JPS6185400A - Protein for manufacturing biological adhesive - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to proteins useful in the manufacture of adhesives. More particularly, the present invention relates to the microbial production of proteins using recombinant DNA technology that can be used to produce bioadhesives whose adhesive properties do not change in a humid environment. These adhesives are therefore used in seawater and general underwater adhesives, medical adhesives for prosthetic joints, arterial or intestinal connections and repairs, etc., and dental cements.

Generally, adhesives must have improved properties to meet the requirements of the particular environment in which they are used. Ideally, the adhesive should cure and should maintain both adhesion and aggregation properties under the conditions of use. Curing is a change in the physical properties of an adhesive by chemical means. For bioadhesives produced by the methods described herein, curing appears to be due to cross-bonding of adjacent uncured adhesive molecules via catalytic and/or chemical agents.

Curing may involve polymerization, vulcanization, and/or cross-linking.

Adhesion, sometimes referred to as peel strength, refers to the ability of a substance to adhere to different surfaces. Buildability, sometimes referred to as abrasion strength, indicates the internal strength and resistance of a material to plastic deformation, and is particularly important when the adhesive used is subject to abrasion load. Many adhesives that exhibit excellent peel and shear strength under dry conditions lose most or completely of these properties in a wet environment, or, more seriously, are unable to cure in a wet environment. Therefore, it has been particularly difficult to develop adhesives that can be used in humid environments such as marine environments or medical and dental applications.

Marine mussels and other sessile crawlers have the ability to secrete adhesive substances that attach their bodies to underwater structures. For example, ノ, Rasakigai M-y↓
jlus e4ujj♀- produces an adhesive substance from the mussel legs that subsequently hardens and permanently adheres to the substrate. M, e+J+4ji≧ does not appear, and l of the adhesive board:.

components have been identified as hydroxylated proteins of approximately 130,000 Da
Wide 1.1. 8io1. Chem,, 25j3
-: 2911-2915 (March 10, 1983)
]. Although this material may be an excellent adhesive for use in humid environments, it is impractical to separate uncured adhesive from mussels for commercial use. To extract I kg of adhesive substance, approximately 5 million to 10 million mussels must be killed.

The present invention relates to the microbial production of proteins useful in the production of bioadhesives using recombinant DNA techniques.

The 1L adhesive precursor protein produced by the method of the present invention has about 100 to about 40% proline residues and about 100% to about 40% proline residues.
about 100 to about 15 consisting of ~40% lysine residues, about 100 to about 40% tyrosine residues, and 0 to about 40% amino acid residues other than proline, lysine, and tyrosine
It consists of a sequence of 00 amino acid residues. Preferably, the bioadhesive precursor protein of the invention consists of repeating decapeptides. Each decapeptide has approximately 30% proline residues,
Contains 20% lysine residues and 20% tyrosine residues.

Proteins produced by the method of the invention can be used as bioadhesive precursors. The adhesive properties of this protein are determined using chemical or enzymatic methods to convert approximately 50% of tyrosine residues to L-3,4-dihydroxyphenylalanine (DOPA) and 60-100% of proline residues to 3-dihydroxyphenylalanine (DOPA). Alternatively, it can be improved by hydroxylation to 4-hydroxyproline. The hydroxylated protein is cured, resulting in the desired physical properties of the bioadhesive.

The hydroxylated bioadhesive precursor protein is J
, an analog of the adhesive protein isolated from the phenolic glands of the mussel M, Dan I↓1 [J, H, Wide, J, Biol, Chem, 258:291
1-29+5 (March 10, 1983)].

This bioadhesive precursor protein is a chemically synthesized double-stranded DNA (d
s DNA) sequence into a microbial host, e.g., C0Lj4S! 4c e
r e y-i-≦i-a e・or skewer-・tough book”
! A synthetic dsDNA sequence is finally inserted and expressed in a host to produce the protein. Synthetic ds encoding the bioadhesive precursor proteins of the invention
l) The NA sequence is composed of codons selected to optimize expression and stably reproduce the genetic information of the particular host microorganism used.

dsDNA provides code for bioadhesive precursor protein
can be linked at its 5' end to a sequence coding for the N-terminal portion of the microbial protein to promote transcription initiated by a microbial promoter. In such cases, the expressed protein constitutes a fusion of the bioadhesive precursor protein and the microbial protein fragment.

Microbial protein fragments are
In some cases, the expression product may contain a signal peptide that facilitates secretion of the expression product through the cell membrane into the surrounding medium; be done. A bioadhesive is produced from a microbial protein fragment by inserting between the sequence coding for the bioadhesive precursor protein and the microbial protein fragment a dsDNA sequence coding for an amino acid sequence that can be specifically cleaved by chemical or enzymatic methods. Partitioning means are provided for separating precursor proteins.

The bioadhesive precursor protein produced by the method of the invention has about 100 to about 1500 7-mino acid residues, preferably about 600 to about 900 amino acid residues coordinated to a repeating decapeptide.
It consists of amino acid residues.

The protein and preferably each decapeptide is about 1
Composed of 00 to about 40% proline residues. Proline residues give the bioadhesive flexibility and make the molecule less spherical, allowing it to conform to the surface of the substrate and interact with other adhesion molecules. The protein and preferably each decapeptide also contains about 10% to
It is composed of approximately 40% lysine residues. This lysine residue renders the bioadhesive basic, which helps the bioadhesive bind to underwater surfaces that are typically covered with a thin film of acidic biological material. Lysine residues also provide reactive groups to which proteins can be cross-linked during curing. The protein, and preferably each decapeptide 1', is also comprised of about 10% to about 40% tyrosine residues.

Phenolic tyrosine residues allow hydrogen to bind to the bioadhesive. Additionally, proline and tyrosine residues provide sites for hydroxylation. The addition of a hydroxyl group to tyrosine I- to form DOPA allows the bioadhesive to forcefully expel water molecules from the substrate surface. In addition to proline, lysine, and tyrosine, the protein and preferably each decapeptide is comprised of 0% to about 40% other amino acid residues. When present, these residues preferably include relatively small unreactive fatty acid side chains, such as alanine, and hydroxyl groups containing amino acids;
For example, selected from serine and threonine. It is preferred to distribute these residues throughout the protein family, so that no more than about 4 appear together in any given decapeptide sequence. Unpreferred amino acids are the acidic amino acids, ie aspartic acid and glutamic acid, and cystine.

The bioadhesive precursor protein is produced by inserting a synthetic dsDNA sequence encoding the protein into a replicable expression vector operatively linked to a regulatory vector capable of effecting expression of the encoded protein in a host microorganism. Manufactured by

For example, E. coli, S. cerevisiae
e, or dan.

A suitable host microorganism, such as -5ubti, is then
Transformation can be carried out using an expression vector, cultured, and placed under conditions where the protein is expressed.

The dsDNA sequence that gives the code to a protein is a known DNA
Prepared by A synthesis method. A suitable method for dsDNA sequence 7 synthesis is the phosphorous acid homologous method (Te
trahedron Letters, 21;
719-722 (1980)).

Several criteria are considered in selecting deoxyribonucleic acid nucleotides to fit into the synthetic dsDNA sequence that codes for the protein. For example, when highly repetitive DNA sequences are used to encode proteins, the repetitive sequences are susceptible to recombination and deletion. Therefore, repeating DNA sequences should be avoided as much as possible. Because the degeneracy of inherited information is well known and the DNA sequences that code for decapeptides are potentially diverse, it is important to minimize the repeats of the DNA sequences that code for bioadhesive precursor proteins that consist of repeating decapeptides. It is possible to do so. Additionally, if the amino acid sequence of the same decapeptide is changed such that the tetragon adhesive precursor protein is composed of 'M49 repeating decapeptides rather than identical repeating decapeptides, repeats of the DNA sequence can be further minimized. It can be done. The amino acid sequence diversity of the decapeptides is within the aforementioned guidelines. In addition to avoiding a high degree of repetition in DNA sequences, particular microbial hosts may have biases that favor the use of codons in the coded instructions for particular amino acids, and these codons may be used when possible. , it is preferable to use it all the time. In general, S. and S. tllis have a relatively low tolerance to repetitive DNA sequences, whereas S.
cerev-ae has sufficient resistance to it. Therefore, and sign u or dip-1 subtilis
When considering a dsDNA coding sequence for the expression of a protein in a protein, avoiding repeats in codon sequences must be the first consideration, and the use of suitable codons is a second consideration. ).

When considering dsDNA coding sequences for expression in corevisi salmon, first of all consider preferred codon usage and secondly avoid repeating codon sequences.

Translation stop codons, which are identified by proteins that release translated polypeptide chains from ribosomes, are produced by synthetic dsDNA that instruct proteins to code.
This must be inserted Q at the 3' end of the sequence. Either one terminal (TGA or TAA) or a series of two terminals may be utilized.

Short synthetic linker sequences can be added to the 5' and 3' ends of synthetic dsDNA sequences that code to the bioadhesive protein precursor and are matched with convenient restriction enzyme cleavage sites on the expression vector.

dsDNA provides code instructions for bioadhesive precursor proteins
is inserted into a replicable expression vector in such a way that it is under the control of regulatory sequences capable of effecting expression in the host microorganism. Host microorganisms include E, coli, B-0
subjil-is and -3,cqreyjsjpe
is preferred. In general, those skilled in the art have the highest level of experience with the expression of heterologous proteins in c,oli. However, because the dsDNA sequences involved are repetitive, and because stably maintaining repetitive 1) NA sequences is a hallmark property of eukaryotic cells, Σ
, cerevjsige can be used to achieve effective expression most easily. Furthermore, −δ, c, ere−
It was observed that the N A sequence can restrict the expression of different genes under large-scale fermentation conditions (N
ucleic Ac1ds Res,, 10:
2625-2637 (1982)). E-0 tough b
-t-i! is is a particularly useful host because it can secrete proteins into the surrounding medium, thus facilitating large-scale production and recovery of proteins produced by microorganisms.

The synthetic dsDNA for the bioadhesive precursor protein is inserted into an expression vector under the control of regulatory sequences including a promoter, a ribosome attachment point, and a translation initiation signal that allows expression in the chosen host. Expression vectors can be selected from plasmids and phages, although plasmids are generally preferred.

To promote expression, the synthetic dsDNA that codes for the protein is ligated at its 5' end with a sequence that codes for the N-terminal portion of the microbial protein, which is usually under the control of the specific regulatory sequences used. It's okay. B. 5ub
For expression in tills, the 5' end before the sequence encoding the bioadhesive precursor protein can also encode the normally secreted protein;
The protein must allow the bioadhesive precursor protein to be secreted.

E, Protein expression in c9ji was performed using synthetic dsDN
This can also be achieved by fusing the internal part of the A sequence to a part of the co-Vi gene that has already been effectively expressed by forming a branch in an expression vector (including the regulatory sequence of the co-Vi gene). For example, dsDNA that codes for a protein can be inserted into a branched E. coli gene that codes for one or more subunits of tryptophan synthetase or serine hydroxymethyltransferase.

Expression vectors containing the E. coli liptophan synthetase and serine hydroxymethyltransferase genes were stored in the American Standard Culture Collection, Rockville, Maryland, under accession number ATCC39, respectively.
388 (within 99U strain c X 1668) and A
TCC39214(-%, aer-o(Ien
es strain GX1704). A recombinant plasmid containing synthetic dsDNA for the bioadhesive precursor protein fused to a portion of either of these genes is used for transformation of E. coli and the transformants are used for the production of the fusion protein. Analyze using known methods.

Synthetic dsD with coded instructions for bioadhesive precursor proteins
The NA can be inserted into the S. cerqv-isiae expression vector such that it fuses internally with an effectively expressed yeast gene on the vector. For example, synthetic dsDNA
Insert the sequence into YpGXl and then -j.

S town ev-i! The jack PG K structural gene and its regulatory sequence portion can be inserted. P.G.K.
The gene provides the code for phosphoglycerate kinase.

Phosphoglycerate kinase is involved in glucose metabolism and can constitute up to 5% of the total amount of yeast cell lytic proteins. Suitable yeast vectors identified as '1/pGX60 and Y p G Consigned to collection. Yeast expressed hector synthesis ds
The silk recombinant plasmid resulting from insertion of the DNA sequence is used to transform S. cereyisjae and the transformants are analyzed by known methods for fusion protein production.

Expression of the bioadhesive precursor protein in a bacillus host, such as B. 5ubtilis, is accomplished by internally fusing a synthetic dsDNA sequence to the effectively expressed bacillus gene. Advantageously, this bacillus gene contains a sequence that codes for the signal peptide necessary for transporting the microbial protein across the cell membrane with concomitant cleavage of the signal peptide. In this way, the bioadhesive precursor protein can be secreted from the bacillus host into the surrounding medium with a signal peptide followed by a small protein fragment, thereby simplifying protein recovery and purification.

B. A suitable vector for bioadhesive precursor protein expression in P. 5ubtilis is the plasmid pG x25
It is 09. This plasmid has accession number ATCC39.
854, deposited with the American Reference Culture Collection, Rockville, Maryland. This plasmid contains the regulatory region and structural genes for α-amylase from the sigtylphenyl peptide strain AT CC23844. Synthetic dsDNA is inserted into the structural gene of mature α-amylase to code the bioadhesive precursor protein to secrete a protein consisting of a fusion of the N-terminal fragment of α-amylase with the bioadhesive precursor protein. Alternatively, a synthetic d that gives the code to the bioadhesive precursor protein can be inserted.
The α-amylase gene can be altered by oligonucleotide-directed in vivo mutagenesis using known methods such that sDNA can be inserted directly after the α-amylase signal peptide coding sequence (Nucleic Aci
ds Res, 10: 64137-6500
(19B2)) In such a case, and because the Inkosho sphere transformant directly secretes the bioadhesive precursor protein, there is no need for splitting to remove microbial protein fragments from the N-terminus. .

A linker that is cleavable by one or more amino acids in order to secrete the bioadhesive precursor protein from the fusion protein.
A short DNA sequence that encodes the sequence is added to the 3' end of the sequence that encodes the microbial protein fragment and a synthetic dsDN that encodes the bioadhesive precursor protein.
Advantageously, it is inserted between the 5' ends of the A sequence. The inserted DNA sequence selectively codes for one or two amino acid sequences that are cleaved chemically or enzymatically. If the bioadhesive precursor protein lacks methionine, the preferred cleavable linker sequence is methionine, to which the ATG sequence codes. If a methionine residue is placed between the microbial protein fragment and the bioadhesive precursor protein, the expressed fusion protein can be treated with dicyanogen bromide, which is selective for the carboxyl side of the methionine residue. The bioadhesive precursor protein is separated from the microbial protein fragment. Other known splittable linker sequences can also be used to attach the bioadhesive precursor protein to microbial protein fragments, provided that no splitting sequence occurs within the bioadhesive precursor protein. limited to. For example, the amino acid sequence ^sp-^sp-^5p-Asp-Ly
A DNA sequence coding for s can be inserted between the microbial protein fragment and the bioadhesive precursor protein. This sequence is confirmed and cleaved on the carboxyl side of the Lys residue by the bovine enterokinase enzyme. Other suitable amino acid sequences specifically identified and resolved with selected enzymes are well known to those skilled in the art (see published European Patent Application No. 035384).

Expression vectors containing inserted dsDNA encoding the bioadhesive precursor protein are used to transform host microorganisms using known transformation methods. This transformant is cultured in a fermenter and subjected to conditions for expressing the polypeptide. Expression products are recovered using conventional methods. Yeast (for example).

are generally sequestered within cells and cells must be lysed before they can be harvested. Proteins are transferred to the bacillus host (
For example, in the case of production (for example, in vitro), the protein attached to the signal peptide passes through the cell membrane, with concomitant cleavage of the signal peptide, resulting in secretion of the protein into the well-known culture medium. If necessary, after collection,
The expression product can be treated chemically or enzymatically to separate the bioadhesive precursor protein from the fused microbial or linker derived proteins. Bioadhesive precursor proteins produced by microorganisms can be converted into bioadhesives with excellent underwater adhesive properties by hydroxylation of tyrosine residues and curing of the hydroxylated proteins. After protein recovery, it is preferred to hydroxylate at least about 50% of the tyrosine residues. Hydroxylation can be accomplished using commercially available enzymes such as pine mushroom polyphenol oxidase.

q The bioadhesives produced by the method of the invention can be used in conventional manner, but if desired can be combined with conventional synthetic polymer adhesives, fillers, coacervates and /or may be mixed with an adjuvant. They are particularly useful where durability in humid environments is desired, such as marine adhesives, medical and dental adhesives, protective coatings, electronic circuit soldering, and the like.

The following examples are intended to further illustrate the practice of the invention herein described and are not intended to limit the scope of the invention.

In the examples, the method used to synthesize oligodeoxyribonucleotides was developed by Applied Biosystems (App
Lied Biosystems, Inc.
Phosphite solid-phase method using an automatic solid-phase DNA synthesizer manufactured by (M, D, Matteucei, M, H,
Caruthers.

Engineering Lotters, 21
: 719-722 (1980)). Four types of appropriately protected 5'-dimethoxytrityl-2'-deoxyribonucleoside-Q 3'-phosphoramibutylene were further synthesized with silica and appropriately protected 5'-dimethyltrimethyl-2'-deoxyribonucleoside. Controlled pore glass (CPG)
(S, P, Adams, K, S.

Kavka, E. J., Wykes, S.
B, 1lorder and G, R, Ga1
lappi, J, he-n+er-Lp-jem,'
Fy oc,.

105: 661-663 (1983) 3 and other solid supports are commercially available.

DNA synthesis proceeds from the 3' end to the 5' end. Below is the signal chain, 5' GCG^^A CCA AGT TA
A special example of the synthesis of CCCACCG ACCTACAAA 3' is described.

Approximately lμ Tsuru's protected 5'-dimethyltrityl-2'-
A derivatized solid support containing deoxyadenosine is loaded and placed into an automatic DNA synthesizer. The conjugate circuit was detritised with 2% trichloroacetic acid in dichloromethane; rinsing in methanol, anhydrous nitromethane, then anhydrous acetonitrile; appropriately protected 5'-dimethane in acetonitrile]・Xytrityl-
2'-deoxyribonucleoside-3'-phosphoramidete (10 μl I1) and tetrazole in acetonitrile (30 μs+) were added simultaneously, incubated for 3-5 min, and incubated with a mixture of tetrahydrofuran, lutidine and water (2:
I: Oxidation with iodine in 2); unreacted 5
It consists of capping the '-hydroxyl groups with dimethylaminopyridine in acetic anhydride and tetrahydrofuran; and a final washing with ditromethane and then anhydrous acetonitrile. The conjugation circuit is repeated until the desired length of DNA is obtained. The DNA was then partially deprotected by treatment with thiophenoxide in dioxane/trimethylamine and transferred to a solid support by several (2-4) short treatments (5-10 min) with concentrated ammonium hydroxide. released from. Completely unprotected DNA is obtained by heating concentrated ammonium hydroxide at 60-65° C. for 8-14 hours.

This DNA was then subjected to ion exchange HPLC using a weak ion exchange resin and 0.1
It is purified by a linear gradient of 3 liters of M ~ 0.4M phosphate ester buffer or by electrophoresis on an acrylamide gel. Purified I) NA is enzymatically phosphorylated at the 5' end and characterized prior to subsequent ligand binding.

Example I E. Nllz- (Ala-l.y
s-Pro-Ser-Tyr-Pro-Pro-Thr
-Tyr-1. ys) Preparation of go-COOII Synthesis ds instructing each of the 20 iterative decapeptide units
The DNA can be selected from sequences whose coding strand has the following formula: GCN AAR CCN (AGY or TCN) TAY
CCN CCN ACN TAY During the AAR ceremony, G.
A, T and C represent deoxyriponucleotides containing the bases guanine, adenine, thymine, and cytosine, respectively, R represents a deoxyribonucleotide containing guanine or adenine, and Y represents a deoxyribonucleotide containing cytosine or thymine. , N is G
, A, T or C.

Dan. 9ri↓ or dan. =! For expression of the 12-20 repeat protein in winter, the five double-stranded oligodeoxyribonucleotide sequences listed below are used to tailor the dsDNA insert to direct the bioadhesive precursor protein. be done.

5'6 GCGAAACCAAGTTACCCACCGA
CCTACAA＾GGTTCAATGGGTGGCTG
GATGTTTCGCTTT"5'5'^GCGAA
ACCCAGCTATCCTCCGACATATAAAA
GGGTCGATAGGAGGCTGTATATTTC
GCTTT65'5'” GCGAAACCTTC
TTATCCGCCTACCTATAAGGGAAGA
ATAGGCGGATGGATATTCCGCTTT65'5 ”'GCGAAACCGAGTTACCCAC
CAACGTACAAGGGCTCAATGGGGTGG
TTGCATGTTCCGCTTT65'5'”
GCGAAACCGTCGTACCCGCCACCT
ACAAAGGCAGCATGGGCGGGTGGAT
GTTTCGCTTT^5' These oligodeoxyribonucleotides were chosen with a view to minimizing repetitive DNA sequences that could lead to deletion or recombination by the host. Five oligodeoxyribonucleotides are combined into two decapeptides.
0 repeats are arbitrarily linked together to create a sequence that points to the code.

An automatic DNA synthesizer is used to synthesize 10 single-stranded oligodeoxyribonucleotides having the sequence described above. We also synthesize two single-stranded oligodeoxyribonucleotides that can anneal to form a linker fragment with matching ends as described below for the 5' end of the dsDNA insert.

Ncol 5' CTA GAG GGA TCC AT[;G
AT CTC CCT AGG TAC CGC TT
T'k5'Finally, synthesize two single-stranded oligodeoxyribonucleotides that can anneal to form a linker fragment with the following ends for the 3' end of the dsDNA insert: 5'6 GCG AAA TGA ATT CACT
T^^ G5' The 5' end of the single-stranded oligodeoxyribonucleotide marked with an asterisk is phosphorylated by treatment with adenosine triphosphate in the presence of polynucleotide kinase.

10 oligodeoxyribonucleotides representing the decapeptide (1.6 μg each) and 4 linker fragments, oligodeoxyribonucleotides (1.4 μg each)
) and ligated in the presence of T4 DNA ligase. By a binding reaction, the 5′
and 3' linker fragments, each of which has an average of about 20 repeats of the decapeptide-indicating fragment, leading to and following the dsDNA strands of varying lengths are produced. Synthetic dsDN thus produced
A is Leu-Glu-Gly- directed at the 5' end
The 5er-Met sequence directs the code to a series of repeating decapeptides directly preceded by the dipeptide ^1a-lys directed by the GCGAA^ sequence preceded by the stop codon (TGA) of the 3' linker. The synthetic dsDNA obtained by the binding reaction was prepared using the method of Manietis et al.
a+1sLry.

↓4: 3787-3794 (+975)) with 6% polyacrylamide gel. A heald corresponding to the 20 DEG peptide instruction sequence in size is cut from the gel and dsDNA is electroextracted from the gel.

If it is desired to produce a protein with fewer or more than 20 decapeptide repeats, the proportions of oligodeoxyribonucleotide fragments representing the decapeptide and linker fragments in the conjugation mixture may be adjusted to achieve the desired size. Remove the dsDNA fragment from the gel.

The synthetic dsDNA sequence was then added to the plasmid l'pGX221.
3 into the single-Hpa1 site. Regarding FIG. 1, this plasmid 1 is -! trivial hybrino jtr, p/
1 cup -) Under the control of the promoter, l · Rip 1 fan's,! Contains rpB and trP-A %fJ regions. This one rasmite was transferred to -piece, row 9-j host (strain GX166
8) and deposited with the American Standard Culture Collection, Rockville, Maryland, under grant number AT CC39388. Plasmid (1 μg) was added to Ja+ (1 μg).
unit) and divide it. Splitting occurs within the tr-PB region, with trpB bound to the tac promoter.
1122 base pairs remain at the 5' end of. The ends of a linear plasmid are aligned. decapeptide indicator sequence (0,2
, cog) was ligated to linear pcx2213 using T4 DNA ligase to align the ends.

The retransmitted plasmid was used as E. coli strain JM10.
9 is used for transformation. This host strain is, for example, P −+-hiochemicals (P-L Bi
chemicals, Inc.), Bethesda Research Laboratories
companies, Inc.) and New Eng-1 and Bi
oLabs, Inc.). It contains the IacIQ gene, which overproduces a repressor protein that regulates expression from the tac promoter. The host is also rec A-, which reduces the possibility of recombination of the repetitive decapeptide instruction sequences in the dsDNA insert. Plate on agar plates and culture for 24 hours. Plasmid DNA prepared from the resulting colonies is examined by restriction analysis, and colonies containing the Ql-ds DNA insert in the appropriate orientation are isolated. Isolation. The colony that did
Synthetic dsDNA insert (1,eu-Glu-Gly-5
The first three of the trp B gene fused to five amino acids directed by a linker at the 5' end of the er-het
74 amino acids, followed by 20 repeats of the decapeptide sequence of the insert, and a linker moiety pointing to Ala-I,y at the 3' end of the synthetic insert preceding the stop codon.
It contains a fusion gene that specifies the code for proteins ending in s. The coding region includes the untransformed region following the TGA stop codon -(,!(-) under the control of the promoter.

Transformants containing single-dsDNA inserts in the appropriate orientation were plated into 2-liter culture flasks containing Luria liquid medium and ampicillin at mid-logarithmic phase (OD,).

. Culture until 0.5). I to induce expression
Add PTG (0,25n+M, final concentration). 8~
After 16 hours, the fusion protein is highly expressed within the host cells. Cells are harvested by centrifugation, lysed by sonication, and the fusion protein is recovered using conventional methods of protein recovery. This fusion protein is treated with dicyanogen bromide, which cleaves the protein on the carboxyl side of the methionine residue just before the first decapeptide sequence, thus linking the N-terminal fragment of the rPLB gene product with the linker. - Separating the bioadhesive precursor protein from the peptide fragments of M1. The bioadhesive precursor protein is isolated using conventional methods.

Example 2 NO3-(Ala-Ly
s- Pro-3er-Tyr-Pro-Pro-Th
r-Tyr-Lys) 2O-COOII production automatic 1
) Using an NA synthesizer, synthesize 10 similar oligodeoxyribonucleotides representing the decapeptide prepared in Example 1, and treat the 5' end of oligodeoxyribonucleotide 1 with adenosine triphosphate in the presence of the polynucleotide. and phosphorylation.

Synthesize the following single-stranded oligodeoxyribonucleotides that can be annealed to provide a linker for the end of the dsDN eight insert rod insert.

5'^GCTTTATGATG AATACTACCGCTTT65' The oligodeoxyribonucleotides described below are synthesized 11 and annealed to provide a linker for the 3' end of the dsDNA insert.

5'6 GCGAAATGAT^^GGATCCAACT
ATTCCTAGGTTCGA 5' The 5' end of the asterisked linker fragment is phosphorylated by treatment with adenosine triphosphate in the presence of polynucleotide kinase.

10 oligodeoxyribonucleotides (1.6 μg each) representing the decapeptide and 4 linker fragment oligodeoxyribonucleotides (0.4 μg each)
μg) and ligated in the presence of T4 DNA ligase. The ligation reaction results in a family of dsDNAs of varying lengths with an average of about 20 repeats of the decapeptide-indicating fragments ligated in any order and preceded and followed by 5' and 3' linker fragments, respectively.

The synthetic dsDNA thus produced has a 5' linker.
Directly precedes the sequence Ser-Phe-Met-Met, which indicates the code, and is then preceded by two stop codons (TGA, TAA) at the 3' linker. It is followed by a dipeptide Ala-Lys- in which the GCGAAA sequence directs the code (instructing a series of repeating decapeptides). The synthetic dsDNA obtained in the ligation reaction was processed on a 6% polyacrylamide gel according to the method of Manietis et al. The band corresponding to the decapeptide indicator sequence of size 20 is excised from the gel and the dsDNA is electroextracted.

The synthetic dsDNA sequence was then added to the plasmid l'pGX25.
Insert into the single-H1ndI11 site of 09. Regarding Figure 2, this plasmid]' is -dust, a! ! Iy
It has the regulatory region and structural gene for α-amylase derived from the 19i-j engineering plant. Once containing the plasmid (GX7027)-,s! btijis
The strain was deposited with the American Baseball Culture Collection, Rockville, Maryland, under accession number ATCC39854. This plasmid (1 μg) was
Treat with rHd-Tll to split. ”↓−Aki d m
- The digested plasmid is approximately 50.17 g/m7! Total D
Combine with dsDNA at NA 771 degrees.

The binding mixture was prepared by the method of S. Chap and S. N. Cohen (M-o-1ee, G, e-G, g-B,
168:III-115 (1979)).
River, Σujti! from the Bacillus Genetic Strain Center, 210 MB, Ohio! used to transform is strain 1553. Transformants are examined for failure to produce α-amylase and the presence of a -Tel insert of the desired size.
determined by digestion and measurement of the size of small fragments by gel electrophoresis. For a 600 base pair fragment directed to a 20-repeat decapeptide, ζ, if the fragment is inserted in the appropriate orientation, a small a
The mHI fragment will be approximately 1500 bases, or approximately 900 base pairs if the fragment is inserted in its opposite orientation.

Transformants containing a single insert directing a 20-repeat decapeptide in the appropriate orientation were incubated in the presence of kanamycin (1
0 μg/m#), following culture liquid culture Nitribut 7 (
33g/n+4ri, yeast extract (20g#), Na
C71 (7.4 g/l), 3 M NaOH (12 t
al/1), NazllPOn(8g#), KHt
PO4 (4 g/l), casamino acids (20 g/l, guar1/:]-su (10 g/l') and MnClt (0,
06mM>. The production and secretion of the 20-repeat decapeptide fusion protein will be investigated immunologically. The fusion protein is recovered using conventional protein recovery methods and treated with amylbromide to cleave the bioadhesive precursor protein and linker-derived peptide from the α-amylase fragment. The bioadhesive precursor protein is then isolated using conventional methods.

Example ■ -B, 5ubj, 1l-is NHz-(^Ia-1
．． ys-Pro-3er-Tyr-Pro-Pro-T
hr-Tyr-Lys-) Production of zo-COOII A plasmid containing the 20-decapeptide coding sequence prepared according to the method of Example H was digested with 1.%-1, and a portion was digested with 1β]! Digest it at first sight. Xba containing dsDNA insert
P-L Biochemicals Dip, Pharmacia (P-L Biochemica)
1SDIv, PharmaAal Inc.) into phage Hector M13mp18. Schiller and Smith's method for oligonucleotide l'-governed in vivo mutagenesis (Nucle4c - Induction 4
Scale-B stain S,, -1 leaf: 64B7~6500 (1
9B2)) to remove the entire NA sequence between the end of the α-amylase signal sequence and the beginning of the decapeptide indicator sequence. The exact oligodeoxyribonucleotides used in this method depend on which of the five double-stranded oligodeoxyribonucleotides occurs first in the sequence of the dsDNA insert. The oligodeoxyribonucleotides described below can be used if the first decapeptide-indicating oligodeoxyribonucleotide occurs first.

3' GTTTTTTTGTAGTCG GCGCTT
TGGTTCAAT2〇-repeat decapeptide sequence is α-
After isolating the deletion mutant directly fused to the amylase signal sequence, REI DNA is isolated as described by Shira and Smith, supra. RvuTI-Ba! !
HI fragment 1 is ligated to pGX2509 digested with PvuII and BamHI to produce a shipping plasmid that codes for a 20-repeat decapeptide fused directly to the α-amylase signal sequence. This plasmid has the following S, Chap and S, N.

B. 5ubtilis strain 15 by Niehen's method
53 is used for transformation. If this transformant secretes the directed polypeptide l' into the lpi substrate, with concomitant cleavage of the signal peptide, the desired bioadhesive precursor protein is transferred from the N-terminus to the bacterial protein sequence. Chemical compounds can be recovered from the culture medium without the need for enzymatic resolution to remove them.

Example ■ S, NI+2-(^
Ia-1. ys-Pro-3er-Tyr-r'ro-
Pro-Thr-Tyr-Lys) production of go-COOH Σ, dsl') NA encoding the double-stranded oligodeoxyribonucleotide sequence described below into the bioadhesive precursor protein for expression in C. ceae
Used for adjusting the insert.

GCTAAGCCATCTTTACCCACCAACCT
AC^8GGGTAGAATGGGTGGTTGGAT
Synthesize the oligodeoxyribonucleotides listed below using an ATTC automatic DNA synthesizer to GTTCC.

G A 5'GCT AAG CCA TCT TACC
CA CCA ACCTACAAGB 5'CTT
AGCCTT GTA GGT TGG TGG GT
A AGA TGGC5' GAA TTCGTCGA
CATGD 5'C1'T AGCCAT
GTCGACGAA TTCE 5' GC
T AAG TAA GCT TGG ATCCF
5' GGA TCCAAG CTT A oligodeoxyribonucleotides, A, B, D and E, are vosborylated at the 5' end by treatment with adenosine triphosphate in the presence of polynucleotide kinase. This oligodeoxyribonucleotide was 7-nealed and in the presence of T4 DNA ligase, 4A: 4B: IC: iD: IE
: 5' linkers (C and D) linked in the proportion of IF
, 3′ linkers (E and F), and Σ, cere
dsDNA consisting of repeated decapeptide coding sequences (A and B) containing suitable codons for expression in vilAe
Manufacture. The 5' linker has an EcoRI and 5ail split site. The 3' linker has a split site for Hindll and Ban+Hl. The conjugated products are run on a 6% polyacrylamide gel according to the method of Manietis et al., supra. A band corresponding to dsDNA having approximately 20 repeats of the decapeptide coding sequence is excised from the gel and the dsDNA is electroextracted from the gel.

The isolated dsDNA fragment is digested with -3-a-i1 and 'I-↓se1' to shift the ends. The dsDNA fragments produced in this way were ypcx shown in Table 3.
Insert into l. YpGX] has novel restriction sites Σall and ipdll in the tetracycline resistance gene. This plasmid (2 μg) was
and -H-1nd m, and the resulting linear plasmid is ligated with the dsDNA insert in the presence of T4 DNA ligase. E using the redirected plasmid,
E. coli strain JM]09 was transformed and the transformants were cultured separately on L H-agar plates containing ampicillin and then transferred to LB' ampicillin and LB'' tetracycline plates. Ap''Tc' colonies. The plasmids from the human body are analyzed by restriction endonuclease digestion and the appropriate stereotaxic dsDNA inserts are immobilized in human bodies.

Σ. The E. cerevisiae phosphoryglycerate kinase (PGK) promoter and partial structural gene fragment are monolayered from the plasmid YpGX60 shown in FIG. YpGX60; digested with 1cSall and PG
A ~2000-base pair solugment corresponding to the K promoter and the first 229 codons of the structural gene is isolated by gel electrophoresis. Plasmid YpGX1, which has inserted a synthetic dsDNA solug that codes for the decapeptide of the 2° repeats, is digested with 51 ml. Plasmid YpGx
The PGK fragment isolated from 60 was converted into T4 DNA.
In the presence of ligase, the 20 DEG peptide is coupled to the linear YpGX1 containing the peptide decoding insert. The obtained plasmid was used to transform Σ and YGXCl 8. The transformants are plated on YNBD+) liptophan plates and immunologically tested to identify colonies that produce the PGK-adhesive fusion protein. The isolated transformant was planted in a 2-Linol flask containing YNBn+1-rib i-fan and incubated at 30°C.
Feed in the evening. Harvest cells by centrifugation and dissolve in a French press. The fusion protein is recovered by conventional protein recovery methods and treated with dicyanbromide, which is used to remove the initial decapeptid 1 sequence.
The protein is cleaved on the carboxyl side of the methionine residue of nj) to separate the bioadhesive precursor protein from the N-terminal fragment of PGK and the linno,-derived peptide. The bioadhesive 0;1 precursor protein is then 11 bound by conventional methods.

[Brief explanation of drawings]

Figure 1 is a sequence diagram of the trp r (and trp, -A region-containing shellfish plasmid I'p GX22) of I. liptophan oberon. Figure 2 shows the α-amylase gene r- Including !3゜;t
4bjijjs plasmid t"l) G X 2509
FIG. Figure 3 shows 3. Cerevisiae plasmid I'
It is a sequence diagram of Y p G Xl. FIG. 4 is a sequence diagram of the plasmid YpGXl, which contains a portion of the phosphoglycerate kinase gene.

Claims (1)

[Scope of Claims] (1) About 20% to about 40% proline residues and about 10% to about 40% proline residues
about 100 to about 1500 amino acid residues consisting of about 40% lysine residues, about 10% to about 40% tyrosine residues, and 0% to about 40% amino acid residues other than proline, lysine, and tyrosine
A protein that can be converted into a bioadhesive consisting of an amino acid sequence of (2) The protein according to claim 1, wherein the protein has 600 to 900 amino acid residues. (3) A protein according to claim 1 or 2 consisting of repeating decapeptide units each having an amino acid composition as described in claim 1. (4) The protein according to claim 1 or 2, which consists of repeating decapeptide units represented by the following formula. -Ala-Lys-Pro-Ser-Tyr-Pro-
Pro-Thr-Tyr-Lys-(5) about 20% to about 40% proline residues, about 10% to about 40% lysine residues, about 10% to about 40% tyrosine residues, and 0% to about 40%
A double-stranded DNA sequence that codes for a protein consisting of about 100 to about 1500 amino acid sequences consisting of amino acid residues other than proline, lysine, and tyrosine. (6) The double-stranded DNA sequence according to claim 5, wherein the coded protein has 600 to 900 amino acid residues. (7) A double-stranded DNA sequence according to claim 5 or 6 which gives a code to repeating decapeptide units each having an amino acid composition as described in claim 1. (8) The two strands according to claim 5 or 6, wherein the deciphering strand of the double-stranded DNA consists of repeating units each independently selected from units having the following formula: Chain D
NA sequence. GCN AAR CCN (AGY or TCN)TA
Y CCN CCN ACN TAY During the AAR ceremony, G
, A, T and C are the bases guanine, adenine,
It represents a deoxyribonucleotide containing thymine and cytosine, Y represents a deoxyribonucleotide containing cytosine or thymine, and N represents G, A, T or C. (9) A fusion protein consisting of the N-terminal portion of a microbial protein fused to the protein of claim 1. (10) The microbial protein is E. coli (Escherichia coli)
The fusion protein according to claim 9, which is a protein. (11) The microbial protein is E. 11. The fusion protein of claim 10, which is E. coli tryptophan synthetase. (12) The fusion protein according to claim 9, wherein the microbial protein is a bacillus protein. (13) The microbial protein is ¥B¥. ￥amylol
13. The fusion protein according to claim 12, which is C. iquefaciens\α-amylase. (14) The microbial protein is ¥S¥. ￥cerevi
The fusion protein according to claim 9, which is a siae\ protein. (15) The microbial protein is ¥S¥. ￥cerevi
15. The fusion protein according to claim 14, which is siae\phosphoglycerate kinase. (16) The fusion protein according to claim 9, wherein the microbial protein contains a signal peptide capable of secreting the fusion protein through the cell membrane of the bacillus host. (17) A patent for fusing a microbial protein fragment to the protein of claim 1 through an enzymatically or chemically cleavable linker sequence of an amino acid that does not occur within the amino acid sequence of the protein of claim 1. The fusion protein according to claim 9. (18) The fusion protein according to claim 17, wherein the cleavable chain sequence is a methionine residue. (19) Transcription promoter, ribosome attachment point, and about 20% to about 40% proline residues, about 10% to about 40% lysine residues, about 10% to about 40% tyrosine residues, and 0 % to about 40% of amino acid residues other than proline, lysine and tyrosine, and a translation initiation signal attached to a double-stranded DNA sequence that codes for the bioadhesive precursor protein, which consists of a sequence of about 100 to 1500 amino acids consisting of amino acid residues other than proline, lysine and tyrosine. A replicable expression vector consisting of a plasmid containing (20) Furthermore, it consists of a double-stranded DNA sequence located less than 5' of the sequence that provides the code for the bioadhesive precursor protein, and that the double-stranded DNA sequence provides the code for the N-terminal portion of the microbial protein. A replicable expression vector according to claim 19. (21) A sequence in which the sequence encoding the N-terminal portion of the microbial protein encodes the bioadhesive precursor protein through a double-stranded DNA sequence encoding a linker sequence that can be enzymatically or chemically cleaved of amino acids. 21. A replicable expression vector according to claim 20. (22) The sequence that gives the code to the splittable linker is AT
22. The replicable expression vector of claim 21, which is G. (23) The coded bioadhesive precursor protein is 6
23. A replicable expression vector according to claim 19, 20, 21, or 22 containing amino acid residues from 00 to 900. (24) Claim 19, wherein the double-stranded DNA sequence giving the code to the bioadhesive precursor protein consists of repeating decapeptide units, each having an amino acid composition as set forth in Claim 1. 23. A replicable expression vector according to paragraphs 20, 21 or 22. (25) Claims 19, 20, and 21 in which the double-stranded DNA sequence that provides the code to the bioadhesive precursor protein consists of repeating units each having a separate decoding strand of the following formula: or the replicable expression vector described in Section 22: [There is a gene sequence] where G, A, T, and C are each the base guanine;
represents a deoxyribonucleotide containing adenine, thymine and cytosine, Y represents a deoxyribonucleotide containing cytosine or thymine, N is G,
Represents A, T, or C. (26) (a) About 20% to about 40% proline residues, about 10% to about 40% lysine residues, about 10% to about 40% tyrosine residues, and 0% to about 40% proline Approximately 100 to 1 amino acid residues other than lysine, lysine, and tyrosine
(b) chemically synthesizing a double-stranded DNA segment that codes for a 500 amino acid residue bioadhesive precursor protein; (c) inserting the chemically synthesized double-stranded DNA insert into a replicable expression vector that operatively binds to ribosome attachment points and translation initiation signals; A method for producing a bioadhesive comprising: (d) expressing a bioadhesive precursor protein in a transformed microorganism. (27) The method according to claim 26, wherein the protein encoded by the chemically synthesized double-stranded DNA contains 600 to 900 amino acid residues. (28) A chemically synthesized double-stranded DNA segment
5′ of the sequence that codes for the bioadhesive precursor protein.
27. The method of claim 26, further comprising a double-stranded DNA sequence attached to the terminus, said double-stranded DNA sequence encoding the N-terminal portion of the microbial protein. (29) The sequence encoding the N-terminal portion of the microbial protein encodes the bioadhesive precursor protein through a double-stranded DNA sequence encoding a linker sequence that can be enzymatically or chemically cleaved of amino acids. 29. The method of claim 28, wherein the method binds to an array. (30) The sequence that gives the code to the splittable linker is AT
30. The method according to claim 29, wherein G. (31) The double-stranded DNA that provides a code for the N-terminal portion of the microbial protein includes a sequence that provides a code for a signal peptide capable of secreting the expressed protein through the cell membrane of the bacillus host. Method described. (32) The host microorganism is ¥E¥. ¥coli¥ (Escherichia coli), ¥B¥. ￥ subtilis￥ (Bacillus subtilis) and ￥
S￥. 27. The method of claim 26, wherein the method is selected from \cerevisiae\. (33) The double-stranded DNA segment codes for a bioadhesive precursor protein consisting of repeating decapeptides, each having an amino acid composition as set forth in claim 1. The method according to scope item 26. (34) The method according to claim 26, wherein the double-stranded DNA segment that provides the code for the bioadhesive precursor protein comprises repeating units each having a separate decoding strand of the following formula: [gene There is a sequence] In the formula, G, A, T, and C are the bases adenine,
represents a deoxyribonucleotide containing thymine and cytosine, Y represents a deoxyribonucleotide containing cytosine or thymine, and N represents G, A, T,
Or represents C.