentration gradient under the conditions shown in Table 5 below.

Table 5 Under these conditions, human calcitonin standard reagent (manufactured by Sigma)
eluted after 15.9 minutes. Figure 11 shows the elution pattern of the collagenase reaction solution, and the unreacted solution (reaction 0 minutes).
The one shown in Fig. 12. In the reaction solution pattern, 1
At 3.6 minutes (peak A), 16.0 minutes (peak B), and 17.9 minutes (peak C), reaction decomposition products that were not seen in the pattern of the unreacted liquid were detected. The elution time of peak B almost matched the elution time of the human lucitonin standard reagent. Furthermore, after the reaction decomposition product of peak B was separated and freeze-dried, the amino acid sequence was confirmed using a gas phase protein sequencer (Model 470A manufactured by Applied Biosystems), and the sequence was as follows. It was found that it corresponds to a C-terminal glycine adduct of human calcitonin.

X-Gly-Asn-1,eu-5er-Thr-X-
Met-Leu-Gly-Thr-Tyr-Thr-G
ln-85p-Phe-Asn-Lys-Phe-11
is-1゛hr-Phe-Pro-Gly-Thr-A
la-11e-Gly-sial-Gly-to 1a-Pr
o-Gly (X means unknown).

As described above, a human calcitonin C-terminal glycine adduct was efficiently obtained. This human calcitonin C-terminal glycine adduct is produced by C-terminal amidation enzyme (Bradury,
8, Fl et al., Nature, 298.686.1982
) can be easily converted to human calcitonin. When the amino acid sequence of the degradation product of peak C was similarly confirmed, it was found to be a C-terminal glycine adduct of human calcitonin with methionine added to the N-terminus.

[Brief explanation of drawings]

FIG. 1 is a graph showing the IIPLC elution pattern of the product after deprotection of the single-stranded DNA (iv) of Example 1. FIG. 2 is a graph showing the elution pattern of IIPLc for the product after aliquoting the sample of FIG. 1 and removing the trityl group. FIG. 3 is a photograph in place of a drawing showing the sequence ladder of pUc118-hCT. Figure 4 shows plasmid pLIC119-hCT-(J
FIG. 2 is an explanatory diagram showing the procedure for producing ac'Z. In the figure, arrows indicate the direction of transcription. Figure 5 shows plasmid pHc119-hCT-hio'
It is an explanatory view showing a manufacturing procedure of D. FIG. 6 is an explanatory diagram showing the procedure for producing Blasumi FpZT31. Figure 7 shows plasmids pBcT31 and pRCT32.
, pBCT33. FIG. 3 is an explanatory diagram showing the procedure for producing pBCT34. FIG. 8 is an explanatory diagram showing the procedure for producing yeast expression plasmid pMT134-3. Figure 9 shows the results of DEAE-Sepharose CL-6B ion exchange column chromatography. It is a graph showing a discharge pattern. FIG. 10 is a photograph in place of a drawing showing the results of 12% 5DS-PAGE of a purified calcitonin fusion polypeptide sample. FIG. 11 is a graph showing the elution pattern of IIPl and C for a sample in which the calci I/nin fusion polypeptide was treated with collagenase. FIG. 12 is a graph showing the elution pattern of 11P1,C for a sample of calcitonin fusion polypeptide before collagenase treatment. ori... E. coli replication initiation region; old 31G...M
13 Phage recombination region; Amp'...Johong gene; Km"...Kanamycin resistance gene region;
tet'...tetracycline resistance gene region;
rrB...transcription termination region of rrB liposomal RNA;
2μori...Replication initiation region of yeast 2μ plasmid. Figure 10; millet 11 forks

Claims (1)

[Claims] 1. General formula (I) A-proline-B-glycine-proline-C (I) (where A and C each represent a polypeptide having two or more amino acid residues, B represents one amino acid residue, - represents a peptide bond, and proline represents L
A gene encoding a polypeptide represented by 2. The gene according to claim 1, wherein A is a polypeptide up to 31 amino acid residues from the N-terminus of calcitonin, and B is a glycine residue. 3. The gene according to claim 1, wherein A is a polypeptide up to 31 amino acid residues from the N-terminus of human calcitonin, and B is a glycine residue. 4. C encodes E. coli β-galactosidase￥l
The gene according to any one of claims 1 to 3, which is the acZ\ gene. 5. The gene according to any one of claims 1 to 3, wherein C is the \bioD\ gene encoding Escherichia coli desthiobiotin synthase. 6. General formula (I) A-Proline-B-Glycine-Proline-C (I) (Here, A and C each represent a polypeptide having two or more amino acid residues, and B represents one amino acid residue. residue, - indicates a peptide bond, and proline indicates L
An expression plasmid DNA characterized in that it contains a gene encoding a polypeptide of the following type, linked downstream of an expression promoter. 7. Expression plasmid DN according to claim 6, wherein the expression promoter is E. coli\tac\ promoter
A. 8. The expression plasmid DNA according to claim 6, wherein the expression promoter is the \GAL7\ promoter of the yeast Saccharomyces cerevisiae. 9. Claim 6 of the secretory type patent, in which a gene encoding a signal peptide portion of a secretory protein of a microorganism is inserted between the expression promoter and the gene of general formula (I) with codon reading frames aligned. Expression plasmid DNA of
. 10. The expression plasmid DNA according to claim 9, wherein the signal peptide gene is from the \lpp\ gene encoding E. coli lipoprotein protein. 11. General formula (I) A-Proline-B-Glycine-Proline-C (I) (Here, A and C each represent a polypeptide having two or more amino acid residues, and B represents one amino acid residue. residue, - indicates a peptide bond, and proline indicates L
A microorganism transformed with an expression plasmid containing a gene encoding a polypeptide shown in (type) linked downstream of an expression promoter. 12. The microorganism according to claim 11, wherein the microorganism is Escherichia coli. 13. The microorganism according to claim 11, wherein the microorganism is the yeast Saccharomyces cerevisiae. 14. General formula (I) A-Proline-B-Glycine-Proline-C (I) (Here, A and C each represent a polypeptide having two or more amino acid residues, and B represents one amino acid residue. residue, - indicates a peptide bond, and proline indicates L
polypeptide of type ). 15. General formula (I) A-Proline-B-Glycine-Proline-C (I) (Here, A and C each represent a polypeptide having two or more amino acid residues, and B represents one amino acid residue. residue, - indicates a peptide bond, and proline indicates L
The above-mentioned general formula (I) is characterized in that a microorganism transformed with an expression plasmid containing a gene encoding a polypeptide represented by A method for producing a polypeptide. 16, General formula (I) A-Proline-B-Glycine-Proline-C (I) (Here, A and C each represent a polypeptide having two or more amino acid residues, and B represents one amino acid residue. residue, - indicates a peptide bond, and proline indicates L
A microorganism transformed with an expression plasmid containing a gene encoding a polypeptide of the general formula
) is treated with collagenase to form the polypeptide of the general formula (
I) A method for producing a polypeptide, which comprises cleaving between B and glycine. 17. The method according to claim 16 for producing a human calcitonin C-terminal glycine adduct.