JPS62210989A - Effective procaryon expression system - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The expression of cloned DNA in tubes has been extensively studied. The most available information relates to the expression of own, foreign, and hybrid genes cloned in large iI% planes using portable promoters in plasmid, phage, or cosmid cloning vectors.

PRIOR ART Several laboratories have recently reported expression levels of 30% of total cellular proteins as a single protein product.

The major IL1 gene uidA codes for the enzyme β-O-glucuronidase (E, C, 3, 2, 1, 31), which may be the first enzyme in the hexurodohexuronate pathway. (7 Bushyu XPk Sea, [19
B21Methods in Enzymol.

5:190-208), this enzyme is derived from β.D-glucuronide, but hydrolyzes β-0-glucuronide and underivatized β-O-galacturonide to their respective uronic acids. Subsequent enzymes in the pathway convert glucuronate or galacturonate to 2-keto-3-deoxyglucuronate (DG), which is further fed into the deW pathway after phosphorylation to DG-+3-
P: is produced and converted to rubate + glyceraldehyde triphosphate.

! LL! The iA gene is a closely linked upstream repressor gene! It has been shown to be under negative regulation by LLeR, and partially or weakly negatively regulated by another IR gene. Maddaki” Rusin #--Im [1983] Mo1
．． Gen, Genet, 191:263-27
0).

LXjlR is a repressor of the looperon, which later produces the enzyme necessary for the conversion of fructochronate to KGD by the same pathway (Barn, X and Noheel, G. [1976] J, 8acterio1.
127:407-417, id. 418-432).

Blanco et al. (19B2) J, Bact, 149:
587-594) is the large 111 of Kralke and Carbone @
- Identification of plasmid υ1 from the ColEl hybrid clone bank (1976 Cal 9:
91-99>. This is the LL[lA
, LLLJIA-LLL! It has an IR area. strain, lA200 (Ul) when fully induced, lA2
β-D-glucuronidase enzyme induced in 00
．． I only made 8 times as much. In contrast, subclones carrying the Yama^ gene without a direct copy of the Harebresser gene produced sufficient enzyme as visualized by Komatssie blue staining of non-denaturing polyacrylamide gels (Figure 83 of Blanco et al.).

[Means for Solving the Problem] The present invention enables those skilled in the art to express cloned gene products to a level hitherto unattainable of 5Q$tt@err of whole cell proteins of mm hosts containing a single polypeptide product. The new L-<tablet system, which is in between recognized highly efficient expression systems, is capable of producing high yields of the enzyme β-glucuronidase (BG) useful herein. Such expression of large amounts of BG is achieved by the use of a hybrid plasmid vector consisting of the large IG gene DNA. The fact that BG is expressed in such a large amount suggests that BG was only expressed in insignificant amounts by its original E. coli host, and the known E. coli strain of the 8G gene described by Barco et al. (19B2). It is surprising that no clone expressed the BG enzyme at these exceptionally high levels.

It is therefore believed that this state of the art for BG expression by E. coli has led those skilled in the art to abandon the use of BG promoter DNA in prokaryotic expression systems. rather well-characterized yi and b
Promoters have been used extensively in prokaryotic expression systems.

Expression vectors that exemplify the high expression system of the invention are hybrid plasmids pBG101-41 and pBGl. The new hybrid plasmid pBG101-41 contains approximately 6 kb of E. coli BG DNA inserted at the Ban+HI position of pBR322. The novel hybrid plasmid pBG1 is Sat I,8
The 1237 base pair SalT of pBG101-41 was ligated into pBR322 vector cut with amHI.
- Contains the BamHI fragment. Plasmid pBGl
See formula A, which has all the nucleotide bases necessary to achieve high level expression of the host transformed with plasmid pBG101-41.

The figure shows the endonuclease restriction map of plasmids pBG101-41 and pBGl. Formula A at the end of the specification
depicts the DNA sequence of pBGl into which E. coli BG has been inserted. The 26 base pair dyad is outlined with a dotted line. RBS = liposome binding position.

The present invention is in the field of molecular biology and relates to expression vectors useful for producing the useful enzyme β-D-glucuronidase in a highly efficient manner. The level of expression of β.0-glucuronidase by a suitable E. coli host is at least 50% of total cellular protein.

β-0-glucuronidase is a useful biological tool; for example, it can be used to identify steroids in the urine and to measure steroid conjugates in the blood. The current high price of this enzyme is due to its low level of presence in native E. coli.
This greatly reduces the cost of manufacturing this enzyme. This increased level of expression affects the cost of protein production in two independent and significant ways. Increased expression of useful enzymes can be produced in a growth vessel, e.g. a Fl fermenter of any given size.
increase to Furthermore, the increased level of expression greatly reduces the degree of difficulty encountered in purifying the enzyme. For many uses of this useful protein, the protein must be in pure persimmon form.

The expression system of the present invention can be used to express useful proteins similar to β-glucuronidase. These proteins can be produced either by inserting their genes after the BG promoter or by using the BG promoter and the N-
High levels of expression can be achieved either by creating hybrid genes containing the terminal sequences. Useful proteins that can be expressed at high levels by one or both of these methods include industrially useful enzymes such as sugar isomerase (glucose isomerase), proteolytic enzymes, sugar and starch amylases, rennet, esterases and oxygenases. such as lignin-degrading enzymes and aromatic ring-cleaving enzymes. Other useful proteins that can be expressed by this system include hormones such as insulin, interferons, interleukins, growth hormones, and somatomedins, including human, bovine, and poultry. derived growth factors, tumor necrosis factors,
These include glucagon, pituitary hormones (growth hormone stimulating factor, ACTH, endorphins), adrenaline-inducing protein hormones, and rennin.

Additionally, the invention is particularly useful for expressing bacterial toxins and viral proteins. These viral proteins can be used in the production of cutin and in the development of assay kits to detect the presence of either viruses or virus-derived antibodies in biological body fluids. The bacterial toxins expressed by this stone can be used to treat diseases or control pests in the environment.

All of the proteins mentioned above can be produced by the techniques described above, or by other techniques known to those skilled in the art.

Before describing in detail the construction and identification of the novel plasmids and expression systems of the present invention, the materials and methods used are disclosed.

(1) Medium - The culture medium is YT medium (8 g of tryptone, 5 g of
g of yeast extract, 5 g of NaCl/vert). If necessary, add 50μ87ml of ampicillin,
Tetracycline was added at 20 gg/ml. Glucuronidase screening plates were prepared by Tarshin and Lynch ([1973] ppl, Microbiol,
26:863-866).
g/ml β-methylumbelliferyl glucuronide (
MUG).

(2) Escherichia coli DN, A-large 111 M DNA was obtained from Murmar (1961, 1, Mo1.8iol).

3:208-218) and 7 Nilionis and Lilley (1980J, Bacteriol, 14).
3:355-365) from the MS371 strain. All large intestine seedling strains disclosed here are large III.
This is an MK-12 induction surface.

(3) β-0-glucuronidase assay - Hydrolysis of p-nitrophenol-β-glucuronide (pNPGA) and release of free p-nitrophenol was measured by absorbance increase at 400 nm. The assay was calibrated against standard E. coli type ■ enzyme material obtained from Sigma Chemical (St. Louis, Mo.). The sigma unit definition (revised Fishman unit) of β-glucuronidase is 1.0 gg of phenolphthalin glucuronide in 1 hour at 37°C at optimal pH (6.8 for the E. coli enzyme). It has the activity of liberating ren. The testing procedure is as follows. Each assay tube was pre-equilibrated with enzyme sample in 0.98ml 150mM NaH.
PO<(FIH6,8) or E. coli type ■ W# violet standard in 0.01 ml for 10 min at 37 °C. Add 0.11 lomg/ml pNPGA Motoga solution and quickly Start by mixing, 37°C
0 reactions incubated in a water bath at 0.11 to 1. .

Buoyancy was achieved by addition of N NaOH. 400nm
The absorbance at 37°C was measured against a blank containing all components except the enzyme, which was incubated for the same period at 37°C. Duplicate assays were performed for each of the three different times to obtain accurate activity data.

(4) Two-dimensional gel electrophoresis - Escherichia coli lysates were prepared by treatment with lysozyme followed by several freeze-thaw cycles. The clarified supernatants of these lysates were assayed for protein. These samples are next 2! NP40
and 5zβ-mercaptoethanol into an isoelectric focusing gel. The isoelectric gel was cast into acid-washed 160 x 2.5 II 1 m (inner diameter) glass tubes. The formulation of the gel solution is as follows (for 101).

5.5 g urea (ultra pure, Schwarzman, New York, New York) 1.33 ml acrylamide solution (28.4 m w/w)
Capacity: 11,117 mm, t, e: Weight/Capacity: Acrylic 7 mm) 2.0 ml IO! Capacity/Capacity NP401.97m1 H2O 0.60m1 Amphoteric salt (LKB, J-i-11-
5-1MO), r+83-100.08ml of tetraethylmethylenediamine solution was degassed, then 10μ
10×Ift/volume of ammonium persulfate solution was added, and approximately 1.21 μm of ammonium persulfate was added to each glass tube through a 4-inch or larger spinal tap needle. . Pre-seal the bottom of the test tube with paraffin. The top of the gel was covered with 20 μm of deionized water and polymerization occurred within 30 minutes at room temperature. The isoelectric focusing gel was placed in a tube gel electrophoresis apparatus (Hoeffer Scientific Instruments, Sun Francisco, CA). The lower (anode) electrode buffer was 1 wM phosphoric acid, and the upper (ca-, de) electrode solution was 20++M N
It was aOH. The NaOH solution can be freshly prepared or C
Stored under vacuum to prevent O2 accumulation. 30 gels
Prefocus was performed at 0 volts for 30 minutes before sample loading.

Sample (typically 100 μs protein) is transferred to the top (cathode end) of the isoelectric focusing (IEF) gel.
layered on top. 1εF was then carried out at 300 volts for 14 hours and then at 800 volts for 2-3 hours. Extrude the gel from the tube for 30 minutes 2.3! SO5,62,511
N) ') , ;C) ICI (+)86.8) and 5
Equilibration was carried out for 30 minutes with a solution consisting of Iβ-mercaptoethanol. The equilibrated gel was placed on top of a conventional discontinuous SDS polyacrylamide slab gel cooking gel, and the equilibration buffer (2,:l$sD
s, 62.5 mM) Lis-11cI (pH 6,8)
, 5zβ-mercaptoethanol) in hot 1
Seal in place with z agarose solution.

The gel was run in the second dimension at 25 m7'7/gel until the tracking dye reached the end of the gel.

The slab gel was then stained with 0.24% Comassie Blue R11 oz acetic acid in 5 oz methanol for approximately 30 minutes at room temperature with gentle agitation.

Destaining in lOx methanol, 5x acetic acid was performed overnight, again with gentle agitation, and the stained gels were then directly photographed.

(5) Plasmid DNkm '111-Plasmid DN
The method used for large-scale production of A is essentially as follows. Grow 250 ml of culture medium to logarithmic phase and adjust the optical density to 0.6-0.7 with chloramphenicol.
or alternatively without the addition of chloramphenicol)
The cells were amplified and grown overnight. Cells were heated to 6 JA for 20 min.
Pellet with 140-tera and 61-glucose buffer (
50mM glucose, 25mM) Lis, 10mM E
DTA). Transfer the cells to 1 ml of 20ml at room temperature.
g/ml of freshly made lysozyme for 10 minutes, add 13.8 ml of tzsos in 0.2N Na0)I for 5 minutes, place on ice, and incubate on ice for an additional 15 minutes.
1 of 5M KAC (p) 15.0-5.5). The debris was pelleted for 10 minutes at 10°C and an equal volume of pheno-chloroform-isoamyl alcohol (25:
24:1. The supernatant was extracted once with TE saturated, O, 1% 8-hydroxyquinoline). Following precipitation with 0.6 volume isopropyl alcohol, the DNA was
Purified on I gradient.

(6) Restriction enzyme digestion and isolation of desired fragments - Digestion was performed according to the supplier's instructions. The fragments were separated using TBE slow solution containing 0.5 μg of ethidium bromide 11 (
90mM) Lis, 0.89M borate, 2mMEDT
This was accomplished by 7-gallose electrophoresis in A). Isolation of the desired fragment is achieved by cutting the appropriate region of the gel, followed by 100
[lNA voltage in TBE for 2 h at volts]
c elution (electroelution), followed by 1
This was accomplished by reversing the current for a minute to reduce DNA attachment to the dialysis tubing. Eluted DNA
Purify L-chip (εIu) according to the supplier's instructions.
-tip) column (Schleicher and Schnell, Chiene, NH) followed by precipitation by addition of carrier tRNA in 2.5 volumes of EtOH.

(7) DNA ligation - standard vector/
T4 ligase was used for insert ligation and was present in excess (200u/μ8 DNA). Inserts were present in a 5-fold molar excess, 0.0z in a 20 μm reaction volume.
There were β moles of vector and o, i p moles of insert.

(8) Transformation - Fresh overnight culture was diluted in L-broth and grown at 37° C. with stirring until Asoa 0.3 was obtained. Cells were cooled on ice and then collected by centrifugation (4100 xg for 10 min). Cells were resuspended in 1/2 the original volume of ice-cold 50mM CaCl2 and incubated on ice for 20 minutes. Cells were again collected by centrifugation as above and resuspended @ 0.1 ml of cell suspension in ice-cold 50 mM CaC12 (j% 1/25 of the initial volume) with 1-10 μI (50-100 ng )'s DNA
It was mixed with the plasmid solution and allowed to stand at 0°C for 30 minutes.

Cells were then heated at 37° C. for 2 minutes and plated on Nipros plates containing 1.5$ agar and either 10Mg/ml tetracycline or 50μ8/1 ampicillin. Plates were incubated overnight at 37°C. Transformation efficiencies of 1 x 108 colonies/mg plasmid DNA were consistently observed.

(9) Agarose electrophoresis - DNA fragments 2X) Lysuborate 11 solution (178mM) Lys, 178n+M
Isolated by gel electrophoresis in 0.8% agarose in boric acid, 5mM'Na2EDTA pH 8,4). The analytical and separation gels were immersed in electrophoresis buffer (1× Tris-boreto) in a horizontal gel barrel and run at 60 volts.

DNA bands were made visible under UV light by including 5.0 Mg/ml ethidium bromide (EtBr) in the gel. Cut the section containing the desired DNA band from the gel and place it in dialysis tubing (
112 diameter) of 0.5 to 1. DNA was recovered by electrophoresis in 1x Tris-borate buffer containing oml of buffer. Electrophoresis was run for 30 minutes at 10 volts or until the stained material was positioned against the side of the dialysis tube. The gel slices were removed from the dialysis bag and the DNA was recovered by flushing the bag multiple times with Tris volley.

NaCl was added to the INA solution to a final concentration of 1 molar, and ethidium bromide and agarose gel impurities were removed by extracting twice with phenol saturated with Tris-borate buffer. The phenol was removed by two extractions with ether and the purified DNA was recovered by precipitation with 1710 volumes of 3M sodium acetate pH 4,5 and 2.5 volumes of cold ethanol. The precipitation reaction was carried out at -70°C for 15-20 minutes. precipitated [
) The yield of recovered fragments was assayed by direct comparison of ethidium bromide fluorescence with pure NA standards. Recovery of 50% was typically obtained, with yield decreasing as the size of the fragments increased.

(lO) Polyacrylamide gel electrophoresis - all SO
S gel is run by Laemli's method, Laemli U,
, [+9701 Nature [London] 227:68
0-685).

These gels contained a total acrylamide concentration of 9%. Slab gels were 1.5 mm wide and run in an electrophoresis apparatus obtained from Hoef 71 Scientific Instruments (Sun Francisco, Calif.). Tube gel stacking without gel 6+nm inner diameter x 1
It was run in a 0 cm glass tube.

The tube gel was stained in the following manner. 1.0mg of gel overnight
650 ml of isopropyl alcohol containing 2501, 820 and 1001 of Comassie Blue
of acetic acid. This was then re-stirred overnight in 1001 parts acetic acid, 1001 parts isopropyl alcohol and 8001 parts H2O containing 0.05 Comassie Blue. A third overnight stirring was carried out in 10% acetic acid. The gel was then scanned using a Peckman Model 34 with a Model 576767 Gel Scanner (Beckman Instruments).
Scanned using a spectrophotometer. The % expression was determined by cutting out the protein peak and measuring the weight of the paper. The % hybrid protein expression was calculated as [β-glucuronidase protein weight/total protein peak weight] x 100%.

(11) Bacterial strains and media - The origins and genotypes of all bacterial strains used are listed below.

All strains were maintained and grown using YT medium (8 g
5 g/d tryptone, 5 g/d yeast extract, and 5 g/d sodium chloride).

(12) Chemicals - Growth medium components were obtained from Difco (Detroit, MI) and acrylamide was obtained from Accurate Chemical and Scientific Corporation (West Valley, NY). All pond chemicals were obtained from Sigma Chemical Company (St. Louis, Mo.).

(13) Culture medium (all Escherichia coli K-12 strains) (A) Bacterial strain - 1 run l Kukou 1 1 stop 1 E. coli F-1 GAL-1 Thi-1 NRRL B-1
5129MS371 endA, phantom 24B,
Deposited on August 18, 1982 bi! iR4 Currently available to the public E. coli argE3, lacY 1, NRRL B
-1591? GMS407 galK2, man4
, deposited on December 7, 1984 uidA1. mtll large mW Pro-1Leu-1NRRL 8
-11371) 18101 Th1-1IacY,
In general, hsdR, endA can be done manually.

recA, rpsL20゜upE44 (B) Bacterial host 11 Eyuyu 1 upper 1 stop 1j MS371 (pBG10141) NRRL B
-15905 Deposited on November 1, 1984 MS371 (118G1) NRRL B-
15904 Deposited on November 1, 1984 (C) Plasmid Plasmid pBR322 is a well-known and accessible plasmid. This is E. coli host ATCC370
It is held in 17. Purified pBR3220114 was obtained from Polyva F0, Rodrique EZR, L0, Greenepp, JA0, VetrachM, C0, Heinecker H, L0, and Boyer H.

Dubliny 9, Crosagiei, H., and Falkoues, (1977) Gene 2: 95-113:
and Sutcliffe, G., (1978) N.
ucleic Ac1ds Res.

5: 2721-2728.

NRRL B-15915, NRRL B-159
04 and NRRL B-15917 are generally available pursuant to patent grants disclosing these deposit numbers. It is to be understood that the availability of these deposits does not constitute a right to exploit any patent rights granted to this invention by administrative action. The culture medium deposit is at the Northern Regional Research Laboratory (NRRL), US Department of Agriculture, Peoria, Illinois.

Other well-known E. coli hosts can be used in place of E. coli MS371, such as large 1i1 M RRI, 88101.
and Escherichia coli GMS407 (Norhel M. and N.H., [1973] Mol.

Gen, Genet, 120319).

A further pond prokaryotic host that can be used is Salmonella
onel Ia), Pseudomonas
nas), Bacillus, Streptomyces, and the like.

(14) Recombinant DNA from transformed host
Isolation of Recombinant plasmid DNA can be isolated from its prokaryotic host using well known procedures, such as clear lysate-density gradient equilibration procedures.

(15) DNA sequencing DNA sequencing (Maxam and Gilber) (197
(1977)
Proc, Natl, 8cad, Set, US 74
:5463-5467.

growing the cells, extracting the DNA, performing restriction enzyme digestion, electrophoresing the DNA fragments, tilling the plasmid, annealing, inserting ON8, ligating the DNA, transforming the cells, Plasmid DNAftm
It is within the skill of those skilled in the art to vary the conditions required for electrophoresing proteins and for DNA sequencing.

(16) Construction of hybrid plasmid - The source of β-glucuronidase (B'G) gene DNA used to construct hybrid plasmid pBG101-41 was E. coli MS371. This BG gene DNAft
Inserted into pBR322 at the BamHI location. A large i! ligation mixture lacking BG activity! Transformed into bacterial competent cells.

Subsequent plating on YT agar, followed by screening and purification generated a clone designated BGIOI-41. Plasmid DNA was isolated from this clone and retransformed. Plasmid pBG101-41
Identification was then established by DNA size, restriction endonuclease pattern and BG expression in the prokaryotic host.

The novel hybrid plasmid pBGl is pectot
-41 of 1237 base pairs of Sal l -Bam)I
The plasmid pBG101-41 was constructed by removing the I fragment and ligating it into the SaJ I, BamHI cut pBR322 vector. The identity of pBGl was established as described above for p8G101-41.

Examples are given below to explain procedures including the best mode for carrying out the invention. These examples are not to be construed as limiting; all percentages are by weight and all solvent mixture proportions are by volume, unless otherwise stated.

下＝し」剋－L は ト－'-'s'
t” -20 mg of E. coli MS371 DNA
were incubated with two units of 5au3A enzyme at 37°C in a 200 μm0 reaction volume. Except for the 50 μm section, the reaction was stopped after 2, 5, 10 and 30 minutes by heating to 80°C. Testing of 1 μg samples after gel electrophoresis through H agarose was performed for 2 min and 5 min.
It was shown that it contained a partially digested product with an average molecular length in the 0 kb range.

An 11 g amount of each of these partial digests had been heat treated to inactivate the restriction enzyme.
It was ligated with the cleaved pBR322. The ligation mixture is β-
E. coli mutant fiGM lacking glucuronidase activity
s407 (NRRL 8-15917) (7) Eligible w
Transformed into single cells, each mixture was spread on 10YT agar plates supplemented with 50 μg/ml ampicillin and 5 μs/ml MUG. - After overnight incubation at 37°C, the plates were examined under UV light. Each plate was densely covered with colonies, but a single focus of strong fluorescence was seen on three plates. Colonies from these foci were treated with YT, ampicillin, Mt, lG.
It was purified by re-slanting on agar plates. After four rounds of purification, isolated highly fluorescent colonies were isolated, and one such purified colony was named BGIOI-41 and was selected for further study. Plasmid D N from this transformation,
Isolation to A and large Il! Strains GMS407, MS371
and 88101 showed that the MLIG+ fluorescent phenotype was coselected with ampicillin resistance conferred from pBG101-41.

A restriction map of pBG101-41 plasmid DNA was derived and is represented in the figure. The B. E. coli DNA insert is approximately 6 kb in size and contains a single recognition site for the endonucleases BamHI, εcoRI, and XhoI. The insert is PstI, C
Not cleaved by 1al, t(ind■, or SalI).

The presence of high levels of β-glucuronidase activity in the pBG101-41 transformants was confirmed by pNPGA assay). Lysozyme-EDTA solution W GMS407 (pB
G101-41) and MS371 (pBG10141)
cells showed similar activity of 1000-1500 units of β-D-glucuronidase activity/mg wet cell weight.

Y of MS371 and MS371(pBG101-41)
T growth arrest'#, r4 (stationary pha
se) A 100 μg protein sample of the culture medium clear lysate was resolved by two-dimensional electrophoresis as previously described. M.S.
While the protein pattern seen in the 371 lysate is that of a typical E. coli strain, MS371 (pBG101-
41) The lysate is normal! A single major protein species was shown with a much reduced content of the normal combination of fungal proteins.

This major protein has an apparent molecular weight of 72 and d,
It had an isoelectric point of approximately 6.8, consistent with the properties of E. coli β-glucuronidase enzyme. The major protein was clearly more abundant than any other cellular protein, and visual assessment suggested that it comprised over 50% of the total cellular protein. This corresponds to a level of cell wet weight of 61 or higher.

Glucuronidase enzymes from other sources exist in tetrameric form, leading to the prediction that the native colon We element is of very high molecular weight and may be separated from other host proteins by gel filtration. 91 MS371 (ρ) containing 3.5 x 10 units of β-D-glucuronidase activity.
BG101-41) crude cell lysate was added to 1.5 ml of 0.0.
Mixed with 5mM sodium phosphate pH 6,8, flow rate 11/
Minute Ultra Gel (LIItraBI=registered trademark)
ACA34 (Shiuni B, Geiserberg, M (1), column (2,5 cm x 120 cm, 590 ml volume) was loaded. The column was coated with 50 mM sodium phosphate pH 6,8
, 1mM εDTA, in+M DTT.A single peak of partially contained protein was β-glucuronidase activity that eluted from the column long before the low molecular weight protein peak.

The recovered β-glucuronidase peak has a total activity of 2.
1 x 10? units (more than a 6-fold increase in the total apparent 1 activity of the loaded column), indicating a protein content of 490 II 1 g. The apparent increase in activity may be due to removal of inhibitor in the crude lysate from the enzyme preparation. The specific activity of this fragment is therefore 4.2 x 10? 11/8
It is. Four such purified enzymes I! A sample (20 μg) of 1 product run on a 121 polyacrylamide gel showed a 95% reduction after only one column purification step.
It was determined that the purity was higher than that of β-0-glucuronidase.

Example 2 Construction of hybrid plasmid pBG1 Hybrid plasmid pBG1 was constructed as shown in the drawing. pBGl is Sat I, 8allHI cut pBR
1237 base pair pBG ligated into 322 vector
This is a clone of the SalI-BaII)II fragment of 101.41. This plasmid was added to MS371 and GM
S407 and the total protein content of overnight cultures of these transformants was examined on SOS polyacrylamide gels.

Four isolates of MS371 (pBGl) showed the presence of an abundant protein with a molecular weight of approximately 20 d, which is consistent with MS37
This was not found in the parents of No. 1. This protein is incompletely terminated after BaIII I C placement of pBGl (truncated) uid
A* is estimated to be intact, and truncates 20% of the enzyme, which accumulates to an estimated 15% of total cellular protein and has no β-glucuronidase activity.
d) N-terminal fragment was produced. This is clone BGI
Corresponds to the similar number of molecules expressed per cell for OI-41. This is because the incomplete polypeptide is on the order of one-fourth the size of the intact enzyme. Plasmid pBGL thus contains all the sequences necessary to specify the high level expression observed in clone BGIOI-41.

p B t; GMS40 on plates containing β-methylumbelliferyl glucuronide (MUG) to check for the presence of the old dR operator position among others.
7 (pBGl) and MS371-(pBGl) were tested. Fluorogenic activity was present in MS371 but G
It did not exist in MS407. Activity is GMS
407 host, so it is not directly contributed by the plasmid, and the activity is not found in MS371 (pBG
l) This phenomenon is observed in the chromosome (UID).
A) It must be due to derepression of gene copies.

Therefore, the plasmid pBGl copy is the host's old dAi! +
i binds a repressor molecule that releases inhibition of the child, u
It has an id operator position.

Formula A shows the large 1111 MBG insert DNA sequence of BGI. The single open reading frame cut at the BamH1 position is the uidA structural gene.

The nucleic acid sequence of the control region of Gyokuryu is disclosed along with the flanking 170 codons of the N-terminal segment of the structural gene. The 17 N-terminal amino acid residues of the β-D-glucuronidase enzyme were identified by the amino acid sequence of the isolated protein product.

A computer-aided search of the DNA sequence of the upstream regulatory region of the uidA gene reveals a possible promoter configuration, a predicted CAP-binding position, and a 26-base pair imperfect dyad symmetry. (symmetrical) and may be involved in repressor binding, and a strong liposome binding site with an appropriately spaced methionyl initiator codon.

Plasmid pBGl contains all the sequences necessary for high expression and can be used as a transfer vector for the expression of useful proteins as discussed previously. The procedure for using the nucleotide sequence of the pBG1 position shown in Formula A to function as a promoter sequence in various transfer vectors and prokaryotic hosts is well known and standard in the art. For example, a promoter [)NA sequence into a formula can be used in much the same way that promoters are currently used in this technology. Furthermore, only a portion of the nucleotide sequence represented by formula A can be expressed in a prokaryotic (E. coli) expression system as a useful protein (
It was determined that protein A) could be used as a promoter to create very high level expression (in excess of 5 oz of total cellular protein). We next showed that the sequence has extremely high expression activity.

CAτATq 9τ GACAGττTAT CGTT
CCCAAT ACGC'rCCAACGAACGTT
CGG TTGCTTATTT TTGGCTTCT
GTCAACGCTC;AhalI Engineering 5au
3A TτTTAAAGAT ATCTATA to TAATGC
TCACGCT(1; TGGGTATTau3A GCAGTTTTTG GTTTTTTGAT CGC
GGTGTCA GTTCTTτττAco I TTTCCATTTCTCTTCCATGG GTTT
CτCACA CATAACTGTCBS CCAGTATTAT TATCTTAATG AGG
AGTCCCT T ATG TTA C ni Taq I CCT ni TA GAA ACCCCA ACCCGT
GAA ATCAAA AAA CTCGACGGC The above nucleotide sequences can be readily engineered by those skilled in the art, and thus any portion of the sequence can be used in expression systems to enhance the production of useful proteins. For example, this sequence can be cut at any one of the restriction positions shown, as well as at others not shown, to give fragments of various sequences. Additionally, if this sequence is cleaved with one or more restriction endonucleases, the resulting fragments can be further chewed back by the use of exonucleases or synthetic linkers can be added. Additionally, double-stranded synthetic oligonucleotide fragments containing multiple cloning sites containing several restriction endonuclease recognition sequences can be inserted into the translation region, and the cloned segments may therefore have more general utility. Will. All these manipulations can be made by those skilled in the art without undue experimentation. Accordingly, the scope of this pioneering invention encompasses all or part of the nucleotide sequences set forth above, provided that the nucleotide sequences used enhance the level of expression in the prokaryotic expression system used. Again, the presence or absence of expression level enhancement in prokaryotic expression systems can be readily ascertained by one skilled in the art without undue experimentation using the standard procedures described herein.

The scope of the invention includes the use of all or a portion of the disclosed BG structural gene sequences, including the use of the BG promoter region not only for producing BG, but also as part of an expression system for producing other useful proteins. Upstream non-anatomical translations of 1) include the use of all or part of the HA sequence, many of which are exemplified herein.

Thus, in using the present invention, one skilled in the art can readily determine whether the 8G promoter and all or only a portion of the genetic DNA will function best to provide high expression levels of the desired protein. Will,
This determination can be made without too much experimentation and includes all or part of the first 17 codons of the B6 structural gene shown in formula A and reproduced above as well as the upstream untranslated components disclosed above. It stands to reason that some or all of the 271 base pairs of sequence will provide the highest level of expression in a particular expression system designated for the production of a particular useful protein.

It is understood by those skilled in the art that the DNA from the phenotypic system is the individual protein gene DNA.
It is clear that the protein produced by the BG expression system of the present invention may be a hybrid protein in that it will be co-transcribed with A. These hybrid proteins still retain the major functions of the desired protein and can therefore be used as any desired protein is used. It is within the skill of those skilled in the art to further process the hybrid protein to recover the desired protein if desired.

As is well known in this technique, the nucleic acid sequence W11' upstream of the structural gene and other promoters are identified. Only some of these nucleotides are important for promoter activity. One is located 35 bases upstream, and the other is located 10 bases upstream of the position where mRNA starts. For example, Hawley D, K., and Matsukurure W, R.

(1983) Nucl, Ac1ds Res, +
1:2237-2255.

The CAP (degradation product activity (hiprotein) protein) is known to bind at certain promoter positions and stimulate expression from the promoter. 198
4) 5science 224:831-83L The nucleotide sequences interspersed between these positions may not contribute to expression activity, so certain bases can be changed without affecting this activity.

Also, the amino acid sequence of a protein is determined by the nucleotides of DNA. Due to the redundancy of the genetic code, i.e. the protein tti! For many of the amino acids used to make
- Different nucleotide sequences can be encoded for a particular amino acid since more than one encoding nucleotide triblet (codon) can be used. Therefore, the genetic code is depicted as follows.

centre! 2n7 U: N (Phe) TT Histician (old S) CA 0 Ishin (Leu)
XTY Retail (in)
CAj iso 0 isine (Ile) ATH
7 Suha 0 Rakishi (Asn) AA methionine (Met), ATG phosphorus (L
yS), AA, 1+1-phosphorus (
Val) GTL 7th" Birakin 1i (Asp) GA Serin (Ser)
QR5 glutamic acid (Glu) GAj fluorine (Pro) CCL cysteine (Cys) TG to storonishi (Thr
) ACL ) Lift 0 Tof 7 (Try
) TGG7 Lanin (Ala) GC
L 73N-n (Arg) WGZyo Ushishi (Tyr) TAK Ri-rishishi (Gly) GGL Sueli Inio TA
J Terminal Signal TGA Key: Each three-letter deoxynucleotide triplet has the 5'-end on the left and the 3'-end on the right.
Corresponds to the NA trinucleotide. All DNA sequences given herein are of the sequence chain corresponding to the mRNA sequence, with thymine substituted for uracil. The letters represent purines or pyrimidines forming a deoxynucleotide sequence.

A = Adenine G = Nibuanine: Cytosine T = Thymine X = T or C when Y is A or G X = CV when V is T or C V = A, GC or T when X is C When is T, A or G W = When Z is 8 or G, C or A When enemy = Z is C or T, C When Z = enemy is C, A, G, C or T When Z is A, A or G when QR=S is A%G%C or T TC J = A or GL = A, T, C or CM = A, C or T The above is a nucleotide sequence in which the novel amino acid sequence is more than one. This shows that it can be manufactured by

Accordingly, the present invention includes such equivalent nucleotide sequences.

All studies described herein were conducted in accordance with the physical and biological containment requirements specified in the Ml)I' guidelines.

Formula A TGAAGCGTCG TTTGCTCAGG GAT
TACGCGCGATGATTGGCGGTATCTT
AA CCGCATCCTGATTCTCTCTCTT
TTTCGGCG GGCTGGTGAT AACTG
TGCCCGCGTTTCATATCGTAATTT
CCATATGTCAT GAGAGTTTAT CG
TTCCCAAT ACGCTCGAACGAACGT
TCGG TT and others TTATTT Ming Ji! 17'; engraving (no change in content) formula Δ (continued) engraving of specification (no change in content)

[Brief explanation of drawings]

The figure depicts the endonuclease restriction map of plasmids 98G101-41 and pea+.

Claims (1)

[Scope of Claims] 1. A recombinant DNA transfer vector consisting of an equivalent nucleotide sequence in which all or part of the following nucleotide sequence, or a translated region thereof, contains bases that code for the same amino acid sequence. [There is a DNA sequence] 2. The DNA transfer vector according to claim 1, which is transferred and replicated in a prokaryotic microorganism. 3. The DNA transfer vector according to claim 2, wherein the prokaryotic cell is an Escherichia coli K-12-derived bacterium. 4. The amino acid sequence of the translated portion of the nucleotide sequence of the transfer vector according to claim 1. [There is an amino acid sequence] 5. The recombinant DNA transfer vector according to claim 1, which contains DNA having all or part of a non-coding region of DNA. 6. A recombinant DNA transfer vector comprising a DNA sequence coding for some or all of the amino acids of β-glucuronidase fused to a DNA sequence coding for a different part. 7. The recombinant DNA transfer vector according to claim 6, wherein the protein is a protein foreign to E. coli. 8. The recombinant DNA according to claim 6, wherein the protein is a hybrid protein containing DNA sequences derived from both β-glucuronidase and another protein.
A transfer vector. 9. The DNA transfer vector according to claim 6, which is transferred and replicated in a prokaryotic microorganism. 10, transferred and replicated into prokaryotic microorganisms, which in turn β
- The DNA transfer vector according to claim 6, which produces a protein containing part or all of the amino acid sequence of glucuronidase. 11, plasmid pBG101-41 containing the entire genome of pBR322 and having the restriction endonuclease pattern as shown in the figure. 12. The DNA has the restriction endonuclease pattern shown in the drawing and has an equivalent nucleotide sequence in which the following nucleotide sequence or translated region contains bases that code for the same amino acid sequence. , plasmid pBG1 containing the entire genome of pBR322. [There is a DNA sequence] 13. A microorganism transformed with the transfer vector according to claim 1. 14. A microorganism transformed with the transfer vector according to claim 11. 15. Escherichia coli MS371 (pBG1), which is the microorganism according to claim 13. 16. Escherichia coli MS371 (pBG101-41), which is a microorganism according to claim 14. 17, (a) pBG101-41 was cut with restriction endonucleases Sal I and BamH I to give 1237 pb
(b) The above 1237 bp fragment was converted to Sal I, BamH I
A method for producing the recombinant plasmid pBG1, which comprises ligating it into the pBR322 vector cut with. 18. A method for producing β-glucuronidase, which comprises culturing a prokaryotic microorganism harboring plasmid pBG101-41. 19. The method according to claim 18, wherein the prokaryotic microorganism is an Escherichia coli K-12-inducing bacterium. 20. The above E. coli is E. coli MS371 (pBG101-
41) The method according to claim 19. 21. A DNA with an equivalent nucleotide sequence in which the following nucleotide sequence or translated region contains bases that code for the same amino acid sequence. [There is a DNA sequence] 22. A DNA with an equivalent nucleotide sequence containing bases in which the following nucleotide sequences or translated regions code for the same amino acid sequence. [There is a DNA sequence] 23. A recombinant DNA transfer vector comprising the DNA sequence according to claim 22. 24. A method for producing a useful protein, which comprises culturing a prokaryotic microorganism harboring a recombinant DNA transfer vector containing all or part of the β-glucuronidase structural gene DNA or promoter DNA. 25. The method according to claim 24, wherein the β-glucuronidase structural gene DNA or promoter DNA is obtained from Escherichia coli K-12-derived bacteria. 26. The method according to claim 25, wherein the E. coli K-12-inducing bacterium is E. coli MS371. 27. The method according to claim 24, wherein the prokaryotic microorganism is an Escherichia coli K-12-inducing bacterium. 28. The method according to claim 27, wherein the E. coli K-12-inducing bacterium is E. coli MS371. 29. A protein produced according to the method according to claim 24, which contains part or all of the amino acid sequence of β-glucuronidase.