JPS63119692A - Novel human tnf polypeptide variant - Google Patents

Abstract

PURPOSE:To produce a human TNF polypeptide, by culturing a host transformed with a vector produced by integrating a DNA having a base sequence coding a polypeptide having a specific amino acid sequence into a vector. CONSTITUTION:A DNA fragment having an initiation codon ATG at the 5' terminal and a termination codon at the 3' terminal of a DNA having a base sequence coding a polypeptide variant and the DNA itself is prepared beforehand. The fragment is bonded successively to a proper promoter and an SD sequence. The product is integrated into a vector to obtain an expression vector for the production of a polypeptide variant. The expression vector is introduced e.g. into E.coli and the obtained transformant is cultured under a proper condition to produce the objective polypeptide variant.

Description

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to a novel human TNF polypeptide variant, a method for producing the same, and a DNA encoding the variant.
r) was described in 1975 by Carswell et al. [Proc.
Natl, ^cad, Sc1. , USA.

72, 360 (3 (1975)), and has been characterized as a substance that exhibits strong cytotoxic activity in an in vitro cell culture system, and that causes necrosis in transplanted supertumors in vivo. [L, J,
Old, Cancer Res,, 41.301
(+981>1.

1884-1985, rabbit, human and mouse TN
The Sho gene encoding F was isolated [JP-A-Sho fly-12
(15) 90° Japanese Patent Publication No. 00-185799. L, F
ransen et al., Nuclelc Ac1dsRas
,, 13.44117 (+985>1), the full-order structure of each TNF polypeptide was revealed.

The isolation of the TNF i17 gene, especially the human TNF gene, has made it possible to produce human TNF in microorganisms using genetic engineering techniques, and the human TNF gene has been isolated.
A more detailed study was conducted on the properties of the drug, and strong cytotoxic activity in vitro and antitumor activity in vivo were confirmed [D.

I'annica et al., Nature, 312.
724 (2984); T, 5hirai et al.
Nature, 313. 803 (+985)
, fil, Yamada et al., J.

[I+otechnology, 3. 141
(1985) Ko.

Research has also been conducted on modified versions of human TNF polypeptides (some patent applications have been published (1').
CT International Patent Application Publication No. WO8G102381° WO8G102381゜Publication No. 1108670400G, European Publication Patent 1
68214, same published patent +55549. JP-A-02-4
8032>.

Among these, the patent applications of the first three mainly mention modifications of the human TNF polypeptide, which is composed of 157 amino acid residues, or only disclose specific modifications. The patent application discloses or mentions a modified form of human TNF polypeptide consisting of +55 amino acid residues, but the human T of the present invention
NF polypeptide variants differ in amino acid sequence from the modifications specifically disclosed in these application specifications.

The present inventors have developed a protein consisting of 155 amino acid residues.
In the NF polypeptide or a polypeptide in which several amino acids have been deleted from the N-terminal side of the polypeptide, amino acid conversion in the amino acid sequence is specifically carried out, and various polypeptide variants obtained are obtained. As a result of examining its properties, it was found that soluble Toughback can be obtained only when specific amino acids are converted. It is therefore an object of the present invention to provide a group of soluble human TNF polypeptide variants.

The present inventors have discovered that among the above polypeptide variants, certain variants have cytotoxic activity and anti-ulcer activity comparable to human TNF in vitro and in vivo. . Therefore, another object of the present invention is to exhibit excellent cytotoxic activity and anti-inflammatory activity in vitro and in vivo. An object of the present invention is to provide a human TNF polypeptide variant that has tumor activity.

Furthermore, among the polypeptide variants mentioned above, another specific variant has an excellent anti-inflammatory activity in vitro, although it has very low cytotoxic activity in vitro. ) II was found to exhibit tumor activity.

It has also been found that in this polypeptide variant, exothermic effects, etc., which are undesirable effects when used as a medicine, are considerably reduced. Therefore, a further object of the present invention is to develop a TNF polypeptide that exhibits extremely low cytotoxic activity in vitro but exhibits excellent antitumor effects in vivo and has reduced side effects! The object of the present invention is to provide an 8' variant. Like this mutant, despite its low activity in vitro,
In fact, the structure (active center) essential for expressing the cytotoxic activity and antitumor activity, which are typical biological activities of TNF, is said to show excellent activity in vivo.
This indicates that the sites are not the same within the polypeptide molecule. Furthermore, it is presumed that the active centers of the various biological activities of TNF are also different.

Other objects of the invention will become apparent from the description below.

In this specification, the following abbreviations will be used to abbreviate the period α.

A Adeni/ C Cytosine G Guanine T Thymine Ala Alanine Arg Arginine Asn Asparagine Asp Aspartic acid Cys Cystine Gln Glutamine Glu Glutamic acid GIV Glycine 11is Histidine 11e Isoleucine Lcu Leucine Lys Lysine Met Methionine Ph c Phenylalanine Pro Proline Ser Serin TI+r threoni/Trp) ri but
F7 NoTyr Tyroshi/Val Valine DNA Deoxyribonucleic acid c DNA Complementary DNA dATr' Deoxyadenosine triphosphate dCTP
Deoxycytidine triphosphate dGTf' Deoxyguanosine triphosphate dTTr' Deoxythymidine triphosphate bp Base pair SDS Sodium dodecyl sulfate 11MW
Molecular weight KD Kilodalton SD sequence Shine-Dalgarno sequence In this specification,
The base sequence shown as a single strand is the base sequence of the positive strand (sense strand), the left end of which is the 5'-terminus, and the right end of which is the 3'-terminus.The left end of the amino acid sequence is the N-terminus, and the right end is the C-terminus. shows.

(The following is a blank space) The present invention relates to the amino acid sequence represented by the formula [I1 in Table 1, the 16th, 31st to 34th, 36th, and 4th]
8th, 73rd, 82nd, 85th, 89th
No. 94, No. 97, No. 98, No. 103
th.

3rd day, 115th day, 117th day, 118th day.

131st, 132nd, 141st~! A polypeptide having an amino acid sequence in which at least one of the amino acid residues at positions 46 and 153 [I is converted to another amino acid residue Jλ (provided that the amino acid residue at position 115 is When converted to amino P11 residue, the 67th
1 and/or the 99th amino acid residue may be converted to other amino acid residues), or up to 8 amino acids I12 on the N-terminal side of the polypeptide are deleted sequentially from the N-terminus. A flash of inspiration for polypeptides.

The following are more specific examples of the TNF polypeptide variants of the present invention.

(A) In the amino acid sequence shown by the formula [■] in Table 1.

The 16th Ala becomes Val.

The 31st Ala becomes Thr.

The 32nd Asn is Ala, Cys, Asp, His
.

')le, Arg, Ser, Thr,
Vat.

Thr.

The 34th Leu becomes Ile.

The 36th Ala becomes Val.

48th Vat becomes Met.

73rd Lcu becomes Pro.

The 82nd Ala becomes Asp.

The 85th Tyr is l1is.

The 89th Val becomes Tie.

The 94th Ala becomes Thr.

The 97th Scr becomes Asn.

The 98th I'ro goes to Tits, Lcu.

The 103rd Thr is I'ro.

The 113th Tyr becomes Cys.

The 115th I'ro is Lcu, 1lis,
Gln.

Ser, Ala, Phe, Asn, Thr.

Gly, Tyr, Val, Gln, Met.

lie, Asp, Trp, Lys, Arg.

Thr.

The 117th Tyr becomes l1is.

118th Lcu7! I (to Gln.

131st Scr will be in Summer 1c.

132nd Ala becomes Thr.

141st Asf) to Tyr.

The 143rd Ala becomes Val.

The 144th Glu becomes Lys.

The 145th Scr becomes Cys.

The 140th Gly becomes Glu.

A human TNF polypeptide having an amino acid sequence in which Ilc at position 153 is converted to Lcu.

(rl> In the amino acid sequence shown by formula [I] in Table 1, the 67th and l or the 99th Cys is S
A human TNI'' polypeptide variant having an amino acid sequence in which the 115th Pro is converted to cr and the 115th Pro is converted to another amino acid other than Pro.

and (C) the human TNF of (A) or (B) above.
Examples include human TNF polypeptide mutants in which 1 to 8 amino acids are sequentially deleted from the N-terminal side of the polypeptide mutant.

The above polypeptide variants (A), (n), (C
), examples of polypeptide variants that exhibit excellent cytotoxicity and anti-neoplastic activity in vitro and in vivo are as follows.

In the amino acid sequence represented by formula [I].

The 16th Ala becomes Val.

The 36th Aha becomes Val.

73rd Leu becomes Pro.

The 98th Pro becomes IIis or Leu.

103rd Thr becomes Pro.

The 115th Pro becomes IIis or Gin.

A polypeptide having an amino acid sequence in which the 131st Set is converted to lie, or the 1st↓3rd Ala is converted to Val.

” Among the bipedal mutant group, it has lower in vitro activity;
I/ 1g in vivo! Polypeptide variants that exhibit antitumor activity are as follows.

In the amino acid sequence represented by formula [I].

The 31st Ala becomes Thr.

The 32nd Asn is Ala, Cys, Asp.

11is, Ilc, Arg, Ser,
Thr.

To Val or Tyr.

The 115th Pro is Scr, Ala, Phc.

Asn, Thr, Gly, Tyr, V
al.

Glu, Met, lie, Asp, T
rp.

A polypeptide having an amino acid sequence in which the 1st to 7th Tyrs are converted to Lcu, Lys, or 11is.

A particularly preferred variant is the amino acid sequence represented by formula 2 [I].

The 32nd Asn is Tyr, l1is, As
p or Set.

The 115th Pro becomes Leu, Scr, Asp or GIy, or the 117th Tyr becomes II i s.

Included are polypeptides with altered amino acid sequences.

D encoding a human TNF polypeptide variant of the invention
NA is obtained by a known method 1, for example, European Patent Publication No. +55
549, or by a method such as total synthesis, and then, for example, Δ.

The method of Wamp et al. [5c1enca, 224.1431
(+984)], or create DNA with a point mutation of the desired base, or use an appropriate restriction enzyme to create DNA.
By isolating the A fragment and adding a synthetic oligodeoxynucleotide adapter in which the base sequence of the target site is artificially changed, the DNA encoding the human TNF polypeptide variant of the present invention, that is, the human TNF polypeptide DNA encoding a polypeptide variant of the present invention in which specific positions (- or more) of the constituent amino acid sequence of the peptide are changed to other amino acids, or up to 8 points from the N-terminus of such a polypeptide variant It is possible to produce a DNA encoding a polypeptide in which an amino acid is deleted.

For example, the 115th amino acid (Pro) of formula 2 [I]
DNA encoding a polypeptide variant in which Leu is converted to Leu can be produced as follows.

h) DNA containing a base sequence encoding a TNF precursor
is isolated according to the method described in the European published patent.

The base sequence of the TNF precursor is shown in Table 8, and the base sequence from the 235th base to the 699th base corresponds to the base sequence encoding human TNF. No. 115 in the amino acid sequence of human TNF? lr
The codons that code for the oral amino acid Pro are 1Table 8
It corresponds to the 577th to 579th bases (CCC) in

Therefore, a DNA fragment containing the codon is cut out using a combination of appropriate restriction enzymes. 1) The above Pro codon (CCC) in the NA fragment is changed to a codon corresponding to ■, cu (CTC). DNA containing the base sequence
A DNA encoding the polypeptide variant described above can be produced by chemically synthesizing a fragment and replacing the synthesized 1) NA fragment with the previously excised DNA fragment.

To explain more specifically, 9 For example, restriction enzymes DdeI and P
DNA fragments corresponding to positions 555 to 603 in Table 8 are excised using Vu If.

Next, the nucleotide sequence of the oligodeoxyribonucleotide to be chemically synthesized is as shown in the formula below, and the nucleotide sequences of the following two DNA fragments were synthesized as two fragments, and these were extracted from Nos. 555 to 555 of Table 8 cut out above. DN corresponding to 003rd
Replace with A fragment.

5' TGAGGCCAAGCCCTGGTATGAG
CTCAT-3'3'-CCGGTTCGGGACC
ATACTCGA-5' and 5'-CTATCTGGGAGGGGTCTTCCAG
-3'3' -G T A G A T A G A
CCCT CCCCA G A A G G T C
-5' Insert the DNA thus prepared into an appropriate expression vector so as to have an appropriate sequence by a technique known in the art, and culture four transformants using this as a host. A polypeptide variant of the present invention can be produced by one method.

More specifically, 2. For example, 1) an NA fragment having an initiation codon ATG at the 5' end and a stop codon at the 3' end of the DNA containing the base sequence encoding the polypeptide variant of the present invention. An expression vector for producing a polypeptide variant of the present invention can be produced by constructing a vector, subsequently ligating it to an appropriate promoter and SD sequence, and then incorporating it into a vector. As a promoter.

For example, 4, Zee, ■, Toka, Hikasa, PL, SV4
Examples include the 0 first moe promoter and the like. Examples of vectors include plasmids (p[IR322, etc.), phages (
λ)1-di derivatives, etc.), viruses (SV40, etc.), and runway plasmids. This expression vector for producing a polypeptide variant of the present invention is transferred to a suitable host9, for example, to Escherichia coli using the method of Koe et al.
Natl, ^cad, Set,, USA
, 69. 2110 (1972)], J.
A transformant can be obtained by performing the same procedure. Then, by culturing this transformant under appropriate culture conditions, it is possible to produce the desired polypeptide variant or a polypeptide variant in which 11′1 of Mct is attached to its N-terminus. . For example, if you use this cultivar,
After lysozyme digestion and destruction by freeze-thawing, ultrasonic disruption, French press, etc., the polypeptide variant-containing extract of the present invention can be obtained by centrifugation or filtration. Purification methods (ultrafiltration, dialysis, ion exchange chromatography, gel filtration, electrophoresis, affinity chromatography, etc.)
By purifying according to the method, two polypeptide variants of the present invention can be obtained in pure form. Furthermore, a salt of the polypeptide variant of the present invention can be produced by reacting the polypeptide variant of the present invention with an organic acid, an inorganic acid, or a base according to a conventional method.

The polypeptide variants of the present invention will be explained below by giving experimental examples. The human TNF used as a control was the purified human TNP polypeptide disclosed in Example (5) of European Published Patent No. 1555↓9.

(Margin below) (1) Various polypeptide variants were produced by culturing the transformants produced in the Examples and Reference Examples described later, and their solubility was determined by 5DS-PAGE [L(18
) mmll, U, ni,, Nature (Lond
on) 227.080 (+970)] and EIA.

That is, transformants for producing various polypeptide variants were cultured according to the method shown in Example 1 below, and each polypeptide variant produced in E. coli cells was cultured at 0.1%.
It was extracted into 50M Tris-HCl buffer (pl+8) containing lysozyme and 30mM NaCl.

The amount of the target polypeptide variant recovered in the extract was measured by 5DS-PAGE and EIA, and the solubility of each polypeptide variant in the above medium was evaluated.

In 5O3-PAGE, determination was made using the presence or absence of a protein detected at a position corresponding to the calculated molecular weight of the polypeptide variant of interest as an index.

In addition, in EIA, gold in polypeptide variants that immunologically reacted with anti-human TNF antibodies was quantified.

The method for quantifying human TNF polypeptide variants by EIA is based on the first order principle.

That is, a competitive binding reaction was caused between the human TNF polypeptide variant in the sample and human TNF labeled with β-galactosidase with respect to anti-TNF rabbit anti-blood 1n. By adding insolubilized anti-Heron IgG goat antiserum, enzyme-labeled human TNF-anti-human TNF rabbit antibody-anti-Heron Ig
One reaction solution in which a G goat antibody complex was formed was centrifuged to obtain the same phase. The amount of enzyme-labeled human TNF recovered in the solid phase and in the t2 complex was quantified using the enzyme activity as an index.

That is, 2-nitrophenyl-β-D-galactobira/cyto was added as an enzyme substrate, and the amount of J Kogyo decomposition product (2-nitrophenol) produced by the enzyme reaction was calculated.

It was determined by absorbance at a wavelength of 410 nm. The enzyme-labeled human TNF n in this complex is the human TNF n in the sample.
Reflects the amount of polypeptide variants.

Separately, the standard prepared using TNP ~ (using a curve, the amount of TNF polypeptide mutations in the sample)
The amount was calculated as a debt equivalent to TNF.

For the production of anti-human TNF rabbit antiserum, Yamada et al.
[l+otcchnology, 3.141 (1
985>1 method! Purely produced human TNF was used as the antigen.

The results are shown in Table 3 below.

In the case of the target polypeptide variant detected in each bacterial cell extract compared to human TNF as a control, the case was indicated as (奢). This is +7;1! It is confirmed that the 'J peptide variant is a soluble protein.

On the other hand, if the detected amount is slightly small, it is displayed as (10).
Cases where it is extremely rare or not observed are indicated as (-).

Polypeptide variants marked with a (-) are thought to have either significantly decreased solubility or been degraded in E. coli cells due to a change in the structure of the polypeptide due to a specific amino acid exchange. It will be done.

Table 3 Soluble TNF- of human TNF polypeptide variants
12τ 12th ^1λ→Thr
(-) TNF-+3Y
13th Hls -Tyr
(-) TNF-+4^ 1
(G1 Val-*^la (
-)TIIF-16'i l[i@ffi
^n Moan VN (+) TNF-17T
l710 Asn-*Thr
(+) TNF -24F
24th Leu −+−Phe
(+) TNF -2 [IR2Q No.Q
Trp-^r((-)TNF-31T
31st Alt 4 Thr
(41-) TNF-32A 32nd ^5n-h^1 turtle (number) TNF-32C32t
5 ^5n-4hCys (+)TN
F -32032nd ^gn→^sp
(4)) TNF-321 (32nd Asn.
-e IHs (4))τNF-3
21321 items 5n-elle (bone) NF-32R3
2nd ^S mouth → ^rg (+1 TNF -32532 No. 5
Asn4Sar T
NF-32732nd 8gn -h Thr
(+) Ding NF-32V32ti^
sn → Vat (+) TNF -32Y
32nd Asn −+−Tyr
(v) τNF-32G32N low Asn −
h +ly (1τNF −:12L
32nd Asn-e Leu
(bone) TNF-3413 cap + [I
Lea-elle (+) TNF −
3SP 35th Lau -h
Pro (-)τNF-30V
3G Alt -Ysl
＜＋）Ding NF -44044th ＾fight→＾
sp (-> TNF Ichiban 5P
45th Gln 4P
ro (−) TNF −
4all 48th Vat 4Nle
t (+) TNF-SOP
50a Ser →Pro
(-) TNF -SAC54th Tyr
4Cys (-)Table 3 (continued) TNF-SQL 511th G
In −1,eu (−) TNF −
[+00 coth Val→^
sp (-1τNF-00G
1lJi%13 Vil →
Gly (-) TNF-6
2S G21st Ph1l-se
r (-) TNF-07507a
Eye Cys →Ser D)TN
F-TOY 70th Thr
-e Tyr (old) TNF -
73F 73rd Leu→Pr
o (Bone) TNF-820821
%th ^1a→^sp D)T
NF-8SH85th Tyr-” lln
(4t) TNF-119111! ]
th V++l 411e (
+) TNF-&IP 91st
Ser 4Pro (-) Ding NF
-+147 94th
^1a -h Thr
(4)) TNF -97N! 171
7th Ser 4Asn (+)
TNF-081188 gProw ll+s
(+) Ding NF-08L
98a Pro 4 Leu
D) TNF-! triS
! lI9$1] Cys-Sar
(+)τNF-+03P 10
3fl! Eye Thr-Pro
D) τNF-113c I+3
#me cyoyr 4Cys
(脣) TNF -1151111'Jth!
'ro →111g (+) TNF-11
5Q 115th Pro 4 G
in (su TNF-1155115
th Pro-h Ser
DllTNF-115^ 115Iei P
ro groan ^la (4)) TNF-115F
115th Pro 4 Phe
(+) TNF-115N
II! J eye Pro 4^Sn
(◆) TNF-1157115th P
ro -e Thr D) TNF-
115G 1156F Pro
-Gly D) TNF-115Y
115KgProp Tyr
(iτNF-1+5V 1
15f! i-th Pro-* Val
D)-2! ``2111''! Table 3 (Continued) TNF-1151115th Pro-h 11
11 (4)) TNF-115D
115th Pro →^gp
(4)) TNF-1161114Jth Pro -h Trp (+
) TNF-11SL 115th
Pro 4Leu D) TNF-1
15K 115th Pr(+4
Lyi (bone) Ding NF-1 summer 5R
II 5th prO-h^rg(+) TNF-11781
17th Dingyy →lguchi S
(Permanent) TNF-1180118th Leu
-Gln (+) TNF-121
G +21@th 11al -G
ly (-) TNF-12IQ
124th Leu-Gln
(-) TNF-128^
128th Asp→^la
(-) TNF-128N 128
th AIIP-*^sn
(-) TNF-1311131 No. 0 5er-ell
e (1st NF-+32T1322It^
1a4Thr(+) TNF-1350135th
8gn4^sp (+) TNF-+3
8V 138th ^sp -Dyoyr (+)DyoNF-141Y
141st ^SP 4 Tyr
(+)τNF-+43V
143rd Alt −+−Vat
(+) TNF-+44
144th Glu →Lys
(+) Ding NF-145CI45th S
er-6Cys (4)) TNF
-+4GE 140th Gly
-Glu (+) TNF-148
0148th v1→^sp
(-) TNF-148G 148th Val 4 cry (-
) TNF-15OL 150th Phe -4Leu
(-n TNF-151E 151st Gly-”Glu
(-) TNF-1511, 153 gIIe-tau
(+> TNF-115L-5er
G7
D) TNF-11SLΔNg-5er87

<41) TNF-115L△N8
(old time)■
The isoelectric points and cytotoxic activity values of various polypeptide variants of the present invention obtained in the Examples described later are shown in Table 4 below.

Cytotoxic activity was determined by mouse LM cells (^TCC, CCL
1.2> The method of Yamada et al. [J, Biotech
All polypeptide variants used in this test were evaluated according to 3,141 (+985>1).
This is a purified product that does not contain any impurity protein on DS-PAGE.

(Left below) Table 4 Isoelectric point and cytotoxic activity of TNF polypeptide variants Human TNF S, 9
2,080τNF-10V5.731G TNF-3175,812 TNF-32Y 5.9 0.
From 111 TNF-32118, 132 TNF- 5.5 1.
1 TNF-3255,81,0 DingNF-32G5.88.7 TNF-32L 5.11
0.43 TNF-3GV Ei, 9
122TNF-73P 8.0
234TNF-911118,41,3
30 TNF-103P O,22+5TNF-1
15L 5.9 12TNF-
II Guo 5.8 23TNF-1
1575,838 TNF-115118,0220 TNF-115R7,80,22 TNF-11505,78,8 TNF-115G 5.9 3
7TNF-117118,331 TNF-13115,91,890 TNF-+43V 5.8 2
43τNF-144K 7.5
1.3 TNF-146E5.8G, Heavy 8 (3) In vivo anti-inflammatory activity of various polypeptide variants of α described in Example below! I tumor activity is shown in Table 5 below.

Anti 1)! Evaluation of tu activity was performed as follows.

2XIO' female A sarcoma cells were transplanted into the abdomen of a BFLII/C female mouse (8 withdrawals), and one cell of this polypeptide variant was intravenously administered 7 days after transplantation. The tumor necrosis-inducing effect was 241+ after administration! ? Carswell et al.'s criteria [Proc, Natl, Acad, Set
, IJS^, 72°3000 (+975)].

As shown in Table 5, the in vitro cytotoxic activity of TNP, which has been characterized as a factor that selectively damages H tumor, and the in vivo translocation and anti-tumor activity of TNP.
There is a poor correlation between 10 activities and 1 e.g. TNF-
1311 has almost the same in vitro cytotoxic activity and in vivo anti-anal ulcer activity as human TNF. However, other polypeptide variants 1, such as the 32nd, 115th, and 143rd positions from the N-terminus.
Polypeptide variants in which the th amino acid was changed exhibited stronger in vitro/vivo antitumor activity compared to their in vitro cytotoxic activity, and exhibited less lethal toxicity.

(Margins below) Table 5 Anti-IFRW active polypeptide of human TNF polypeptide Necrotic reaction am growth inhibition rate Human
TNF: 000 1500 5! i2.000
0420 1108.000 0
0 0 O8? Ding NF-+8V: 03 e o o o at3
1042008 910 0 4 2 0 fi.

3.100 0 0 G O' 8
8 TNF-:IIT: TNF-32Y: TNF-32D: ++ 4 0 Q O En Ding NF-325
: ! 0 5 0 0 0 1730
1 4 0 0 τNF-3211 9G +400 71 Table 5 (continued) TNF -38V: +20 2 4 0 0 491
．． 200 0024 933.700
0008 1?37NF-73P: 700 0 7 0 0 8Q2
．． 300 0520 90TNF-9
1118 1,300250070 4,000052081 13, Sir 0018 94th NF-1
03P: 7NF-1+sL: 12! 1lGo 70o
2400 73350
0240! I11.170
0 0 5 1 837NF-1+5S: 2:13 3 0 0 742'1lQO2
Number (15) 1 [Im 0051 842.3
0[+ 0 0 1 5 100Table 5 (continued) Polypeptide Necrotic reaction IvJ increase suppression rate TNF-1151+= TNF-1+5T: +14 2300 &1TIIF-
1151) 2 Oa 0500 57 TNF-11
5G: 110 0500 0S1.100 00141Q艷--- TNF-11711: TNF-1311+ S, 700 0 0 2 3 83↑
NF-143v Near 30 0 5 0 (1<22.400
0 4 1 0 85 (4) Several polypeptide variants of the present invention were tested for pyrexia. The results are shown in Table 6 below.

In this pyrogenic test, the drug was administered intravenously to rabbits, and changes in rectal salt levels after administration were observed. Observation continued for 4 hours after administration, and the results were determined to indicate a body temperature increase of 0.4℃ or less (-), 0.5 to 0.5℃.
(A rise in body temperature of 1.9°C is indicated as (+), and a rise in body temperature of 1.0'C or more is indicated as (+).

(Left below) Table 6 and) Thermogenic effect of TNF polypeptide i variant rNF
-+8V: 0.52 (-
)5.2 (-) TNF-3ZY: 0.50
(-)5.0 (-) TNF-32110,50 (-) 5.0 (+) TNF-30V: 0.5Q
(-)S, O<+> TNF-73P: 0.51
(-)5・Summer (+) TNF-1151,: Q, G7
(-)8・7 (-) Ding NF-+15S: 0.
52 (-)5.2
C+) τNF-115110,50(-) 5.0 4 +) TNF-11711: 0.52
(-)5.2 (-') (5) The effect of TNF-11SL on blood pressure was tested.

In the blood pressure lowering effect test, 5L of TNF-1 was administered into the tail vein of 3l-IR/NCrJ HA rats weighing 264 to 304 g (Japan Charles River Co., Ltd.), and a rat dose arterial pressure measuring device (KN-2 (15)) was administered. Systolic blood pressure was measured without anesthesia using a mold (Natsume Seisakusho). The results are shown in Table 7 below.

Table 7 Human TNF: ! 00 18!1lf3. o@@lIg
+05*2.5m511g 19112. [Im
++11g1.000 +89±3.0
178±2.7 184±2.25.1)00
100±1.5 180±2.1 1
89±2.5In, 000 191±2.1
185±2.4 188±3.6 The present invention will be explained in more detail by giving examples and reference examples below.
The invention is not limited to this example.

Example 1 Human TNF polypeptide variant TNF-32Y f)
1. Construction of a plasmid expressing the 1-fold (lid) expression A plasmid for expressing a polypeptide (hereinafter referred to as TNF-32Y) consisting of 155 amino acids corresponding to amino acid numbers 1 to 155 in Table 9 for natural nails (1) IINY-32) was constructed as shown in FIGS. 2 and 3.

Cloned cDNA encoding human TNF.

Recombinant plasmid pHTNF 13 produced according to the method described in European published patent +55549
Then, it was excised by quenching using the restriction enzyme Pstl to give a single π.

Add restriction enzymes to this cloned cDNA! and l
A DNA fragment (rrag
■ent) was isolated. This isolated DNA fragment is hereinafter referred to as TNP-DNA, and this TNF-DNA fragment is an approximately GOObp-long fragment containing a base sequence corresponding to the downstream sequence from base number 250 in Table 2. .

The entire nucleotide sequence was reported by Yamada et al. [J.

Old otechnology, 3. 141 (1985
)].

This TNF-DNA fragment was treated with restriction enzymes Hparl and l.
Digested with 1 g 1 ■ 2 In Table 8, base numbers 250 to 3
DNA fragment corresponding to number 21 [referred to as DNA-1 fragment]
, a DNA fragment corresponding to base numbers 322 to 337 [
1) NA fragment C1) NA-3 fragment corresponding to the downstream side from position 338]
Cut into two DNA fragments, DNA-1 fragment and DNA-1 fragment.
3 fragments as molecule fif+7? lJL, Core DNA-
The 1111r fragment and the human DNA-31fi fragment were synthesized according to a conventional method using an oligonucleotide adapter represented by the following formula:
The DNA fragments were ligated using T4 DNA ligase (Iigas (7)). The resulting DNA fragment is referred to as the NY-DNA fragment.

This NY-DNA 1tIi piece was synthesized using the following formula 5% [I [T4+ oligonucleotide adapter represented by I]]
Sequential ligation was performed using NA ligase. Obtained DN
The A fragment is hereinafter referred to as a peptide region DNA fragment.

On the other hand, plasmid pcT-t [M, Ikahara
At at,.

Proc, Natl, ^cad, Sc+,, US
A, restriction enzyme 2I to 81.595G (198↓)]
A DNA fragment of approximately 380 bp containing a part of the moon 1 promoter region was obtained by reacting with AatII and AatII [The nucleotide sequence of this DNA fragment 10 glomotor region was based on the report by Bennett et al.
Mol, old 01. ．． In the back, 113゜1978) was cut out and inserted into the above peptide region DN.
It was ligated to the A fragment using D4[)NA ligase. The obtained DNA fragment is hereinafter referred to as promoter peptide DNA fragment.

Separately, add restriction enzyme Av to plasmid r) n R322.
A large NAA fragment (approximately 3.7 kbp) was separated by 0.7% agarose gel electrophoresis using aI and Pvu II.

Both ends of this DNA fragment were treated with DNA polymerase I (Kunnow fragment) and dGTP, d, ~TP, (I
CTI'.

A flat end was prepared using dTTP, and both ends were ligated using T4 DNA ligase. This plasmid vector is called pDR36, and this vector (p13R3o
) was treated with restriction enzymes Aat■ and l1indllll to isolate and purify a large NA fragment (approximately 3.0 kbp). By ligating the previously prepared promoter peptide region DNA fragment to this DNA fragment using T4 DNA ligase, the expression plasmid PIINY was created.
-32 was constructed.

C2) Production of TNF-32Y The expression plasmid PIINY-32 obtained in section (1) was purified using a standard method [S, N, Cohen et at., Proc.
, Natl, ^cad, Sci,, USA.

(15), 2110 (1972)].
Introduced to 0IO+.

A transformant was produced. This transformant was transformed into LB Pros (
Composition: 1% Bactodrypton, 0.5% yeast extract, 1
% NaCl, pH 7.5>, and the culture was mixed with 10 times the volume of modified M9 medium (composition: 0.45% Casamino I'fi, 0.4% glycerol, 25 μg/m
1 ampicillary) and cultured at 37°C for 1 hour.
Next, add indole acrylic acid to a final concentration of 20 μH/1.
After further culturing for 24 hours,
Bacterial cells were collected by centrifugation. The bacterial cells are added to the medium volume of 171
0 volume (il of 0.1% lysozyme and 30mM NaCl
50++ MTris-11c11fl buffer containing (pH
8) and allowed to stand in ice water for 30 minutes. After repeated freezing in a dry ice/tanol bath and thawing at 37°C, an extract was obtained from which bacterial cell residues were removed by centrifugation.

This extract was mixed with 20mM Tris-IICI buffer (P
After dialyzing against l+7.8>, centrifugation was performed and the supernatant liquid was collected. This supernatant was added to DEAE-5 epharose CL-Gll (7
y) Shi? (Schiff Co.) column, and the non-adsorbed components were thoroughly washed and removed with the same buffer. Then, in the same buffer,
Continuously increasing the NaCl concentration from 0 to 0.3M,
TNF-32Y was eluted.

The elution position of the peptide was determined using a protein detected at a position of approximately 17 KD in 5DS-polyacrylamide gel electrophoresis analysis as an index.

This fraction was collected and reconstituted with 20mM Tris-IICl
After desalting by dialysis against J street solution (2117,8), the above DEAE-5 epharose CL-Off column chromatography was performed.

Repeated elution with a gentle NaCl etf gradient.

The peptide elution fractions were collected and subjected to ultrafiltration (molecular sieve membrane'/M
IO, Amico/Company).

This concentrated solution was mixed with the old o-Ge1 PG (Bioraft).
column, 5mM in the eluate! Purified TNF-32Y was obtained by gel filtration using J-phosphate buffered physiological saline.

The N-terminal amino acid sequence of purified TNF-32Y was determined using a protein sequencer (Applied Biosystems, Inc.,
470A) by the automated Edman decomposition method.

As a result, the N-terminal amino acid of TNF-32Y is Sc
It was r. That is, Met derived from the translation initiation codon (^TG) was removed from the N-terminus of this final purified product.

Example 2 Production of human TNF polypeptide variant TNF-115L (1) Construction of expression plasmid A polypeptide consisting of 155 amino acids corresponding to the sequence from amino acid numbers 1 to 155 in Table 10 (hereinafter referred to as The expression plasmid pHPL-115 for production (referred to as TNF-115L) was constructed as shown in FIG.

TNF prepared by the method described in Example 1-(1)
- The DNA fragment was digested with restriction enzymes Pvu■ and TaqI.

DN corresponding to base numbers 250 to 369 in Table 8
A fragment [referred to as DNA-4 fragment], base number 370~
DNA fragment corresponding to base number 603 [referred to as DNA-5 fragment], DNA fragment corresponding to base number 604 to 653 [referred to as DNA-0 fragment], and 1) NA fragment corresponding to the downstream side from base number 654. [The DNA was cut into four DNA fragments called DNA-7 fragments, and each was separated and purified. The DNA-5 fragment was further cut with the restriction enzyme Dde I to obtain D corresponding to base numbers 370 to 554 in Table 1.
The NA fragment [referred to as DNA-8 fragment] was separated and purified. D
The NA-4 and DNA-8 fragments were ligated using T4 DNA ligase.

Furthermore, the following formula % formula %[] and 5'-CTATCTGGGGAGGGGTCTTCCAG synthesized by a conventional method
-3'[e]3'-GTAGATAGACCCTCC
Oligonucleotide adapters represented by CAGAAGGTC-5' were sequentially ligated using 41) NA ligase.

Furthermore, DNA-6 fragment and DNA were added to the obtained DNA.
-7 fragments were ligated. The obtained DNA fragment was PL-D
It is called an NA fragment.

Hereinafter, according to the method α described in Example 1-(1).

Expression plasmid pHPL-115 was constructed using the above disordered DNA fragment instead of the NY-DNA fragment.

(2) Production of TNF-115L Expression plasmid pHPL-11 constructed in section (1)
Transformants were prepared and cultured according to the method of Example 1-1.

The hedron extract was purified according to the method α described in Example I-(2) to obtain purified TNF-11SL-t-.

(3) Amino Acid Sequence Determination The amino acid sequence of TNF-11SL and its peptide fragments was determined by the automated Edman degradation method using Protein/Nenquencer.

Peptide fragments were prepared as follows. That is, the essence a12
500 μg of TNF-115L with 4M urea
0.11 of mM di-ris-11C1 buffer (pH 8)
medium, 10 μg of lysyl endopeptidase (EC3,
4,21,50: Wako Pure Chemical Industries). After reacting at 35°C for 15 hours, the digestion products (peptides) were synthesized with Syn
Chropak RP-P300 column (250X4
．． The monomer was purified by high performance liquid chromatography using Oml (Zinchrome Co., Ltd.). The elution was with a linear 0 degree gradient from 10% to 50% of acetonitrile containing 0.07% trifluoroacetic acid in 0.1% trifluoroacetic acid.
It was run for 60 minutes at a flow rate of 111 minutes.

The elution diagram is shown in Figure 5, from N011 to N in Figure 5.
The amino acid sequence of the N-terminal portion of the peptide fragment isolated from each of fractions 0 and 7 was determined by automated nitrogen fluorolysis.

As a result, the partial amino acid sequence of the peptide fragment of i is Pro-X-Tyr-G Iu-Le
u-11e-Tyr-Leu-Gly-Gly-Val
-Phe-Gln-Lau-Glu. X in the sequence means an uncertain amino acid.

The above amino acid sequence is amino acid number 11 in Table 10.
The sequence matched numbers 1 to 125.

From this result, it was confirmed that the 115th amino acid from the N-terminus of TNF-1+5Lf) was Leu. In addition, TNF-115L0) N-terminal amino acid is S
er, and Ne derived from the translation start codon (^TG)
t was removed.

Example 3 Human TNF polypeptide variant TNF-115LΔN8
(1) Construction of expression plasmid The 9th amino acid (L) of the amino acid sequence shown in Table 10
The expression plasmid (PIIPL-147) for producing a polypeptide (hereinafter referred to as TNF-115LΔN8) consisting of 147 amino acid residues corresponding to the 155th amino acid (Leu) from ys) is shown in Figure 6. It was built in

Expression plasmid plIP obtained in Example 2-(1)
+, -115 was digested with the restriction enzyme CIaI h [IstE■.
A large NA fragment containing a region encoding the C-terminal portion of F-115L), a tetracyclyc/resistance gene, an ambicilifit sex gene, and a portion of the sato promoter region (
(hereinafter referred to as vector DNA fragment) and a small fragment N containing the base sequence corresponding to base numbers 1 to 379 in Table 10.
The Atfi pieces were separated and purified. This small NA fragment was further digested with restriction enzyme 11g1^■, and then a DNA fragment corresponding to base numbers 219 to 379 was isolated. This DNA fragment is hereinafter referred to as If(j-DNA).

Expression plasmid pHT147, which was constructed according to the method described in Reference Example 2 separately, was mixed with 1 restriction enzyme CIaI and 11
Approximately 200bp QDNA digested with g1^■ and containing the base sequence corresponding to base numbers 25 to 218 in Table 10.
fi pieces were isolated. This DNA fragment is hereinafter referred to as ΔNg-D
It is called an NA fragment.

This ΔN8-DNA fragment and the above lIgi-DNA fragment were ligated using T4 DNA ligase, and the resulting D
The NA fragment was prepared first. By integrating into the vector DNA fragment, the expression plasmid PIII'L-1
47 was constructed.

■ Production characteristics of TNF-11SLΔN89. The current plasmid p11PL-147 was transformed into a transformant (1) according to the method described in Example 11-section (2).
Not manufactured.

Cultured. Example 1 from the bacterial cell extract! - Purify and purify TNF-11SLΔN by learning from the method of Section 1.
I got 8.

Mct derived from the translated tit codon (8TG) as the N-terminal amino acid of TNF-115LΔN8 was detected by automated ethylysis.

Example 4 Human TNF polypeptide variant TNF-115L-S
Production of cr07 (1) Construction of expression plasmid The 67th amino acid (y
s was replaced by Ser: 1!1 Noveppudo (T
An expression plasmid for production (referred to as NF-11SL-9er07) was constructed as shown in FIG.

Referring to Reference Example 3, the expression plasmid pHTP392 constructed by the method in 1 was digested with restriction enzymes (I, C: IA I and 11pal) to obtain base numbers 1 to 218 of Table 10.
The base sequence corresponding to the base number 22, including the base sequence in which the 200th and 201st bases GC are replaced with CT.
A DNA fragment of Gbp was isolated. This DNA fragment is shown below.

It is called 5arG1-DNA fragment.

This 5er0? -DNA fragment and Example 3- (II prepared by the method described in Section 11)
The resulting DNA fragment was ligated using NA ligase, and the vector DNA obtained by the method described in Example 3-(Section 11)
By integrating into the fragment, the photoexpression plasmid pHP
I won the L-5erG7.

(Production of 21TNF-11SL-Ser07 Using the expression plasmid pHPL-3er07, Example 1-(2
) term Ji! Transformants were produced according to the method of the company.

Cultured. The bacterial cell extract was purified according to the method described in Example 1-(2) fj (2), and purified ``A TNF-''
115L-9ar07 was obtained.

N-terminal amyl z of purified TNF-115L-9er07
The 1%i sequence was determined by automated Edman decomposition.

Ser, M derived from the translation start codon (^TG)
et had been removed.

Example 5 Human TNF polypeptide variant TNP-115LΔN3
Production of -5er07 (1) Construction of expression plasmid Cys, which is the 67th amino acid from the N-terminus in the sequence consisting of 147 residues corresponding to Nos. 9 to 155 of the amino acid sequence shown in Table 10, is replaced with Ser. A gene expression plasmid (pHl'L 14
7S07) was defeated by 11 as shown in Figure 8.

Expression plasmid p11 obtained by the method described in Example 1)! 'L-ScrG7 with restriction enzyme C1aI and 1l
Two DNA fragments were obtained by digestion with stEII. The large NA fragment is the vector DN prepared in Fire Spraying Example 3.
This is the same fragment as fragment A. After further digesting the small NA fragment with restriction enzyme Rsa I,
A DNA fragment containing the base sequence corresponding to numbers 01 to 379 was isolated. Hereinafter, this fragment will be referred to as an Rsa-DNA fragment.

On the other hand, the form m yA obtained by the method described in Example 3-+1j
'IJ plasmid PIIf'L-147 was transformed with restriction enzyme C
Digested with IaI and 9 I, base number 25 in Table 10
~+44 bp of D containing the saltba sequence corresponding to number 160
The NA fragment was isolated.

This DNA fragment and the above Rsa-DNA fragment were combined into 74 DNA
By ligating using A ligase and incorporating the obtained DNA fragment into the previously prepared vector DNA fragment, TNF-order 5LΔN3-5er13? A production expression plasmid pHl"L 147SG7 was constructed.

■ Production of TNF-+15LΔN3-5arG7 Example 1 using expression plasmid pHr'L 147SO7
- Transformants were produced and cultured according to the method described in section (■). Purified TNP-1+5LΔN3-9erG from the bacterial cell extract according to the description in Example 1121, and
I got a 7. As the N+Q amino acid of purified TNF-115LΔN3-5erC7, T is added to the translation initiation codon (^TG).
111r+t was detected.

Example 6 Production of other human TNF polypeptide variants - (Construction of O expression plasmid) Amino acid sequences 1 to 155 represented by formula [I] in Table 1
Expression plasmid for polypeptide production in which the 32nd aE/fi from the N-terminus, ^sn, in a sequence consisting of 155 residues corresponding to No. was constructed according to the method described in Example 1-(1) except that in place of synthetic adapter [a], one of the chemically synthesized oligonucleotide adapters shown by the following formula was used.

5'-CGGGCCCCACGCCCTCC-3'3
'-cccccTacccc-t+'
(For conversion to l-S) 5' -CGGGCCGAT
GCCCTCC-3'3''-CCGGCTACGGG-
5' (for conversion to Asp) or.

(2) Production of human TNF polypeptide mutation values (1)
Each of the expression plasmids prepared in section ) was injected into Escherichia coli strain 118101 according to a conventional method to produce transformants.

The transformant was cultured according to the method described in Example 1-(2), and f+'fi! was obtained from the bacterial cell extract according to the method described in Example 1-(2). ! By doing so, the following human T
NF polypeptide variants were obtained.

TNF-3211: No. 32 in the amino acid sequence of formula [I]
Polypeptide TNF-32D in which the 32nd amino acid ^sn has been converted to l1is: Polypeptide TNF-329 in which the 32nd amino acid ^sn in the amino acid sequence of formula [I] has been converted to Asp: Formula Amino acid sequence of [I] 1g ¥32
Polypeptide Example 7 Production of other human TNF polypeptide variants-(1)
Construction of Expression Plasmid Amino acid sequences shown by formula [I] in Table 1 -! 55
In the sequence consisting of 155 residues corresponding to
Example 2 Expression plasmids for producing polypeptides converted to Il, for example, Scr, Asp or any
- according to the method described in section (1), except that the synthetic adapter [d
95'-TGAGGCCAAGCCCTGGTATGA constructed by using one of the chemically synthesized oligonucleotide adapters shown below in place of
GTCC Haccho-3'3' -CCGG-TCGGGAC
CTCAG-5' to CAT (for conversion to Scr) 5' -TGAGGCCAAGCCCTGGTATGA
GGACAT-3'3'-CCGGTTCGGGA
CCATACTCCT-5' (for conversion to Asp) or.

5'-TGAGGCCAAGCCCTGGTATGAG
GGCAT-3'3'-CCGGTTCGGG8CCA
C-5' to TACTC (in the case of conversion to cry) (2) Manufacturing instructions for human TNF polypeptide variants (1)
Each of the transformation plasmids prepared in section ) was introduced into E. coli strain 110101 according to a conventional method to produce transformants.

The transformant was cultured according to the method of Example 1-■ Yoashitsu, and the following human TNF polypeptide was purified from the bacterial cell extract using the method described in Example 1-(2). I got a mutant.

TNS-11i1is: A polypeptide in which the 115th amino acid Pro in the amino acid sequence of formula [I] has been converted to Scr. TNF-1150: The 11th amino acid in the amino acid sequence of formula [I1]
Polypeptide TNF-115G in which the 5th amino acid Pro is converted to 85P: In the amino acid sequence of formula [I], the 11th
Polypeptide in which the fifth amino acid Pro is converted to Gly Example 8 Production of human TNF polypeptide variant TNF-11711 (1) Construction of expression plasmid In the sequence consisting of 155 residues corresponding to positions 1 to 155, the first
Tyr, the amino acid on the 17th day, is the other amino acid.

For example, a polypeptide converted to 111s (hereinafter referred to as T
A production expression plasmid (referred to as NF-order 711) was constructed according to the foot loading method for Example 2 (Section 11), except that the chemically synthesized oligonucleotide adapter represented by the following formula was used in place of the synthetic adapter [e].

5'-CCATCTGGGAGGGGTCTTCCA
G-3'3'-GTAGGTAGACCCTCCCC
AGAAGGTC-5'■ Production of TNF-11711 The expression plasmid prepared in section (1) above was introduced into E. coli strain 11[I101 according to a conventional method to produce a transformant. By culturing the transformant according to the method described in Example 1-(2) and purifying the bacterial cell extract according to the method described in Example 1-(2), TNF-1 can be obtained.
I got 1711.

Example 9 Production of other human TNF polypeptide variants - 3 According to the method of Kiga in Example 1, expression plasmids for the following polypeptide production were constructed, and transformants were generated in Escherichia coli by four people. Created. The transformant was cultured, and the following polypeptide was isolated and purified from the bacterial cell extract.

TNF-ICv: A polypeptide in which the 16th amino acid ^1a in the amino acid sequence of formula [■] has been converted to Val. TNF-31T: The 31st amino acid in the amino acid sequence of formula [I] Polypeptide TNF-32G in which ^1a is converted to Thr: Polypeptide TNF-32L in which the 32nd amino acid ^sn in the amino acid sequence of formula [I] is converted to Gly. TNF-32L: Amino acid of formula [I] Polypeptide TNF-30V in which the 32nd amino acid, 8sn, has been converted to Leu: In the 7mi/acid sequence of formula [I], the 36th amino acid, ^1a, has been converted to Val. Polypeptide TNI'-73P: Polypeptide TNF-82D converted to Laull Pro, which is the 73rd amino acid in the amino acid sequence of formula [i]; m8
A polypeptide in which the 2nd 1"l amino acid 81a has been converted to Asp (isoelectric point 5.3). TNF-851 has the formula [In the amino acid sequence of I, Tyr, the 85th amino acid, has been converted to 1lis. Converted polypeptide (isoelectric point 6.4) TNF-9811: No. 98 in the amino acid sequence of formula [I]
Polypeptide TNF 103T' in which the No. 1 amino acid Pro has been converted to IHs: In the amino acid sequence of formula [I], the No. 1
Thr, which is the amino acid on day 03, is Prol: Converted polypeptide TNF-1157: In the amino acid sequence of formula [r], real 11
Polypeptide TNF-Hsll in which the 5th amino acid Pro is converted to Thr: In the amino acid sequence of the formula [I, the 11th
Polypeptide TNF-115R in which the 5th amino acid I'ro is converted to 1lts: In the amino acid sequence of formula [I], the 11th
Polypeptide TNP-1311 in which the 5th amino acid Pro is converted to Arg: In the amino acid sequence of formula [■], the 13th
Polypeptide TNF-141Y in which the 1st amino acid Scr is converted to Ila: Polypeptide TNF-143V in which the 141st amino acid Asp in the amino acid sequence of formula [I] is converted to Tyr: Formula [I] (7) y In the amino acid sequence, ^1a, the amino acid at position FA 72143, is V
In the polypeptide TNF-144 converted to at: in the amino acid sequence of formula [I], the 14th
Polypeptide TNF-140E in which the 4th amino acid Glu has been converted to Lys: 14th amino acid in the amino acid sequence of formula [I]
Polypeptide in which the 6th amino acid Gly is converted to Glu Example IO Production of other human TNF polypeptide variants-4 To Example 1! [! According to the method of α, an expression plasmid for producing the following polypeptide was constructed and transformed into E. coli to produce four transformants. The transformant was cultured, and the following polypeptide was extracted from the cell extract. ! Purified.

TNF-32A: Formula [In the amino acid sequence of I1, the 32nd Asn is ^! Polypeptide TNF-32C converted to λ: polypeptide TN+ in which the 32nd Asn in the amino acid sequence of formula [I] is converted to Cys
-321: 32nd A in the amino acid sequence of formula [I]
lipobutide TNP-32R in which sn was converted to Ile: polypeptide TNF- in which the 32nd Asn was converted to ^rg in the amino acid sequence of formula [I]
32T: 32nd 8s in the amino cleft sequence of formula [I]
Polypeptide TNF-32V in which n is converted to Thr:
In the amino M sequence of formula [I], the 32nd Asn is Ma
Polypeptide TNF-341 converted to l: Formula [I]
34th in the amino acid sequence of formula [I] Polypeptide TNF-48M in which Leu at 1 is converted to lle: Polypeptide TNI? in which Val at position 48 in the amino acid sequence of formula [I] is converted to Net? -891: Polypeptide in which Mal at position 89 in the amino acid sequence of formula [I] was converted to He. TNF-94T: In the amino acid sequence of formula [I], ^1a at position 94 was converted to Thr. Polypeptide T
'NF-97N: Formula [! ] In the amino acid sequence, Ser at position 97 has been converted to Asn.
98L: Pr at position 98 in the amino acid sequence of formula [I]
Polypeptide TNF-1+3C in which o is converted to Lau
: In the amino acid sequence of formula [I], the 113th Tyr is converted to Cys. TNI7-1+5Q: In the amino acid sequence of formula [I], the 1st
Polypeptide TNI'115^ in which the 15th Pro is converted to Gln; in the amino acid sequence of formula [I], the 11th
Polypeptide TNF-115F in which the 5th I'ro is converted to ^1a: Amino l of formula [I]! In the amino acid sequence of formula [I],
Polypeptide TNI''-115Y in which the 5th Pro is converted to Asn: in the amino acid sequence of formula [I],
Polypeptide TNF-1+5V in which the 115th Pro is converted to Tyr: In the amino acid sequence of the formula [I, the 11th
Polypeptide TNI''-115E in which the 5th Pro has been converted to Val: In the amino acid sequence of formula [I], the 1st
Polypeptide TNF 115M in which the 15th PrO is converted to Glu: In the amino acid sequence of formula [I], the 11th
Polypeptide TNI with the 5th PrO converted to Net? -1151: Formula El], in the amino acid sequence
Polypeptide TNr''-1+5W in which the 5th Pro is converted to lle: In the amino acid sequence of formula [I], the 1st
In the polypeptide TNF-115 in which the 15th Pro is converted to Trp: in the amino acid sequence of formula [I], the 11th Pro is converted to Trp.
Boribebuchi TNF with the 5th Pro converted to Lys
-118Q: 118th position in the amino acid sequence of formula [I]f) Polypeptide converted to LeufA Gln TNF-1327: 13th position in the amino acid sequence of formula [I]
Polypeptide TNF-+45C in which the second ^1a is converted to Thr: in the amino acid sequence of formula [I], the 14th
Polypeptide TNF-153L in which the 5th Ser is converted to Cys: in the amino acid sequence of formula [I], the 15th
3rd t)) Reference Example 1 of a polypeptide converted to llekaLau h) Construction of expression plasmid for TNF production Human TN
A cloned cDNA encoding F.

The recombinant plasmid pHTNF 13, which was produced according to the method described in European Patent Publication No. 155549, was excised and isolated using the restriction enzyme Pst I.

This cloned cDNA was further digested with the restriction enzyme EcoRI to cut and remove a portion of the untranslated region downstream of the TNF translation region, resulting in approximately 1. A DNA fragment of IkbP was obtained. By incorporating this DNA fragment into a fragment (approximately 3.6 kbp) cut with restriction enzymes; ÷; EcoRI and Pst I of plasmid PIIR322, TNF cD
A new recombinant plasmid containing NA and tetracycline resistance genes was constructed. This recombinant plasmid was named pHT113.

Add restriction enzymes ^vaI and 5a to this plasmid pHT113.
Apply lI and 3! Ti DNA fragments (each about 0.
8kbp.

1.3 kbp and 2.0 kbp>. Among these DNA fragments, an approximately 1.3 kbp DNA fragment containing most of the TNF-encoding region and part of the tetracycline resistance gene of plasmid ptlR322 was isolated and purified (this DNA fragment was
(referred to as I fragment).

A synthetic oligonucleotide adapter [fl] represented by the linear formula was conjugated to this ^va I-5at I fragment.

5'-CGATAT to TCATCTTCTCGAAC
C-3'[fl3'-T^T
The obtained DNA fragment ACAGTAGAAGAGCTTGGGGCT-6' is hereinafter referred to as 117NF-adapter fragment.

Separately, a DNA fragment (35 bp long) containing part of the trp promoter region was added to the plasmid PDR? 20(P-L l1ioche+[cals:
D, R, Ru5sell, et a! ,, Ge
ne.

20, 231 (+983)] to the restriction enzyme 4-PI
It was excised and isolated by means of

The base sequence of this DNA fragment is as shown in the following formula.

5'-AATTCCCCTGTTGACAATTAA
TCATCGAACTAGTT3'-GGGGACA
ACTGTTAATTAGTAGCTTGATCAATo this, an oligonucleotide adapter [g] synthesized by a conventional method and represented by the following formula % formula % [
4. Linked using DNA ligase. The DNA fragment obtained here is hereinafter referred to as promoter fragment.

On the other hand, the restriction enzyme EcoR (
and 5alI to form a large NA fragment (approximately 3.7
kbp length) was cut out. In addition to this, the IIT that was adjusted earlier
The NF-adapter fragment and trp promoter fragment were
2 Table 8 by joining using 4 DNA ligase
An expression plasmid for producing human TNF consisting of 155 amino acid residues corresponding to amino acid numbers 79 to 233 in the amino acid sequence was constructed (see Figure 9).

This expression plasmid was named pHTR old.

Reference-6 Example 2 Construction of expression plasmid for production of human TNF polypeptide derivative TNF (147) A human TNF inducer consisting of 147 amino acid residues corresponding to sequences 84 to 233 of the amino acid sequences shown in Table 8. A gene expression plasmid (pHT147) for the production of four organisms [hereinafter referred to as TNF (147)] was constructed (first O
(see figure).

Recombinant plasmid p obtained by the method described in Reference Example 1
HTR91 was digested with restriction enzymes C1aI and l1all to obtain four types of DNA fragments. Two small fragments (113bp and O,0kbp, respectively) of them were added to 5%
It was separated and purified by polyacrylamide electrophoresis. A small fragment (11311P) was further treated with restriction enzyme Ode.
The DNA fragment was cut into two DNA fragments (47 bp and GObp) using I and the 47 bp DNA fragment was isolated. this DNA
The fragment is hereinafter referred to as a 47 bp fragment.

This fragment was synthesized by the following formula 5% [
I [Two types of oligonucleotide adapters denoted by I1 [
h] and [h] were ligated using T4 DNA ligase.

Furthermore, a chemically synthesized oligonucleotide adapter [J] represented by the following formula % [] was bound. The DNA fragment obtained here is referred to as 5'-DNA.
It's called a fragment.

On the other hand, plasmid pCT-1 [M, Ikchara a
tal,.

1'roc, Natl, ^cad, sc+,, US
A.81. 595[I (198↓)] was treated with restriction enzymes 1pal and ^at■ to cut out a DNA fragment of about 380 bP containing part of the trp promoter region, and the above 5''-DNA fragment was ligated to this. The obtained DNA fragment is hereinafter referred to as ProSter 5'-D.
It is called an NA fragment.

Separately, restriction enzymes 11alI and 1in were added to the recombinant plasmid pHTR91 prepared by the method α described in Reference Example 1.
A DNA fragment (4B7bP) containing the region encoding the C-terminal portion of the human TNF polypeptide was excised, separated and purified. The previously prepared promoter 5°-DNA fragment was ligated to this DNA fragment using τ4 DNA ligase. The obtained DNA fragments are shown below.

Promoter TNF (referred to as +47>-DNA fragment.

On the other hand, plasmid p[IR
The restriction enzymes ^atlI and 1lindl were applied to sG, and a large NA fragment (approximately 3.0 kbp) was isolated.

(7) Promoter TN previously adjusted to the DNA fragment
By joining F (147) ~ DNA fragments.

The expression plasmid pHT147 was tIItg.

Reference Example 3 H) Construction of expression plasmid for producing TNF polypeptide variant TNF-673 In the amino acid sequence shown by formula [I] in Table 1, Cys, the 67th amino acid from the N-terminus, was converted to Set. An expression plasmid (PIITP392) for producing a polypeptide (hereinafter referred to as TNF-673) was constructed (
(See Figure 11).

Recombinant pHTR91 obtained by the method described in Reference Example 1
was digested with the restriction enzymes ^val and INndI[I.
A DNA fragment of about coobp length corresponding to the i'IIT region downstream from base number 250 in the Shiofuki sequence shown in Table 8 was isolated.

This DNA fragment was further digested with restriction enzymes ff1Avall and Jiraud AI into three DNA fragments (approximately +02 bp, 41
bp and 375 bp) and subjected to polyacrylamide gel electrophoresis.

DNA fragments of 102 bp and 375 bp length were isolated.

These DNA fragments are chemically synthesized oligonucleotide adapters represented by the linear formula [kl and [l].

5'-GTCCTCTTCAAGGGCCAA-3
'3'-GAGAAGTTCCCGGTTCCtl;
A-5' [kl and 5'-GGCTCTCCCTCCACCCATGTGC
T-3'[I13'-GAGGGAGGTGGGTA
C-5' was ligated using T41) NA ligase.

In addition, the obtained DNA fragments contain synthetic oligonucleotide adapters [j] and [m], which are represented by the quadratic formula.

and 5'-CGATTATGTCATCTTCTC;A
ACC-3'[Ten]3'-TAATACAG
TAGAAGAGCTTGG ni CT-5', T4
Sequential ligation was performed using DNA ligase.

The DNA fragment obtained here is referred to as TNF (Sc r
G7) -1) NA fragment, on the other hand, a DNA fragment (approximately 380 bP) containing the trp promoter region was obtained from plasmid pCT-1 by restriction enzyme:'t;1lpa (and eight at
It was excised and isolated by I. This DNA fragment was combined with the previously prepared TNF (S e 07)-DNA fragment. This DNA fragment is referred to as promoter TNF.
It is called (Ser[i7)-DNA fragment.

Separately, the plasmid vector pORso obtained by the method described in Example 1-(1) was treated with the restriction enzyme Aat II.
and l1indll+ to obtain a large NA fragment (
Approximately 3.0 kbp> was isolated. By ligating the promoter TNF (Set(i7)-DNA fragment) to this DNA fragment using a fourth DNA ligase, the expression plasmid pHTP392 was obtained.

Example 1-(
2) TNF-G7S was produced by introducing it into Escherichia coli and culturing the transformant according to the method described in 71 α.

Reference Example 4 The expression plasmid for producing the following polypeptide was constructed according to the method α in Example 1.

The following polypeptide was produced by culturing the large intestine transformed with the expression plasmid.

TNF-70Y: A polypeptide TNF-70Y in which Thr at the 70th position in the amino acid sequence of formula [I1 has been converted to Tyr.
993: Cy of the 99th aroma in the amino acid sequence of formula [I]
Reference Example 5 of a polypeptide in which s is converted to Scr An expression plasmid for producing the following polypeptide was constructed according to the method described in Example 1.

By culturing Escherichia coli transformed with these expression plasmids, the following polypeptides were produced.
Little or no soluble protein was extracted from these polypeptides.

TNF-127: A polypeptide in which the 12th Ala in the amino acid sequence of formula [I] is converted to Thr. TNF-13Y: A polypeptide in which the 13th His is converted to Tyr in the amino acid sequence of the formula [IF]. Polypeptide TNF-14A: Amino l of formula [I]! Polypeptide TNF-17T in which the 14th Vat in the II sequence is converted to Ala: Polypeptide TNF-24F in which the 17th position Asn in the amino acid sequence of formula [I] is converted to Thr Polypeptide TNF-2OR in which the 24th Lcu in the amino acid sequence of formula [I] has been converted to Phe: Polypeptide TNF-35P in which the 26th Trp in the amino acid sequence of formula [I] has been converted to Arg : Formula [polypeptide TNF-441 in which the 35th Leu in the amino acid sequence of I is converted to I'ro): Formula [44th in the amino acid sequence of I1]
Polypeptide TNF-45P in which Asn at position 45 is converted to Asp: Polypeptide TNF-501' in which Gin at position 45 is converted to Pro in the amino acid sequence of formula [I] , 50th
Polypeptide TNF-54C in which Set of aromatic eyes is converted to Pro: Formula [5th amino acid sequence in the amino acid sequence of I1
Polypeptide TNF-5811 in which the fourth Tyr is converted to Cys: in the amino acid sequence of formula [I], the 58th
Polypeptide TNF-59L in which Scr at No. 11 is converted to P r o: Polypeptide TN F -Go D' in which G I n at No. 59 in the amino acid sequence of formula [I] is converted to Lcu : A polypeptide in which the 60th Vat in the amino acid sequence of formula [I] has been converted to AsP. TNF-000: A polypeptide in which the 60th Val in the amino acid sequence of formula [I] has been converted to Gly. -G2S: a polypeptide in which the 62nd position [1'hc of I in the amino acid sequence of formula [I] is converted to Scr TNF-93r': the 93rd position in the amino acid sequence of formula [I]
Polypeptide TNF-121G in which the th Scr is converted to I'ro: in the amino acid sequence of formula [I], the 12th
Polypeptide TNF-+24Q in which the first Val is converted to Gly: Formula [■ Ami7W! Polypeptide TNF-128A in which the 124th Lcu in the i sequence is converted to Gln: In the amino acid sequence of formula [I], the 12th
Polypeptide in which the 8th Asp has been converted to Ala TNF-128N: Polypeptide in which the m12B-th AsP in the amino acid sequence of formula [I] has been converted to Asn TNF-135D: Amino acid sequence of formula [I] middle, 13th
Polypeptide TNF-138Y in which the 5th Asn has been converted to AsP: In the amino acid sequence of formula [I], the 13th
Polypeptide TNF-148D in which the 8th Asp has been converted to Tyr: Ami7PiI of formula [I]! During the array,
No.! Polypeptide TNF-148G in which VaT at position 48 is converted to Asp: in the amino acid sequence of formula [I],
Polypeptide in which the 148th Val is converted to Gly TNF −+50L: Amino of formula [I]! In the amino acid sequence of formula [I], the 150th Phe in the 2 sequence is converted to Leu.
Polypeptide in which the first Gly is converted to Glu Table 1 Amino acid sequence of human TNF Ser Ser Ser Ser Arg Thr
Pro Ser ALp Lys Pr.

Val Ala 1lis Val Val
Ala Asn Pro Gin AlaG
lu Gly Gln Leu Gin T
r9 Leu Asn Arg ArgAla
Asn Ala Lau Leu Ala
Asn Gly Val GluLeu
Arg Asp Asn Gln Leu V
al Val Pro 5er Glu Cly
Lcu Tyr Leu Ile Tyr
Ser Gin ValLeu Phc
Lys Gly Gln Gly Cys
Pro Ser Thrllis ValLauLe
uThrHisThrIleScrArglle A
la Val Ser Tyr Gin T
hr +, ys Val AgnLeu Le
u Ser Ala Ile Lys Se
r Pro Cys GinArg Glu
Thr Pro Glu Gly Ala
Glu Ala LysPro Trp Ty
r Glu Pro Tie Tyr Le
u Gly GlyVal I'he Gln
Leu Glu Lys Gly Asp
Arg Leu Ser Ala Glu
Ile Asn Arg Pro AsP
Tyr LeuAsp Phe Ala Gl
u Scr Gly Gln Vat Ty
r PheGly Eye IIQ Ala
Leu[:11Table 2 Human T
Base sequence encoding NF (5')-TCA TCT
TCT CGA ACCCCG AGT
GACAAGCCT GTA GCCCAT G
TT GTA GCA AACCCT CAA
GCT GAG GGG CAG CTCCA
G TGG CTG AACCGCCG;G
GCCAAT GCCCTCCTG GCCAAT
GGCGTGGAG CTG AGA GA
T AACCAG CTG GTG GTG
CCATCA GAG GGCCTG TAC
To CTC TCTACTCCCAGGTCCTCTTCA
AG GGCCΔA GGCTGCCCTCCA
CCCAT GTG CTCCTCACCCACA
CCATCAGCCGCATCGCCGTCTCCTA
CCAG ACCAAG GTCAAACCTCCT
CTCT GCCATCAAG AGCCCCTG
CCAG AGG GAG ACCCCA G
AG GGG GCT GAG GCCAAG
CCCTGG TAT GAG CCCAT
CTAT CTG GGAGGG GTCTTC
CAG CTCGAG AAG GGT GA
CCGACTCAGCGCT GAG ATCAA
T CGG CCCGACTATCTCGACTT
T GCCGAG TCT GGG CAG
GTCTACTTT GGG ATCATTT
GCCCTG-(3') [A] Table 8 HiLTN
Amino acid sequence deduced from the base sequence encoding the F precursor and the saltba sequence GACCCCACGG -30-20-10-I CTCCACCCTCTCTCCCCTGGAAAGG
ACACC(21luGIupHC厘'rOArgA9
pLCuSerLcuIIcI bi The part surrounded by [] shows the nucleotide sequence encoding human TNF and the amino acid sequence of human TNF.

Table: Base sequence encoding OTNF-32Y and amino acid sequence deduced from the base sequence +11SValL (!uL
culharll+5TttrllcScrArlr1n
b This zero indicates a stop codon.

Table 10 Amino acid sequence deduced from the nucleotide sequence encoding 7NF-115L and the salt J1 sequence 11isValL
cuLculnrll+5tor+ +cbcrhar+
The r zero at the end indicates a stop codon.

[Brief explanation of the drawing]

Figure 1 shows examples of restriction enzyme cleavage recognition sites for DNA encoding human TNF polypeptide.
The region encoding F is shown. Figures 2 and 3 show the steps for constructing an expression plasmid for producing TNF-32Y. In the figure, the two synthetic oligonucleotides [al, [b] and [c are respectively Example 1-(
11. Figure 4 shows the steps for producing the PL-DNA'#fr piece used for the construction of the expression plasmid for TNF-115L production. It refers to the synthetic NA adapter described in (1). Figure 5 shows the elution of the lysyl endopeptidase digestion product (peptide fragment) of TNF-115L by high performance liquid chromatography. Figure 6 shows Figure 7 shows the construction process of the expression plasmid pHPL-147 (Example 3). Figure 7 shows the construction process of the expression plasmid pHPL-9arG7 (Example 4). Figure 8 shows the construction process of the expression plasmid ptlr1.I47sO7.
(Example 5). FIG. 9 shows the process of constructing the expression plasmid pHTR91 for TNF production in mature humans. In the figure, synthetic oligonucleotides [f] and [g each refer to the synthetic 1) NA adapter described in Reference Example 1. FIG. 10 shows the construction steps of expression plasmid pH7147 for producing a polypeptide consisting of an amino acid sequence of +47 residues. In the figure, synthetic oligonucleotide [h]. [+] and ['' are the synthetic N described in Reference Example 2, respectively.
A means adapter. FIG. 11 shows the construction steps of the expression plasmid pHT+'392 for producing TNF (Scr137). In the figure,
Synthetic oligonucleotides [k], [+], [J] and [
Patent applicant: Dainippon Pharmaceutical Co., Ltd. Representative Yu Tsuboi Part 4 Figure 1 Figure 2 (NY-DNA fragment) Figure 3 Fig. Synthetic oligonucleotide Fig. 5 141+I@17MLmln Fig. 6 Fig. 8 Fig. 9

Claims (18)

[Claims] (1) In the amino acid sequence represented by the following formula [I], the 16th, 31st to 34th, 36th, and 48th
No. 73, No. 82, No. 85, No. 88, No. 94, No. 87, No. 98, No. 103, No. 113, No. 115, No. 117, No. 1
18th, 131st, 132nd, 141st-1
A polypeptide having an amino acid sequence in which at least one of the 46th and 153rd amino acid residues has been converted to another amino acid residue (however, the 115th amino acid residue has been converted to another amino acid residue) (in cases where the 67th and/or 99th amino acid residues may be converted to other amino acid residues) or up to eight amino acids on the N-terminal side of the polypeptide are deleted sequentially from the N-terminus. lost polypeptide. [There is an amino acid sequence] [I] (2) The polypeptide according to item 1, wherein the 32nd amino acid Asn and/or the 115th amino acid Pro in the amino acid sequence represented by the formula [I] are converted to other amino acids. (3) The first amino acid in which the 32nd amino acid Asn in the amino acid sequence represented by the formula [I] is converted to Tyr.
Polypeptides described in Section. (4) The polypeptide according to item 1, wherein the 115th amino acid Pro in the amino acid sequence represented by the formula [I] is converted to Leu. (5) A polypeptide in which Met is bound to the N-terminus of the polypeptide according to any one of claims 1 to 4. (6) A DNA having a base sequence encoding a polypeptide according to any one of claims 1 to 5. (7) 32nd codon AAT in the following base sequence
DNA that has or contains a base sequence that has been converted into a codon that encodes another amino acid. [There is an amino acid sequence] [A] (8) DNA having or containing a base sequence in which the 115th codon CCC is converted to a codon encoding another amino acid in the base sequence represented by formula [A] in claim 7 j28. . (9) The DNA according to claim 7, wherein the codon encoding another amino acid in claim 7 is a codon TAT encoding Tyr. (10) The DNA according to claim 8, wherein the codon encoding another amino acid in claim 8 is a codon CTC encoding Leu. (11) D according to claim 6, in which a start codon and/or a stop codon are bound to the 5' end and/or the 3' end of the base sequence according to any one of claims 6 to 10.
N.A. (12) A vector incorporating the DNA according to any one of claims 6 to 11. (13) A vector obtained by incorporating any of the DNAs described in claims 6 to 11 into a gene expression vector. (14) A host transformed with the vector according to claim 12 or 13. (15) The host according to claim 14, wherein the transformed host is a microorganism. (16) The host according to claim 14 or 15, wherein the transformed host is E. coli. (17) A method for producing the polypeptide according to claim 1, which comprises culturing a host according to any one of claims 14 to 16 and collecting the polypeptide from the culture. (18) A pharmaceutical composition containing the polypeptide according to any one of claims 1 to 5 or a salt thereof.