JPS62190083A - Polypeptide-expression vector, host transformed with said vector and production of polypeptide using said host - Google Patents

Abstract

PURPOSE:To produce a useful polypeptide such as growth hormone, etc., in high yield, by culturing a host transformed by a polypeptide-expression vector containing a plurality of specific structural genes and information units. CONSTITUTION:A polypeptide-expression vector pUGT150S having single information unit is produced by treating a plasmid vector pBR322, etc., originated from E.coli. A DNA base sequence is taken out of the vector and treated with a restriction enzyme and a ligase to link plural sequences and obtain a polypeptide-expression vector pUGT150S-2, etc., containing plural information units containing a promoter, a liposome-linking site, a structural gene containing a start codon, a stop codon and a DNA base sequence coding extraneous polypeptide and a transcription termination signal linked together in the order. The vector is introduced into a host such as E.coli and the obtained transformed cell is cultured in a medium containing a carbon source at 5-8 pH and 20-45 deg.C under aeration and agitation to accumulate the objective polypeptide in the cultured product.

Description

DETAILED DESCRIPTION OF THE INVENTION Field of the Invention The present invention relates to a polypeptide expression vector, a host transformed with the vector, and a method for producing a polypeptide using the host.

Conventional technology Various methods have already been proposed for producing various useful polypeptides such as interferon and growth hormone using bacteria such as Escherichia coli and Bacillus subtilis, yeast, and animal cells as hosts using genetic engineering techniques. There is.

However, each of the proposed methods leaves some unresolved problems. For example, λPL 5j
In a system in which useful products are expressed in the bacterial cell cytoplasm using E. coli as a host using a strong promoter such as CD,
C, WNIiams et al.

5science, 215.687-689 (198
2): Morio Ikehara et al., Proc, Natl, A
cad, sci., USA.

81.5956-5960 (1984)), but many of the products obtained by this system have an unnecessary methionine residue at their N-terminus, making it impossible to produce a polypeptide identical to the desired natural polypeptide. Furthermore, in the above-mentioned system, useful products form insoluble particles within the bacterial cells, which has the disadvantage that their recovery is extremely difficult.

In the above system, a method is also known in which a gene encoding a polypeptide of interest is combined with a gene encoding another polypeptide to express it as a fused polypeptide. In this method, the target polypeptide is separated from the resulting fusion polypeptide by treatment with an enzyme such as trypsin or chemical treatment using cyanogen bromide or the like. However, in this method, if an amino acid sequence that is a target of the enzyme or chemical agent used exists in the target polypeptide chain, the peptide chain will be cleaved at that location, and the target polypeptide cannot be produced. Also,
Even if it is possible to separate the target polypeptide from the fusion polypeptide by the above method, isolation of the target polypeptide usually requires a step of separating the fusion polypeptide from a crude bacterial cell extract and a step of separating the fusion polypeptide from the fusion polypeptide. Two times of N in the step of separating the target polypeptide from the reaction composition in which
A manufacturing operation is required, and the operation and process itself are complicated, and furthermore, a decrease in the yield of the target product is unavoidable.

Furthermore, a signal peptide is used as a system that can easily recover useful products having the same amino acid sequence as the natural type,
Systems for secreting and expressing useful products using Escherichia coli, Bacillus subtilis, etc. as hosts are also known, but generally the amount of useful products obtained by this method is not large. In systems using E. coli as a host, methods to increase the production rate of the product have been proposed, such as activating the promoter by increasing the culture temperature and increasing the copy number of the vector. However, it is becoming clear that the protein secretion mechanism of bacteria is similar to that seen in animals, and that it is based on the cooperative action of many proteins embedded in the cell membrane. In this case, there is a high possibility that the secretory function, which is a normal function of cells, is impaired, and there are almost no reports of cases in which useful products were produced in large quantities even by employing such methods.

In addition, in systems that host animals and plants other than E. coli and yeast, the growth rate of animal and plant cells is slow and the λPL of E. coli
For reasons such as the fact that a system comparable to the high expression system using the 5tac promoter has not yet been obtained, a system for expressing useful products in large quantities has not yet been established.

Problems to be Solved by the Invention The objects of the present invention are, in particular, to provide an improved polypeptide expression vector capable of increasing the expression level of a useful product, a host carrying the vector, and a method for producing a target polypeptide by culturing the host. Our goal is to provide manufacturing technology.

Means for Solving the Problems According to the present invention, promoters, ribosome binding sites,
DNAf encoding the start codon, stop codon, and foreign polypeptide! A polypeptide expression vector comprising a plurality of information units in which a base sequence, a tube sequence M4 synthetic gene, and a transcription termination signal are linked in this order, a host transformed with the vector, and a polypeptide for culturing the host. A method for producing a peptide is provided.

In this specification, the abbreviations used for amino acids, all bases, and others are IUPAC.

The IUB m constant or common symbols in the field shall be followed, examples of which are listed below.

Ser: Serine leu; Oisin Ara:
Arginine Cysnidistine Gln; Glutamine lle; Isoleucine pro; Proline
■al; Balint 1is: Histidine Met: Medionine Ala; Alanine Phe: Phenylalanine Gly; Glycine Asp: Aspartic acid ASn; Asparagine Trp; Tryptophan T y
r: tyrosine 7hr; threonine A: adenine T; thymine G; guanine C: cytosine The present inventors have developed a secretory expression system using the signal peptide to obtain the target polypeptide by actually introducing it into host cells. to the mature polypeptide, i.e. III
We succeeded in constructing a new polypeptide secretion expression vector that can be secreted as a target polypeptide in a form that is secreted extracellularly and does not have unnecessary amino acids, and in producing the target polypeptide by using this vector.Based on this knowledge, A patent application was filed (Japanese Patent Application No. 59-271206). One typical vector related to the above invention includes a promoter, a ribosome binding site, a base sequence encoding a β-lactamase signal peptide (including a start codon), and a base sequence encoding β-urogastrone (including a stop codon). and a transcription termination signal arranged in exactly this order.

In subsequent research, the present inventors succeeded in constructing a vector in which multiple information units possessed by the above vector were introduced into the same vector. The present invention has now been completed based on the discovery that a more prominent target polypeptide is expressed than when transformed with a vector containing the above-mentioned single information unit.

The vector of the present invention contains DNA jl! which encodes a promoter, a ribosome binding site, a start codon, a stop codon, and a foreign polypeptide. The essential constituent is that it contains a plurality of information units in which a structural gene containing a sequence (including in the form of a DNA base sequence encoding a fusion polypeptide with a signal peptide) and a transcription termination signal are linked in this order. shall be.

Although it is essential for the expression of a foreign polypeptide that each element including the promoter that constitutes the information unit is arranged in the above order, it is not necessary that all the elements are directly connected. For example, between the promoter and the bosome binding site, between the ribosome binding site and the DNA base sequence encoding the foreign polypeptide, between the DNA base sequence encoding the polypeptide and the transcription termination signal, etc. As with this type of polypeptide expression vector, any DNA base sequence may be inserted.

Furthermore, as long as the plurality of information units described above contain DNA base sequences encoding the same foreign polypeptide, they do not need to be completely identical, even down to the DNA base sequence that directs the expression of a promoter, etc. The DNA base sequences encoding the above-mentioned polypeptides may also differ within the range permitted by codon selection. Furthermore, the amino acid sequence and number of amino acid residues of the signal peptides may also differ.

Furthermore, the information units may be simply repeatedly linked within the same origin vector, or may be introduced separately at any number of positions within the vector.

In addition, the origin vector in which multiple information units should be introduced is
The vector does not have to be derived from prokaryotes such as Escherichia coli, and may be vectors from animals, plants, or eukaryotic cells such as yeast, and the host to which the vector of the present invention is introduced and transformed is not limited to prokaryotic cells. It can be an animal, a plant, or a eukaryotic cell such as yeast.

The technology for producing the vector of the present invention will be described in detail below.

The origin vector for the vector of the present invention includes various vectors conventionally used for cloning foreign genes, such as plasmids, bacteriophages, and viral DNAs.
, cosmids, etc. may be used. Specific examples of particularly suitable origin vectors include pBR322, a plasmid vector derived from E. coli, pG
Examples include Bacillus subtilis-E. coli shuttle vector pKKOl (8th Annual Meeting of the Molecular Biology Society of Japan, Lecture Abstracts East, p. 173, published November 15, 1985), such as H54 and pGH55, and derivatives thereof. Other specific examples include, for example, M13 as a bacteriophage-derived vector.
1E18 (MeSSin(II, J,,Meth
ods in Enzymology, 101, 20
-78 (1983)) as a viral DNA-derived vector 1) H8V-106 (Mc Knig
ht, S, L, and Grace, E, R,,
Nucleic Ac1ds Res,, 8゜59
31 (1980)) as a cosmid vector.
B8 (Ish-Horovicz, D, and
Burke, J. F., Nucleic A.
aids Res,,9゜2989 (1981)
) and their derivatives can be exemplified.

As the promoter, ribosome binding site, and transcription termination signal that constitute the information unit contained in the polypeptide expression vector of the present invention, those contained in the above-mentioned origin vector can be used as they are, but they are not limited to these. Instead, conventionally known regulatory factors derived from various microorganisms or viruses can also be used.

Examples of promoters include E. coli λPL, λ
PR, tac, trp, 1acLIV'5, Iac
.

Examples include promoters such as bla and the 5PO2 promoter of Bacillus subtilis.

Examples of the ribosome binding site include the SD sequence of Escherichia coli β-galactosidase and β-lactamase.

Examples of the transcription termination signal include the transcription termination signal of β-lactamase of Escherichia m, and the “shi1” of λ phage.

Each of the above-mentioned regulatory factors is extracted from the DNA containing them according to a conventional method, and then the DNA encoding the foreign polypeptide is appropriately extracted.
An information unit can be constructed by aligning the base sequence with the NAfA base sequence, and necessary components can also be appropriately introduced into the origin vector. Each of these operations may be performed in accordance with conventional methods.

The DNA Aj! that encodes a foreign polypeptide and is carried as a gene constituting an information unit in the polypeptide expression vector of the present invention. ! As the I sequence, any DNA base sequence that is derived from humans, animals, plants, or microorganisms and encodes various polypeptides having some physiological function can be used. Examples of the above polypeptides include epidermal growth factor, somatostatin, insulin, GIP
Hormones and growth factors such as IR-MSA, thymosin β4, growth hormone, growth hormone releasing factor, lymph-in immunomodulators such as interferon, interleukin 2, tumor necrosis factor, serum albumin, plasminogen activator Examples include blood constituent substances such as , apoliboprotein, and antigenic proteins for vaccines such as hepatitis B virus surface antigen.

DNA base sequences encoding various polypeptides such as these may be extracted and isolated from cells etc. from which they originate according to conventional methods, and cDNA can be produced using mRNA extracted from such cells etc. as a template. It's okay, again 2
The polypeptide may be chemically synthesized according to the amino acid sequence of the polypeptide, or may be produced by a combination of these methods.

The DNA base sequence encoding the above-mentioned polypeptide may also contain an intervening sequence (intron) in the case where a eukaryotic cell is used as a host vector.

In the vector of the present invention, the above genes constituting the information unit include a start codon (ATG) and a stop codon (TAA, T
DN/11 sequence encoding a foreign polypeptide having (AG or TGA) (including any intervening sequences)
However, more preferably, it encodes a fusion polypeptide in which a signal peptide is linked to the N-terminus of the foreign polypeptide in order to secrete and express the foreign polypeptide as a mature (natural) polypeptide. D.N.
A base sequence is preferable.

In the above, the signal peptide can be exemplified by a conventionally known signal peptide, for example, a signal peptide of β-lactamase of Escherichia coli having an amino acid sequence represented by the following formula (1).

Met -Ser -I Ie -G In -His
-phe -A rg -va+-Ala -L e
u -11e -P ro -P he -P he
-A la -A Ia -P he -CVs -L
eu -Pro -Val -Phe-Ala
(1) Examples of other signal peptides include the signal peptide of E. coli phosphate binding protein (P hos ) and the signal peptide of Bacillus subtilis α-amylase. Examples of plasmids containing these and other signal peptides include the following.

0 plasmid 1) TUB4 (signal peptide of α-amylase derived from Bacillus subtilis, H9Yama
zaki et al., J. Bacteri
ol, 156°327-337 (1983)), 0 plasmid p HO2 (signal peptide of maltose binding protein derived from Escherichia coli, H, BedOuelleet
al., Nature, 285.78-81 (
1980)), 0 plasmid p5N518 (signal peptide of phosphate binding protein from Escherichia coli, K, MaQOta et al.
at,,J,Bacteriol,,157.909
-917 (1984)), 0 plasmid pJP12 (signal peptide of E. coli-derived outer leg protein induced under phosphate suppression, N, Qve
rbeeke et al., J. Mo1. B
iol,.

163.513-532 (1983)) etc.

The DNA base sequence encoding the signal peptide is:
Arbitrarily within the permissible limits of codon choice.

You can choose. Furthermore, the DNA base sequence encoding the signal peptide or the base sequence containing the same can be obtained by various conventionally known methods, such as a microorganism containing the same, a plasmid isolated from the same, and preferably, for example, pBR.
DNA 1 encoding the signal peptide can be easily produced by a method of cutting and isolating the signal peptide from 322 etc. using a restriction VT sequence, a method of chemical synthesis according to the DNA base sequence, a combination of these methods, etc. The linkage or bonding between the base sequence and the DNA base sequence encoding the foreign polypeptide can also be carried out according to various conventionally known methods, such as an enzymatic reaction using T4 DNA ligase or the like.

Construction of an information unit by combining the DNA salt W sequence encoding the signal peptide or the DNAm base sequence encoding a fusion polypeptide of this and a foreign polypeptide with each of the regulatory factors and/or each WA node factor. The operation for introducing the above-mentioned DNA base sequence into the original vector can be carried out according to conventionally well-known conventional methods and known operations used when incorporating this type of foreign gene into a vector.

Specific examples of particularly preferred vectors carrying the signal peptide described above that can be used in the present invention include pGH54 constructed using pBR322 as the origin vector and 1) GH
55 can be exemplified. Within these plasmids pGH
No. 54 has a DNA base sequence encoding a β-lactamase signal peptide following the β-lactamase promoter and ribosome binding site, and has NruI and pvu restriction enzyme recognition sequences at the 3′ end of this base sequence. It is something. Its characteristics are as shown in FIG. 1 along with its manufacturing process.

Figure 1. pGH54 is characterized by the illustrated restriction enzyme cleavage map, and its size is determined by 1.0% agarose gel electrophoresis.

The result is approximately 3.9kb. Escherichia coli strain 88101 carrying this plasmid pGH54 was sent to the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry as "1" B101 (pGH54
) with the designation J, FERM No. 679 (FERM
BP-679).

Furthermore, pGH55 shares the same features as pGH54 in that it has a DNA base sequence encoding the signal peptide of β-lactamase following the promoter and ribosome binding site of β-lactamases; It lacks 637 bases of DNA containing the second PvuIII restriction site, and has the first PvuI restriction site near the 3' end of the DNA base sequence encoding the signal peptide. Its characteristics are as shown in FIG. 2 along with its manufacturing procedure.

From FIG. 2, pGH55 is characterized by the illustrated restriction enzyme cleavage map, and its size is about 3.3 kb, as measured according to the above method.

E. coli H8 harboring this plasmid EIGH55
Strain 101 has been deposited with the National Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry, under the designation rH8101 (p Gf (55) J) and as FERM Article No. 680 (FERM BP-680).

The operation of introducing a DNA base sequence encoding a foreign polypeptide into a plasmid vector carrying regulatory factors such as promoters such as pGH54 and pGH55 and a DNA 1 base sequence of a signal peptide is performed using restriction enzymes according to a conventional method. This can be carried out using an enzymatic reaction or an enzymatic reaction using Ta DNA ligase. Alternatively, after chemically synthesizing the DNA base sequence of a fusion polypeptide of the above polypeptide and a signal peptide in advance, this DNA base sequence can be introduced into an origin vector containing an appropriate regulatory element.

In this way, a polypeptide expression vector carrying a single information unit can be obtained.

Preferred examples of the polypeptide expression vector having the above-mentioned single information unit include 1) UG201, pUGT
l 50 and p UGTl 508 are examples.

pUG201 is approximately 3.7 kb in size and includes the β-lactamase signal peptide D containing the β-lactamase promoter, ribosome binding site, and start codon.
It has a DNA base sequence in which the NA base sequence, the DNA base sequence of β-urogastrone (a foreign polypeptide), its stop codon, and the transcription termination signal are arranged in exactly this order. The sequence is as shown in Table 4 in Reference Examples below. The E. coli strain 88101 carrying the plasmid pUG201 is rl-IBlol (p U
G201) J is indicated, and the number 681 (FE
RM BP-681).

pUGT150 is approximately 3.9 kb in size and p U
The β-lactamase promoter and ribosome binding site were removed from the sequence of G201, and the vector pDR was used instead.
540 (D, R, Ru5sell and G.

N. Bennett, Gene, 20.231
-243 (1982)) is a vector into which the Iac operator and ribosome binding site attached thereto are inserted. Details of the vector construction are as described in Reference Examples below, and a schematic diagram thereof is shown in FIG. The E. coli JM103 strain harboring pUG150 is rJMl 03 (pUGTl 5
0) Indicated by J, FERM
BP-974).

p UGTI 50S is approximately 3.9 kb in size,
3' of the DNA base sequence encoding β-urogastrone
Except for some differences in the base sequence near the end, pUGTl
It has the same structure as 50. The p UGTl 5
The DNA base sequence encoding β-urogastrone in 08 and a construction example of the pUGTl 50S are shown in Reference Examples below. A schematic diagram of the construction is shown in FIG.

The above pUG201, pUGTl 50 and pUGT
In 150S, these are generated by each vector! Transcription of RNA is initiated upstream of the start codon encoding methionine (Met), which corresponds to the N-terminal amino acid of the signal peptide of β-lactamase, and continues downstream through the signal peptide portion, β-urogastrone portion, and further downstream. The transcription is terminated by the transcription termination signal of the β-lactamase gene in pBR322, which is the origin vector of the secondary vector. The location is thought to be around 0.6 kb downstream of the stop codon at the end of the DNA base sequence encoding β-urogastrone. Since va RNA is thought to function only after transcription is terminated, having a transcription termination signal downstream of the gene is essential for the expression of the gene, and the above p
UG201 and the like use a signal for terminating ra RNA transcription related to β-lactamase expression as the transcription termination signal, but this is not possible using other known DNA salt 1 sequences with similar functions, such as those of λ phage. It can be substituted with ``Ll or E. coli trl)A transcription termination signal.

The polypeptide expression vector of the present invention comprises the above pUG2
01, pUGTl 50, pUGTl 50S, etc., the promoter, ribosome binding site, start codon, and a 132-base sequence of DNA that encodes a foreign polypeptide (a DNA base that encodes a fusion polypeptide in which a signal peptide and a foreign polypeptide are linked) Starting from a vector having a single information unit by linking a stop codon and a transcription termination signal in this order, extract the information unit or the DNA base sequence containing it from these, and insert these into an appropriate vector. Manufactured by inserting multiple pieces.

The plurality of information units do not need to be identical to each other, and other genetic information may be different as long as they contain DNA base sequences encoding the same foreign polypeptide. Multiple information units such as these can be connected in advance so that they are serially arranged in the same direction, and then inserted into one vector in this form. An information unit or a plurality of information units connected in advance may be inserted separately, and the directionality of each information unit to be inserted may also be made different. Retrieval of a desired DNA base sequence site and insertion thereof can be carried out in the same manner as this type of operation described above.

Typical specific examples of the vectors of the present invention include, for example, pUG
Tl 508-2, p UGTl 508-3 and p
An example is UGTl 508-4.

p UGTl 50S-2 has a size of approximately 5. DN that is Okb and includes the information unit of p UGTl 50S
This is an arrangement in which two DNAF base sequences are connected in the same direction. An example of the construction of pUGT150S-2 is as shown in Examples below, and a schematic diagram thereof is shown in FIG. 7.

p LIGTI 508-3 and p UGTl 50S
-4 was constructed in the same manner as the above p UGTl 508-2, and has a DNA base sequence in which three and four DNA base sequences containing the information unit of EI UGTl 50S are connected in series in the same direction. They are about 6.1 kb and about 7.2 kb in size, respectively. Construction examples and their outlines are as shown in the examples described later and in FIGS. 8 and 9.

In addition, E. coli JM103 strain carrying each of the above vectors is
They have been deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry, under the names and deposit numbers shown in the examples.

The polypeptide germination vector of the present invention can be introduced into host cells according to various known methods, and the host cells to be used are not particularly limited, and various known types may be used. Examples of host cells that can be used include Durham-negative bacteria such as Escherichia coli, Gram-positive bacteria such as Bacillus subtilis, actinomycetes, yeast, animal and plant cells, and the like.

Among these, H8101 strain derived from 12 E. coli strains (
@, W, 3oyer and D, Roullan
d-Dussoix, J. Mo1. Bio
l,, Earthworks, 459-472 (1969)) and J.M.
103 strains (J, Messino et al.,
Nucleic Ac1ds Res,,9゜30
9 (1981)) is preferred.

Each of the above-mentioned host cells has a signal peptidase as a mechanism for secreting polypeptides necessary for maintaining normal cell functions, such as extracellular secretion components and exoR components, and has secondary signal peptidases. It is known that there is almost no difference in the substrate specificity of peptidases (D, p
Erllan and H.

0, Halvorson, J., Mol, B.
iol,, 167.

391 (1983)).

A specific example of the method for introducing the vector of the present invention into the above-mentioned host cells includes, for example, a method in which host cells are treated in an aqueous solution containing calcium chloride at low temperature, and the vector is added to the solution (E, Lederberg and Cohe et al.
n, J. Bacteriol, 119, 10
72 (1974)).

As described above, transformed cells can be obtained by introducing the vector of the present invention, and the present invention also provides such transformed host cells.

Cells transformed with the above-mentioned vectors of the present invention can be cultured using an appropriate medium used for culturing normal cells. As the medium, various types of media can be preferably used, such as e.g., elongated medium, E medium, M9 medium, and M63 medium. In addition, various commonly known carbon sources, nitrogen sources, non-salts, vitamins, natural product extracts, physiologically active substances, etc. can be added to these media, and such media are also preferably used. can. Cultivation can be carried out by various methods employing conditions such as pH, temperature, aeration, and stirring that are suitable for the growth of the host cells. For example, in the case of Escherichia coli, a pH range of approximately 5 to 8, particularly pH 7, is appropriate, and it is desirable to culture at a temperature of approximately 20 to 43°C under aeration and agitation conditions, and there are no particular limitations on the culture scale. do not have. Furthermore, the above medium composition, culture conditions, etc. can be changed as appropriate in order to increase the expression level or secretion level of the target polypeptide, or to promote or suppress the discharge of the target polypeptide outside the bacterial cells. .

Through the above culture, for example, in cells transformed with the vector of the present invention containing a DNA base sequence encoding a fusion polypeptide of a signal peptide and a foreign polypeptide, the fusion polypeptide is produced completely in the cytoplasm, and then the fusion polypeptide is produced outside the cell. Alternatively, the target polypeptide is secreted and accumulated in the periplasm in the form of a mature polypeptide. That is, first, from the gene encoding the fusion polypeptide in the vector, m
RNA is produced. Next, a fusion polypeptide is produced from the mRNA under the action of translation regulatory factors and various factors in the host cell. Furthermore, the fusion polypeptide produced here is secreted extracellularly or into the periplasm by the action of the signal peptide, and at the same time, the signal peptide is separated from the fusion polypeptide by the action of the signal peptidase. As a result, the mature polypeptide, which does not contain the signal peptide or any other unnecessary amino acid sequences, is secreted and accumulated extracellularly or in the periplasm. Furthermore, in cells transformed with the vector of the present invention that does not have a DNA base sequence encoding a signal peptide, the polypeptide of interest is normally produced and accumulated within the cell.

The polypeptide of interest thus accumulated can be separated and purified by conventional methods. This separation and purification operation can be carried out using, for example, culture supernatant, periplasmic fraction prepared by osmotic shock method, and ultrasonic disruption. ! The prepared intracellular fractions are subjected to gel filtration, adsorption chromatography, ion exchange chromatography,
This can be carried out by an appropriate combination of methods such as high performance liquid chromatography. In particular, mature polypeptides that are secreted or excreted into the culture supernatant have the advantage of being relatively easy to separate and purify.

Hereinafter, reference examples and examples will be given to explain the present invention in more detail.In addition, each method and operation used on each side is assumed to have been carried out as follows unless otherwise specified. .

16 limit 1? DNA cutting operation using a DNA aqueous solution (or buffer solution) or powder is mixed with a concentrated solution of each buffer shown in Table 1 below and water, then a restriction enzyme is added, and the mixture is incubated in a water bath at 37°C. Let stand for 3 hours to react. The standard amount of restriction enzyme used is 1 unit per 1 μΩ of DNA, and the final solution should be at least 10 μQ.

Table 1 Composition Low salt concentration Medium salt level High salt concentration (eM)
! l buffer solution all buffer solution buffer solution sodium chloride 0 50 100 Tris-HCl (pH 7,5) 10 10 50 magnesium chloride 10 10 10 dithiothreitol 1 1 12. Phenol extraction method After the enzymatic reaction is complete, inactivate the enzyme and stop the reaction. This extraction method was used to That is, TE-saturated phenol (1 m M EDT
After adding 10IIM Tris-HCl (1)H8,O) buffer containing A) and mixing thoroughly, half the amount of chloroform was added and further mixed, and then centrifuged to remove the DNA. Remove the buffer layer. Furthermore, add 0.1 times 8 3M sodium acetate M buffer (pH 5.0
) and twice the amount of cold ethanol and mix to -20
The phenol is completely removed by allowing the mixture to stand for at least 1 hour at °C and collecting the DNA as a precipitate.

3. Joining (circularization) of DNA fragments using TA DNA ligase 66mM Tris Ii! ! (1) 87.5>, 6.61
In an aqueous solution containing 1M magnesium chloride, 10mM dithiothreitol, and 1++1M ATP with 0.01% bovine serum albumin added, DNA fragments were combined with 3 units of T and DNA ligase (Takara Shuzo) per 1μQ.
D by reacting with (manufactured by
Bind (cyclize) NA.

4. How to use DNA modifying enzymes (1) DNA modification using Klenow fragment of DNA polymerase
Plant Ended A 40mM Potassium Phosphate (+) H7,4), 6IIIM
Magnesium chloride, 1mM β-mercap 1-ethanol, 1mM ATP and 1mM each (7)d ATP
Dissolve the DNA in an aqueous solution containing dCTP, dGTP, and dTTP, add DNA polymerase (Klenow fragment, manufactured by Takara Shuzo) in an amount of 1 unit per 1 μg of DNA, and react at 12°C for 30 minutes. , perform phenol extraction if necessary.

(2) Plant-ended DNA with S1 nuclease For each 5' end of DNA, 6+nM sodium acetate, 40m
A buffer solution of the above DNA was prepared using 100 μQ of M buffer solution (pH 4,5) containing M sodium chloride and 1 mM 1aF [Q zinc. To this was added 2000 units of 81 nuclease (manufactured by BRL) and heated at 20°C. After the reaction is complete, phenol extraction is performed to completely inactivate the enzyme.

(3) T, DNA 5' by polynucleotide kinase
End-phosphorylated 1-10μQ DNA was mixed with 10mM magnesium chloride,
501 containing 51M dithiothreitol, 1n MATP
M is dissolved in 50IiQ of Tris-HCl M buffer (pH 9,5), 5 units of Tt polynucleotide kinase are added thereto, reacted at 37°C for 30 minutes, and then the enzyme is inactivated by phenol extraction.

5. Transformation method As the host cell, strain 88101 or strain JM103 derived from 12 strains of Owaki bacteria is used.

The host cell line was grown in LB medium (1% Bactodributone, 0.
5% bacto yeast extract, 0.5% sodium chloride)
The cells were grown at 37° C. until the absorbance at 610 rv reached 0.25. Centrifuge 40% of this culture solution (6000
Collect the bacterial cells (rotation/minute x 10 minutes), and then cool on ice. This was washed with 0.1M magnesium chloride 201110, followed by ice-cold O, 1M calcium chloride and 0.0
Suspended in 5M magnesium chloride solution 20I112,
Chill on ice for an hour. Centrifugation (6000 rpm x 10 minutes)
After that, the bacterial cells were ice-cooled with 0, 1M calcium chloride and 0.0
Resuspend in 5M magnesium chloride solution 2-. To 0.2 mm of this suspension, a reaction composition solution o and oi- of DNA fragments ligated using T and DNA ligase is added, and the mixture is cooled on ice for 1 hour. It was then heated in a water bath at 42.5°C for 90 seconds, and L
Add 2.8 Tsuru pieces of B medium and leave it standing in a 37°C water bath for 1 hour.

Next, the resulting transformed strain is selected for the following antibiotic resistance. That is, 50 μQ/mfl of ampicillin or 20 μg/mfl of tetracycline was added to LB medium containing 1.5% agar.
- Spread 0.3 ml of each of the reaction composition solutions obtained above on a plate medium prepared by adding -, culture this overnight at 37°C, and isolate growing E. coli colonies.

6. A strain carrying a single-acting plasmid was treated with ampicillin 50 μQ/
- or i- Culture with shaking at 37°C in LB medium 500+112 supplemented with 20μ (1/IIQ) of tracycline until the absorbance at 610 nm becomes about 0.6.

Then, 8CNng of chloramphenicol was added and heated at 37°C.
Culture with shaking for 12 to 16 hours. This is the centrifugal valve Ill.
(6000 rotations/min x 10 minutes) to collect bacterial cells, and
Wash with 5% aqueous sodium chloride solution. 2. Transfer the bacterial cells to 50mM Tris-HCl (pH 8.0) buffer containing 20% sucrose.
5 Peng, then 0.25M containing 1% lysozyme
Add 0.5- of Tris-HCl (pH 8゜0) buffer and incubate for 10 minutes.
Cool on ice for a minute. Furthermore, 0.25M EDTA (pH
8.0) Add 1 Peng and cool on ice for 10 minutes. Then 6mM Tris salt Fli (pH 8,0), 60mM ED
Solution of TA and 0.1% Triton X-100 41112
Add.

This is ultracentrifuged (25,000 rpm x 90 minutes) and the supernatant is collected. Add 9.0 cesium chloride to 8.2 mQ of this supernatant.
g and dissolve, then add 0.8 ml of 1% ethidium bromide solution. This centrifugal valve 11t (20
00 revolutions/minute x 10 minutes) to remove suspended matter, and the solution is ultracentrifuged (50,000 revolutions/minute x 15 hours). Then, the plasmid portion that emits fluorescence is separated by ultraviolet irradiation.

Ethidium bromide is removed from this by extraction 5-6 times with isopropanol saturated with 5M sodium chloride solution. 1011 including 11M EDTA at the end
Cesium chloride is removed by dialysis against 1M Tris-HCl (pH 8,0) buffer.

7. Synthesis of oligonucleotides Synthesis was carried out using the in-phase synthesis method (solid-phase phosphate triester method) shown below (H, Ito et al.

N ecleic acids Research
h, 20, 1755-1769 (1982)).

That is, first, 1% crosslinked polystyrene resin 5-xi (200
~400 mesh, manufactured by Nokuiora Laboratories, Inc.)
A nucleoside-supporting resin is obtained by reacting the aminomethylated product with a monosuccinic acid ester of 5'-0-dimethoxytrityl nucleoside. Next, the following operations are performed using a DNA synthesizer manufactured by Birchiem.

40IIg of the above resin was placed in a reaction tube, and the dimethoxytrityl group at the 5' position was converted to IIRIm using a 1M solution of zinc bromide in dichloromethane/isopropanol (85:15). Next, a fully protected dinucleotide (C, Bro
ka et al, Nucleic Ac1d
sResearch, 8.5461-5471 (19
1 g of the triethylammonium salt 50II prepared by the method of 80) is added, and condensation is carried out using a condensing agent (mesitylenesulfonyl-5-nitrotriazole). The above operations are repeated to sequentially increase the chain length to obtain a resin carrying the protected oligonucleotide. In addition, in the final synthesis step, in place of the dinucleotide, if necessary,
The mononucleotide triethylammonium salt 251!11 prepared by the method described in the above-mentioned document is used.

The protected oligonucleotide is then cleaved from the resin using a 1:1 pyridine-water solution of 0.5 M pyridine doximate. Sephadex G-5
0 column (Pharmacia, 2X100c■), and high performance liquid chromatography (pump; Waters 6000A type, detector: 440 type detector, column: Micro Bonder Pack C18, elution solvent; (5
→ Purify with acetonitrile-0.1M triethylammonium acetate aqueous solution) (40%). Next, a deprotection reaction is performed using 80% m-acid, and the product is purified again by high performance liquid chromatography until a single peak is obtained. The conditions for this high performance liquid chromatography were as follows: (5→25
%) Acetonitrile The same as above except that a 0.1 M aqueous triethylammonium acetate solution is used.

8. Analysis of DNA base sequence Analysis of DNA base sequence is performed using Messinc+
) method CM13 method, Methods Enzymo
101°20 (1983)) as follows. That is, first, DNA fragments are cut out using restriction dyes and separated by 1% agarose gel electrophoresis. This DNA fragment is cloned using M13111)8RF (manufactured by Amarjam) as a vector.

The obtained recombinant phage DNA was
el) and the method of Hioa (J, Mol.

Biol, 53.154 (1970)) into E. coli strain JM107. This bacterial suspension 0.
2Peng, 25io/snake isopropyl-β-D-thiogalactoside (r I PTGJ) 25μQ and 20111MlIQ 5-bromo-4-rero-3-
40 μQ of indolyl-β-D-galactoside was added.

Next, this bacterial cell suspension was heated and dissolved in advance, and then dissolved for 50 min.
- Top agar solution (1% batat tryptone, 0.8% sodium chloride and 0.5% agar >3+1
2XYT added with LQ and solidified with 1.5% agar
It is layered on a plate of medium (1.Q% Batatotributone, 1% yeast extract and 0.5% sodium chloride) and cultured overnight at 37°C. The recombinant phage with the inserted DNA fragment produces colorless plaques, whereas the parent strain M13mp8
produces blue plaques, so the desired recombinant phage can be easily selected.

Next, a single colorless plaque was taken out using a Bathtool Vivera, and 0.01-mL of the culture solution of JMl 03 strain was added to 1 volume of 2XYT medium, and cultured under shaking at 37°C for about 5 hours. Propagate recombinant phages. After culturing and culturing, remove the bacterial cells by centrifugation and add 20% polyethylene glycol 60 to the supernatant.
After mixing 0.2- of 00 and leaving it at room temperature for 15 minutes or more, the precipitated phage was collected by centrifugation, single-stranded DNA was extracted from the phage by phenol extraction, and this was converted into template-heavy-stranded DNA. used as

Template - heavy chain DNA and brimer (manufactured by Takara Shuzo, M13)
15 base primer (5'AGTCACGACGT
TGTA 3')> and 0.5 pmol of each were mixed, heat treated at 60° C. for 20 minutes, and then slowly cooled. Next, α32P-d CTP (manufactured by AmaJam Co., Ltd., 4
00Ci/mol) and 2 units of DNA polymerase (Klenow, manufactured by Takara Shuzo) were added and mixed thoroughly, and then 3.2μQ each was added to the four types of dNTP shown in Table 2 below. -add to reaction tubes containing 2 μQ each of the ddNTP mixture. After reacting for 20 minutes at room temperature, the chase reaction solution (d ATP, d C
1μQ each of TP, dGTP and dTT'P (11M)
were added to each and allowed to react for an additional 20 minutes. Formamide stop solution (95% V/V formamide, 0.1% xylene cyatool and 0.1% bromophenol blue)
Add 6μQ of the mixture, heat at 95°C for 3 minutes, and then rapidly cool. Next, 2μQ of each sample was electrophoresed on a 6% or 8% polyacrylamide gel (1800V, 30mA
, 2-3 [between 18].

After electrophoresis, the gel was transferred to a filter paper (Whatman 3MM), dried in a gel dryer, an autoradiogram was taken, and the DNA
Decoding the base sequence.

Table 2 (unit: μQ) However, in Table 2, ddA is dideoxyadenosine, dd
C represents dideoxycytidine, ddG represents dideoxyguanosine, and ddT represents dideoxythymidine.

9. Agarose gel electrophoresis Schleif and Wensink
sink> guide! (“Practical Met
hodsin Molecular B 1olo
oy” (1981).

S prin (ler-Verlag, pp11
4-125), agarose gel electrophoresis and separation of DNA fragments from the gel after electrophoresis are performed.

As a power source for electrophoresis, Atto's Constar Power 5J
1065 model, a 12 x 15 cm plastic water tank (platinum electrode material) as the electrophoresis tank, Agarose A (manufactured by Isotope Kagaku Kenkyusho) as the agarose, and MWE for electrophoresis.
As the liquid, 40IIM Tris-HCl (containing 5mM sodium acetate and 1mM EDTA, pH 7.9) is used.

10. Polyacrylamide gel electrophoresis Polyacrylamide gel electrophoresis and separation of DNA fragments from the gel after electrophoresis are performed according to the method described on pages 78-87 and 114-125 of the above-mentioned manual. As a timing for electrophoresis, Constar Power 5J1065 model manufactured by ATTO Corporation is used, and as a migration tank, SJ 1060SD model manufactured by ATTO Corporation is used.

Acrylamide and N as an acrylamide solution.

An aqueous solution of N'-methylenebisacrylamide (29:1) was used as a polymerization accelerator.

N'-tetramethylene ethylene diamine and ammonium pertanate were used as the polymerization catalyst, respectively.

Also, as a buffer for electrophoresis, 2.5. A 90 mM Tris-Borate M solution (pH 8.3) containing mM EDTA is used.

Reference Example 1 ■) Construction of β-urogastrone expression vectors pGH54 and pGH55 (A) Construction of intermediate plasmid pGl-153 ■
For the synthesis of oligonucleotides having a DNA base sequence encoding part of the signal peptide of E. coli β-lactamase, each of the four types of oligonucleotides having the following base sequences was added to the solid-phase phosphotriester described above. It was synthesized by the method.

<1>(5')CGCCGGCCTTTTGCC
TTCCTGTC(3')<2> TTCGCGAACTCAGCGC
A <3> GCTGAGTTTCGCGA
AACAG <4> GAAGGCAAAA
GGCCGCGAT The 5' ends of the above oligonucleotides <2> and <4> were each phosphorylated using T4 polynucleotide kinase (manufactured by BRL).

■ As a cloning vector, plasmid +) B
R322 (3o1ivar et al, Gen
e, 2°95-113 (1977)).

10μQ of the plasmid pBR322 was digested with the restriction enzyme P
The DNA fragment was cleaved using StI (manufactured by Takara Shuzo@) and PvuI (manufactured by NEB) in a high salt concentration buffer, and subjected to 1.0% agarose gel electrophoresis to separate a DNA fragment of approximately 4.24 kb.

■ The DNA fragment obtained in the above (■) was mixed with the phosphorylated oligonucleotides <2> and <4> prepared in the above (■) and the unphosphorylated oligonucleotides (1) and (3).
1 μg of each of the following were combined and subjected to a ligation reaction using Tm DNA ligase.

After the reaction was completed, the H8101 strain derived from E. coli strain 112 was transformed with this reaction composition solution. One strain was selected from the obtained transformants exhibiting tetracycline resistance, and a plasmid was isolated from it to obtain the target pGH53.

An outline of the series of operations is shown in FIG.

The obtained pGH53 had a size of 4.3 kb as a result of 1.0% agarose gel electrophoresis, and its DNA
/l! As a result of analyzing 11 sequences with M131, pB
R322 was deleted between both the PStI and pvuI restriction sites and was replaced with the oligonucleotide
It was confirmed that 〉, 〈2〉, 〈3〉, and 〈4〉 were inserted.

The H8101 strain carrying pGH53 was sent to the Research Institute of Microbiology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry.
GH53) J with the designation No. 678 (FE)
RM BP-678).

(B) Vector pGH for β-urogastrone activation
Construction of 54■ 10 μQ of pGH53 obtained in the above (A>) was cleaved using restriction enzymes NaeI (manufactured by NEB) and AvaI (manufactured by Takara Shuzo ■) in a medium-temperature concentration buffer, and then electrolyzed on a 1.0% agarose gel. After electrophoresis, FJ2.22kb D
NA fragment <A> was isolated.

This fragment contains most of the DNA sequence derived from the synthetic oligonucleotide and the replication initiation region of the plasmid.

■ pBR322 restricted WI elements AVaI and Hindl
(both produced by Takara Shuzo Co., Ltd. (1111)) using a medium-temperature concentration buffer and electrophoresis on a 1.0% agarose gel to obtain a DNA fragment of about 1.40 kb <B).

This fragment contains part of the promoter of the tetracycline resistance gene and all of its structural genes.

■ 2011Q of pBR322 with restriction enzyme Fnu4H1
(manufactured by NEB) using a low salt concentration buffer, and then the protruding bases at the ends of the DNA fragments were decomposed and removed using S1 nuclease. Next, the obtained DNA was treated with restriction enzyme 1-
It was cleaved using 1indI[I in a raw salt concentration II box solution and subjected to 6% polyacrylamide gel electrophoresis.
, a 28 kb DNA fragment <C> was obtained.

This fragment contains a portion of the gene encoding the beta-lactamase promoter, ribosome binding site, and signal peptide, as well as a portion of the promoter of the tetracycline resistance gene.

(2) The three fragments <A>, <B> and <C) obtained above were ligated using Tm DNA ligase. After the reaction,
H8101 strain was transformed with this reaction composition solution. One strain was selected from among the obtained transformants exhibiting tetracycline resistance, and a plasmid was isolated. Thus pGH54 was obtained.

As a result of base sequence analysis using the M13 method, pGH54
It has a DNA base sequence encoding a signal peptide following the β-lactamase promoter and ribosome binding site, and Nru
It was confirmed that each of the restriction enzyme recognition sequences of PvuII was present on the downstream side and on the downstream side.

An outline of the series of operations is as shown in FIG.

As mentioned above, pGH54 is characterized by its size of approximately 3.9 kb and the restriction enzyme cleavage map shown in Figure 2, and as a result of base sequence analysis using the M13 method, it is encoded by the base sequence shown in formula (2) below. It was confirmed that the gene contains the β-lactamase signal conjugate gene.

ATGAGTATTCAACATTTCCGTGTCG
CCCTTATTCCCCTTTTTTGCGGCCTT
TTGCCTTCCTGTCTTCGCGAACTCA
GCTG (2) (C) Construction of β-urogastrone expression vector pGH55■ pBRH, a plasmid in which the base sequence between the Ava■ and PvuII restriction sites of pBR322 has been deleted
O2 was created by the following operation. That is, 5 of pBR322
The restriction enzymes Ava■ and P
After cleavage with vulI (both manufactured by Takara Shuzo ■) and extraction with phenol, the cut fragment was converted to plant ends with DNA polymerase Klenow fragment (manufactured by Takara Shuzo ■). then 1.0
A DNA fragment of approximately 3.72 kb was separated by % agarose gel electrophoresis, and this fragment was circularized with Ti DNA ligase. After completion of the reaction, strain 88101 was transformed with this reaction composition, and one strain was selected from among the resulting transformants exhibiting ampicillin resistance and tetracycline resistance, and a plasmid was isolated to obtain pBRH02. The obtained p
BRHO2, unlike pBR322, was not cleaved by Ava or pvu.

■ 5 μQ of p BRH02 obtained in ■ above was added to the restriction enzyme p
The DNA fragment (D) of about 2.60 kb was separated by cutting in a medium-temperature M solution using St and Baa + HI (both manufactured by Takara Shuzo), and then performing 1.0% agarose gel electrophoresis. .

This fragment contains part of the tetracycline resistance gene and the plasmid replication initiation region.

■ 10μQ of pGH54 was treated with restriction enzymes PStI and Ba.
Cleavage in raw salt buffer using 1HI followed by 1
．． Approximately 0.66k by 0% agarose gel electrophoresis
A DNA fragment (E) of b was obtained.

This fragment contains DNA encoding the β-lactamase promoter, ribosome binding site, and signal peptide.
Contains the sequence and part of the tetracycline resistance gene.

■ Put the two fragments <D> and <E> obtained above into T, D
The ligation was performed using NA ligase. After the reaction, strain 88101 was transformed with this reaction composition.

Select one strain from the obtained transformed strains showing tetracycline resistance and make a plasmid! J′! I let go. Thus p
GH55 was obtained.

An outline of the series of operations is as shown in FIG.

EIGH55 was characterized by the restriction Wg elementary cleavage map shown in FIG. 3 above, and as a result of 1.0% agarose gel electrophoresis, it had a size of about 3.3 kb. Furthermore, as a result of base sequence analysis using the M13 method, pGH55
pGH54 except that it lacks approximately 0.64 kb of DNA containing the second PvuII restriction site in pGH54.
It was confirmed that the first PvuI restriction site was located near the 3' end of the DNA base sequence encoding the signal peptide.

■) Construction of a vector having a DNA base sequence encoding a signal peptide-β-urogastrone fusion polypeptide (A) Synthesis of a DNA base sequence encoding β-urogastrone This base sequence was reported by Gregory H. First, β
- The DNA base sequence encoding urogastrone was constructed by adding a start codon, a stop codon, and a restriction enzyme recognition site before and after the DNA base sequence as shown in Table 3 below. This DNA base sequence has already been patented by the present inventors as Japanese Patent Application No. 137691/1983.

3rd Table 5' AAT TCG AAG ATCTGCATG
AAT AGC3' GCTTCTAG ACG
TACTTA TCGGAT TCT GAG TGC
CCA CTG TCT CACCTA AGA CT
CACG GGT GACAGA GTGGAT GG
CTAT TGT CTG CACGACGGTCTA
CCG ATA ACA GACGTG CTG C
CAGTT TGCATG TACATCGAA GC
T TTGCAA ACG 1'ACATG TAG
CTT CGA AACGAT AAA TACGCG
TGT AACTGT GTAσrA TTT AT
G CGCΔCA TTG ACA CATGTG G
GT TAT ATCGGT GAA CGCTGTC
ACCCA ATA TAG CCA CTT GCG
ACACAA TACCGT GAT CTG AA
A TGG TGGGTT ATG GCA CTA
GACTTT ACCACCGAA TTG CGT
TAA TAG TGA AGA TCTCTT AA
CGCA ATT ATCACT TCT AGAG
3' CCT AG 5' (B) Construction of a plasmid carrying a DNA base sequence encoding β-urogastrone I) First, 10 μg of BR322 was mixed with EcoRI (manufactured by Takara Shuzo) and BamHI in a high salt concentration buffer. After cutting and then 1.0% agarose gel electrophoresis, a DNA fragment of approximately 3.99 kb was isolated.

■ The DNA fragment obtained in (■) above and the β- obtained in (A) above.
The DNA base sequence encoding urogastrone and TA
They were joined using DNA ligase. After the reaction, strain H8101 was transformed with the reaction composition, and one strain was selected from among the resulting transformants exhibiting ampicillin resistance, and a plasmid was isolated. Thus, the DNA encoding β-urogastrone
jm! EcoRI and Ba1ll whose sequence is pBR322
Plasmid pUO3 inserted between the HI restriction sites was obtained.

The 88101 strain carrying this plasmid pUO3 is
It has been deposited as FERM BP-543 under the designation rHBlol (p UO3)J.

(C) Construction of p UG201 The outline of this operation is as shown in FIG.

EI UO3 obtained in (B) above was treated with restriction enzyme HinfIr.
The DNA fragment obtained by cutting was digested with PvuI of pGH55.
[PUG201, a vector containing a DNA base sequence inserted into the restriction site and encoding a signal peptide-β-urogastrone fusion polypeptide, was constructed by the following method.

■ 15μQ of pUO3 was Hi
After cutting with nfI (manufactured by Takara Shuzo) and extracting phenol, D
NA polymerase ■ Glue? The cut fragment was made into a plant end with no fragment. Next, 6% polyacrylamide gel electrophoresis was performed, and a DNA fragment <F> of approximately 0.43 kb was isolated.

This fragment contains the DNA encoding β-urogastrone.
The base sequence (including the translation stop codon) except for the 7 bases at the 5' end was included.

■ In pGH55, the first seven DNA base sequences encoding the N-terminal region of β-urogastrone are directly linked after the DNA base sequence encoding the signal peptide of β-lactamase, and immediately after that, the DNA base sequence encoding the signal peptide of β-lactamase is directly linked with the DNA base sequence encoding the N-terminal region of β-urogastrone. Cut! 5 μg of the pGH55 was digested with pvu in a medium concentration buffer to obtain a DNA fragment (G) of approximately 3.26 kb. .

This fragment contains all the genetic information of pGf-155.

(2) Approximately 1 μg of the Togada fragment CF> obtained in (2) above and approximately 0.5 μg of the fragment (G) obtained in (2) above were ligated using Tt DNA ligase. After the reaction, strain H8101 was transformed with this reaction composition, one strain was selected from the obtained tetracycline-resistant transformants, and plasmid pUG201 was isolated.

1) LIG201 had a size of approximately 3.8 kb as a result of 1.0% agarose gel electrophoresis.

When this is cut with Ba1llHI or Hind[l,
Since two types of DNA fragments are obtained, the p
It was found that UG201 contains the β-urogastrone gene, and from the results of examining the size of the fragment,
It turned out to be the desired plasmid. Furthermore, p UG
Regarding No. 201, the base sequence of a DNA fragment containing a portion of the β-lactamase promoter to the β-urogastrone gene was investigated by base sequence analysis using the M13 method. As a result, the DNA base sequence is as shown in Table 4 below, and pUG201 has exactly the promoter, ribosome binding site, base sequence encoding the β-lactamase signal peptide, and base sequence encoding β-urogastrone. The parts arranged in this order are Ii
! ! ! ! It was done. Table 4 also lists the amino acid sequences corresponding to the DNA base sequences.

E. coli carrying the above p UG201! -18101 has been deposited with the Institute of Microbiology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry under the designation rHBl 01 (p GH201)J. Its deposit number is FERM No. 681 (FERM
BP-681).

Table 4 TTCTTGAAGACGAAAGGGCCTCGTG
ATACGCCTAAGAACTTCTGCTTTCC
CGGAGCACTATATGCGGAATTTTATA
GGTTAATGTCATGATAATAATGGTT
AAAAATATCCAATTACAGTACTATT
ATTACCATTCTTAGACGTCAGGTGG
CACTTTTCGGGGAAAAAAATCTGC
AGTCCACCGTGAAAAGCCCCTTT"- TGTGCGCGGAACCCCCTATTTGTTTA
TTTTTCTA△CACGCGCCTTGGGGAT
AAACAAATAAAAAGAT□ Pro
Motor -AΔTACATTCAA
ATATGTATCCGCTCATGAGACATTA
TGTAAGTTTATACATAGGCGAGTAC
TCTGTATAACCCTGATAAAATGCTTC
AATAATATTGAAATATTGGGACTAT
TTACGAAGTTATTATAACTTT/ribosome binding site AAGGAAGAGT ATG AGT ATT
CAA CATTTCCGT GTCGCCC
TT ATT CCCTTTTTTT GCG
GCCTTT TGCCTT CCT GTCT
TCGCG AACTCA GAT TCT
GAG TGCCCA CTG TCT CA
CGAT GGCTAT TGTCTG CAC
GACGGT GTT TGCATG TACG
ACGTG CTG CCA CAA ACG
TACATGLeu His ASII
Gly Val C3Met Tr△
TCGAA GCT TTG GAT AAA
TACGCGβ-urogastrone polypeptide TGT △ACTGT GTA GTG GG
T TAT ATCGGT GAA CGCT
GT CAA TACCGT GATCTG
AAA TGG TGG GAA TTG
GGT TAATAGTGAAGATCTGGATC ATCACTTCTAGACCTAG (D) Construction of pUGTI 50 ■ A schematic diagram of pUGTI 50 construction according to this example is shown in Figure 5.
As shown in the figure. 1 as the origin vector of the tac promoter
) DR540 (manufactured by Pharmacia) was selected.

15μ(] of the pDR540, limit M element 3amH■
After cutting in a neutral concentration buffer using
The ends of the Ji pieces were made blunt with 81 nuclease,
Next, limit! l? Using EC0RI to reduce high salt concentration @
Cut in liquid. Next, 5% polyacrylamide gel electrophoresis was performed, and a DNA Alli piece of approximately 0.38 kb <H>
I got it. This fragment contains the tac promoter and SD sequence.

(2) 22 μg of pUG201 was cleaved using restriction enzymes PstI and EC0RI in a medium-temperature concentration buffer solution and a high-salt concentration MWjJ solution, respectively. Of the obtained DNA fragments, approximately 2.97 kb DNA fragment <I> was obtained from an amount equivalent to 2 μg by 0.9% agarose gel electrophoresis. This fragment contains the tetracycline resistance gene and the replication initiation region of the vector.

■ The remaining 20 μg of the DNA fragment obtained by cleaving the above pUG201 with PStI and E (IORI) was partially cleaved in a low-salt buffer using restriction' MboI. The above partial cleavage was carried out by adding 10 units of DN (manufactured by Nippon Steel & Co., Ltd.) to the reaction solution and allowing the reaction to proceed at 37°C for 30 minutes.Next, 5% polyacrylamide gel electrophoresis was performed, and approximately 0.49 kb DNA was isolated.
A fragment (J) was obtained. This fragment contains the DNA base sequence encoding the signal peptide of β-lactamase.
The 3' end of the partial sequence lacking 6 bases at the 5' end contains a continuous sequence of [)NA base sequences encoding β-urogastrone.

■ A DNA fragment (
The following oligonucleotides I-3 and I-4, which serve to connect H) and (J), were synthesized according to the solid phase phosphotriester method.

1-3 5'TCGACAATGΔGT 3'1
-4 3'AGCTGTTACTC5' As mentioned above, oligonucleotides 1-3 and I-4 are complementary to each other, and when they are correctly combined with DNA fragment (H), recognition by restriction enzyme 5alI occurs in this binding region. A new array is formed.

■ Fragments (H), <r>, and (J) obtained above and 1 μg each of oligonucleotides I-3 and [-4 were mixed and ligated using Tt DNA ligase in a 50 μQ reaction solution. I let it happen. Next, Escherichia coli strain JM103 was transformed with this reaction composition to obtain a transformant exhibiting tetracycline resistance. One strain was selected from the transformants thus obtained, and the plasmid pUGTl 50 was extracted from the strain.
was isolated.

The pUGTl 50 had a size of about 3.9 kb as a result of 1.0% agarose gel electrophoresis. Furthermore, as a result of examining the cleavage pattern of this product with restriction enzymes such as 5alI and HindI[I, it was found that the pUGT150 was
In addition to the tetracycline resistance gene, the information unit of pUG201, namely the tac promoter of pDR540 and its downstream SD sequence, encodes a fusion polypeptide in which the β-lactamase signal peptide of pUG201 and β-urogastrone are directly linked. It contains an information unit in which a DNA base sequence encoding the fusion polypeptide and a transcription termination signal for β-lactamase are linked in this order, and there is a 5alI site between the SD sequence and the DNA base sequence encoding the fusion polypeptide. This was confirmed.

The Escherichia coli JM103 strain harboring p UGTl 50 is designated as rJMl 03 (p UGTl 50)J and has been designated as FERM BP974 (FERM BP974).
It has been deposited as.

(E) Construction of p UGTl 50S p Following this example
A schematic diagram of the UGTI 508 construction is shown in FIG.

■ 5 μg of pUGTl 50 was added to the restricted Ichihara B (II
II (manufactured by Takara Shuzo Co., Ltd.) in a high-salt buffer, the resulting DNA fragments were converted to plant-ends with DNA polymerase Klenow fragment (manufactured by Takara Shuzo Co., Ltd.), and then restricted to 19-fold E coRI. in a high salt buffer. Next, 0.9% agarose gel electrophoresis was performed to obtain a DNA fragment (K) of approximately 3.24 kb. This fragment contains the tetracycline resistance gene and the replication initiation region of the vector.

■ 5 μg of pUGTl 50 was added to EcoRI and 5 μg.
The fragment was cleaved using alI (manufactured by Takara Shuzo Co., Ltd.) in a high-salt concentration M side solution, and then subjected to 5% polyacrylamide gel electrophoresis to obtain a DNA fragment CL) of about 0.39 kb. This fragment contains the tac promoter.

■ 32 μg of pUGTl 50 was cleaved in high salt buffer using Ba1I and 5alI, then cleaved with 4
% polyacrylamide gel electrophoresis, approximately 0.2
A 4kb DNA fragment was obtained. Furthermore, this fragment was digested with restriction enzyme 5.
The fragment was cleaved using au3AI (manufactured by Takara Shuzo Co., Ltd.) in medium salt II buffer, and then subjected to 6% polyacrylamide gel electrophoresis to obtain a DNA fragment of approximately 0.21 kb <M). This fragment contains a portion of the information unit contained in pUGT150 other than the 3'-terminal 24 bases of the DNA mm sequence encoding the signal peptide and β-urogastrone fusion polypeptide.

■ Oligonucleotides DE1, DE2, D shown below
E3 and DE4 were synthesized according to the solid phase phosphotriester method.

DEI 5' GATCTGAAATGGTGG
3DE2 5'GAACTGCGCTAGGAGGAC
TCGA 3' DE3 5'TAGCGCAGTTCCCCACCAT
Oligonucleotides such as TTCA 3' DE4 5' TCGAGTCCTCC 3' are designed to form mutually complementary double strands as shown in the formula below, and these oligonucleotides are combined with the DNA fragment (K). When combined correctly,
A new XhoI site is formed at this location.

The 5' ends of DE2 and DE3 were each phosphorylated using T4 polynucleotide kinase (manufactured by Takara Shuzo). Then 1μ each of phosphorylated DE2 and DE3
Add 1 μg each of DEI and DE4 to TAD
These were ligated using NA ligase. Subsequently, 8% polyacrylamide gel electrophoresis was performed, and approximately 0.04 kb
The DNA fragment <N> is 1q. This product has a sequence corresponding to the portion before and after the 3' end of the DNA base sequence encoding β-urogastrone.

■ 4 kinds of DNA fragments <K>, <L
>, (M) and <N) were mixed and ligated using TA DNA ligase. After the reaction is completed, use this reaction composition solution to make JM.
I03 strain was transformed, and from among the resulting tetracycline-resistant transformants, - strain was selected and plasmid p
UGTl 508 was isolated.

1) UGTl 508 thus obtained had a size of approximately 3.9 kb as a result of 1.0% agarose gel electrophoresis. Furthermore, as a result of examining the cleavage pattern with restriction enzymes such as 5alI and XhoI (manufactured by Takara Shuzo Co., Ltd.), it was found that this
Similar to UGTI 50, in addition to the te-racycline resistance gene, the tac promoter, S D sequence, β-
It was confirmed that the DNA base sequence encoding the signal peptide of lactamase, the DNA base sequence encoding β-urogastrone, and the transcription termination signal were linked in this order to contain an information unit.

I) Escherichia coli J harboring UGT150S obtained above
M103 strain is rJMl 03 (1) UGTl 50
8) Indicated by J, FERM
BP975).

Furthermore, as a result of analysis using the M13 method, the DNA base sequence encoding β-urogastrone possessed by the pUGTI 50S was confirmed to be a novel -b shown in Table 5 below.

Table 5 AACTCA GAT TCT GAG TGCCCA
CTG TCT CACGAT GGCTAT TG
TCTG CACGACGGT GTT TGCATG
TACATCGAA GCT TTG GAT AA
A TACGCGTGT AACTGT GTA GT
G GGT TAT ATCGGT GAA CGCT
GT CAA TACCGT GATCTG AAA
TGG TGG GAA CTG CGCTAG Example 1 Construction of the vector of the invention pLIGTl 508-2 A schematic diagram of the construction of the vector of the invention according to this example is shown in FIG.

■ 20 μg of pLJGTl 508 was treated with restriction enzyme
The fragment was cleaved using hol II (manufactured by Boehringer Mannheim) in a low-salt buffer, and the resulting fragment was then converted to plant-end using $1 nuclease.

The plant-ended fragment was cut using restricted NIPstI in high salt buffered saline and then subjected to 1.6% agarose gel electrophoresis to obtain approximately 0.39 kb DNA.
Fragment (0) was obtained.

This fragment contains a transcription termination signal.

■ 8μQ of pUGTl 50S was added to the restriction enzyme pst
cleaved in a high salt concentration Mm solution using
Next, 1.6% agarose gel electrophoresis was performed, and approximately 0
, a 91 kb DNA fragment <p> was obtained.

This fragment contains the tac promoter, SD sequence, and DNA encoding the signal peptide and β-urogastrone.
Contains base sequences.

■ Each DNA fragment <O> and <p> obtained in above ■ and ■
were mixed and ligated using T and DNA ligase. Next, 1.6% agarose gel electrophoresis was performed to obtain approximately 1.
A 29 kb DNA fragment <Q> was obtained. This fragment is p U
It contains one complete information unit that is the same as the information unit held by GTl 50S.

■ 6 μg of pUGTl 50S was added to the restriction enzyme pst
The fragment was cleaved in a high-salt buffer using EcoRV and EcoRV (manufactured by NEB), and then subjected to 1.6% agarose gel electrophoresis to obtain a DNA fragment (R) of approximately 0.72 kb.

This fragment also contains the tac promoter, the SD sequence, and the DNA base sequence encoding the signal peptide and β-urogastrone, similar to the fragment obtained in ① above.

■ 2μg of pUGTl 508 was added to the restricted intoxication PSt.
and EC0RI in a high salt buffer,
Next, 0.9% agarose gel electrophoresis was performed, and approximately 2
．． A 97 kb DNA fragment <S> was obtained.

This fragment contains the tetracycline resistance gene, vector.

It contains a replication initiation region and a transcription termination signal.

(2) The DNA fragments <Q>, <R>, and (S) obtained in (1) to (2) above were mixed and ligated using T and DNA ligase. After the reaction is completed, use this reaction composition solution to incubate Escherichia coli JM103.
Transform the strains, select one strain from the obtained tetracycline-resistant transformed strains, and use the plasmid pUGTl 5.
OS-2 was isolated.

The p UGTl 508-2 thus obtained was 1.0
% agarose gel electrophoresis, the size was approximately 5.0 kb. Furthermore, as a result of examining the cleavage patterns with restriction enzymes such as PStI and Se2, it was found that pUGTl 5
08-2 has ta in addition to the tetracycline resistance gene.
Contains two sets of information units in which the cbuO motor, the SD sequence, the DNA base sequence encoding the β-lactamase signal peptide, the DNA base sequence encoding β-urogastrone, and the transcription termination signal are linked in this order. was confirmed.

E. coli strain JM103 carrying pUGTl 508-2 obtained above is rJMl 03 (1) UGTl
No. 976 (
It has been deposited as FERM BP976).

Example 2 Construction of the vector of the invention pUGTl 508-3 A schematic diagram of the construction of the vector of the invention according to this example is shown in FIG.

■ 12μ of pUGTl 508-2 obtained in Example 1
Q was cleaved using the restriction enzyme EC0RV in a high temperature a temperature buffer and then partially cleaved with the restriction enzyme PStI. In other words, 6 units of pst ■ are in the middle? The above partial cleavage was performed by adding it to a reaction solution containing an 11° C. buffer and reacting at 37° C. for 30 minutes. Then after phenol extraction,
0.9% agarose gel electrophoresis, approximately 1.82
A DNA fragment (T) of kb was obtained.

This fragment contains one complete information unit, which is the same as the information unit possessed by pUGTl 508, and another information unit connected to it, which lacks the transcription termination signal portion. There is.

■ DNA fragments (Q) and (
S) and the DNA fragment (T> obtained in ① above), T, DNA
Ligation was performed using ligase. After completion of the reaction, Escherichia coli strain JM103 was transformed with this reaction composition, and one strain was selected from the resulting tetracycline-resistant transformants to isolate plasmid ptJGTl 50S-3.

The p IJGTI 503-3 thus obtained was 1.
As a result of 0% agarose gel electrophoresis, the size was approximately 6.08 kb. Also pstI.

As a result of examining the cleavage pattern with restriction WI elements such as 3alJ, pUGTl 508-3 contains, in addition to the tetracycline resistance gene, the tac promoter, the SD sequence, and the β-
It was confirmed that the DNA base sequence encodes the signal peptide of lactamase, the DNA base sequence encodes β-urogastrone, and the transcription termination signal are linked in this order to contain three sets of information units.

E. coli JMI harboring this pUGTl 50S-3
The 03 strain is rJMl 03 (p UGTl 50S
-3) Indicated by J, FERM
BP977).

Example 3 Construction of the vector of the invention pLIG-r150s-4 A schematic diagram of the construction of the vector of the invention according to this example is shown in FIG.

■ 2μQ of pUGTl 50S-3 obtained in Example 2
was cleaved in a high-salt buffer using the restriction enzyme EC0RV, and then cleaved using the restriction enzyme Eco52I (manufactured by Takara Shuzo Co., Ltd.) in a raw-salt buffer containing 50 mM sodium chloride. Next, 0.9% agarose gel electrophoresis was performed to obtain a DNA fragment <U> of approximately 4.95 kb.

This fragment contains pUGTl 50S-3 obtained in Example 2.
It contains three sets of information units, the second half of the tetracycline resistance gene, and the replication initiation region of the vector, identical to that of the vector.

■ High 1 using EC0RI with 6μQ of pBR322!
50! in concentration buffer and then using the restriction enzyme Eco52I. Cleavage was performed in raw salt buffer supplemented with IM sodium chloride. As a result of 1.6% agarose gel electrophoresis, a DNA fragment of approximately 0.94 kb <V
> obtained. This fragment contains the first half of the tetracycline resistance gene.

■ The DNA fragment (Q) obtained in Example 1 (■) and the DNA fragments <U> and (V) obtained in
Ligation was performed using A ligase. After the reaction was completed, Escherichia coli strain JM103 was transformed with this reaction composition, and one strain was selected from among the resulting tetracycline-resistant transformants and plasmid pUGTl 50S-4 was injected 11*1 times.

The pLIGTl 508-4 thus obtained was 1.
As a result of 0% agarose gel electrophoresis, the size was approximately 7.18 kb. Furthermore, as a result of examining the cleavage patterns with restriction enzymes such as psB and 5alI, pUGTl 5
In addition to the tetracycline resistance gene, 0S-4 has ta
c promoter, SD sequence, DNA base sequence encoding the β-lactamase signal peptide, DNA base sequence encoding β-urogastrone, and transcription termination signal were confirmed to contain four sets of information units linked in this order. It was done.

E. coli JM1 harboring this pUGTl 508-4
The 03 strain is rJMl 0'3 (p UGTl 50S
-4) Indicated by J, FERM
It has been deposited as BP978).

(A) pLIGT201, pUGT150 and 1)
Secretion and expression of β-urogastrone by UGTI 503 (1) Culture of bacteria E. coli strain JM103 carrying each vector obtained in each of (C), (D>, and (E) of Reference Example III) was cultured as follows.

As the medium, M9 medium supplemented with glucose, casamino acid, proline, thiamine, and tetracycline was used. Its composition is as follows.

Disodium phosphate decahydrate 13.4g Potassium phosphate 3.0g Sodium chloride
0.5゜Ammonium chloride
1.0g Calcium chloride dihydrate 14.7m
c) Magnesium chloride hexahydrate 203ng glucose 5.0g casamino acid
5.0OL-Proline
5011g thiamine/hydrochloric acid vA1m (] Tetracycline 15mlQ Inoculate the bacteria into a flask containing the above medium 200-
Shaking culture was performed at ℃. 4 hours after the start of culture, r
PTG was added to 1mM and culture was continued, and after 1.3.5 and 20 hours, a constant [1(10112
) was collected, the absorbance at 610n11 was measured, and then the bacterial cells and the culture supernatant were separated by centrifugation (<6000 revolutions/min, XIO minutes, 4°C). The t7-treated j8 culture supernatant is used as the extracellular fraction.

In addition, the bacterial cells were dissolved in PBS (2On+M 1-lium phosphate containing 150mM putrium chloride, 1)H7,0)1
Suspend at 0mi and use an ultrasonic crusher (Minister Seisakusho 520)
Crushing was carried out three times for 30 seconds each using a centrifugal valve #1 (18,000 rpm x 20 minutes, 4
℃) and wait for the top. This is referred to as the bacterial intracellular fraction.

(2) Measurement of β-urogastrone by RIA Each of the fractions obtained in (1) above was examined for the presence of β-urogastrone by β-urogastrone-specific radioimmunoassay (RIA) as follows. The RIA method is as follows. That is, a domestic rabbit was immunized using purified human β-urogastrone as an antigen to prepare an antiserum. That is, after dissolving 300 μQ of β-urogastrone in 0.2112 μl of distilled water,
1.511112 of a 50% polyvinylpyrrolidone solution was added and stirred at room temperature for 2 hours. Complete Freund's Adjuvant 2. Om was added to emulsify and injected subcutaneously into the chest of three domestic rabbits. After repeating immunization four times every two weeks, 50 μg of antigen was further intravenously injected, and three days later, whole blood was collected and serum was separated.

Next, we examined the tightness curve to determine the dilution factor of the antiserum used in the assay, the incubation time to optimize the assay conditions, and the separation method of antibody-bound labeled antigen (bound) and free labeled antigen (free). The following measurement conditions were set.

i.e. 0.5% bovine serum albumin (BSA), 140
Using 10IIM phosphate buffer (pH 7,4) containing mM sodium chloride, 25 g + M EDTA disodium as a diluent, add 400 μQ of the diluent, 100 μQ of the measurement sample or standard human β-urogastrone, and 100 μQ of anti-human β-urogastrone serum. After incubation at 4°C for 24 hours, 100 μQ (approximately 5000 Cpl) of 1251-labeled human β-urogas iron was added. After further incubation at 4°C for 48 hours, the second antibody (
anti-rabbit γ-globulin goat serum) (1:20) 100μ
Q, 10 gmM PBS solution containing 100 μQ of normal rabbit baijiu (1:200) and 5% polyethylene glycol 9
00 μQ was added and incubated at 4° C. for 3 hours.

Next, the mixture was centrifuged at 3000 rpm for 30 minutes, and the upper groove was removed and the precipitate was counted. The content of human β-urogastrone immunoreactive substance in the sample was determined from a standard curve obtained from standard human β-urogastrone.

The results of the above RIA are shown in FIG. 10 and Table 6.

In the figure, the horizontal axis shows the culture time (hr), and the vertical axis shows the extracellular β-urogastrone j1 (
o+o/, c ), β inside the bacteria shown in graph (2)
-Urogastrone ff1 (10/12) and graph (3
) shows the absorbance (OD) at 610nllll, respectively. In each figure, the timing of IPTG addition is indicated by a white arrow.

Table 6 also shows the total amount (μg/Q) of intracellular and extracellular β-urogastrone.

Table 6 Test bacteria p IJG p UGT pt
JGT20”l 150 1508 Culture 3hr 15 0
0 nutrition 5hr 112
524 376r17hr 1
220 1080 9hr 137
1120 152824hr 63 5
32 1128 From Figure 10 and Table 6, 9 UGT
The strain harboring l50 and p1JGT150S is
It can be confirmed that secretory expression of β-urogastrone begins within 1 hour after addition of IPTG, and the expression level greatly exceeds that of the strain harboring pUG201.

It has also been confirmed that in these strains, the addition of IPTG substantially stops the growth of the bacteria, and that the significant β-urogastrone is excreted from the cells. Further o UGT
I508 strain is ptJGT.

It was also confirmed that this strain secreted and expressed a large amount of β-urogastrone compared to the 150 strain, and that the difference was remarkable, especially outside the bacterial cell. In addition, when the above-mentioned two strains were cultured in an IPTG-free system, β-urogastrone was not detected either inside or outside the cells.

(B) Expression of secretion of β-urogastrone by a strain carrying pUGTl 50. ②Escherichia coli H8101 strain carrying the bacterial culture vector pUGT150 was further added to the M9 medium having the composition shown in ② of (A>) above.
0 m (J/Q medium supplemented with L-leucine 200 m
Shaking culture was carried out at 37°C in a flask containing IQ.

At 35.6.5.8 and 24 hours during culture, a certain amount (101i2) of the culture solution was collected, and each 61001
The absorbance was measured at In addition, the intracellular fraction and the extracellular fraction were separated in the same manner as in (A) above, and the amount of β-urogastrone was measured for each of them according to the method shown in (2).

The results are shown in FIG. 11 in the same manner as FIG. 10.

From FIG. 11, it was confirmed that in this culture, β-urogastrone was produced both inside and outside the cells, even though IPTG was not added. Furthermore, it can be seen that the production of β-urogastrone outside the bacterial body is remarkable from 6 to 8 hours, when the growth of the bacteria has almost stopped.

(C) l) UGTl 508, ρUGT150S-2,
p UGTl 508-3 and p UGTl 50S-
Secretion and expression of β-urogastrone by a strain carrying 4. ① Cultivation of bacteria Each of the E. coli JM103 strains carrying each of the above vectors was inoculated into a flask containing medium 2004 having the same composition as used in (A) ① above. The cells were cultured with shaking at 37°C.

At 4.5 to 5 hours after the start of culture, add IPTG to the flask.
was added at 1mM once, culture was continued, a certain amount of ff1 (1017) of the culture solution was collected over time, and 610
The absorbance at nl was measured.

Further, the intracellular fraction and the extracellular fraction were separated in the same manner as in (A) above, and the amount of β-urogastrone was measured in the same manner for each of them.

The results are similarly shown in FIG. 12 and Table 7.

Table 7 shows the total amount of β-urogastrone in the intracellular and extracellular fractions (μQ /Q >).

From Table 7, Figure 12, and Table 7, each strain used in this test was:
In both cases, after 1 to 1.5 hours, the addition of IPTG stops bacterial growth and produces a significant amount of β-urogastrone within the bacterial body, and as time progresses, a significant amount of β-urogastrone is released outside the bacterial body. - It can be confirmed that urogastrone is produced.

In addition, when comparing the maximum amount of intracellular and extracellular β-urogastrone in each strain, it was found that ρLIGT1
While the 50S strain is 816 μg/Q, ρtJGT
In the 150s-2 strain, 1604μ9/Q, p(JGT
For strain I 50S-3, 2240 μQ/Q and p UG
In the TI 508-4 strain, the concentration was 1920 μg/Q, and these values were found to be about 2 times, about 3 times, and about 2.5 times, respectively, as those of the ptJGT150S strain.

(D) Purification of β-urogastrone and i [(A) to
The β-urogastrone immunoactive substance in the bacterial intracellular (periplasmic) to extracellular fractions obtained in (C) was subjected to M production to confirm β-urogastrone.

As an example, among the strains used in (C) above, 1) UG
Regarding the JM103 strain carrying Tl 508-2, N and 'tr1g from the periplasmic fraction extracted by the osmotic shock method from the culture solution 20Q after culturing it for 24 hours will be described in detail below.

■ The β-urogastrone immunoactive substance in the Heliblasm fraction was analyzed by adsorption chromatography using Butyl Toyovar 650C (manufactured by Toyo Soda), anion exchange chromatography using DEAE-Toyovar 650M (manufactured by Toyo Soda), Fractional purification was carried out by sequentially performing cation exchange chromatography using CM-Toyovar 650M (manufactured by the same company) and gel filtration chromatography using Sephadex G-25 (manufactured by Pharmacia),
13411 g of a single polypeptide with a purity of over 99% was obtained.

■ Natural β-urogastrone isolated and purified from the obtained polypeptide and human urine (manufactured by Nippon Chemical Research)
FIG. 13 shows the elution pattern of the compound obtained by reverse phase high performance liquid chromatography. FIG. 13 shows TSK gel-0DS-
Using a 120T column (manufactured by Toyo Soda Co., Ltd.), 50 nM phosphate buffer (pH 7.0) containing 22% acetonitrile was added.
) at a flow rate of 1.0-min. In the figure, the vertical axis shows the absorbance at 280rv and the horizontal axis shows the retention time (minutes). The peptide results and (2) are the results for natural β-urogastrone.

It can be seen from the figure that the retention times of both are completely the same.

■ In addition, the polypeptide obtained above was hydrolyzed with 4M methanesulfonic acid, and the Hitachi Amino Acid Fractionator Model 8
The results of amino acid analysis determined by the ortho-phthalaldehyde method using Type 35 are shown in Table 8 below.

Table 8 Amine, acid Actual number of residues Theoretical number of residues Asx
7.1 7Thr Not detected OSer 2.5
3Glx 5.0
5Pro
1Gly 4.0
4ΔIa 2,0
21/2Cys 6
Vat 2.5 3V
at O,91 11e 1.9 2shieu 4.9 5Tyr
4.9 5phe
Not detected 0Lys 2.0
2His 2.1 2Trp
2.3 2Ar 2.
9 3 From the table, it can be seen that the actually measured number of residues agrees well with the theoretical number of residues.

(2) Furthermore, a test to confirm the cell proliferation promoting activity of the polypeptide obtained above was conducted as follows.

This test was performed using the method of Nakamura et al. (J, [3tochem,
.

94 (1983) 1029-1035) to measure the incorporation of [3H)-thymidine into polymeric DNA by primary cultured hepatocytes of adult rats.

It was carried out by.

The results are shown in FIG. In the figure, (1) is the result of the polypeptide obtained according to the present invention, and (2) is the same test conducted on mouse EGF (manufactured by Collaboration Tape Research), which is known to have similar activity. This is the result.

From the above figure, the polypeptide according to the present invention is mouse EG
It is clear that it exhibits stronger cell proliferation promoting activity than F.

■ In addition to the above, results of polyacrylamide gel electrophoresis, amino acid sequence analysis, early eyelid dehiscence activity test in newborn mice, etc. showed that the polypeptide of the present invention corresponds to natural β-urogastrone in all of them. was recognized.

■ Also, JMl carrying the above pUGT1508-2
After culturing strain 03 for 24 hours, centrifugation (6000 rpm/
The culture supernatant obtained after centrifugation (4℃) was used as the extracellular fraction, and the cells after centrifugation were added to washing buffer (3C).
10IIM Tris-HCl containing aM sodium chloride, p
After washing with H8,0), suspend in PBS (201M sodium phosphate containing 150mM sodium chloride, pH 7,0), and use an ultrasonic crusher IN (Model 5202 manufactured by Minister Seisakusho) at 100W for 30 seconds each for 3 times. After the crushing process, centrifugal valve 11
(18,000 rpm x 20 minutes, 4°C) The resulting supernatant was used as the intracellular fraction, and each of these was subjected to the same purification and confirmation tests as above.

Furthermore, similar purification and confirmation were performed on the intracellular fraction, periplasmic fraction, and extracellular fraction of bacterial strains other than the JMI 03 strain carrying pUGTI 508-2 used in (C) above.

As a result, it was confirmed that the product of both strains was β-urogastrone when any strain was cultured.

[Brief explanation of drawings]

Figure 1 shows the process of obtaining plasmid 1) GH53 by cloning synthetic oligonucleotides <1>, 2>, 3> and <4> into the origin vector pBR322, and the characteristics of pGH53 obtained thereby. The opening in the figure shows the base sequence derived from the synthetic oligonucleotide. In addition, in the figure, All' represents the ampicillin resistance gene,
Tc indicates a tetracycline resistance gene, and the same applies to the following figures. Figure 2 is a diagram showing the process of obtaining the β-urogastrone expression vector pGH54 from pGH53 and pBR322 and the characteristics of the obtained vector pGH54, in which - indicates the base sequence encoding the signal peptide. . In the figure, (F) indicates the F nn4 HI site, and the restriction enzyme site shown in parentheses indicates the corresponding site among the plurality of restriction enzyme sites present on the vector. , the same applies to the following figures. Figure 3 shows that p BRHO2 is obtained from p BR322, and the p BRHO2 is obtained from p BR322.
Step of obtaining β-urogastrone expression vector pGH55 from BRHO2 and pGH54 and the obtained pGH5
5 is a diagram showing the characteristics of No. 5. Figure 4 shows pGf-155 and 1) vector D UG201 containing a DNA mM sequence encoding a fusion polypeptide of a signal peptide and β-urogastrone from UO3.
FIG. 2 is a diagram showing the process for obtaining p-UG201 and the characteristics of the resulting vector pUG201, in which the white arrow indicates the DNA base sequence encoding β-urogastrone. FIG. 5 is a diagram showing the process of obtaining pUGT150 from pUG201, pDR540 and oligonucleotides I-3 and I-4, and the characteristics of pUGT150 obtained. In the figure, the black arrow indicates the promoter of β-lactamase, the arrow with diagonal lines indicates the tac promoter, and Qri? ! 2JJ start area is shown, and the same applies to the following figures. Figure 6 shows pUGTl 50 and oligonucleotide DE.
1, pUGT150S from DE2, DE3 and DE4
! FIG. 2 is a diagram showing the process for obtaining the oligonucleotide and the characteristics of the vector used; in each oligonucleotide, a white circle indicates the unphosphorylated 5' end, and a faithful dog indicates the phosphorylated 5' end. Figure 7 shows ρLIGTI 50S to pUGTl 50
This figure shows the process of obtaining S-2 and the characteristics of the obtained vector, in which the white arrow indicates the tac promoter, the SD sequence, the DNAj [sequence, the DNA encoding β-urogastrone] encoding the signal peptide of β-lactamase.
It shows an information unit in which the A base sequence and the transcription termination signal are linked in this order. Figure 8 shows pLIGTl 50S-2 and DNA fragment (Q
FIG. 3 is a diagram showing the process of obtaining pLIGTI 508-3 from .gamma. and (S) and the characteristics of the resulting vector. Figure 9 shows p LIGTl 50S-3, p BR322
and DNA fragment (Q>) and the characteristics of the resulting vector. FIG.
It is a graph showing the intracellular and extracellular β-urogastrone production amounts by culturing JMl 03 strain, each carrying LIGTl 50S. Figure 11 shows H8101 containing p LIGTl 50.
It is a graph showing intracellular and extracellular β-urogastrone production by culturing the strain. Figure 12 is p LIGTI 50S1p LIGTl
50S-2, p UGTI 508-3 and p UGT
1 is a graph showing intracellular and extracellular β-urogastrone production by culturing JM103 strain carrying 508-4. Figure 13 shows β purified from bacterial cells (periplasmic fraction).
- Shows the elution patterns of urogastrone and natural β-urogastrone by reverse phase high performance liquid chromatography. FIG. 14 is a graph showing that [3H]-thymidine incorporation into polymeric DNA of primary cultured hepatocytes of adult rats is promoted by β-urogastrone and mouse EGF purified from the belliplasm fraction. (Above) 610r1m OXiX Mig 61Q
nmaT:JT'b') Death Wβ-Uroka 1 Stroi mg
A) /j'-walker2to%mg/z)610
nm=07L Luminous intensity - β-Ogastron (mg/J) Fig. 14 1 Tourogastrone (, us/mt) Procedural amendment (method) % formula % 1 Incident indication 1985 patent application no. No. 31415 No. 2 Name of the invention Polypeptide expression vector, host transformed with the vector, and method for producing polypeptide using the host Earth Pharmaceutical Co., Ltd. 4 Agent: Sawanotsuru Building, 2-10 Hirano-cho, Higashi-ku, Osaka Date of shipment: 1988 April 22, 2016 6 Drawings subject to correction Contents of surface correction 1st
Correct (3) and (4) in Figure 2 as shown in the attached sheet. (that's all)

Claims (7)

[Claims] (1) It is characterized by containing a plurality of information units in which a promoter, a ribosome binding site, a structural gene including a start codon, a stop codon, a DNA base sequence encoding a foreign polypeptide, and a transcription termination signal are linked in this order. polypeptide expression vector. (2) The vector according to claim 1, wherein the structural gene contains a DNA base sequence encoding a fusion polypeptide in which a signal peptide is further linked to the N-terminus of the foreign polypeptide. (3) Claim 1 which is pUGT150S-2
Vectors described in section. (4) Claim 1 which is pUGT150S-3
Vectors described in section. (5) Expression of a polypeptide containing a plurality of information units in which a promoter, a ribosome binding site, a structural gene including a start codon, a stop codon, a DNA base sequence encoding a foreign polypeptide, and a transcription termination signal are linked in this order. A host transformed with a vector. (6) A polypeptide containing a plurality of information units formed by linking in this order a promoter, a ribosome binding site, a structural gene including a start codon, a stop codon, and a DNA base sequence encoding a foreign polypeptide, and a transcription termination signal. A method for producing a polypeptide, which comprises culturing a host transformed with an expression vector. (7) A DNA base containing a plurality of information units formed by linking a promoter, a ribosome binding site, a structural gene including a start codon, a stop codon, a DNA base sequence encoding a foreign polypeptide, and a transcription termination signal in this order. array.