JPS63196299A - Fused protein - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] The present invention relates to the construction of fusion proteins.

Hepatitis B virus is a partially double-stranded DNA virus with a 3200 nucleotide genome. This viral DNA is the core antigen encoded by the virus (
HBcAq), and this core antigen is enveloped by similarly encoded surface antigens (Robin
Son, 1977), surface antigens are removed by gentle treatment with detergent, leaving a core particle of diameter 27n11 consisting of HBcAg and viral DNA. So far,
HBcAq is expressed in the microbial Ill vector in the form of a natural polypeptide and as a derivative fused to the terminal eight residues of β-galactosidase (Hurray
et al., 1984).

When synthesized in E. coli, the core protein self-associates to form 27ni particles, which can be seen under electron microscopy at
-iu can be seen (Cohen & Richmond,
1982) and showed no immunogenicity in experimental animals (5ta
hl et al., 1982). The amino acid sequence of the core antigen exhibits a region of homology near its carboxy terminus with that found in protamine (a DNA binding protein).

As a result of speculation, it has been hypothesized that the above region of the molecule interacts with DNA when the core particles are associated (Pa5ek et al., 1979).

We have previously shown that immunogenic epitopes of foot-and-mouth disease virus (FMDV) can be expressed as fusion proteins to β-galactosidase in bacterial systems and in cells infected with recombinant vaccinia virus. (Winter et al., 1986; Newton
et al., 1986), the active form of β-galactosidase exists as a tetram, so the format of the fusion was such that only four copies of the FMDV sequence were present in each complex; It is only about 2% of the weight of .

Furthermore, animals vaccinated with recombinant vaccinia virus failed to produce neutralizing antibodies (New
(1986), the reason for this poor response is thought to be that β-galactosidase is expressed in the cytoplasm.

To improve the presentation of FMDV epitopes to the immune system, we fused FM[)V sequences to HBcAg. A DNA sequence encoding a fusion protein in which FMDV VP1 residues 141 to 160 were linked to the amino terminus of -IBcAa (respectively) was constructed. The fusion gene sequence was introduced into the vaccinia virus genome. Cells infected with this recombinant virus strongly expressed the above-mentioned fusion protein.

This recombinant protein self-assembled into particle structures. These have a high density of externally exposed F M D V epitopes. Expressing the FMDV epitope in this way allows it to be presented in a more virus-like form.

This approach for exposing antigenic epitopes to the immune system has general applicability. Therefore, the present invention:
A DNA sequence encoding a fusion protein in which a non-corresponding antigen epitope is linked to the amino terminus of HBCAG is provided.

For expression of the fusion protein, the DNA sequence is introduced into an expression vector. The DNA sequence is introduced into a vector such that when provided in a suitable prokaryote or eukaryote, the vector is capable of expressing the fusion protein. The vector may be a plasmid. In addition, the vector is DNA
It is also possible to use a viral vector into which the sequence has been integrated, such that the fusion protein is expressed by cells infected with the vector. The fusion protein is obtained in the form of particles. Fusion proteins are used as vaccines. Thus, the vaccine is comprised of a fusion protein and a physiologically acceptable carrier or diluent.

The uncorresponding epitope is fused to the amino terminus of HBcΔq, as expected from the apparent involvement of the carboxy terminus of HBC/'l in DNA interactions at the core of hepatitis B virus. Epitopes may be fused directly to HB CA g. Alternatively, non-corresponding epitopes can be fused to HBcAg via an intermediate linker. Such linkers may be composed of one or more, for example up to 10, amino acid residues. The Brecoa HBCAGI signal amino acid sequence, which is normally located immediately before the amino terminus of HBcAg, may therefore be omitted from the fusion protein, or a portion thereof may constitute the linker.

At the amino terminus of the non-corresponding epitope, one or more amino acid residues may be present before the MetTA group corresponding to the translation initiation codon.

Any unmatched antigen epitope can be fused to HBcAg. The term non-corresponding means that it is an epitope other than that of H8cAa.

The size of the epitope can be from 4 to 26 amino acid residues. Two or more unmatched antigenic epitopes can also be provided. In this way, multivalent vaccines can be obtained.

The non-corresponding epitope can be a viral, bacterial or protozoan epitope. Examples of viral epitopes include FMDV, poliovirus, human rhinovirus, influenza virus and hepatitis B surface antigen (H
BsAo). Protozoa that can use epitopes include the malaria parasite Plasgiodi
ui falci arum is included.

The major EMDV antigenic sites correspond to amino acid residues 141-160 and 200-213 of the VP1 capsid protein. Therefore, any of these sequences or positions of amino acid residues may constitute a non-corresponding antigenic epitope. portions of these sequences, e.g. residues 142-145
．． 146-151.142-151 or 142-16
0 can also be an antigenic site. EMDV O
Type 1 VP1 amino acid residue 1
Suitable NA constructs introducing 42-160 and their corresponding amino acid sequences are shown below in single letter symbols.

TTTTTTTCT8TGCT^TA ATGAATT
Promoter in CAGCTP11
HNSACCG^^CCTGCGTGGTGACCT
GCAGGTTCTGPNLRGDLQVL [VPI GCTCAGAAAGTTGCTCGTACCCTGC
CGGGA 80KVAR Ding LPG VP1] [GCTCCGGATCCGGCGCCCTTαGGT
GGC ding■A P D-P R8
LGWL linker] [ TGGGGC＾TGGAC＾TTG8CCCTT＾■＾
^8 To GAAW To 14 To OrOP KE Hepatitis B Core Antigen T T T ------ The DNA sequence encoding the fusion protein is derived from a plasmid into which a DNA sequence encoding HBcAg, such as the HBcAom gene, has been introduced. Can be manufactured. The DNA sequence encoding the unpaired antigenic epitope to be included in the fusion protein is ligated in the correct framework to the 5' end of HBcAa. A vector capable of expressing this fusion protein is
It can be produced by introducing a DNA sequence encoding a fusion protein into a vector between translation start and stop signals and providing a promoter for the sequence. Transformation of appropriate host cells with such expression vectors produces the fusion protein.

Thus, viral vectors capable of expressing fusion proteins can be produced by introducing a DNA sequence encoding the fusion protein between the start and stop signals in the viral genome and providing a promoter for the sequence. Typically, this involves constructing a shuttle vector in which the DNA sequence encoding the fusion protein is introduced under the transcriptional control of a promoter between translation start and stop signals, and transfecting with that shuttle vector (i!). , infect mammalian cells with a virus, D
Introduce the NA sequence and promoter into the viral genome.

The DNA sequence contains, immediately upstream of the HBcAg gene and in correct framework with it, a
Consists of NA. The DNA sequence and promoter are introduced into the C. quillis getum by homologous recombination. Therefore, appropriate flanking sequences of viral DNA are provided on either side of the DNA sequence and promoter in the shuttle vector. The fusion protein is expressed by cells infected with the resulting recombinant virus.

Shuttle vectors are usually plasmids.

It consists of a replication of bacterial origin that makes it possible to carry out the operations required in step (i) in bacteria, especially in E. coli. The promoter is usually a viral promoter, more preferably a promoter endogenous to the virus in the genome into which the DNA encoding the fusion protein is inserted. Unpaired antigenic epitopes are generally
Manufactured by chemical synthesis and/or cloning. linker-DNA sequence to non-corresponding epitope and 11B
It can also be given during CAQ.

Vaccinia virus system can be used.

A shuttle vector can be constructed by introducing the fusion protein gene under the transcriptional control of the vaccinia promoter. A suitable promoter is the vaccinia 1) 11 promoter. The promoter and fusion protein gene are flanked by vaccinia virus DNA that are not essential for viral replication. Usually thymidine kinase (
A lateral segment of the vaccinia gene of TK) is used.

The fusion protein gene resides between DNA encoding translation initiation and termination signals.

The vaccinia promoter and fusion protein gene are then inserted into the vaccinia genome by homologous recombination. This is usually accomplished by infecting mammalian cells with vaccinia virus, such as the -yeth (LIS vaccine) strain, and transfecting the cells with a shuttle vector. The insertion site is determined by the flanking vaccinia DNAt7 segments of the shuttle vector.

of the wild-type virus by homologous recombination! ! ! Functional TK
The gene is replaced by a non-functional TK gene sequence within which the fusion protein gene is included. The resulting recombinant virus is TK- and can therefore be selected for.

The fusion protein into which the antigenic epitope has been introduced is usually expressed in cells, particularly mammals, infected with a recombinant viral vector, as described below.

Fusion proteins are obtained from cells by conventional methods, such as by disassembling the cells and centrifuging them. The fusion protein self-assembles within the cell to form particles. These particles closely resemble 27 nm core particles consisting of viral DNA and IBG/'Q obtained by denaturing hepatitis B virus. Non-corresponding epitopes are exposed on the outer particle surface.

Fusion proteins can also be obtained using other expression systems. Expression can be carried out in other suitable hosts, prokaryotes or eukaryotes. To this end, it is necessary to select a compatible host, such as one in which the fusion protein is not degraded by endogenous proteases and does not exhibit toxicity to the host. Such hosts can be readily selected by those skilled in the art using routine experimentation if necessary. The present inventors developed the FMDV-HBcAg fusion protein.

It could not be produced in E.coli. The problem clearly appears to be the toxicity of the FMDV sequences we used to bacteria. HBcAg itself is E, col
It can be stably expressed in i. Therefore, what should be controlled is the E of the extra sequences consisting of non-corresponding antigenic epitopes.
, is effective against coli.

E. coli strains can be used as protozoan hosts. Other microbial strains that can be used include bac i l i i
Even if it's a marcesans. various types of pseudo
n+onas species can also be used. Plasmid vectors can commonly be used to transform such hosts. Plasmids generally contain an origin of replication and control sequences derived from a species compatible with the host. Label sequences that allow phenotypic selection of transformed cells are naturally present in the plasmid.

Vertebrate or non-vertebrate cells, preferably mammalian cells, can be used as eukaryotic host cell systems. For example, VERO, HeLa, CHO (Chinese hamster ovary), Wl 38°BHK, C08-7, MDC
Cell lines such as K and cv-i can be used. The expression vector for such cells is *! the origin of l, the promoter located upstream of the gene to be expressed, and any.

It generally contains the necessary liposome binding sites, RNA splice sites, polyazonylation sites and transcription terminator sequences. Preferably, viral promoters are used. Viral vectors as described above can be used, such as the baculovirus expression system.

Eukaryotic microorganisms such as yeast cultures can alternatively be used as host cells. Therefore, 5accharolce
S. cerevisiae strains can also be used. Plasmid vectors such as plasmid YRp7 are commonly utilized for the transformation of such hosts. Any plasmid vector containing a yeast compatible promoter, origin of replication, and termination sequences is suitable.

The fusion protein can be used as a human or animal vaccine. It can be administered in any suitable manner. Oral administration or parenteral administration such as subcutaneous, intravenous or intramuscular administration can be optionally selected, and the usage varies depending on the purpose of vaccination, whether the subject is human or animal, etc. Similar standards exist for physiologically acceptable carriers or diluents used in the manufacture of vaccines.

In conventional dosage forms, carriers or diluents are used.

However, typically 10 to 100 doses of fusion protein are used at a time.
It is administered in 0μ doses, preferably 10 to 100μ per dose, either orally or parenterally.

The invention will now be further illustrated by the following examples.

Two clones were used to construct the fusion protein described by Ken Ken. The clone providing hepatitis B core antigen (HBcAg) is P.

Obtained from former Dr. gMield (pWRL 312
3 = Deposited with NGIB, UK, accession number NClB124
23 is given). This clone has been modified at the amino terminus so that it can be expressed in bacteria as a fusion protein to the E. coli protein TRPE.

01 FMDV 142 from Kaurbeuren
The second clone, which provides ~160 and which is linked to the amino terminus of β-galactosidase, is H0Wint
(pWRL 201) obtained from herl1 (
winter et al.: 1986), the restriction enzyme map of each clone is shown in Figure 1.
The junction between the MDV sequence and β-galactosidase is 3a
Consists of mHI restriction enzyme site. Therefore, this B a m HI site allows the FMDV sequence and HBc
We decided to adopt a plan to skip the fusion of Ag sequences.

Therefore, the first step in the construction was to add B a m l-I to the 5' end of the HBCAG gene of pWRL3123.
was to insert a synthetic oligonucleotide linker for. The site used for insertion of this linker was the NarI site at position 2f290. However, a second Nar engineering site at position 1230 was also present in this plasmid.

Therefore, this plasmid was partially digested with NarI and
A population of plasmid molecules cut at only one NarI site was observed by agarose gel electrophoresis and allowed to be purified. After making the Nar ■ site blunt using the Klenow fragment of DNA polymerase ■, Ba
A synthetic oligonucleotide linker providing an mHI site was ligated to the partial NarI digest and the resulting plasmid was used for transformation of E. coli. Then,
The clones were analyzed for the presence of a BamHI linker at the correct Nar site by constructing a restriction enzyme map.

Such a clone, designated pEB 208, was isolated and the DNA prepared. The length of the 38mHI linker was specifically chosen so that when ligated to the FMDV portion of pWRL 201 (Figure 1), the translation open reading frame was continuous and a fusion protein was produced. Bam
With the insertion of the HI linker, the inserted Nar
Site I was destroyed. Therefore, it was possible to remove the HBcAg sequence from pEB 208 by BamHI-Nar digestion, and a 940 base DNA fragment was obtained. Similarly, the approximately 3.5 kilobase BamHI-NarI fragment from pWRL 201 was purified. These two 7-ragments were ligated together and the correct clone (DFOHc) was identified by restriction mapping.

As is clear from FIG. 1, D F OHC can be expressed in bacterial cells under the control of the tac promoter. Hybrid genetic cotton senior virus (V
V) To facilitate transport into shuttle vectors,
Plasmid 1) FOt-1c was cut at one NarI site and a second ECoRI site was introduced as a synthetic linker. This ensures that the complete hybrid gene is EC0
It became possible to isolate it as an RI fragment.

The Vv rashal vector was pVpll, which was derived from the vector pH3JΔR1A (Newton Haka: 1986) by deletion of the vV sequence. This shuttle vector has a ■v promoter (pllk in this case) inserted within the v■ thymidine kinase (TK) 3W gene.

This vector has promoter and AUG in vvpll.
It has a unique EcoRI site immediately after (Bert
Holet et al.: 1985). ECoRI site and A
UG is in the same translational reading frame as the amino-terminal EC0RI site of the hybrid gene in pFOHc. Gatte, FMDV-HBcAQ gene ha, EC0RI
It was inserted as an EC0RI fragment into the cleaved and dephosphorylated pvp11. Clones with the hybrid gene in pll in the correct orientation with respect to the promoter were identified by restriction Wj cumulative plotting. This clone is p
It was named vFOHc (Figure 2).

This shuttle plasmid was then inserted into the genome of the Wyeth (LJ S vaccine) strain of vv under the control of the pll promoter and by homologous recombination with flanking TK sequences (Hackett et al.; 198
5 a and b). Each progenitor with a TK-phenotype was screened for the presence of FMD-HBCAGI DNA by dot-plot hybridization.

Wild type (1yeth) and recombinant (vFOI-
1c) CV-III cell lysates from infected cells were screened for the presence of core antigen and FMDV sequences by sandwich ELISA. Antigen from infected cells was bound to ELISA plates using either FMD viral particles (1468) or rabbit-induced FMD VPl 141-160 antiserum.

Each of the captured antigens was then combined with the respective guinea pig antiserum and developed with an anti-mottober oxidase conjugate to isolate HBC, FMD 1468.
or examined the presence of the FMD vPl 142-160 epitope. The results are shown in Figure 3. As is clear from FIG. 3, the protein recombinant from the (vFOHc) infected cell lysate was collected with anti-FMDV 141-160 antiserum, and then this protein was collected with anti-HBG, anti-FMDv 14.
1-160 and FMDV anti-pilion serum in sandwich ELISA.

Furthermore, the protein could be purified by ultracentrifugation, suggesting that it is a ligneous particle. This was clearly demonstrated when the centrifugation products were precipitated onto a sucrose density gradient and each fraction was retested by ELISA for the presence of core antigen. Cell lysates from recombinant (vFOHc) cotton cilia virus-infected IIl vacuoles or bacteria expressing the native core antigen were fractionated on a 15-45% sucrose gradient. For each fraction, the presence of core-reactive substances was determined by indirect sandwich ELISA using human anti-core serum as the collection antibody and guinea pig HBC antigen antiserum for detection.
Investigated by. The results are shown in Figure 4. The location where the FMD virus precipitated is also indicated. Figure 4 is HBCA! ;)
A reactive peak was observed at the same location as was observed when core particles expressed in bacteria were centrifuged in parallel. This indicates that the presence of the FMDV vP1142-160 sequence does not interfere with the particle forming properties of the core particles.

The ability of the fusion protein to self-associate into canonical 27 nm core-like particles was confirmed by electron microscopy examination of immune complexes formed with sucrose gradient purified material.

This complex was formed by reaction of FMDV-HBcAa particles with antiserum excited by intact foot and mouth disease virus. This complex was adsorbed to form a coated grid and was not stained with phosphotungstic acid.

As expected from the ELISA data shown in FIG.
Immune complexes were also observed after reaction with antiserum against eMDV7t'141-160.

Finally, we characterized the polypeptides synthesized in cv-'rm cells infected with wild-type vaccinia virus or vFOHC by 35s-methionine labeling of cells and by immunization with HBcAa-reactive serum and PAGE of cell supernatants. It was analyzed by sedimentation. Infection am pulsed with 35S-methionine for 1 hour? A total cell lysate was prepared. Immunoprecipitation of labeled proteins was performed using vaccinia virus antiserum (A,
D), performed with human Hel) B antiserum (B, E) or guinea pig MBC antigen antiserum (C, F). The precipitated proteins were then analyzed by PAGE and fluorography. The results are shown in Figure 5. FMDVVPl 142
The position of the ~16o-HBcAg fusion protein is indicated by an arrow.

As shown in Figure 5, several proteins are recombinant (VHOF
c) From extracts of infected cells, HBCA was specifically precipitated with J antiserum. Two of these proteins (molecule ff
125KD and 20KD) are the complete fusion protein and FMDv vPl 142-16o in which the 5KD fragment was lost by proteolytic digestion from its carboxy terminus.
-corresponds to HBcAg (Mackay et al.: 198
1).

Written by Berthelot et al (1985) PN
AS 822096Cohen and Richn+
ond (1982) Nature 296677-
678 Hackay et al (1981) J.
Hed, Vlrol 8237Hacket et
al (1985a) DNA Cloning,
A Practical Approach (ed.
, Ro, H, Glover) 2 191 [R
L Press Oxford Nackett et al (1985b) Tec
hniQues-in GeneCloning V
ol, 2 Hurray et al (1984) EHBOJ
own 3645-65ONewton et
al (1986) Vaccines 86: Ne
wApproaches to I++++++uni
zation, Co1d Springtlarbo
r Laboratory, 303-309Pase
K et al. (1979) Nature 282
575-579Robioson (1977) An
n, Rev, )licrobial 31Stah
l et al (1982) Proc, Natl.
, Acad, Sci.

tlsA 79 1606-1610Winter
et at (1986) J, In+u
no1. 136 1835

[Brief explanation of the drawing]

FIG. 1 is a diagram showing the construction of plasmid pFOHc. FIG. 2 shows a shuttle vector p v F O with a sequence containing a biphasic start codon separated by 6 amino acids of the FMDV vP1142-160 sequence and the authentic HB Sprea sequence.
It is a figure which shows it C. Figure 3 shows the wild type (Wyet
h) Sandwich ELISA results of cell lysates from recombinant (vFOHc) infected cells are shown. Figure 4 shows the sucrose gradient profile of the core reactive substance. jN5 diagram shows labeling of cells infected with wild-type vaccinia virus and recombinant (VFOHC) with 35s-methionine, immunoprecipitation of cell supernatants with HBcAg-reactive antiserum, and polyacrylamide gel electrophoresis (PAGE).
The results are shown below.

Claims (19)

[Claims] (1) A fusion protein in which a non-corresponding antigen epitope is linked to the amino terminus of HBcAg. (2) The fusion protein according to claim 1, wherein the non-corresponding antigen epitope is directly fused to HBcAg. (3) The fusion protein according to claim 1, wherein the non-corresponding antigen epitope is fused to HBcAg via a linker having from 1 to 10 amino acid residues. (4) The fusion protein according to claim 1, wherein the non-corresponding antigen epitope is a viral, bacterial or protozoan epitope. (5) The fusion protein according to claim 4, wherein the antigenic epitope is an epitope of a foot-and-mouth disease virus, poliovirus, human rhinovirus, influenza virus, or hepatitis B virus surface antigen. (6) Antigen epitope is ¥Plasmodium fa
5. The fusion protein according to claim 4, which is an epitope of lciparum. (7) A vaccine comprising an effective amount of the fusion protein according to claim 1 and a physiologically acceptable carrier or diluent. (8) A DNA sequence encoding a fusion protein in which a non-corresponding antigen epitope is linked to the amino terminus of HBcAg. (9) The DNA sequence according to claim 8, wherein the corresponding antigen epitope is directly fused to HBcAg. (10) The DNA sequence according to claim 8, wherein the non-corresponding antigen epitope is fused to HBcAg via a linker having from 1 to 10 amino acid residues. (11) The DNA sequence according to claim 8, wherein the non-corresponding antigen epitope is a viral, bacterial or protozoan epitope. (12) The DNA sequence according to claim 11, wherein the antigenic epitope is an epitope of a foot-and-mouth disease virus, poliovirus, human rhinovirus, influenza virus, or hepatitis B virus surface antigen. (13) The antigen epitope is ¥Plasmodium f
The DNA sequence according to claim 12, which is an epitope of alciparum. (14) A vector into which the DNA sequence according to claim 8 is incorporated, and which is capable of expressing the fusion protein when introduced into a suitable host. (15) Claim 14, which is a virus vector
Vectors described in section. (16) The vector according to claim 15, which is a recombinant vaccinia virus into which the DNA sequence has been integrated. (17) The vector according to claim 15, which is a plasmid. (18) A host into which the vector according to claim 14 has been introduced. (19) The host according to claim 18, wherein the vector is a viral vector and the host is a mammalian cell system.